 |
INTRODUCTION |
Integrins are heterodimeric transmembrane receptors composed of
one 
and one 
subunit. The extracellular domains of integrins dictate the specificity toward extracellular ligands (1), whereas their
highly diverse cytoplasmic domains have specific functions in cell
signaling and in mediating interactions with the cytoskeleton (2).
Integrin subunit cytoplasmic domains are short, comprised of only
tens of amino acids, and they are devoid of enzymatic activities. Despite their small size, these domains are important for
integrin function. Studies with chimeric integrin constructs suggested
that the conserved, membrane-proximal part of both the and subunit cytoplasmic tail is necessary to maintain integrins in a low
activation state (3). Although many of the known interactions of
integrins with cytoplasmic proteins are mediated by subunits (4),
integrin subunits play important roles in regulating integrin
function (5, 6).
The diversity of integrin cytoplasmic domains derives from the
large number of subunit gene products, as well as alternative mRNA splicing of these genes (7). Comparative studies of specific cytoplasmic domain splice variants, as well as studies with chimeric integrin constructs have linked individual -subunit sequences to
specific cellular responses (8-13). The mechanisms by which cytoplasmic domain sequences dictate function, however, are largely unknown. Surprisingly, few direct interactions between integrin subunit tails and intracellular proteins have been described so far
(see recent review in Ref. 4). Paxillin binds to a conserved motif in
the 4 cytoplasmic tail (14), suggesting that
4 is exceptional among -subunits in interacting with
a focal adhesion protein directly. Also, the focal adhesion protein
talin has been reported to bind to the IIb integrin subunit (15).
Nischarin, a recently characterized cytoplasmic protein, binds to the
5 integrin cytoplasmic tail but not to several other subunits (16). Nischarin has little homology to proteins with well
characterized function, but initial studies suggested that nischarin
inhibits cell motility on fibronectin and seems to modulate small G
protein function.
PDZ domains are found in
numerous cytoplasmic proteins, and they interact specifically with
either C termini of other proteins or short recognition sequences in a
-hairpin structure somewhere else in the protein (17). Crystal
structures of PDZ domains have explained the need for the C-terminal or
-hairpin location for the recognition sequence. A hydrophobic
GLGF-motif acts as a steric block that efficiently prevents longer
peptide sequences from interacting with the PDZ domain (18). This motif
also provides the critical amino acids for coordinating the terminal
COOH-group in PDZ interaction with C-terminal sequences (19). The
recognition sequence is only a few amino acids in length, and the
preferred recognition sequences of several different PDZ proteins have
been analyzed by the peptide library approach. These studies divided PDZ recognition sequences into two major groups. In class I
interactions, the -2 position in the recognition sequence is occupied
by a hydroxyl group-containing amino acid (Ser, Thr, or Tyr),
whereas in class II interactions, there is a hydrophobic residue in the
-2 position. The C-terminal residue (position 0) is hydrophobic
(20).
The peptide library studies make it possible to predict potential PDZ
binding sites in the C termini of different proteins. In the current
literature, there is no analysis of possible PDZ binding sites in
integrin subunits, and no PDZ interactions have been described between
integrin cytoplasmic domains and cytoplasmic proteins. For this reason,
we analyzed the amino acid sequences of different integrin subunits
and identified two subunits, 6A and 5,
with a potential PDZ recognition motif. We used this information for a
yeast two-hybrid screen to identify PDZ proteins that interact with the
6A integrin subunit. Surprisingly, our results
demonstrate the presence of PDZ interaction site in both splice
variants of 6 integrin. The PDZ binding site present in 6B splice variant was not predicted by any previously
published models of PDZ interactions, and it defines a new type of PDZ
recognition sequence that may be present in many other proteins, too.
| |
EXPERIMENTAL PROCEDURES |
Plasmid Constructs--
The pRC/CMV expression vectors
containing the 6A and 6B cDNAs have
been described previously (21). A new 6A construct lacking the last three amino acids was created by site directed mutagenesis (QuikChange, Stratagene, La Jolla, CA). The three nucleotides that encode the serine in the -2 position in the C terminus were changed to a stop codon. cDNAs coding for integrin cytoplasmic domains were designed using a common strategy. These constructs started with the first residue of the conserved,
membrane-proximal domain of all integrin subunits. The primers used
were as follows: 6A-sense,
AAGAATTCAAGTGTGGTTTCTTCAAGA; 6A-antisense,
TTGTCGACTTGCATGGTATCGGGGAACAC, 6B-sense,
TTGAATTCAAGTGTGGATTCTTTAAACG;
6B-antisense,
TTGTCGACCTATGAGTAGCTTTCATTTCTG; V-sense,
TTGAATTCAGGATGGGCTTTTTTAAACG; V-antisense,
TTGTCGACCAGTTAAGTTTCTGAGTTTCC; 2-sense,
TAGAATTCAAGCTCGGCTTCTTCAAAAG; 2-antisense,
TTGTCGACCCACAATTTCTTCATTC; 3A-sense,
TTGAATTCAAGTGCGGCTTCTTCAAG; 3B-sense,
TTGAATTCAAGTGTGACTTCTTTAAGC; 3A/B-antisense,
TTGTCGACCCTGTGGACTGTCAGAG; 5-sense,
TTGAATTCAAGCTTGGATTCTTCAAACG; and
5-antisense, TTGTCGACGACTCAGGCATCAGAGGTG. An
alternative construct lacking the last three amino acids was created
for subunits with a PDZ binding domain (5,
6A, and 6B). In these constructs the PDZ
binding domain was deleted by replacing the serine residue in position
-2 by a stop codon. These constructs were named 
pdz.
6Apdz was created by using the regular
6A-sense/-antisense primers and the
6APDZ full-length cDNA as a template. The other pdz constructs were made by using modified antisense primers: 5pdz, TTGTCGACGACTCAGGCATCTCAGGTG;
6Bpdz, TTGTCGACCTATGAGTATCATTCATTTCTG. In
addition, constructs coding for only the last seven amino acids of
6A and 6B were designed separately.
