JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M005503200 on November 7, 2000

J. Biol. Chem., Vol. 276, Issue 4, 2565-2570, January 26, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/4/2565    most recent
M005503200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vallejo, A. N.
Right arrow Articles by Goronzy, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vallejo, A. N.
Right arrow Articles by Goronzy, J. J.

Functional Disruption of the CD28 Gene Transcriptional Initiator in Senescent T Cells*

Abbe N. VallejoDagger, Cornelia M. Weyand, and Jörg J. GoronzyDagger

From the Departments of Medicine and Immunology, Mayo Clinic and Foundation, Rochester, Minnesota 55905

Received for publication, June 22, 2000, and in revised form, November 6, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We recently reported that aging is accompanied by the emergence of CD4+CD28null T cells, a functionally aberrant lymphocyte subset rarely seen in individuals younger than 40 years. Here, we directly examined whether the lack of CD28 expression is due to a defect at the level of transcriptional initiation. Molecular studies reveal that CD28 gene transcription is controlled by two sequence motifs, sites alpha  and beta . In vitro transcription assays using initiator-dependent DNA templates revealed that reversed polarity or the deletion of either motif inhibited transcription, indicating that alpha /beta sequences constitute a composite initiator. Moreover, nuclear extracts from CD28null cells failed to activate transcription of alpha beta -initiator DNA templates. Transcription of such templates was, however, restored with the addition of extracts from CD28+ cells. Although previously described initiator elements have been defined by a consensus sequence, the alpha beta -initiator has no homology to such sequence. These studies demonstrate that initiators have functions other than positioning elements for the basal transcription complex. Rather, initiators can have a direct role in regulating the expression of specific genes. The gain or loss of initiator activity can be an important determinant of cell phenotypes.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The cellular and molecular processes underlying immune dysfunctions during normal aging are complex. The immune system undergoes a constant turnover of cells and is highly dependent on the replenishment of new precursor cells. However, de novo production of T cells rapidly declines with the progressive involution of the thymus with age (1, 2). Consequently, there is replicative stress resulting in the progressive shortening of telomeres of peripheral lymphocytes (3, 4). Replicative senescence is associated with altered patterns of gene expression (5). Among T cells, senescence is accompanied by a characteristic loss of CD28, predominantly among CD8+ T cells (6, 7) and to a lesser degree among CD4+ T cells (8). Interestingly, CD4+CD28null T cells have also been found in patients with chronic inflammatory syndromes, such as those seen in rheumatoid arthritis, Wegener's granulomatosis, and coronary artery disease (9-11). A CD28null phenotype is stable. Neither the triggering of the T cell receptor (TCR)1 nor signals generated by pharmacologic agents such as phorbol ester and calcium ionophore that bypass the TCR can restore CD28 expression (8, 12, 13).

Because CD28 is the dominant costimulatory molecule required for T cell activation, proliferation, and effector function (14), elucidation of the molecular basis for CD28 deficiency is of paramount interest. Inasmuch as CD28null T cells uniformly lack specific mRNA of all known splice variants (8, 12, 15), we evaluated the hypothesis that the loss of CD28 is due to a transcriptional block. In previous work, we reported that CD28 expression is controlled by two sequences, sites alpha  and beta , that are surprisingly situated immediately downstream from the TATA box (8). Nuclear proteins that specifically bind to sites alpha  and beta  are limited to lymphoid tissue, and their expression patterns are correlated with the presence or absence of CD28 on the surfaces of T and B cells (15). Moreover, random mutations in either site can sufficiently inactivate promoter activity in reporter gene bioassays (8). The functional relevance of these sequence motifs is further indicated by the modulation of alpha /beta -nuclear protein binding profiles by TCR triggering and during replicative senescence, two conditions that induce down-regulation of CD28 on the T cell surface (15).

Our finding that sites alpha  and beta  map downstream from the TATA box (8) suggests that the expression of CD28 might be controlled at the level of transcriptional initiation. Although the TATA box has been traditionally considered as the assembly site of the basal transcription complex, flanking initiator (INR) sequences have been found to be critical core promoter elements (16-19). In TATA-containing promoters, such INRs are thought to be positioning elements that tether TATA-binding protein, ensuring the fidelity of transcription from the TATA box (20). INR-binding proteins may also interact with TATA-binding protein-associated factors, resulting in improved efficiency of transcription, as has been demonstrated for immunoglobulin promoters (21, 22). Although the existence of distinct INR-binding proteins is not clear, several proteins have been implicated in the activity of INRs. These include general transcription factors such as transcription factor II-I (23, 24) and the components of transcription factor IID (25-27), or regulatory proteins such as YY1 (28) and USF (29, 30). In the present work, the role of sites alpha  and beta  as INRs was evaluated. Although these sequences have no homology with the consensus INR (18), sites alpha  and beta  coincide with the putative transcription start site (31).


