![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 4, 2565-2570, January 26, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
From the Departments of Medicine and Immunology, Mayo Clinic and Foundation, Rochester, Minnesota 55905
Received for publication, June 22, 2000, and in revised form, November 6, 2000
| |
ABSTRACT |
|---|
|
|
|---|
We recently reported that aging is accompanied by
the emergence of CD4+CD28null T cells, a
functionally aberrant lymphocyte subset rarely seen in individuals
younger than 40 years. Here, we directly examined whether the lack of
CD28 expression is due to a defect at the level of transcriptional
initiation. Molecular studies reveal that CD28 gene transcription is
controlled by two sequence motifs, sites The cellular and molecular processes underlying immune
dysfunctions during normal aging are complex. The immune system
undergoes a constant turnover of cells and is highly dependent on the
replenishment of new precursor cells. However, de novo
production of T cells rapidly declines with the progressive involution
of the thymus with age (1, 2). Consequently, there is replicative
stress resulting in the progressive shortening of telomeres of
peripheral lymphocytes (3, 4). Replicative senescence is associated with altered patterns of gene expression (5). Among T cells, senescence
is accompanied by a characteristic loss of CD28, predominantly among
CD8+ T cells (6, 7) and to a lesser degree among
CD4+ T cells (8). Interestingly,
CD4+CD28null T cells have also been found in
patients with chronic inflammatory syndromes, such as those seen in
rheumatoid arthritis, Wegener's granulomatosis, and coronary artery
disease (9-11). A CD28null phenotype is stable. Neither
the triggering of the T cell receptor (TCR)1 nor signals generated
by pharmacologic agents such as phorbol ester and calcium ionophore
that bypass the TCR can restore CD28 expression (8, 12, 13).
Because CD28 is the dominant costimulatory molecule required for T cell
activation, proliferation, and effector function (14), elucidation of
the molecular basis for CD28 deficiency is of paramount interest.
Inasmuch as CD28null T cells uniformly lack specific
mRNA of all known splice variants (8, 12, 15), we evaluated the
hypothesis that the loss of CD28 is due to a transcriptional block. In
previous work, we reported that CD28 expression is controlled by two
sequences, sites Our finding that sites Cell Culture--
T cell lines and clones were established from
peripheral blood as described previously (8, 15, 32). Briefly,
CD4+CD28null and
CD4+CD28+ T cells were isolated from blood
mononuclear cells by standard fluorescence-activated cell sorting
procedures. Cells were stimulated with anti-CD3 (OKT3, ATCC, Manassas,
VA) and
Primary CD4+ T cell lines were derived from unfractionated
blood mononuclear cells that were similarly stimulated with anti-CD3. After 24 h, CD4+ T cells were isolated by the
immunodepletion of CD8+ cells using the VarioMacs system
(Biotec Miltenyi, Auburn, CA). Purity of the isolated cells was
verified by flow cytometry. Cells were cultured on EBV-transformed B
cell feeders and 20 units/ml recombinant human interleukin 2 (Proleukin, Chiron, Emeryville, CA). Sublines of
CD4+CD28+ and
CD4+CD28null T cells were subsequently
established by fluorescence-activated cell sorting. All lines and
clones were maintained by weekly stimulation with EBV-transformed B
cell feeders and recombinant human interleukin 2 in a humidified 7.5%
CO2 incubator as described previously (8, 15).
The T cell lymphoma lines Jurkat and HUT78 (ATCC) were maintained at
densities of about 5 × 106 cells/ml in RPMI 1640 medium supplemented with 10% fetal calf serum. HUT78 was cultured in
the presence of 20 units/ml recombinant human interleukin 2. Cells were
maintained in a humidified 5% CO2 incubator.
Phenotyping of Cells--
T cells were examined for cell surface
expression of CD3, CD4, and CD28 by three-color immunofluorescence
staining and flow cytometry. The lack of CD28 expression in T cell
clones or lines was also verified by reverse transcription-polymerase
chain reaction (reverse transcription-PCR) procedures for the
splice variants of CD28 (12, 15).
Clonality of the T cell clones was established by standard nested
reverse transcription-PCR for the BV-BJ segments of the TCR. PCR
products were cloned into the TA vector and recombinants were used to
transform One-ShotTM Escherichia coli
(Invitrogen, Carlsbad, CA). Sequencing of plasmids prepared from at
least three randomly selected bacterial colonies authenticated the clones.
Nuclear Extracts--
Nuclear extracts were prepared using a
high salt extraction protocol described previously (8, 33). Extracts
from the primary T cell lines and clones were prepared between 3 and 5 days after the last stimulation. Extracts from Jurkat and HUT78 cells
were prepared during logarithmic growth. Protein concentrations of the
extracts were determined by the Bradford method using a protein assay
kit (Bio-Rad). Nuclear extracts were aliquoted, snap frozen in
liquid nitrogen, and stored at In Vitro Transcription Assay--
Sequences of the human CD28
gene sites
Conditions of transcription reactions were as described previously (34)
with the following modification. Nuclear extracts were subjected to
centrifugation dialysis (Microcon YM3 Amicon filter, Millipore,
Bedford, MA) against 10 volumes of reaction buffer, and the total
protein concentration was determined as above. Nuclear extracts were
added at the indicated amounts to 300 ng of plasmid template and
incubated at 30 °C for 60 min. A mixture of 100 mM ATP,
100 mM CTP, and 50 µM
[ Verification of
Although the transcription factor that directly bind TdT-INR is not
known, transcriptional activation of the TATA/TdT-INR template has been
shown to be dependent on CIF150, a cofactor of transcription factor IID
that appears to be ubiquitously expressed (35). Reverse
transcription-PCR experiments for CIF150 expression in T cells used in
the present study uniformly showed the presence of specific
transcripts. Direct sequencing of PCR products (data not shown)
authenticated these CIF150 transcripts.
Sites
Experiments were also carried out to examine whether sites
In TATA-containing promoters, INRs are known to synergize with the TATA
box, resulting in levels of transcription that are significantly higher
than those seen with INR or TATA alone (38). This synergy is
distinguished from a classical enhancer in that the latter induces
transcription regardless of its orientation or distance from the basal
complex assembled on the TATA box. Thus, we examined whether a reversed
polarity, from
The lack of
Reciprocal experiments were also conducted wherein HUT78 extracts were
added in increasing amounts to a constant amount of Jurkat extracts. As
shown in Fig. 6, the addition of HUT78
extracts did not affect The present work provides functional evidence for the direct role
of sites Although INRs serve as positional elements in TATA-containing promoters
(20), they are the nucleation sites for the basal transcriptional
complex in TATA-less promoters (41-44). This is exemplified by the
expression of lymphoid-specific genes such as TdT, the CD4 antigen, and
the TCR V There are two curious features of the These peculiar properties of The present data also unequivocally demonstrate that a
CD28null phenotype is related to the complete disruption of
transcription. Because our assay system directly assessed the ability
of It is important to note that CD4+CD28null
T cells, whether isolated from elderly individuals (8) or from patients
with chronic inflammatory conditions (9, 11), are functionally active (62, 63) and not anergic as might be predicted from studies in the
mouse (14). However, they have a perturbation in the pattern of
expression of an array of molecules known to be important for
lymphocyte function. For instance, CD4+CD28null
T cells also lack expression of CD40 ligand, hence are unable to
support B cell proliferation and differentiation (13). They are highly
resistant to apoptosis (32, 64), which may explain their persistence in
the circulation for years and their expansion up to 50% of the total
CD4 compartment (8, 9). A key question then is whether reconstitution
of CD28 In conclusion, data presented here show that CD28 deficiency in
CD4+ T cells is due to a transcriptional block.
Specifically, the
and
. In
vitro transcription assays using initiator-dependent DNA templates revealed that reversed polarity or the deletion of either
motif inhibited transcription, indicating that
/
sequences constitute a composite initiator. Moreover, nuclear extracts
from CD28null cells failed to activate transcription of