Primers for these constructs were as follows:
6A-7aa-sense, TTGAATTCGAGAGGCTTACTTCTGATGC; 6A-7aa-antisense, TTGTCGACTTTTGAGTAGCTTTCATTTCTGTTC;
6B-7aa-sense, TTGAATTCAACAGAAATGAAAGCTACTC and
6B-7aa-antisense, TTGTCGACACATGATGTAAGTCAG. Additional
mutations to the 6A and 6B C termini were
created by using the same sense primer as for other constructs and a
mutating the antisense primer as follows (where the asterisk (*)
indicates the stop codon): 5/TADA*,
TTGTCGACGACTCAGGCATCAGCGGTGGC; 6A/TADA*, TTGTCGACCTATGCATCAGCAGTAAGCCTCTCTTTATC;
6A/ASDA*,
TTGTCGACCTATGCATCAGAAGCAAGCCTCTCTTTATC; 6A/ESDA*,
TTGTCGACCTATGCATCAGACTCAAGCCTCTCTTTATC;
6A/TSAA*, TTGTCGACCTATGCAGCAGAAGTAAGCCTCTCTTTATC;
6B/EAYS*,
TTGTCGACCTATGAGTAGGCTTCATTTCTGTTCCAC; 6B/ASYS*,
TTGTCGACCTATGAGTAGCTTGCATTTCTGTTCCAC;
6B/TSYS*,
TTGTCGACCTATGAGTAGCTTGTATTTCTGTTCCAC; 6B/ESYA*,
TTGTCGACCTATGCGTAGCTTTCATTTCTGTTCCAC;
6B/ESFS*,
TTGTCGACCTATGAAAAGCTTTCATTTCTGTTCCAC. The 6A
and 6B constructs were created by standard PCR (Expand High Fidelity, Roche Molecular Biochemicals) using the
full-length cDNA as a template, whereas all other sequences were
cloned by RT-PCR (Titan, Roche Molecular Biochemicals) using MDA-MB-435 (2 integrin), clone A (3A,
3B), or Jar (V, 5) total RNA as a
template. Total RNA from these cells was prepared using Tri reagent
method (Sigma), and treated with RQ1 DNase (Promega, Madison, WI). The
cDNAs were cloned in the EcoRI/SalI site of
either pAS2-1 bait vector (CLONTECH, Palo Alto,
CA) or pGEX-4T1 GST1 fusion
vector (Amersham Pharmacia Biotech). The entire coding sequence of
TIP-2/GIPC was amplified by RT-PCR using total RNA from MDA-MB-231
cells, and cloned in frame in the XhoI/EcoRI site of pBAD-A bacterial expression vector (Invitrogen, Carlsbad, CA). The
desired cDNA was amplified in two parts, using the following primers: GIPC5'-sense, TTCTCGAGATGCCGCTGGGACTGGG;
GIPC5'-antisense, AATGGCCTTCTCTTCAAAGG; GIPC3'-sense,
ACATGATCGAGGCCATTAAC; and GIPC3'-antisense,
TTGAATTCACGTCAGTGTCCCTGCTG. The final construct was made by
fusing the overlapping sequences at the unique SmlI site.
One of the TIP-2/GIPC clones retrieved by yeast two-hybrid screen was
used for site directed mutagenesis (QuikChange,
Stratagene). The GLGF-loop of TIP-2/GIPC was mutated as previously
described (22), using the following oligonucleotides: sense,
CAAGTCGGAGGATGCAGCCGAGCTCACCATCACGGAC; antisense,
GTCCGTGATGGTGAGCTCGGCTGCATCCTCCGACTTG. Three prey vector (pACT2)
constructs containing various parts of TIP-2/GIPC sequence were created
by standard PCR using the clones retrieved from the two-hybrid screen
as a template. The antisense primers were designed to introduce a stop
codon immediately after the last included residue of TIP-2/GIPC. The
primers were as follows: TIP-2/GIPC (115) sense,
AAAGAATTCAGGGCCAAATCGGGCTGGAG; antisense,
AACTCGAGCTAGGCCTTGCGAGGCTCCGT; TIP-2/GIPC (123) sense,
AAAGAATTCTCATCTTCGCCCACGTGAAGG; antisense, AACTCGAGCTAGGCCTTGCGAGGCTCCGT; TIP-2/GIPC (218) sense,
AAAGAATTCCCTTCGACATGATCAGCCAG; antisense,
AAACTCGAGTCATCATCG- CAGGGTCCG.
Yeast Two-hybrid System--
Components of the Matchmaker II
two-hybrid system were purchased from CLONTECH
(Palo Alto, CA). The cDNA coding for the entire 6A
cytoplasmic domain in PAS2-1 vector was used for screening of human
mammary gland library (CLONTECH HL4036AH) in yeast
strain Y190 according to the manufacturer's instructions. Rapidly
growing, brownish colonies were picked up between days 6 and 14 of the screen, restreaked, and subjected to the -galactosidase test. The
-galactosidase reaction was described as being very strong (+++) if
apparent in less than 1 h, strong (++) if apparent in 2 h,
weak (+) if apparent in 2-6 h, and negative if no color change was
detected within 6 h. Prey vector was separated from positive clones by electroporation in HB101 Escherichia coli strain
and selection on M9 plates according to the manufacturer's protocol. Inserts were recognized by running a single sequencing reaction using a
universal primer binding to the prey vector upstream of the multiple
cloning site. A selected insert was recloned in Bluescript KS vector
and prepared for further sequencing by nested deletions (ExoIII/mung
bean deletion kit, Stratagene). Library colonies tested positive in
initial screening were further characterized by two-hybrid tests using
several different baits cloned in the EcoRI/SalI
site of the pAS2-1 vector.
Northern Hybridization--
Total cellular RNA was isolated by
Tri reagent (Sigma) method. 20 µg of total cellular RNA was run in a
reducing paraformaldehyde gel and transferred on Hybond-N nylon
membrane (Amersham Pharmacia Biotech) by capillary transfer using
standard protocols. ApaI fragment of TIP-2/GIPC was used as
the template for the probe. Labeling was done by Rediprime II random
prime labeling kit (Amersham Pharmacia Biotech) using 50 µCi of
[-32P]dCTP (PerkinElmer Life Sciences).