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- T cell lines and clones were established from peripheral blood as described previously (8, 15, 32). Briefly, CD4+CD28null and CD4+CD28+ T cells were isolated from blood mononuclear cells by standard fluorescence-activated cell sorting procedures. Cells were stimulated with anti-CD3 (OKT3, ATCC, Manassas, VA) and gamma -irradiated autologous monocytes for 24 h. Subsequently, cells were subjected to limited dilution cloning in 96-well plates with feeder cells consisting of gamma -irradiated, neuraminidase-treated EBV-transformed B lymphoblastoid cells without additional stimulation. Clones were isolated, and phenotypes were ascertained by immunofluorescence staining and flow cytometry (see below).

Primary CD4+ T cell lines were derived from unfractionated blood mononuclear cells that were similarly stimulated with anti-CD3. After 24 h, CD4+ T cells were isolated by the immunodepletion of CD8+ cells using the VarioMacs system (Biotec Miltenyi, Auburn, CA). Purity of the isolated cells was verified by flow cytometry. Cells were cultured on EBV-transformed B cell feeders and 20 units/ml recombinant human interleukin 2 (Proleukin, Chiron, Emeryville, CA). Sublines of CD4+CD28+ and CD4+CD28null T cells were subsequently established by fluorescence-activated cell sorting. All lines and clones were maintained by weekly stimulation with EBV-transformed B cell feeders and recombinant human interleukin 2 in a humidified 7.5% CO2 incubator as described previously (8, 15).

The T cell lymphoma lines Jurkat and HUT78 (ATCC) were maintained at densities of about 5 × 106 cells/ml in RPMI 1640 medium supplemented with 10% fetal calf serum. HUT78 was cultured in the presence of 20 units/ml recombinant human interleukin 2. Cells were maintained in a humidified 5% CO2 incubator.

Phenotyping of Cells-- T cells were examined for cell surface expression of CD3, CD4, and CD28 by three-color immunofluorescence staining and flow cytometry. The lack of CD28 expression in T cell clones or lines was also verified by reverse transcription-polymerase chain reaction (reverse transcription-PCR) procedures for the splice variants of CD28 (12, 15).

Clonality of the T cell clones was established by standard nested reverse transcription-PCR for the BV-BJ segments of the TCR. PCR products were cloned into the TA vector and recombinants were used to transform One-ShotTM Escherichia coli (Invitrogen, Carlsbad, CA). Sequencing of plasmids prepared from at least three randomly selected bacterial colonies authenticated the clones.

Nuclear Extracts-- Nuclear extracts were prepared using a high salt extraction protocol described previously (8, 33). Extracts from the primary T cell lines and clones were prepared between 3 and 5 days after the last stimulation. Extracts from Jurkat and HUT78 cells were prepared during logarithmic growth. Protein concentrations of the extracts were determined by the Bradford method using a protein assay kit (Bio-Rad). Nuclear extracts were aliquoted, snap frozen in liquid nitrogen, and stored at -70 °C.

In Vitro Transcription Assay-- Sequences of the human CD28 gene sites alpha  and beta , CGTTATATCCTGTGTGAAATGCTGCAGTCAGGATGCCTTGTGGTTTGAGTGCCTTGAT (the underlined 5' and 3' sequences correspond to alpha  and beta , respectively) (8) were cloned into plasmid templates (provided by Dr. Jörg Kaufmann, Chiron Corp.) containing a 180-base pair G-less cassette downstream from a consensus TATA and the INR of terminal deoxynucleotidyl transferase (TdT) (34, 35). Sites alpha  and beta  were introduced into these plasmids as separate elements or as a contiguous unit replacing TdT-INR by the gene soeing technique (36). Templates containing a reversed orientation of alpha beta were also made. Constructs were amplified in E. coli DH5alpha (Life Technologies, Inc.) by standard transformation procedures and randomly selected bacterial colonies were screened for recombinant plasmids by PCR using primers specifically designed to detect the inserted alpha  and/or beta  sequence. Where PCR amplification of alpha beta was indicated, plasmids were prepared by a commercially available kit (EndoFree plasmid kit, Qiagen, Valencia, CA) and subjected to DNA sequencing of the entire the region spanning TATA, INR, and the G-less cassette. Two clones of each construct were selected for these studies.

Conditions of transcription reactions were as described previously (34) with the following modification. Nuclear extracts were subjected to centrifugation dialysis (Microcon YM3 Amicon filter, Millipore, Bedford, MA) against 10 volumes of reaction buffer, and the total protein concentration was determined as above. Nuclear extracts were added at the indicated amounts to 300 ng of plasmid template and incubated at 30 °C for 60 min. A mixture of 100 mM ATP, 100 mM CTP, and 50 µM [alpha -32P]UTP (Amersham Pharmacia Biotech) was added, the total reaction volume was adjusted to 100 µl, and the mixture was incubated for 90 min at 30 °C. Transcription products were digested with 60 units of RNase T1 (Roche Molecular Biochemicals), extracted with phenol-chloroform, size-fractionated on 8% polyacrylamide-6 M urea sequencing gels, and visualized by autoradiography.