-initiator DNA templates. Transcription of such templates was,
however, restored with the addition of extracts from CD28+
cells. Although previously described initiator elements have been
defined by a consensus sequence, the 
-initiator has no homology
to such sequence. These studies demonstrate that initiators have
functions other than positioning elements for the basal transcription complex. Rather, initiators can have a direct role in regulating the
expression of specific genes. The gain or loss of initiator activity can be an important determinant of cell phenotypes.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and
, that are surprisingly situated
immediately downstream from the TATA box (8). Nuclear proteins that
specifically bind to sites
and
are limited to lymphoid tissue,
and their expression patterns are correlated with the presence or
absence of CD28 on the surfaces of T and B cells (15). Moreover, random
mutations in either site can sufficiently inactivate promoter activity
in reporter gene bioassays (8). The functional relevance of these sequence motifs is further indicated by the modulation of
/
-nuclear protein binding profiles by TCR triggering and during
replicative senescence, two conditions that induce down-regulation of
CD28 on the T cell surface (15).
and
map downstream from the TATA box (8)
suggests that the expression of CD28 might be controlled at the level
of transcriptional initiation. Although the TATA box has been
traditionally considered as the assembly site of the basal
transcription complex, flanking initiator (INR) sequences have been
found to be critical core promoter elements (16-19). In
TATA-containing promoters, such INRs are thought to be positioning elements that tether TATA-binding protein, ensuring the fidelity of
transcription from the TATA box (20). INR-binding proteins may also
interact with TATA-binding protein-associated factors, resulting in
improved efficiency of transcription, as has been demonstrated for
immunoglobulin promoters (21, 22). Although the existence of distinct
INR-binding proteins is not clear, several proteins have been
implicated in the activity of INRs. These include general transcription
factors such as transcription factor II-I (23, 24) and the components
of transcription factor IID (25-27), or regulatory proteins such as
YY1 (28) and USF (29, 30). In the present work, the role of sites
and
as INRs was evaluated. Although these sequences have no
homology with the consensus INR (18), sites
and
coincide with
the putative transcription start site (31).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-irradiated autologous monocytes for 24 h.
Subsequently, cells were subjected to limited dilution cloning in
96-well plates with feeder cells consisting of
-irradiated,
neuraminidase-treated EBV-transformed B lymphoblastoid cells without
additional stimulation. Clones were isolated, and phenotypes were
ascertained by immunofluorescence staining and flow cytometry (see below).
70 °C.
and
,
CGTTATATCCTGTGTGAAATGCTGCAGTCAGGATGCCTTGTGGTTTGAGTGCCTTGAT
(the underlined 5' and 3' sequences correspond to
and
,
respectively) (8) were cloned into plasmid templates (provided by Dr.
Jörg Kaufmann, Chiron Corp.) containing a 180-base pair G-less
cassette downstream from a consensus TATA and the INR of terminal
deoxynucleotidyl transferase (TdT) (34, 35). Sites
and
were
introduced into these plasmids as separate elements or as a contiguous
unit replacing TdT-INR by the gene soeing technique (36).
Templates containing a reversed orientation of 
were also made.
Constructs were amplified in E. coli DH5
(Life
Technologies, Inc.) by standard transformation procedures and randomly
selected bacterial colonies were screened for recombinant plasmids by
PCR using primers specifically designed to detect the inserted
and/or
sequence. Where PCR amplification of 
was indicated,
plasmids were prepared by a commercially available kit (EndoFree
plasmid kit, Qiagen, Valencia, CA) and subjected to DNA sequencing of
the entire the region spanning TATA, INR, and the G-less cassette. Two
clones of each construct were selected for these studies.
-32P]UTP (Amersham Pharmacia Biotech) was added, the
total reaction volume was adjusted to 100 µl, and the mixture was
incubated for 90 min at 30 °C. Transcription products were digested
with 60 units of RNase T1 (Roche Molecular Biochemicals),
extracted with phenol-chloroform, size-fractionated on 8%
polyacrylamide-6 M urea sequencing gels, and visualized by autoradiography.