Hybridization was done at 68 °C in QuikHyb hybridization solution
(Stratagene), and washes were done up to the stringency of
68 °C/0.1× SSC.
Recombinant Proteins--
The TIP-2/GIPC recombinant protein was
produced in E. coli, using the pBAD construct described
above and TOP10 E. coli strain (Invitrogen). Cultures in
late logarithmic phase were induced with 0.2% L-arabinose
(Sigma) for 3.5 h at 37 °C, and the recombinant protein was
isolated from the bacterial pellets with Ni-NTA agarose (Qiagen). The
protein was eluted from column by 250 mM imidazole and
dialyzed against 100 mM KCl/20 mM Tris, pH 7.2. GST fusion proteins of integrin cytoplasmic tails were produced using
pGEX-4T1 derived plasmids described above and BL21 bacterial strain
(Stratagene). Cultures in late logarithmic growth phase were induced
with 1 mM isopropyl--D-thiogalactopyranoside
at 30 °C for 3 h. Bacterial pellets were frozen on dry ice,
thawed once, and then resuspended in PBS containing 1% Triton X-100,
10 mM dithiothreitol, 10 mM EDTA and a protease
inhibitor mixture (Sigma). Bacterial preps were then sonicated, and
recombinant proteins were captured from cleared lysates by
glutathione-Sepharose beads (Amersham Pharmacia Biotech), followed by
washes and elution by 5 mM glutathione in 100 mM KCl/50 mM Tris, pH 8.0. All recombinant
proteins were stored as glycerol stocks at 
80 °C.
In Vitro Binding Assays--
500 pmol of GST fusion constructs
and 20 pmol of recombinant His6/GIPC protein were used for
each in vitro pull-down assay. Recombinant proteins were
diluted in 500 µl of buffer and stirred with glutathione-Sepharose
beads at 4 °C for 2 h. Beads were blocked with 5% milk before
use. RIPA binding buffer contained 50 mM Tris, pH 7.2, 100 mM KCl, 10 mM MgCl2, 10% glycerol,
0.1% BSA, 1% Triton-X, 1% sodium deoxycholate and 0.1% sodium
dodecyl sulfate. Binding buffer "1%NP" contained 50 mM
Tris, pH 7.2, 100 mM KCl, 10 mM MgCl2, 10% glycerol, 0.1% BSA, and 1% Nonidet P-40
(Roche Molecular Biochemicals). After the binding, beads were washed
three times with a buffer identical to the binding buffer but lacking
BSA. Samples were analyzed by standard Western blotting using INDIA His-Probe (Pierce). Signal was detected by West Pico chemiluminescence system (Pierce). The experiments were performed in quadruple, and the
results were quantified from the film by image analyzing techniques.
Binding to GST was used as the measure of background binding, and this
was subtracted from the experimental data before analysis. Mutant
constructs were compared with the wild type integrin construct, and the
results were expressed as a percentage ± S.D.
Cell Culture--
MDA-MB-435 and MDA-MB-231 breast carcinoma
cell lines were obtained from Lombardi Breast Cancer Depository
at Georgetown University. They were grown in low glucose
Dulbecco's modified Eagle's medium supplemented with 10% fetal calf
serum and antibiotics. Clone A colon carcinoma cells were grown in
RPMI-1680 medium supplemented with 10% fetal calf serum and antibiotics.
Cell Adhesion Experiments and Confocal
Microscopy--
Coverslips were coated with 50 µg/ml of type I
collagen (Vitrogen, Cohesion Technologies, Palo Alto, CA) or 20 µg/ml
of EHS-laminin (Roche Molecular Biochemicals) in PBS overnight and
subsequently blocked with 1% BSA. Cells were harvested with
trypsin-EDTA and washed three times with RPMI 1680 medium containing
0.2% BSA. Cells were plated on coverslips and incubated at 37 °C in
the presence of 5% CO2 for the time periods described. In
some experiments, the cells were plated on collagen for 50 min and then
treated with 100 nM phorbol 12-myristate 13-acetate (Sigma)
for 10 min. In another set of experiments, the cells were plated on
laminin for 30 min and then treated with 100 nM
staurosporine (Calbiochem, San Diego, CA) for 15 min. After the
experiment the cells were washed once with PBS and fixed with
paraformaldehyde for 5 min as previously described (23). After
fixation, the cells were permeabilized with 0.05% Triton X-100 in PBS
for 5 min and then washed several times with PBS. Immunohistochemical
stainings with anti-GIPC antiserum (kind gift of Dr. Marilyn Gist
Farquhar) and anti-6 integrin antibody (GoH3;
Immunotech, Marseilles, France) were followed by secondary fluorescein
isothiocyanate- or Cy3-coupled antibodies (Jackson ImmunoResearch, West
Grove, PA). After the staining and washes, the samples were treated
with 1% paraformaldehyde for 3 min and then washed and embedded in
medium containing 50 mM Tris, pH 8.5, 150 mM
NaCl, 90% glycerol, and 1% n-propyl gallate. The samples
were analyzed by confocal microscopy.
Analysis of Expression of 6 Integrin Splice
Variants in Clone A Cells--
The expression pattern of the
6A and 6B integrin splice variants was
studied by RT-PCR. The primer pair was designed so that both upper and
lower primer hybridized with the sequence common to both splice
variants, and the reaction product spanned the differentially spliced
region. The expected product sizes were 347 (6A) and 216 base pairs (6B). The primers were as follows: 6-sense, TCATCCTAGTGGCTATTCTC;
6-antisense, CTTTCATTTCTGTTCCACTT. DNase-treated total
RNA (0.2 µg) was used for the reaction, and the reaction products
were analyzed by electrophoresis in 1% agarose gel. A 100-base pair
ladder (New England Biolabs, Beverly, MA) was used as the molecular
weight standard.