Verification of alpha beta -Specific and TdT-INR Activating Proteins-- Nuclear extracts used in the in vitro transcription assays were tested for the presence of alpha - and beta -binding factors by gel shift assays by previously described procedures (8, 15). Centrifugation dialysis of extracts (see above) did not significantly affect the alpha /beta binding profiles of the extracts (data not shown). As in previous studies, CD28+ T cells consistently showed alpha - and beta -specific binding proteins. Additionally, competitive gel shift assays with alpha , beta , or TdT-INR sequences revealed exquisite specificity of binding activities among these 3 promoter motifs, as they did not cross-compete each other (data not shown). Other studies indicate similar distinctiveness of the binding activities of TdT-INR from those of other INR sequences (37).

Although the transcription factor that directly bind TdT-INR is not known, transcriptional activation of the TATA/TdT-INR template has been shown to be dependent on CIF150, a cofactor of transcription factor IID that appears to be ubiquitously expressed (35). Reverse transcription-PCR experiments for CIF150 expression in T cells used in the present study uniformly showed the presence of specific transcripts. Direct sequencing of PCR products (data not shown) authenticated these CIF150 transcripts.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Sites alpha  and beta  Constitute a Bona Fide INR Element-- We have shown previously that two sequence motifs, sites alpha  and beta , regulate the constitutive expression of CD28 (8). The peculiar topographic location of these sequences immediately flanking the TATA box suggested that they might directly interact with the basal transcription complex. To evaluate this hypothesis, we adapted an in vitro transcription system (35) that measures transcription of a DNA cassette controlled by a consensus TATA box and TdT-INR. As shown in Fig. 1, replacement of the TdT-INR element of the DNA template by the CD28 gene alpha beta sequence resulted in the production of cassette transcripts in the presence of nuclear extracts from Jurkat, a T cell lymphoma that expressed high levels of CD28 (15). The levels of alpha beta -dependent transcription increased with the amounts of nuclear extract added in a manner similar to those seen with templates containing the TdT-INR. Consistent with previous studies (34, 35), the mutated variant of the TdT-INR yielded levels of cassette transcripts that were consistently and significantly lower than that seen with wild-type TdT-INR. Presumably, the low amounts of transcripts seen with the mutant TdT-INR represented the basal level of transcription from the upstream canonical TATA box.



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 1.   Sites alpha  and beta  can initiate transcription from a heterologous TATA box. In vitro transcription assays were conducted with plasmid templates containing a 180-base pair G-less cassette under the control of a consensus TATA box and INR sequences (34, 35). The INR consisted of either the wild-type (WT) or the mutated variant (MT) of TdT-INR (16, 34, 46), or of CD28 sites alpha  and beta  sequences (CD28-alpha beta ) (8). Assays were conducted with increasing amounts of nuclear extracts from Jurkat T cells, which express high levels of CD28. Data shown are representative of three independent experiments.

Experiments were also carried out to examine whether sites alpha  and beta  can function independent of each other. As shown in Fig. 2, neither alpha  nor beta  alone elicited transcription at levels higher than the baseline seen with templates containing the TdT-INR mutant. As in the previous experiment, the composite alpha beta sequence elicited high levels of transcription in the presence of Jurkat nuclear extracts in a dose-dependent manner. The amounts of alpha beta -driven transcripts were equivalent to those seen with the wild-type TdT-INR.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2.   Sites alpha  and beta  initiate transcription as a functional unit. Transcription assays similar to those in Fig. 1 were conducted with TATA-INR constructs containing the CD28 alpha  and beta  motifs either as independent (alpha , beta ) or contiguous (alpha beta ) units. Assays were conducted with varying amounts of Jurkat nuclear extracts. Constructs containing the wild-type (WT) or mutated form (MT) of the TdT-INR were used as controls. Data shown are representative of three independent experiments.

In TATA-containing promoters, INRs are known to synergize with the TATA box, resulting in levels of transcription that are significantly higher than those seen with INR or TATA alone (38). This synergy is distinguished from a classical enhancer in that the latter induces transcription regardless of its orientation or distance from the basal complex assembled on the TATA box. Thus, we examined whether a reversed polarity, from alpha  right-arrow beta  to beta  right-arrow alpha , affects INR activity. As shown in Fig. 3, two independent clones of DNA templates containing the reversed beta  right-arrow alpha  sequence indeed yielded only low amounts of cassette transcripts. In these template constructs, the levels of transcription were equivalent to those produced by constructs containing the mutant TdT-INR.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Reversed polarity of alpha  and beta  abrogates INR activity. CD28 alpha beta sequences were cloned in the normal (alpha  right-arrow beta ) or reversed (beta  right-arrow alpha ) orientation into TATA-INR plasmid templates and used in transcription assays as in Fig. 1. Assays were conducted on two independent clones of each of putative alpha  right-arrow beta  and beta  right-arrow alpha  CD28-INR constructs with varying concentrations of Jurkat nuclear extracts. Constructs containing the wild-type (WT) or mutated form (MT) of the TdT-INR were used as controls.