-Specific and TdT-INR Activating
Proteins--
Nuclear extracts used in the in vitro
transcription assays were tested for the presence of
- and
-binding factors by gel shift assays by previously described
procedures (8, 15). Centrifugation dialysis of extracts (see above) did
not significantly affect the
/
binding profiles of the extracts
(data not shown). As in previous studies, CD28+ T cells
consistently showed
- and
-specific binding proteins. Additionally, competitive gel shift assays with
,
, or TdT-INR sequences revealed exquisite specificity of binding activities among
these 3 promoter motifs, as they did not cross-compete each other (data
not shown). Other studies indicate similar distinctiveness of the
binding activities of TdT-INR from those of other INR sequences (37).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and
Constitute a Bona Fide INR Element--
We have
shown previously that two sequence motifs, sites
and
, regulate
the constitutive expression of CD28 (8). The peculiar topographic
location of these sequences immediately flanking the TATA box suggested
that they might directly interact with the basal transcription complex.
To evaluate this hypothesis, we adapted an in vitro
transcription system (35) that measures transcription of a DNA cassette
controlled by a consensus TATA box and TdT-INR. As shown in Fig.
1, replacement of the TdT-INR element of
the DNA template by the CD28 gene 
sequence resulted in the
production of cassette transcripts in the presence of nuclear extracts
from Jurkat, a T cell lymphoma that expressed high levels of CD28 (15).
The levels of 
-dependent transcription increased with
the amounts of nuclear extract added in a manner similar to those seen
with templates containing the TdT-INR. Consistent with previous studies
(34, 35), the mutated variant of the TdT-INR yielded levels of cassette
transcripts that were consistently and significantly lower than that
seen with wild-type TdT-INR. Presumably, the low amounts of transcripts
seen with the mutant TdT-INR represented the basal level of
transcription from the upstream canonical TATA box.

View larger version (78K):
[in a new window]
Fig. 1.
Sites
and
can initiate transcription from a heterologous
TATA box. In vitro transcription assays were conducted
with plasmid templates containing a 180-base pair G-less cassette under
the control of a consensus TATA box and INR sequences (34, 35). The INR
consisted of either the wild-type (WT) or the mutated
variant (MT) of TdT-INR (16, 34, 46), or of CD28 sites
and
sequences (CD28-
) (8). Assays were
conducted with increasing amounts of nuclear extracts from Jurkat T
cells, which express high levels of CD28. Data shown are representative
of three independent experiments.
and
can function independent of each other. As shown in Fig. 2, neither
nor
alone elicited
transcription at levels higher than the baseline seen with templates
containing the TdT-INR mutant. As in the previous experiment, the
composite 
sequence elicited high levels of transcription in the
presence of Jurkat nuclear extracts in a dose-dependent
manner. The amounts of 
-driven transcripts were equivalent to
those seen with the wild-type TdT-INR.

View larger version (32K):
[in a new window]
Fig. 2.
Sites
and
initiate transcription as a functional unit.
Transcription assays similar to those in Fig. 1 were conducted with
TATA-INR constructs containing the CD28
and
motifs either as
independent (
,
) or contiguous (
) units. Assays were
conducted with varying amounts of Jurkat nuclear extracts. Constructs
containing the wild-type (WT) or mutated form
(MT) of the TdT-INR were used as controls. Data shown are
representative of three independent experiments.
to
, affects INR activity. As
shown in Fig. 3, two independent clones
of DNA templates containing the reversed
sequence indeed
yielded only low amounts of cassette transcripts. In these template
constructs, the levels of transcription were equivalent to those
produced by constructs containing the mutant TdT-INR.