| |
RESULTS |
Prediction of PDZ Recognition Sequences from Sequence
Data--
Analysis of the sequences of human integrin subunits (Fig. 1) revealed that two human
integrin chains have a typical class I PDZ binding sequence in
their C terminus: 6A and 5 (last three residues SDA*). This motif constitutes a classical Class I PDZ binding
site, with a hydroxyl group-containing residue at -2 and a
hydrophobic residue at 0. Although most PDZ domains seem to favor
isoleucine or valine at 0, the SDA* sequence is an almost perfect match
with the peptide library data (20) and the structural model of critical
interaction sites (19). Although some other integrin subunits
(V, 6B, and 7C) have a serine residue
at -2, they fail to comply with the requirement of an aliphatic
residue at position 0. We did not recognize type II PDZ binding sites in any of the integrin sequences presented in Fig. 1. It should be
noted that the 7 sequences are of rat origin, because
only the human 7B isoform is currently available in data
bases. Integrin cytoplasmic domains are highly conserved between
species, and therefore the use of rat 7 sequences in the
analysis is unlikely to affect the results.
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Identification of potential PDZ recognition
sequences. The -2 serine of potential PDZ binding sites is
indicated in boldface, and the aliphatic C-terminal residue
is underlined. The 6A and 5
sequences contain a type I PDZ interaction site. The sequences shown
are available in data bases under the following GenBankTM accession
numbers: 1, X68742; 2, XM_003913;
IIb, XM_008360; 3A, NM_005501; 3B,
NM_005501; 4, XM_002572; 5, NM_002205;
6A, X53586; 6B, S66213;
7A, X74293; 7B, 65036; 7C,
X74294; 8, L36531; 9, NM_002207;
10, XM_002097; 11, XM_002379; V,
XM_002379.
|
|
Yeast Two-hybrid Screen--
Based on our sequence analysis, we
sought to identify proteins that interact with the type I PDZ
interaction site found in the 6A and 5
integrins. The entire 6A cytoplasmic domain was cloned
in the pAS2-1 bait vector and used for screening a human mammary gland
yeast two-hybrid library. Most tissues and cell lines express both
isoforms of the 6 integrin, whereas the ductal and
alveolar epithelia of the mammary gland are known to express the
6A isoform solely (7). Therefore, a mammary gland
library was considered particularly suitable for identifying potential binding partners of the 6A integrin. Nineteen of the
most rapidly growing clones that were positive in the -galactosidase
test were selected for analysis by automated sequencing. Of these
clones, 11 of 19 contained varying lengths of the same cDNA
sequence. The sequence data obtained was identical to AF028824
and AK022585; the former sequence is the partial reading frame of TIP-2
(Tax interaction protein clone 2) (24), and the latter sequence is the
complete coding sequence of TIP-2 from an unrelated sequencing project.
Except for some conservative mutations our sequences were also
identical to the published sequence of human GIPC (AF089816) (25). One
of our clones contained the entire reading frame, and we sequenced this
clone to verify the identity of our sequence. Based on our analysis, we
conclude that the amino acid sequences of TIP-2 and GIPC are 100%
identical, and therefore we refer to the protein as TIP-2/GIPC. For
functional studies we cloned the open reading frame of TIP-2/GIPC from
MDA-MB-231 cells by RT-PCR, and also this sequence was identical to the
published TIP-2 sequence (AF028824/AK022585).
Verification of the Identity and mRNA Size by Northern
Blotting--
The published sequences of TIP-2/GIPC contain very
little sequence upstream of the proposed translation start site. Also, the clone that we isolated from the library started only a few nucleotides in the 5' direction of the start codon. To exclude the
possibility that there was any unpublished coding sequence, we
performed Northern hybridization of total RNA isolated from two breast
carcinoma cell lines, MDA-MB-231 and MDA-MB-435 (Fig. 2). Northern hybridization cannot
differentiate between TIP-2 and GIPC sequences, but it clearly shows
that the probe detects a single band at about 2.0 kilobases, the
size of GIPC (25). Therefore, we conclude that mRNAs of TIP-2 and
GIPC are of the same size and that they contain the same size of an
open reading frame and identical amino acid sequences. Thus, the
discrepancies between published TIP-2 and GIPC sequences make no
difference for functional studies.
View larger version (47K):
[in this window]
[in a new window]
|
Fig. 2.
Size comparison of TIP-2 and GIPC
mRNA. Total RNA (20 µg) isolated from MDA-MB-435 and
MDA-MB-231 was hybridized with TIP-2/GIPC probe. A single band of
~2.0 kilobases, the expected size of GIPC (25), was seen.
Despite the differences in their mRNA sequences, we conclude that
TIP-2 and GIPC are products of the same gene. The differences in
published sequences may be due to allelic variations.
|
|
Confirmatory Two-hybrid Tests--
The specificity of the
interaction between 6A integrin and TIP-2/GIPC was
verified by two-hybrid tests using wild type and mutated integrin
sequences. Because the 5 integrin has the same putative
PDZ recognition sequence (TSDA*) as 6A, this integrin subunit was also used in these tests. Mutant constructs of both 6A and 5 with the last three amino acids
deleted were created (named 6Apdz and
5pdz). Because mutation of the -2 position serine
should be sufficient for abolishing type I PDZ interaction, we also
made constructs with the -2 position serine mutated to alanine. These
constructs, as well as all other integrin cytoplasmic domain point
mutants used in this study, were named by listing the last four
residues using the standard one-letter code for amino acids
(6A/TADA* and 5/TADA*). The
6B cytoplasmic domain was selected as a negative
control. The results of these experiments are shown in Table
I. A TIP-2/GIPC clone containing residues 102-333 and captured by the original two-hybrid screen was used as a
prey in these experiments. TIP-2/GIPC interacted strongly with both
6A and 5, and deletion of the last three
amino acids (pdz) or mutation of the -2 position serine
(6A/TADA* and 5/TADA*) completely
abolished the interaction, as expected. Surprisingly, however,
6B also interacted with TIP-2/GIPC.