alpha beta -INR in CD28null T Cells Is Nonfunctional-- In previous studies, alpha /beta -specific complexes were found to be uniformly lacking in CD4+CD28null T cells. Gel shift assays revealed that neither contiguous alpha beta (8) nor separate alpha  and beta  (15) probes showed protein binding activities with nuclear extracts from CD28null cells. Therefore, we examined whether this lack of DNA-protein complexes correlates with the absence of transcriptional activity. As shown in Fig. 4, in vitro transcription assays using nuclear extracts from various activated CD28+ T cells yielded cassette transcripts from DNA templates containing alpha beta as the INR element. The amounts of transcripts produced were equivalent to those seen with Jurkat nuclear extracts. In contrast, none of the nuclear extracts from CD28null T cells elicited transcription above basal levels. Extracts from CD28+ and CD28null T cells were, however, indistinguishable in their ability to promote transcription of templates containing the TdT-INR. As expected, templates with the mutated TdT-INR produced equivalent low/basal amounts of transcripts regardless of the CD28 phenotype of the extracts used.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4.   CD28null T cells lack the motif-specific transcription factors required for alpha beta -INR activity. Nuclear extracts from various T cell lines and clones that either express (+) or lack (-) CD28 were used in transcription assays with the TdT wild-type (WT) or mutant (MT) INR and alpha beta -INR constructs. All cell lines examined are CD4+ except for Jurkat, which lack CD4. Jurkat and HUT78 are T cell lymphoma lines. H28P and H28N are primary T cell lines sorted for CD28 expression. PL52, H4-49, K2, and H2 are T cell clones.

The lack of alpha beta -INR activity in CD28null T cells could be due to the absence of alpha beta -specific transcription factors or to the presence of an inhibitor of alpha beta -proteins. To address this issue, reconstitution experiments were conducted using nuclear extracts from Jurkat and HUT78 cells as prototypes of CD28+ and CD28null T cells, respectively. As shown in Fig. 5, transcription of two DNA templates containing the alpha beta -INR was at low/basal levels with HUT78 extracts. However, the addition of increasing amounts of Jurkat extracts effectively restored alpha beta -mediated transcription. The reconstitution of transcriptional activity was proportional to the amounts of Jurkat extracts added to the reaction. Such mixtures of Jurkat and HUT78 extracts did not alter the levels of transcription of templates containing TdT-INR.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5.   The lack of alpha beta -INR activity of nuclear extracts from CD28null T cells can be reconstituted by extracts from CD28+ cells. Transcription assays with the TdT wild-type (WT) or mutant (MT) INR and alpha beta -INR constructs were conducted with 5 µg of nuclear extracts from HUT78 cells (CD28null) titrated with increasing amounts (5, 20, and 50 µg) of similar extracts from Jurkat cells (CD28+). In control reactions (-), 10 µg of nuclear extracts from either Jurkat or HUT78 cells were used.

Reciprocal experiments were also conducted wherein HUT78 extracts were added in increasing amounts to a constant amount of Jurkat extracts. As shown in Fig. 6, the addition of HUT78 extracts did not affect alpha beta -driven transcription in Jurkat extracts. Transcription from TdT-INR templates were also unaffected by the titration of HUT78 extracts.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 6.   Nuclear extracts from CD28null cells do not inhibit the alpha beta -INR promoting activity of extracts from CD28+ cells. In experiments reciprocal to those shown in Fig. 5, transcription assays with the TdT wild-type (WT) or mutant (MT) INR and alpha beta -INR constructs were conducted with 5 µg of nuclear extracts from Jurkat cells (CD28+) titrated with increasing amounts (5, 20, and 50 µg) of similar extracts from HUT78 cells (CD28null). In control reactions (-), 10 µg of nuclear extracts from either Jurkat or HUT78 cells were used.