View larger version (35K):
[in a new window]
Fig. 3.
Reversed polarity of
and
abrogates INR activity. CD28

sequences were cloned in the normal (
) or reversed
(
) orientation into TATA-INR plasmid templates and used in
transcription assays as in Fig. 1. Assays were conducted on two
independent clones of each of putative
and
CD28-INR constructs with varying concentrations of Jurkat nuclear
extracts. Constructs containing the wild-type (WT) or
mutated form (MT) of the TdT-INR were used as
controls.

-INR in CD28null T Cells Is
Nonfunctional--
In previous studies,
/
-specific complexes
were found to be uniformly lacking in
CD4+CD28null T cells. Gel shift assays revealed
that neither contiguous 
(8) nor separate
and
(15) probes
showed protein binding activities with nuclear extracts from
CD28null cells. Therefore, we examined whether this lack of
DNA-protein complexes correlates with the absence of transcriptional
activity. As shown in Fig. 4, in
vitro transcription assays using nuclear extracts from various
activated CD28+ T cells yielded cassette transcripts from
DNA templates containing 
as the INR element. The amounts of
transcripts produced were equivalent to those seen with Jurkat nuclear
extracts. In contrast, none of the nuclear extracts from
CD28null T cells elicited transcription above basal levels.
Extracts from CD28+ and CD28null T cells were,
however, indistinguishable in their ability to promote transcription of
templates containing the TdT-INR. As expected, templates with the
mutated TdT-INR produced equivalent low/basal amounts of transcripts
regardless of the CD28 phenotype of the extracts used.

View larger version (31K):
[in a new window]
Fig. 4.
CD28null T cells lack the
motif-specific transcription factors required for

-INR activity. Nuclear extracts
from various T cell lines and clones that either express (+) or lack
(-) CD28 were used in transcription assays with the TdT wild-type
(WT) or mutant (MT) INR and 
-INR
constructs. All cell lines examined are CD4+ except for
Jurkat, which lack CD4. Jurkat and HUT78 are T cell lymphoma lines.
H28P and H28N are primary T cell lines sorted for
CD28 expression. PL52, H4-49, K2, and H2 are T
cell clones.

-INR activity in CD28null T cells could
be due to the absence of 
-specific transcription factors or to
the presence of an inhibitor of 
-proteins. To address this issue,
reconstitution experiments were conducted using nuclear extracts from
Jurkat and HUT78 cells as prototypes of CD28+ and
CD28null T cells, respectively. As shown in Fig.
5, transcription of two DNA templates
containing the 
-INR was at low/basal levels with HUT78 extracts.
However, the addition of increasing amounts of Jurkat extracts
effectively restored 
-mediated transcription. The reconstitution
of transcriptional activity was proportional to the amounts of Jurkat
extracts added to the reaction. Such mixtures of Jurkat and HUT78
extracts did not alter the levels of transcription of templates
containing TdT-INR.

View larger version (32K):
[in a new window]
Fig. 5.
The lack of

-INR activity of nuclear extracts
from CD28null T cells can be reconstituted by extracts from
CD28+ cells. Transcription assays with the TdT
wild-type (WT) or mutant (MT) INR and 
-INR
constructs were conducted with 5 µg of nuclear extracts from HUT78
cells (CD28null) titrated with increasing amounts (5, 20, and 50 µg) of similar extracts from Jurkat cells (CD28+).
In control reactions (-), 10 µg of nuclear extracts from either
Jurkat or HUT78 cells were used.

-driven transcription in Jurkat extracts.
Transcription from TdT-INR templates were also unaffected by the
titration of HUT78 extracts.

View larger version (54K):
[in a new window]
Fig. 6.
Nuclear extracts from CD28null
cells do not inhibit the 
-INR
promoting activity of extracts from CD28+ cells. In
experiments reciprocal to those shown in Fig. 5, transcription assays
with the TdT wild-type (WT) or mutant (MT) INR
and 
-INR constructs were conducted with 5 µg of nuclear
extracts from Jurkat cells (CD28+) titrated with increasing
amounts (5, 20, and 50 µg) of similar extracts from HUT78 cells
(CD28null). In control reactions (-), 10 µg of nuclear
extracts from either Jurkat or HUT78 cells were used.

-INR Activity Requires Coordinate Expression of
Motif-specific Transcription Factors--
The observation that

-INR activity required
and
sequences in tandem (Fig. 2)
suggested that nuclear proteins binding to both motifs are essential to
transcription. Although these
/
-binding proteins remain to be
identified, previous studies indicate that
- and
-complexes are
distinct from each other (8). Therefore, we examined the effect of
depletion of either complex in the efficiency of transcription. As
shown in Fig. 7, incubation of Jurkat
nuclear extracts in oligonucleotides corresponding to either site
or
resulted in the significant reduction of transcription of DNA
templates containing the composite 
sequences as INR. The levels
of 
-driven transcription were effectively reduced to basal levels
at oligonucleotide concentrations of 300 fmol. Similarly, incubation of
extracts in oligonucleotides containing both
and
motifs also
abrogated 
-mediated transcription. As expected, none of the
/
oligonucleotides affected transcription of templates containing
the TdT-INR.