View this table:
[in this window]
[in a new window]
|
Table I
Confirmatory yeast two-hybrid tests
A TIP-2/GIPC clone captured in the original library screen, and coding
for residues 102-333 was used in confirmatory yeast two-hybrid tests.
pAS2-1 is the bait vector, and other constructs are described in
detail in the text. The color reaction was estimated as follows:
visible within 1 h, +++; within 2 h, ++; within 6 h, +;
no reaction, negative.
|
|
Two-hybrid Tests Showing That 6B Also Has a PDZ
Binding Site--
Because the 6B integrin C terminus
(ESYS*) is not suggestive of a PDZ domain, we designed several lines of
experiments to find out whether the interaction between the
6B cytoplasmic domain and TIP-2/GIPC actually was a PDZ
interaction. A deletion mutant of 6B lacking the last
three amino acids (6Bpdz) and -2 position point
mutation construct (6B/EAYS*) were used for verifying
the interaction site, and several other integrins were included in the
two-hybrid tests as controls. Because the interaction between 6A/5 and TIP-2/GIPC is clearly a type I
PDZ interaction, we reasoned that 6B integrin sequence
might represent a subtype of PDZ interaction site not revealed by the
peptide library screens. For this reason, we analyzed the integrin subunit sequences one more time, looking for similarities to the
6B C terminus. The V integrin has a serine in
position -2 and threonine in position 0, thus resembling
6B. Therefore, an V integrin construct was included
in the yeast two hybrid tests. We also repeated the tests with
constructs containing only the last seven residues of 6A (ERLTSDA*) and 6B (NRNESYS*). The results obtained are
summarized in Table II. Deletion of the
last three amino acids (6Bpdz) or point
mutation of -2 position serine (6B/EAYS*) completely abolished interaction, suggesting that 6B C terminus
actually is a PDZ recognition sequence. The PDZ interaction hypothesis was further supported by the fact that the last seven amino acids of
6A and 6B were sufficient for interaction
and actually resulted in higher level of reporter gene activation than
the construct containing the entire cytoplasmic tail. Neither the V
subunit nor the 2 and 3A/B subunits
interacted with TIP-2/GIPC.
View this table:
[in this window]
[in a new window]
|
Table II
Yeast two-hybrid tests with various integrin subunits as bait
The last seven amino acids of 6A (ERLTSDA*) and
6B (NRNESYS*) were used for verifying that the most
C-terminal sequence is sufficient for interaction. Color reactions were
graded as follows: visible within 1 h, +++; within 2 h, ++;
within 6 h, +; no reaction, negative.
|
|
Demonstration of PDZ Interaction by Mutation of the GLGF
Loop--
The fact that the point mutation of -2 position serine of
6A, 6B, and 5 C termini
completely abolished the interaction with TIP-2/GIPC was highly
suggestive of a PDZ interaction. To prove this definitively, we made
more yeast two-hybrid tests using various TIP-2/GIPC constructs as a
prey. The GLGF-loop is critically important for PDZ interactions, and
point mutations in this sequence should abolish the interaction. We
used a previously described point mutation strategy (22) to destroy the
atypical GLGF-loop of TIP-2/GIPC (ALGL mutated to AAEL). The results of
these experiments are summarized in Fig.
3. It should be noted that each
TIP-2/GIPC construct was tested with all three integrin subunits
(6A, 6B, and 5). However,
the results were exactly the same no matter which one of these three
integrins was used as a bait, and for clarity, the results of these
experiments are expressed in one single column in Fig. 3. The amino
acid sequence of the PDZ domain and some of the sequence surrounding it
are shown at the bottom of the figure to clarify how the constructs
were designed. One of the plasmids captured by the original two-hybrid
library screen, coding for residues 102-333 of TIP-2/GIPC, was used as
a positive control and for creating the GLGF-loop mutation construct.
The results show that point mutation of the GLGF-loop (ALGL to AAEL) is
sufficient to abolish the interaction with all three integrins (6A, 6B, and 5).
View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
Yeast two-hybrid tests using various
TIP-2/GIPC constructs as a prey and integrin cytoplasmic domains
(6A,
6B, and
5) as a bait. The result of the
-galactosidase test for each TIP-2/GIPC construct was the same
regardless of which integrin construct was used (6A/B or
5), and therefore the results are summarized in one
single column on the right. One of the TIP-2/GIPC clones
obtained from the library screen and coding for residues 102-333 was
used as a positive control, and it was also used for creating the
GLGF-loop mutant construct. In the GLGF-loop mutant construct, the
sequence ALGL was replaced by AAEL as previously described (22). The
other constructs shown in this figure contain various parts of the
TIP-2/GIPC sequence, and the position numbers of the first and
last residues included are shown for each construct. The PDZ homology
region is formed by residues 133-216, and the amino acid sequence of
the entire PDZ domain and some of the sequence around it is shown at
the bottom. Residues forming the PDZ domain are in
boldface, and the atypical GLGF-loop (ALGL) is
underlined. The threonine residue corresponding to the
second residue of the second pleated sheet (B2) of
some more thoroughly characterized PDZ domains (28, 32) is highlighted
by a shaded box. The -galactosidase reaction was assessed
as very strong (+++) when apparent within 1 h, strong (++) if
visible after 2 h, weak (+) if visible within 2-6 h, and negative
if not detectable after 6 h.
|
|
Recognition of the Minimal Sequence in TIP-2/GIPC Required for
Binding to Integrins--
We next decided to test whether the PDZ
homology domain alone is sufficient for interaction. Homology searches
suggested that the PDZ domain of TIP-2/GIPC is formed by residues
133-216. The TIP-2/GIPC clones captured by the original library screen
all contained the PDZ domain and the sequence on its C-terminal side, whereas the amount of sequence N-terminal to the PDZ domain varied considerably. The yeast two-hybrid library was oligo-dT primed, and
therefore it is impossible to make any conclusions of the importance of
the C-terminal sequence for interaction on the basis of the original
library screen. The shortest sequence obtained from the library screen
coded for residues 115-333 of TIP-2/GIPC. We therefore designed a
construct containing residues 115-217, starting at the same residue as
the minimal sequence obtained from the library screen but discontinuing
immediately after the end of the PDZ homology region. Another construct
was designed to start closer to the PDZ homology region but to stop at
the same residue as the previous one (residues 123-217). To exclude the possibility that the sequence on the C-terminal side of the PDZ
domain binds by itself to the integrin cytoplasmic domains, we designed
a construct consisting of residues 218-333. Our results (summarized in
Fig. 3) show that residues 115-217 are sufficient for interaction with
all integrins concerned (6A, 6B, and
5), whereas the construct containing residues 123-217
failed to interact with any of them. The C-terminal sequence (residues
218-333) did not interact with any of the integrin cytoplasmic
domains. We conclude that the interaction between the integrin subunits and TIP-2/GIPC is mediated entirely by the PDZ domain of
TIP-2/GIPC. The minimal sequence required for interaction contains a
short stretch of amino acids on the N-terminal side of the PDZ domain. It should be noted, however, that the localization of PDZ domain to
residues 133-216 is based entirely on the sequence homology data. The
structural requirements for the formation of the PDZ domain may
include the presence of these residues outside the actual PDZ
homology region.