alpha beta -INR Activity Requires Coordinate Expression of Motif-specific Transcription Factors-- The observation that alpha beta -INR activity required alpha  and beta  sequences in tandem (Fig. 2) suggested that nuclear proteins binding to both motifs are essential to transcription. Although these alpha /beta -binding proteins remain to be identified, previous studies indicate that alpha - and beta -complexes are distinct from each other (8). Therefore, we examined the effect of depletion of either complex in the efficiency of transcription. As shown in Fig. 7, incubation of Jurkat nuclear extracts in oligonucleotides corresponding to either site alpha  or beta  resulted in the significant reduction of transcription of DNA templates containing the composite alpha beta sequences as INR. The levels of alpha beta -driven transcription were effectively reduced to basal levels at oligonucleotide concentrations of 300 fmol. Similarly, incubation of extracts in oligonucleotides containing both alpha  and beta  motifs also abrogated alpha beta -mediated transcription. As expected, none of the alpha /beta oligonucleotides affected transcription of templates containing the TdT-INR.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 7.   INR activity of alpha beta requires the coordinate binding of motif-specific proteins. About 5 µg of Jurkat nuclear extracts were incubated with varying concentrations (0, 40, 100, and 300 fmol) of double-stranded synthetic oligonucleotides (ds oligo) corresponding to site alpha  (A), site beta  (B), or both, (AB), respectively, prior to the transcription assays. Assays with the wild-type (WT) or mutated form (MT) of the TdT-INR were conducted with control extracts (-) or those previously incubated with 300 fmol of A, B, or AB oligonucleotides.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present work provides functional evidence for the direct role of sites alpha  and beta  in CD28 gene transcription. Because the assay system adapted in this study stringently gauges the induction of INR-driven transcription over the basal activity of a canonical TATA box (34, 35), the ability of alpha  and beta  to function as a core promoter element in a heterologous DNA template (Fig. 1) is impressive. Moreover, the lack of INR activity in similar templates with either sequence motif isolated from the other, as well as in templates with reversed polarity from an alpha  right-arrow beta  to a beta  right-arrow alpha  orientation (Figs. 2 and 3), provides compelling evidence that alpha  and beta  constitute a singular INR. Incidentally, the sequence stretch encompassing alpha /beta overlaps the previously described, albeit equivocated, transcriptional start site of the CD28 gene (31). The present data therefore authenticate this initiation site coinciding with alpha beta . Its peculiar location immediately flanking and downstream of the TATA box (8) lends further structural definition of alpha beta as an INR in a manner similar to other known INRs (25, 39, 40).

Although INRs serve as positional elements in TATA-containing promoters (20), they are the nucleation sites for the basal transcriptional complex in TATA-less promoters (41-44). This is exemplified by the expression of lymphoid-specific genes such as TdT, the CD4 antigen, and the TCR Vbeta chain, all of which lack a TATA box and utilize INR to initiate transcription (45-47). Interestingly, mutations in INRs have been associated with certain diseases. For example, the lack of beta -globin expression in some forms of beta -thalassemia has been associated with mutations in the INR of the gene (48). The use of such naturally occurring as well as synthetic mutants of beta -globin INR in transcription assays in vitro do in fact reveal down-regulation or complete inhibition of transcription (49), providing physiological evidence for a direct link between INR function and cell/tissue phenotype.

There are two curious features of the alpha beta -INR of CD28. The first is that alpha beta -INR is a much longer element (8) compared with the loosely defined consensus INR sequence Py-Py-A+1-N-T/A-Py-Py (18) with which it has no homology. Although there are indications that this approximate consensus might be conserved among eukaryotes (50, 51), there is an increasing body of evidence for INRs with divergent sequences. Among the evidence are the INRs of retinoic acid receptor beta 2 (37), mRNA cap-binding protein eIF4E (52), HIV-1 long terminal repeat (53), somatostatin receptor II (54), and vascular endothelial growth factor receptor (55). The second feature of alpha beta -INR is that sites alpha  and beta  are nonoverlapping binding sites of discrete protein complexes (8, 15). Although the binding of motif-specific transcription factors occurs independently, the cooperative interaction of alpha - and beta -bound proteins is required for transcriptional initiation. Indeed, the depletion of either alpha - or beta -binding proteins from nuclear extracts by decoy motif-specific oligonucleotides abolish alpha beta -INR activity (Fig. 7).

These peculiar properties of alpha beta -INR suggest that it may be a novel core promoter element. Interestingly, previous studies showed that alpha - and beta -binding factors are found only in lymphoid tissue (15) supporting the notion that alpha beta -INR might account for the restricted expression of CD28 to T cells and some transformed B cells. Although the INRs are primarily involved in enhancing nucleation of the basal transcription complex on the TATA box (20, 56), there is also evidence for their accessory role in regulating expression of specific genes. A classic example is the regulation of the Drosophila alcohol dehydrogenase gene (57, 58) in which the INR can discriminate between two tandem promoters that are used differentially at various stages of development. Cell-specific gene expression is also increasingly indicated to be INR-dependent. The lymphocyte specificity of TdT is INR-dependent (46). The presence of cell type-specific INR-binding proteins, albeit unidentified, have been implicated in the maximal activation of the human chorionic somatomammotropin promoter (59), the interferon-responsive promoters such those of Fcgamma receptor 1b (60), guanylate-binding protein, and H-2Ld (61), and the cell-specific induction of the beta 2 isoform of the retinoic acid receptor (37). Because of the divergent sequences of INRs of these latter genes and the alpha beta -INR from the consensus sequence, it is quite possible that cell type- or gene-specific INR-binding proteins profoundly influence the programs of gene expression. Thus, the identification of alpha beta -INR transcription factors is pivotal to understanding the restricted expression of CD28.