View larger version (51K):
[in a new window]
Fig. 7.
INR activity of

requires the coordinate binding of
motif-specific proteins. About 5 µg of Jurkat nuclear extracts
were incubated with varying concentrations (0, 40, 100, and 300 fmol)
of double-stranded synthetic oligonucleotides (ds
oligo) corresponding to site
(A), site
(B), or both, (AB), respectively, prior to the
transcription assays. Assays with the wild-type (WT) or
mutated form (MT) of the TdT-INR were conducted with control
extracts (-) or those previously incubated with 300 fmol of A, B, or
AB oligonucleotides.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and
in CD28 gene transcription. Because the assay
system adapted in this study stringently gauges the induction of
INR-driven transcription over the basal activity of a canonical TATA
box (34, 35), the ability of
and
to function as a core promoter
element in a heterologous DNA template (Fig. 1) is impressive.
Moreover, the lack of INR activity in similar templates with either
sequence motif isolated from the other, as well as in templates with
reversed polarity from an
to a
orientation (Figs. 2 and 3), provides compelling evidence that
and
constitute a singular INR. Incidentally, the sequence stretch
encompassing
/
overlaps the previously described, albeit
equivocated, transcriptional start site of the CD28 gene (31). The
present data therefore authenticate this initiation site coinciding
with 
. Its peculiar location immediately flanking and downstream
of the TATA box (8) lends further structural definition of 
as an
INR in a manner similar to other known INRs (25, 39, 40).
chain, all of which lack a TATA box and utilize INR to
initiate transcription (45-47). Interestingly, mutations in INRs have
been associated with certain diseases. For example, the lack of
-globin expression in some forms of
-thalassemia has been
associated with mutations in the INR of the gene (48). The use of such
naturally occurring as well as synthetic mutants of
-globin INR in
transcription assays in vitro do in fact reveal
down-regulation or complete inhibition of transcription (49), providing
physiological evidence for a direct link between INR function and
cell/tissue phenotype.

-INR of CD28. The first is
that 
-INR is a much longer element (8) compared with the loosely
defined consensus INR sequence Py-Py-A+1-N-T/A-Py-Py (18)
with which it has no homology. Although there are indications
that this approximate consensus might be conserved among eukaryotes
(50, 51), there is an increasing body of evidence for INRs with
divergent sequences. Among the evidence are the INRs of retinoic
acid receptor
2 (37), mRNA cap-binding protein eIF4E (52), HIV-1
long terminal repeat (53), somatostatin receptor II (54), and vascular
endothelial growth factor receptor (55). The second feature of

-INR is that sites
and
are nonoverlapping binding sites
of discrete protein complexes (8, 15). Although the binding of
motif-specific transcription factors occurs independently, the
cooperative interaction of
- and
-bound proteins is required for
transcriptional initiation. Indeed, the depletion of either
- or
-binding proteins from nuclear extracts by decoy motif-specific
oligonucleotides abolish 
-INR activity (Fig. 7).

-INR suggest that it may be a novel
core promoter element. Interestingly, previous studies showed that
-
and
-binding factors are found only in lymphoid tissue (15)
supporting the notion that 
-INR might account for the restricted
expression of CD28 to T cells and some transformed B cells. Although
the INRs are primarily involved in enhancing nucleation of the basal
transcription complex on the TATA box (20, 56), there is also evidence
for their accessory role in regulating expression of specific genes. A
classic example is the regulation of the Drosophila alcohol
dehydrogenase gene (57, 58) in which the INR can discriminate between
two tandem promoters that are used differentially at various stages of
development. Cell-specific gene expression is also increasingly
indicated to be INR-dependent. The lymphocyte specificity
of TdT is INR-dependent (46). The presence of cell
type-specific INR-binding proteins, albeit unidentified, have been
implicated in the maximal activation of the human chorionic
somatomammotropin promoter (59), the interferon-responsive promoters
such those of Fc
receptor 1b (60), guanylate-binding protein, and
H-2Ld (61), and the cell-specific induction of the
2
isoform of the retinoic acid receptor (37). Because of the divergent
sequences of INRs of these latter genes and the 
-INR from the
consensus sequence, it is quite possible that cell type- or
gene-specific INR-binding proteins profoundly influence the programs of
gene expression. Thus, the identification of 
-INR transcription
factors is pivotal to understanding the restricted expression of CD28.

to initiate transcription of a heterologous DNA template, the
finding that the nuclear extracts from
CD4+CD28null T cells did not promote
transcription of 
-driven templates is a compelling evidence for
functional disruption of INR activity in these cells (Fig. 4). Such
transcriptional incompetence of the CD28null extracts could
be restored by the addition of extracts from CD28+ cells
(Fig. 5), indicating the absence of transcription factor complexes that
specifically recognize 
-INR. This interpretation is supported by
two other observations. The first is that excess amounts of
CD28null extracts do not perturb the transcriptional
competency of extracts from CD28+ cells (Fig. 6), hence the
exclusion for the role of 
-specific repressors. The second is
that efficiency of transcription of TdT-INR driven templates are
equivalent for both extracts (Figs. 4-6). These findings corroborate
previous data demonstrating the uniform and coordinate lack of
- and
-bound complexes in CD4+CD28null T cells (8,
15). Whether or not the emergence of these unusual cells during normal
aging (6-8) or in chronic inflammatory diseases (9-11) could be
solely attributed to the down-regulation (or complete lack) of
expression of a unique 
-INR-binding protein(s) is not known at
this time. Previous data, however, demonstrate that
/
-binding proteins are seen only in lymphoid tissues and that their binding activities are modulated in conditions known to induce changes in the
levels of cell surface expression of CD28 (15).