In Vitro Pull-down Assays--
The interactions found in the yeast
two-hybrid assays were confirmed in vitro. His-tagged
bacterial recombinant TIP-2/GIPC and GST fusion proteins of integrin
cytoplasmic domains were used in stringent RIPA conditions. Fig.
4A shows the comparison of binding to wild type 6A/B and to the constructs either
lacking the last three residues (pdz) or having the point mutation
of -2 serine to alanine (6A/TADA* and
6B/EAYS*). The left lane in Fig.
4A is the positive control, containing 20% of the amount of
TIP-2/GIPC used for the pull-down assays. 6A and
6B show strong interaction with TIP-2/GIPC in
vitro, and the point mutation of the -2 serine and the deletion
of the last three amino acids abolished the interaction equally well.
Fig. 4B shows the corresponding data for the
5 integrin subunit. The binding to 5 was
relatively weak in RIPA conditions, but nevertheless the point mutation
of the -2 serine (5/TADA*) and deletion of the last
three residues (5pdz) both abolished the interaction
in vitro. We repeated the experiment for the
5 constructs using Nonidet P-40 detergent (Fig.
4B, right panel). There was a slightly higher background binding to GST protein itself, but even in less stringent conditions the deletion of the last three residues or mutation of the -2 position
serine abolished the interaction. These results clearly demonstrate
that 5 integrin C terminus binds to TIP-2/GIPC in vitro. We conclude that all three integrin subunits
(6A, 6B and 5) have a PDZ
interaction site for binding to TIP-2/GIPC.
View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
In vitro binding assays.
GST-integrin cytoplasmic domain fusion proteins were used for in
vitro pull-down assays. Bacterial recombinant
His6-TIP-2/GIPC was detected by INDIA His-probe.
A, binding to 6A and 6B
constructs in stringent conditions (RIPA buffer). Strong binding to
both 6A and 6B was seen, and deletion of
the last three residues of the integrins (pdz) or mutation of the
-2 serine to alanine (6A/TADA* and
6B/EAYS*) completely abolished the interaction.
B, binding of TIP-2/GIPC to 5 integrin
constructs. An experiment in stringent conditions (RIPA buffer) is
shown on the left, and an experiment in less stringent
conditions (1% Nonidet P-40) is shown on the right. Binding
of TIP-2/GIPC to 5 integrin was relatively weak in
stringent conditions (RIPA), but the deletion of the last three
residues (5pdz) or mutation of the -2 serine
(5/TADA*) completely abolished this interaction. In 1%
Nonidet P-40, the binding to 5 was more evident, but the
background binding to GST was higher than in RIPA buffer. Deletion of
the last three residues (5pdz) or mutation of the -2
serine (5/TADA*) abolished the binding even in these
conditions. These in vitro experiments in different
conditions confirm that all three integrin subunits (6A,
6B, and 5) contain a PDZ recognition
sequence that interacts with TIP-2/GIPC.
|
|
In Vitro Binding Assays with 6A Cytoplasmic Domain
Mutants--
We next decided to investigate in detail the residues in
6A and 6B integrin that are critical for
interaction with TIP-2/GIPC. The specific PDZ interaction sites are
usually composed of the 4-5 most C-terminal residues of the protein.
Therefore, we focused on the last five amino acids of the
6A and 6B integrins. Both subunits
contain a serine in the -2 position, which is required by definition
for a type I PDZ interaction site. Otherwise, these peptide sequences
have little in common. 6B has a negatively charged
residue (Glu) at the -3 position, and 6A has threonine in the same place. At the -1 position, the situation is reversed: 6A has a negatively charged aspartate residue, whereas
6B has a hydroxyl group- containing tyrosine. We
hypothesized that these two positions might act cooperatively and that
the ability to bind to TIP-2/GIPC would be dictated by the combined
action of the two. Therefore, we continued the in vitro
binding studies with mutational analysis of integrin cytoplasmic tails.
The constructs used in these pull-down experiments contained the entire
cytoplasmic domain of the integrins, with one of the last four residues
being mutated. The constructs were named by listing the last four amino acids of the mutant using the standard one-letter code for amino acids.
Each experiment was performed in quadruplicate, and the binding was
quantified from Western blots by image analysis. The 6A
mutants were compared separately to wild type 6A, and
the 6B mutants were compared with wild type
6B. The binding efficiency was expressed as a percentage
compared with the wild type integrin. The constructs lacking the last
three residues were used as a negative control. The results using
6A mutants are shown in Fig. 5A. Mutation of the -3
position threonine to alanine (6A/ASDA*) reduced the
binding about 60%, whereas mutation of the -1 position aspartate to
alanine (6A/TSAA*) abolished the interaction almost completely. The 6A/ESDA* construct showed higher
affinity toward TIP-2/GIPC than the wild type integrin, suggesting that
glutamate (as in 6B) was preferred at this position.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Analysis of PDZ interaction sequences of
6A and
6B by point mutations. The
mutations were created in the last four residues of each splice
variant. The mutants are named using the standard one-letter code of
amino acids for the four most C-terminal residues of each mutant. The
wild type sequences are TSDA* (6A) and ESYS*
(6B). The experiment was performed in quadruplicate, and
bindings of 6A and 6B mutants were
compared separately to wild type 6A and
6B, respectively. The binding is expressed as the
percentage of wild type ± S.D.