The present data also unequivocally demonstrate that a CD28null phenotype is related to the complete disruption of transcription. Because our assay system directly assessed the ability of alpha beta to initiate transcription of a heterologous DNA template, the finding that the nuclear extracts from CD4+CD28null T cells did not promote transcription of alpha beta -driven templates is a compelling evidence for functional disruption of INR activity in these cells (Fig. 4). Such transcriptional incompetence of the CD28null extracts could be restored by the addition of extracts from CD28+ cells (Fig. 5), indicating the absence of transcription factor complexes that specifically recognize alpha beta -INR. This interpretation is supported by two other observations. The first is that excess amounts of CD28null extracts do not perturb the transcriptional competency of extracts from CD28+ cells (Fig. 6), hence the exclusion for the role of alpha beta -specific repressors. The second is that efficiency of transcription of TdT-INR driven templates are equivalent for both extracts (Figs. 4-6). These findings corroborate previous data demonstrating the uniform and coordinate lack of alpha - and beta -bound complexes in CD4+CD28null T cells (8, 15). Whether or not the emergence of these unusual cells during normal aging (6-8) or in chronic inflammatory diseases (9-11) could be solely attributed to the down-regulation (or complete lack) of expression of a unique alpha beta -INR-binding protein(s) is not known at this time. Previous data, however, demonstrate that alpha /beta -binding proteins are seen only in lymphoid tissues and that their binding activities are modulated in conditions known to induce changes in the levels of cell surface expression of CD28 (15).

It is important to note that CD4+CD28null T cells, whether isolated from elderly individuals (8) or from patients with chronic inflammatory conditions (9, 11), are functionally active (62, 63) and not anergic as might be predicted from studies in the mouse (14). However, they have a perturbation in the pattern of expression of an array of molecules known to be important for lymphocyte function. For instance, CD4+CD28null T cells also lack expression of CD40 ligand, hence are unable to support B cell proliferation and differentiation (13). They are highly resistant to apoptosis (32, 64), which may explain their persistence in the circulation for years and their expansion up to 50% of the total CD4 compartment (8, 9). A key question then is whether reconstitution of CD28 alpha beta -INR function can restore CD28 expression and consequently reestablish normal T cell effector function. Thus, the biochemical dissection of alpha beta -INR activity is of significant interest.

In conclusion, data presented here show that CD28 deficiency in CD4+ T cells is due to a transcriptional block. Specifically, the alpha beta -INR element is nonfunctional because of a coordinate lack of alpha beta -specific transcription factors. This is unlike the well documented active repression of INR activity such as the INR-dependent, c-myc-mediated down-regulation of many genes (65-67). These studies collectively support the notion that INRs can have specific regulatory role in gene expression in addition to the nucleation of the basal transcription complex (20, 56). In a manner similar to enhancers, such a regulatory role of INRs profoundly influences cell phenotype and function.


    ACKNOWLEDGEMENTS

We thank Dr. Jörg Kaufmann (Chiron Corp.) for generously providing the TATA/TdT-INR constructs and Jim Fullbright for assistance in the preparation of the manuscript.


    FOOTNOTES

* This work was supported by the Mayo Foundation and National Institutes of Health Grants RO1-AG15043 and RO3-AR45830.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Mayo Clinic and Foundation, Rheumatology Research, 200 1st St. S.W., Rochester, MN 55905. Tel.: 507-284-1650; Fax: 507-284-5045; E-mail: vallejo.abbe@mayo.edu or goronzy.jorg{at}mayo.edu.