-INR function can restore CD28 expression and
consequently reestablish normal T cell effector function. Thus, the
biochemical dissection of 
-INR activity is of significant interest.

-INR element is nonfunctional because of a
coordinate lack of 
-specific transcription factors. This is
unlike the well documented active repression of INR activity
such as the INR-dependent, c-myc-mediated down-regulation of many genes (65-67). These studies collectively support the notion that INRs can have specific regulatory role in gene
expression in addition to the nucleation of the basal transcription
complex (20, 56). In a manner similar to enhancers, such a regulatory
role of INRs profoundly influences cell phenotype and function.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Jörg Kaufmann (Chiron Corp.) for generously providing the TATA/TdT-INR constructs and Jim Fullbright for assistance in the preparation of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by the Mayo Foundation and National Institutes of Health Grants RO1-AG15043 and RO3-AR45830.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Mayo Clinic and
Foundation, Rheumatology Research, 200 1st St. S.W., Rochester, MN 55905. Tel.: 507-284-1650; Fax: 507-284-5045; E-mail:
vallejo.abbe@mayo.edu or goronzy.jorg{at}mayo.edu.
Published, JBC Papers in Press, November 7, 2000, DOI 10.1074/jbc.M005503200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: TCR, T cell receptor; INR, initiator; PCR, polymerase chain reaction; TdT, terminal deoxynucleotidyl transferase.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | George, A. J. T., and Ritter, M. A. (1996) Immunol. Today 17, 267-272 |
| 2. | Douek, D. C., McFarland, R. D., Keiser, P. H., Gage, E. A., Massey, J. M., Haynes, B. F., Polis, M. A., Haase, A. T., Feinberg, M. B., Sullivan, J. L., Jamieson, B. D., Zack, J. A., Picker, L. A., and Koup, R. A. (1998) Nature 396, 690-695 |
| 3. | Hodes, R. J. (1999) J. Exp. Med. 190, 153-156 |
| 4. | Rufer, N., Brummendorf, T. H., Kolvraa, S., Bischoff, C., Christensen, K., Wadsworth, L., Schulzer, M., and Lansdorp, P. M. (1999) J. Exp. Med. 190, 157-167 |
| 5. | Shelton, D. N., Chang, E., Whittier, P. S., Choi, D., and Funk, W. D. (1999) Curr. Biol. 9, 939-945 |
| 6. | Posnett, D. N., Sinha, R., Kabak, S., and Russo, C. (1994) J. Exp. Med. 179, 609-618 |
| 7. | Monteiro, J., Batliwalla, F., Ostrer, H., and Gregersen, P. K. (1996) J. Immunol. 156, 3587-3590 |
| 8. | Vallejo, A. N., Nestel, A. R., Schirmer, M., Weyand, C. M., and Goronzy, J. J. (1998) J. Biol. Chem. 273, 8119-8129 |
| 9. | Martens, P., Goronzy, J. J., Schaid, D., and Weyand, C. M. (1997) Arthritis Rheum. 40, 1106-1114 |
| 10. | Moosig, F., Csernok, E., Wang, G., and Gross, W. L. (1998) Clin. Exp. Immunol. 114, 113-118 |
| 11. | Liuzzo, G., Kopecky, S. L., Frye, R. L., O'Fallon, W. M., Maseri, A., Goronzy, J. J., and Weyand, C. M. (1999) Circulation 100, 2135-2139 |
| 12. | Namekawa, T., Wagner, U. G., Goronzy, J. J., and Weyand, C. M. (1998) Arthritis Rheum. 41, 2108-2116 |
| 13. | Weyand, C. M., Brandes, J. C., Schmidt, D., Fulbright, J. W., and Goronzy, J. J. (1998) Mech. Ageing Dev. 102, 131-147 |
| 14. | Lenschow, D. J., Walunas, T L., and Bluestone, J. A. (1996) Annu. Rev. Immunol. 14, 233-258 |
| 15. | Vallejo, A. N., Brandes, J. C., Weyand, C. M., and Goronzy, J. J. (1999) J. Immunol. 162, 6572-6579 |
| 16. | Smale, S. T., and Baltimore, D. (1989) Cell 57, 103-113 |
| 17. | Weis, L., and Reinberg, D. (1992) FASEB J. 6, 3300-3309 |
| 18. | Javahery, R., Khachi, A., Lo, K., Zenzie-Gregory, B., and Smale, S. T. (1994) Mol. Cell. Biol. 14, 116-127 |
| 19. | Lo, K., and Smale, S. T. (1996) Gene 182, 13-22 |
| 20. | Novina, C. D., and Roy, A. L. (1996) Trends Genet. 12, 351-355 |
| 21. | Buchanan, K. L., Smith, E. A., Dou, S., Corcoran, L. M., and Webb, C. F. (1997) J. Immunol. 159, 1247-1254 |