|
|
In Vitro Binding Assays with 6B Mutant
Constructs--
The 6B mutants were designed to study
in detail how this atypical sequence could function as a PDZ
interaction site. The results are shown in Fig. 5B. Mutation
of the -3 position glutamate to alanine (6B/ASYS*)
reduced the binding by 70%, and even the mutation to threonine
(6B/TSYS*) reduced binding by almost 50%. Glutamate is
therefore the preferred residue at -3, which is in line with the data
obtained with the 6A mutants. Replacement of the -1
position tyrosine with phenylalanine (6B/ESFS*) reduced the binding affinity only modestly, suggesting that the -3 position glutamate is the most critical residue for high affinity binding in
6B integrin. The hydroxyl group-containing
residues, however, can substitute to some extent for the lack of a
negative charge, as shown by the comparison of wild type
6A (Thr at -3) and 6B (Tyr at -1) to
mutants having an aliphatic residue at these positions.
Analysis of the Atypical C-terminal Residue in 6B
PDZ Recognition Sequence--
Although the 6B C
terminus clearly functions as a PDZ interaction site based on our
results, the previously published peptide library data do not predict
this sequence to be such. We tested the effect of mutating the last
residue in 6B to alanine (6B/ESYA*), which fits the model of classical type I PDZ interaction site better
(Fig. 5B). This mutant showed increased affinity toward TIP-2/GIPC, suggesting that even for TIP-2/GIPC, the preferred residue
at the end of the recognition sequence is aliphatic. However, the
presence of an aliphatic residue at the C terminus of the target
protein is not absolutely required for binding if the residues farther
upstream match the binding specificity of TIP-2/GIPC.
Localization of 6 Integrin and TIP-2/GIPC in Clone A
Cells Plated on Laminin--
Based on previous studies that linked the
6 integrins to the migration of carcinoma cells, we
assessed the possibility that 6 integrins and TIP-2/GIPC
co-localize in structures involved in migration. For this purpose, we
used clone A colon carcinoma cells because the
6-dependent adhesion of these cells to
laminin induces the formation of lamellae and retraction fibers and it stimulates their motility (23). The 6 integrin subunit
can form heterodimers with both 1 and 4
integrin subunits. Clone A cells, however, express solely
64 (23, 26, 27). We also analyzed the
expression pattern of 6 splice variants in clone A cells
by RT-PCR, and our results show that clone A cells express both splice
variants of 6 integrin subunit, although
6A splice variant is expressed at a higher level (Fig.
6, top right). In clone A
cells plated on laminin, a distinct co-localization of 64 and TIP-2/GIPC was most apparent in
retraction fibers (Fig. 6, A and B). Indeed,
there are several areas in which both the 6 integrin
subunit and TIP-2/GIPC are concentrated (arrows). A brief
exposure of these to 100 nM staurosporine increases the formation of retraction fibers dramatically and, under this condition, the co-localization of 64 and TIP-2/GIPC
was striking (Fig. 6, C and D). A co-localization
of these two proteins was much less apparent in lamellae (data not
shown). The formation of lamellae can also be induced in clone A cells
independently of 64 engagement by phorbol
12-myristate 13-acetate stimulation of cells adherent to collagen.
Interestingly, an intense localization of TIP-2/GIPC was apparent at
the edge of the lamellae in these cells, although no co-localization
with 64 was apparent (Fig. 6,
E and F), nor was any co-localization seen in the
retraction fibers in these cells (data not shown). Based on these
results, we conclude that the engagement of the
64 integrin by laminin promotes the
co-localization of this integrin and TIP-2/GIPC in retraction
fibers.
View larger version (71K):
[in this window]
[in a new window]
|
Fig. 6.
Co-localization of integrin
6 subunit and TIP-2/GIPC in clone A
colon carcinoma cells. A and B, clone A
cells plated on laminin. 64 integrin
co-localizes with TIP-2/GIPC in retraction fibers (arrows).
C and D, the cells were plated on laminin for 30 min and subsequently treated with 100 nM
staurosporine for 15 min. The number of retraction fibers
increased dramatically upon staurosporine treatment, and the
co-localization of 64 integrin and
TIP-2/GIPC was even more evident. The areas displaying the most
striking co-localization are indicated by arrows.
E and F, clone A cells plated on collagen and
subsequently treated with 100 nM phorbol 12-myristate
13-acetate to induce the lamellipodia. The focus is at the ventral
surface of the cell. 64 integrin and
TIP-2/GIPC showed a completely different distribution,
64 being localized in small patches and
TIP-2/GIPC being concentrated in the lamellipodium and to lesser extent
in structures resembling stress fibers. There was no co-localization of
64 integrin and TIP-2/GIPC TIP-2/GIPC.
Bars indicate 6 µm (different scales for A and
B versus E and F). Top right
panel shows the RT-PCR analysis of 6 splice
variants in clone A cells. A reaction mixture lacking the template RNA
was used as a control, and a 100-base pair (bp) DNA ladder
is shown as a reference. Both 6A (347 base pairs) and
6B (216 base pairs) splice variants were detected, but
6A isoform clearly predominated.
|
|
| |
DISCUSSION |
This is the first report describing and analyzing PDZ interactions
with integrin subunits. We demonstrate that the 6A
and 5 integrin subunits contain a conserved PDZ
recognition sequence that enables these integrins to interact with
TIP-2/GIPC, a PDZ domain-containing, cytoplasmic protein. Most likely,
this conserved motif mediates interactions with other cytoplasmic PDZ
proteins as well, possibly in a cell type-specific manner. In addition, our study revealed the presence of a novel PDZ interaction site in the
6B integrin subunit, the C terminus (ESYS*) of which is not consistent with the current peptide library based models of PDZ
interaction sites (20). These findings indicate that other PDZ
recognition sequences exist, and the number of PDZ interactions in vivo may be much higher than can be predicted on the
basis of current assumptions about PDZ interaction sites. Moreover, our
results have important implications for the mechanism by which specific
integrins interact with cytoplasmic proteins.