Published, JBC Papers in Press, November 7, 2000, DOI 10.1074/jbc.M005503200


    ABBREVIATIONS

The abbreviations used are: TCR, T cell receptor; INR, initiator; PCR, polymerase chain reaction; TdT, terminal deoxynucleotidyl transferase.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. George, A. J. T., and Ritter, M. A. (1996) Immunol. Today 17, 267-272
2. Douek, D. C., McFarland, R. D., Keiser, P. H., Gage, E. A., Massey, J. M., Haynes, B. F., Polis, M. A., Haase, A. T., Feinberg, M. B., Sullivan, J. L., Jamieson, B. D., Zack, J. A., Picker, L. A., and Koup, R. A. (1998) Nature 396, 690-695
3. Hodes, R. J. (1999) J. Exp. Med. 190, 153-156
4. Rufer, N., Brummendorf, T. H., Kolvraa, S., Bischoff, C., Christensen, K., Wadsworth, L., Schulzer, M., and Lansdorp, P. M. (1999) J. Exp. Med. 190, 157-167
5. Shelton, D. N., Chang, E., Whittier, P. S., Choi, D., and Funk, W. D. (1999) Curr. Biol. 9, 939-945
6. Posnett, D. N., Sinha, R., Kabak, S., and Russo, C. (1994) J. Exp. Med. 179, 609-618
7. Monteiro, J., Batliwalla, F., Ostrer, H., and Gregersen, P. K. (1996) J. Immunol. 156, 3587-3590
8. Vallejo, A. N., Nestel, A. R., Schirmer, M., Weyand, C. M., and Goronzy, J. J. (1998) J. Biol. Chem. 273, 8119-8129
9. Martens, P., Goronzy, J. J., Schaid, D., and Weyand, C. M. (1997) Arthritis Rheum. 40, 1106-1114
10. Moosig, F., Csernok, E., Wang, G., and Gross, W. L. (1998) Clin. Exp. Immunol. 114, 113-118
11. Liuzzo, G., Kopecky, S. L., Frye, R. L., O'Fallon, W. M., Maseri, A., Goronzy, J. J., and Weyand, C. M. (1999) Circulation 100, 2135-2139
12. Namekawa, T., Wagner, U. G., Goronzy, J. J., and Weyand, C. M. (1998) Arthritis Rheum. 41, 2108-2116
13. Weyand, C. M., Brandes, J. C., Schmidt, D., Fulbright, J. W., and Goronzy, J. J. (1998) Mech. Ageing Dev. 102, 131-147
14. Lenschow, D. J., Walunas, T L., and Bluestone, J. A. (1996) Annu. Rev. Immunol. 14, 233-258
15. Vallejo, A. N., Brandes, J. C., Weyand, C. M., and Goronzy, J. J. (1999) J. Immunol. 162, 6572-6579
16. Smale, S. T., and Baltimore, D. (1989) Cell 57, 103-113
17. Weis, L., and Reinberg, D. (1992) FASEB J. 6, 3300-3309
18. Javahery, R., Khachi, A., Lo, K., Zenzie-Gregory, B., and Smale, S. T. (1994) Mol. Cell. Biol. 14, 116-127
19. Lo, K., and Smale, S. T. (1996) Gene 182, 13-22
20. Novina, C. D., and Roy, A. L. (1996) Trends Genet. 12, 351-355
21. Buchanan, K. L., Smith, E. A., Dou, S., Corcoran, L. M., and Webb, C. F. (1997) J. Immunol. 159, 1247-1254
22. Pelletier, M. R., Hatada, E. N., Scholz, G., and Scheidereit, C. (1997) Nucleic Acids Res. 25, 3995-4003
23. Roy, A. L., Malik, S., Meisterernst, M., and Roeder, R. G. (1993) Nature 365, 355-359
24. Cheriyath, V., Novina, C. D., and Roy, A. L. (1998) Mol. Cell. Biol. 18, 4444-4454
25. Chen, H., and Flint, S. J. (1992) J. Biol. Chem. 267, 25457-25465
26. Kaufmann, J., and Smale, S. T. (1994) Genes Dev. 8, 821-829
27. Chalkley, G. E., and Verrijzer, C. P. (1999) EMBO J. 18, 4835-4845
28. Usheva, A., and Shenk, T. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 13571-13576
29. Du, H., Roy, A. L., and Roeder, R. G. (1993) EMBO J. 12, 501-511
30. Roy, A. L., Du, H., Gregor, P. D., Novina, C. D., Martinez, E., and Roeder, R. G. (1997) EMBO J. 16, 7091-7104
31. Lee, K. P., Taylor, C., Petryniak, B., Turka, L. A., June, C. H., and Thompson, C. B. (1990) J. Immunol. 145, 344-352
32. Schirmer, M., Vallejo, A. N., Weyand, C. M., and Goronzy, J. J. (1998) J. Immunol. 161, 1018-1025
33. Vallejo, A. N., and Pease, L. R. (1996) J. Biol. Chem. 271, 29813-29821
34. Kaufmann, J., Verrijzer, C. P., Shao, J., and Smale, S. T. (1996) Genes Dev. 10, 873-886
35. Kaufmann, J., Ahrens, K., Koop, R., Smale, S. T., and Müller, R. (1998) Mol. Cell. Biol. 18, 233-239
36. Vallejo, A. N., Pogulis, R. J., and Pease, L. R. (1994) PCR Methods Applications 4, S123-S130