| 22. | Pelletier, M. R., Hatada, E. N., Scholz, G., and Scheidereit, C. (1997) Nucleic Acids Res. 25, 3995-4003 |
| 23. | Roy, A. L., Malik, S., Meisterernst, M., and Roeder, R. G. (1993) Nature 365, 355-359 |
| 24. | Cheriyath, V., Novina, C. D., and Roy, A. L. (1998) Mol. Cell. Biol. 18, 4444-4454 |
| 25. | Chen, H., and Flint, S. J. (1992) J. Biol. Chem. 267, 25457-25465 |
| 26. | Kaufmann, J., and Smale, S. T. (1994) Genes Dev. 8, 821-829 |
| 27. | Chalkley, G. E., and Verrijzer, C. P. (1999) EMBO J. 18, 4835-4845 |
| 28. | Usheva, A., and Shenk, T. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 13571-13576 |
| 29. | Du, H., Roy, A. L., and Roeder, R. G. (1993) EMBO J. 12, 501-511 |
| 30. | Roy, A. L., Du, H., Gregor, P. D., Novina, C. D., Martinez, E., and Roeder, R. G. (1997) EMBO J. 16, 7091-7104 |
| 31. | Lee, K. P., Taylor, C., Petryniak, B., Turka, L. A., June, C. H., and Thompson, C. B. (1990) J. Immunol. 145, 344-352 |
| 32. | Schirmer, M., Vallejo, A. N., Weyand, C. M., and Goronzy, J. J. (1998) J. Immunol. 161, 1018-1025 |
| 33. | Vallejo, A. N., and Pease, L. R. (1996) J. Biol. Chem. 271, 29813-29821 |
| 34. | Kaufmann, J., Verrijzer, C. P., Shao, J., and Smale, S. T. (1996) Genes Dev. 10, 873-886 |
| 35. | Kaufmann, J., Ahrens, K., Koop, R., Smale, S. T., and Müller, R. (1998) Mol. Cell. Biol. 18, 233-239 |
| 36. | Vallejo, A. N., Pogulis, R. J., and Pease, L. R. (1994) PCR Methods Applications 4, S123-S130 |
| 37. | Folkers, G. E., van der Burg, B., and van der Saag, P. T. (1998) J. Biol. Chem. 273, 32200-32212 |
| 38. | Emani, K. H., Jain, A., and Smale, S. T. (1997) Genes Dev. 11, 3007-3019 |
| 39. | Aso, T., Conaway, J. W., and Conaway, R. C. (1994) J. Biol. Chem. 269, 26575-26583 |
| 40. | Jones, G., Manczak, M., Schelling, D., Turner, H., and Jones, D. (1998) Biochem. J. 335, 79-84 |
| 41. | Zhou, Q., Liberman, P. M., Boeyer, T. G., and Berk, A. J. (1992) Genes Dev. 6, 1964-1974 |
| 42. | Martinez, E., Chiang, C. M., Ge, H., and Roeder, R. G. (1994) EMBO J. 13, 3115-3126 |
| 43. | Usheva, A., and Shenk, T. (1994) Cell 76, 1115-1121 |
| 44. | Weis, L., and Reinberg, D. (1997) Mol. Cell. Biol. 17, 2973-2984 |
| 45. | Duncan, D. D., Stupakoff, A., Hedrick, S. M., Marcu, K. B., and Siu, G. (1995) Mol. Cell. Biol. 15, 3179-3186 |
| 46. | Garraway, I. P., Semple, K., and Smale, S. T. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4336-4341 |
| 47. | Manzano-Winkler, B., Novina, C. D., and Roy, A. L. (1996) J. Biol. Chem. 271, 12076-12081 |
| 48. | Wong, C., Dowling, C. E., Saiki, R. K., Higuchi, R. G., Erlich, H. A., and Kazazian, H. H. (1987) Nature 330, 384-386 |
| 49. | Lewis, B. A., and Orkin, S. H. (1995) J. Biol. Chem. 270, 28139-28144 |
| 50. | Kraus, R. J., Murray, E. E., Wiley, S. R., Zink, N. M., Loritz, K., Gelembiuk, G. W., and Mertz, J. E. (1996) Nucleic Acids Res. 24, 1531-1539 |
| 51. | Liston, D. R., and Johnson, P. J. (1999) Mol. Cell. Biol. 19, 2380-2388 |
| 52. | Johnston, K. A., Polymenis, M., Wang, S., Branda, J., and Schmidt, E. V. (1998) Mol. Cell. Biol. 10, 5621-5633 |
| 53. | Montano, A., Kripke, M., Novina, C. D., Achacoso, P., Herzenberg, L. A., Roy, A. L., and Nolan, G. P. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12376-12381 |
| 54. | Pscherer, A., Dorflinger, U., Kirfel, J., Gawlas, K., Ruschoff, J., Buettner, R., and Schule, R. (1996) EMBO J. 15, 6680-6690 |
| 55. | Wu, Y., and Patterson, C. (1999) J. Biol. Chem. 274, 3207-3214 |
| 56. | Roeder, R. G. (1996) Trends Biochem. Sci. 21, 325-335 |
| 57. | Hansen, S. K., and Tjian, R. (1995) Cell 82, 565-575 |
| 58. | Ren, B., and Maniatis, T. (1998) EMBO J. 17, 1076-1086 |
| 59. | Jiang, S. W., Sheard, A. S., and Eberhardt, N. L. (1995) J. Biol. Chem. 270, 3683-3692 |
| 60. | Eichbaum, Q. G., Iyer, R., Raveh, D. P., Mathieu, C., and Ezekowitz, R. A. (1994) J. Exp. Med. 179, 1985-1996 |