The yeast two-hybrid screen with 6A integrin as a bait
suggested a strong interaction with TIP-2/GIPC. Because
6A and 5 subunits have exactly the same
last four residues (TSDA*), it was reasonable to assume that they would
interact with the same PDZ protein. Although the interaction of both
6A and 5 with TIP-2/GIPC could be
verified in vitro, the interaction with 5 was
weak under the experimental conditions we used for 6A/B
integrins. However, the interaction became clearly apparent under less
stringent conditions, and we conclude that 5 integrin
specifically binds to TIP-2/GIPC. There are many examples in the
literature in which the sequence upstream of the actual PDZ recognition
motif changes the affinity of the interaction (28, 29). The sequences
of 6A and 5 are completely different
upstream of the TSDA* motif, which probably explains why efficient
binding of 5 to TIP-2/GIPC in vitro required
the use of different detergents.
A surprising finding was the presence of a PDZ recognition sequence in
the 6B integrin subunit, even though the C-terminal sequence (ESYS*) is not suggestive of one. The preference for an
aliphatic residue at the very end of the sequence was so strong in the
peptide library screen that it was considered mandatory for the PDZ
interaction (20). The mutational analysis we performed may explain some
discrepancies between peptide library work and studies with actual
proteins. Mutation of the last residue of 6B to alanine
(6B/ESYA*) increased the binding affinity considerably, suggesting that the wild type sequence is sufficient but not optimal for binding to TIP-2/GIPC. TIP-2/GIPC seems to allow more flexibility at the 0 position than the PDZ proteins used in crystal structure studies. In this direction, recent studies have provided insight in how
PDZ domains select for a particular C-terminal residue. The
Na+/H+ exchanger regulatory factor PDZ domain
shows a preference for C-terminal leucine. This binding specificity
derives from the larger dimensions of the binding pocket compared with
the PSD-95 PDZ3 domain that favors the smaller side chain of valine
(30, 31). The critical structure that coordinates the terminal carboxyl group is GLGF motif inside the PDZ homology domain (19). In TIP-2/GIPC,
even the GLGF-loop is atypical: Ala-Leu-Gly-Leu (22). This unusual
GLGF-motif, together with other structural features yet to be
identified, probably explains the promiscuity in preferences for
C-terminal residue.
The fact that TIP-2/GIPC can bind to two seemingly very different
sequences, 6A (TSDA*) and 6B (ESYS*),
suggests that the current models of PDZ interaction are too restricted.
It also shows that the binding site acts as a functional unit, and the relative importance of each residue may differ in different binding sequences even for the same PDZ protein. Apart from the -2 serine that
is critical for all type I PDZ interactions and that is found in both
the 6A and 6B isoforms, the -1 and -3
residues appear to be the most critical for the interaction between
these integrins and TIP-2/GIPC. Constructs that did not have a
negatively charged residue at either position (6A/TSAA*
and 6B/ASYS*) showed the lowest affinity toward
TIP-2/GIPC, whereas the 6A construct with a negatively
charged residue at both positions (6A/ESDA*) was superior to the wild type integrin in binding to TIP-2/GIPC. Thus, our
data suggest that at least one carboxyl group-containing residue in these positions is needed for efficient binding. The preference for
negatively charged residues at both -1 and -3 positions has been
previously described for the first two PDZ domains of PSD-95 (28). Our
studies on TIP-2/GIPC revealed an even more complicated pattern,
because hydroxyl group containing residues were able to compensate for
the lack of a negatively charged amino acid to some extent. This was
shown by the weak but detectable binding to 6B/TSYS*
construct and the slight difference in binding between the wild type
6B (ESYS*) and 6B/ESFS* mutant.
For wild type 6A, the -1 Asp is critically important
for the interaction with TIP-2/GIPC. The mutation of -1 Asp to alanine completely abolished interaction. This finding is somewhat
contradictory to the published structural models of PDZ interactions.
In the third PDZ domain of PSD-95, the side chain of the -1 residue is pointed outwards and does not participate in interactions with the PDZ
domain (19). However, more recent reports have recognized PDZ
interactions in which there is a preference for either a negatively charged or Ser/Thr residue at the -1 position. The critical residue for these preferences is the second residue of the second -pleated sheet (B) in the PDZ homology domain. If this B2 residue is serine, the PDZ domain selects for peptides with a negatively charged
residue at -1, whereas if it is asparagine, the PDZ domain prefers
peptides with -1 Ser/Thr (28, 32). Interestingly, the B2 residue in
TIP-2/GIPC PDZ homology domain is threonine (Fig. 3), which is probably
also able to convert the preference toward negatively charged residues
at -1.
TIP-2/GIPC contains one PDZ domain in the central part of the molecule.
The C-terminal part shows weak homology to acyl carrier protein domain
(25), but so far it has not been shown to have enzymatic activity. Most
functions suggested for TIP-2/GIPC are those of a scaffold protein, as
is typical for other PDZ proteins. An obvious problem for scaffold
functions is the fact that TIP-2/GIPC has only one PDZ domain. However,
TIP-2/GIPC self-associates (33, 34), which may enable it to cross-link
two proteins with C-terminal PDZ recognition sequences. In addition,
the interactions of TIP-2/GIPC with molecules such as myosin VI (33)
and TrkA/B (22) are not PDZ interactions. Thus, a single TIP-2/GIPC
molecule can simultaneously interact with a PDZ recognition sequence of
one protein and an unrelated recognition sequence of another. The
sequence outside the PDZ domain shows little homology to other
proteins, and except for the weak match with the acyl carrier protein
domain there, are no signs of the existence of other characterized
protein domains. At the moment, the function of these unique N- and
C-terminal peptide sequences is poorly understood.
Our identification of PDZ recognition sequences in integrin cytoplasmic
tails has important implications for the mechanisms by which integrins
interact with intracellular proteins and mediate function. Indeed, the
interaction of 6A and 6B with TIP-2/GIPC
Subunits
TOP
ABSTRACT
INTRODUCTION