| 61. | Wang, I. M., Blanco, J. C. G., Tsai, S. Y., Tsai, M. J., and Ozato, K. (1996) Mol. Cell. Biol. 16, 6313-6324 |
| 62. | Park, W., Weyand, C. M., Schmidt, D., and Goronzy, J. J. (1997) Eur. J. Immunol. 27, 1082-1090 |
| 63. | Vallejo, A. N., Mügge, L. O., Klimiuk, P. A., Weyand, C. M., and Goronzy, J. J. (2000) J. Immunol. 164, 2947-2954 |
| 64. | Vallejo, A. N., Schirmer, M., Weyand, C. M., and Goronzy, J. J. (2000) J. Immunol. 165, 6301-6307 |
| 65. | Li, L. H., Nerlov, C., Prendergast, G., MacGregor, D., and Ziff, E. B. (1994) EMBO J. 13, 4070-4079 |
| 66. | Philipp, A., Schneider, S., Vasrik, I., Finke, K., Xiong, Y., Beach, D., Alitalo, K., and Eilers, M. (1994) Mol. Cell. Biol. 14, 4032-4043 |
| 67. | Mai, S., and Martensson, L. L. (1995) Nucleic Acids. Res. 23, 1-9 |
This article has been cited by other articles:
![]() |
B. H. Lemster, J. J. Michel, D. T. Montag, J. J. Paat, S. A. Studenski, A. B. Newman, and A. N. Vallejo Induction of CD56 and TCR-Independent Activation of T Cells with Aging J. Immunol., February 1, 2008; 180(3): 1979 - 1990. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. GORONZY, G. HENEL, H. SAWAI, K. SINGH, E. B. LEE, S. PRYSHCHEP, and C. M. WEYAND Costimulatory Pathways in Rheumatoid Synovitis and T-Cell Senescence Ann. N.Y. Acad. Sci., December 1, 2005; 1062(1): 182 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy Distinct Transcriptional Control Mechanisms of Killer Immunoglobulin-like Receptors in Natural Killer (NK) and in T Cells J. Biol. Chem., June 24, 2005; 280(25): 24277 - 24285. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gniadecki and A. Lukowsky Monoclonal T-Cell Dyscrasia of Undetermined Significance Associated With Recalcitrant Erythroderma Arch Dermatol, March 1, 2005; 141(3): 361 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. HAN, O. ADOLFSSON, C.-K. LEE, T. A. PROLLA, J. ORDOVAS, and S. N. MEYDANI Vitamin E and Gene Expression in Immune Cells Ann. N.Y. Acad. Sci., December 1, 2004; 1031(1): 96 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. G. Nadareishvili, H. Li, V. Wright, D. Maric, S. Warach, J. M. Hallenbeck, J. Dambrosia, J. L. Barker, and A. E. Baird Elevated pro-inflammatory CD4+CD28- lymphocytes and stroke recurrence and death Neurology, October 26, 2004; 63(8): 1446 - 1451. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. M. van Leeuwen, E. B. M. Remmerswaal, M. T. M. Vossen, A. T. Rowshani, P. M. E. Wertheim-van Dillen, R. A. W. van Lier, and I. J. M. ten Berge Emergence of a CD4+CD28- Granzyme B+, Cytomegalovirus-Specific T Cell Subset after Recovery of Primary Cytomegalovirus Infection J. Immunol., August 1, 2004; 173(3): 1834 - 1841. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Lewis, M. Merched-Sauvage, J. J. Goronzy, C. M. Weyand, and A. N. Vallejo Tumor Necrosis Factor-{alpha} and CD80 Modulate CD28 Expression through a Similar Mechanism of T-cell Receptor-independent Inhibition of Transcription J. Biol. Chem., July 9, 2004; 279(28): 29130 - 29138. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Schonland, C. Lopez, T. Widmann, J. Zimmer, E. Bryl, J. J. Goronzy, and C. M. Weyand Premature telomeric loss in rheumatoid arthritis is genetically determined and involves both myeloid and lymphoid cell lineages PNAS, November 11, 2003; 100(23): 13471 - 13476. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Warrington, A. N. Vallejo, C. M. Weyand, and J. J. Goronzy CD28 loss in senescent CD4+ T cells: reversal by interleukin-12 stimulation Blood, May 1, 2003; 101(9): 3543 - 3549. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Vallejo, E. Bryl, K. Klarskov, S. Naylor, C. M. Weyand, and J. J. Goronzy Molecular Basis for the Loss of CD28 Expression in Senescent T Cells J. Biol. Chem., November 27, 2002; 277(49): 46940 - 46949. [Abstract] [Full Text] [PDF] |
||||