37. Folkers, G. E., van der Burg, B., and van der Saag, P. T. (1998) J. Biol. Chem. 273, 32200-32212
38. Emani, K. H., Jain, A., and Smale, S. T. (1997) Genes Dev. 11, 3007-3019
39. Aso, T., Conaway, J. W., and Conaway, R. C. (1994) J. Biol. Chem. 269, 26575-26583
40. Jones, G., Manczak, M., Schelling, D., Turner, H., and Jones, D. (1998) Biochem. J. 335, 79-84
41. Zhou, Q., Liberman, P. M., Boeyer, T. G., and Berk, A. J. (1992) Genes Dev. 6, 1964-1974
42. Martinez, E., Chiang, C. M., Ge, H., and Roeder, R. G. (1994) EMBO J. 13, 3115-3126
43. Usheva, A., and Shenk, T. (1994) Cell 76, 1115-1121
44. Weis, L., and Reinberg, D. (1997) Mol. Cell. Biol. 17, 2973-2984
45. Duncan, D. D., Stupakoff, A., Hedrick, S. M., Marcu, K. B., and Siu, G. (1995) Mol. Cell. Biol. 15, 3179-3186
46. Garraway, I. P., Semple, K., and Smale, S. T. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4336-4341
47. Manzano-Winkler, B., Novina, C. D., and Roy, A. L. (1996) J. Biol. Chem. 271, 12076-12081
48. Wong, C., Dowling, C. E., Saiki, R. K., Higuchi, R. G., Erlich, H. A., and Kazazian, H. H. (1987) Nature 330, 384-386
49. Lewis, B. A., and Orkin, S. H. (1995) J. Biol. Chem. 270, 28139-28144
50. Kraus, R. J., Murray, E. E., Wiley, S. R., Zink, N. M., Loritz, K., Gelembiuk, G. W., and Mertz, J. E. (1996) Nucleic Acids Res. 24, 1531-1539
51. Liston, D. R., and Johnson, P. J. (1999) Mol. Cell. Biol. 19, 2380-2388
52. Johnston, K. A., Polymenis, M., Wang, S., Branda, J., and Schmidt, E. V. (1998) Mol. Cell. Biol. 10, 5621-5633
53. Montano, A., Kripke, M., Novina, C. D., Achacoso, P., Herzenberg, L. A., Roy, A. L., and Nolan, G. P. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12376-12381
54. Pscherer, A., Dorflinger, U., Kirfel, J., Gawlas, K., Ruschoff, J., Buettner, R., and Schule, R. (1996) EMBO J. 15, 6680-6690
55. Wu, Y., and Patterson, C. (1999) J. Biol. Chem. 274, 3207-3214
56. Roeder, R. G. (1996) Trends Biochem. Sci. 21, 325-335
57. Hansen, S. K., and Tjian, R. (1995) Cell 82, 565-575
58. Ren, B., and Maniatis, T. (1998) EMBO J. 17, 1076-1086
59. Jiang, S. W., Sheard, A. S., and Eberhardt, N. L. (1995) J. Biol. Chem. 270, 3683-3692
60. Eichbaum, Q. G., Iyer, R., Raveh, D. P., Mathieu, C., and Ezekowitz, R. A. (1994) J. Exp. Med. 179, 1985-1996
61. Wang, I. M., Blanco, J. C. G., Tsai, S. Y., Tsai, M. J., and Ozato, K. (1996) Mol. Cell. Biol. 16, 6313-6324
62. Park, W., Weyand, C. M., Schmidt, D., and Goronzy, J. J. (1997) Eur. J. Immunol. 27, 1082-1090
63. Vallejo, A. N., Mügge, L. O., Klimiuk, P. A., Weyand, C. M., and Goronzy, J. J. (2000) J. Immunol. 164, 2947-2954
64. Vallejo, A. N., Schirmer, M., Weyand, C. M., and Goronzy, J. J. (2000) J. Immunol. 165, 6301-6307
65. Li, L. H., Nerlov, C., Prendergast, G., MacGregor, D., and Ziff, E. B. (1994) EMBO J. 13, 4070-4079
66. Philipp, A., Schneider, S., Vasrik, I., Finke, K., Xiong, Y., Beach, D., Alitalo, K., and Eilers, M. (1994) Mol. Cell. Biol. 14, 4032-4043
67. Mai, S., and Martensson, L. L. (1995) Nucleic Acids. Res. 23, 1-9


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
J. Immunol.Home page
B. H. Lemster, J. J. Michel, D. T. Montag, J. J. Paat, S. A. Studenski, A. B. Newman, and A. N. Vallejo
Induction of CD56 and TCR-Independent Activation of T Cells with Aging
J. Immunol., February 1, 2008; 180(3): 1979 - 1990.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
J. J. GORONZY, G. HENEL, H. SAWAI, K. SINGH, E. B. LEE, S. PRYSHCHEP, and C. M. WEYAND
Costimulatory Pathways in Rheumatoid Synovitis and T-Cell Senescence
Ann. N.Y. Acad. Sci., December 1, 2005; 1062(1): 182 - 194.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xu, A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy
Distinct Transcriptional Control Mechanisms of Killer Immunoglobulin-like Receptors in Natural Killer (NK) and in T Cells
J. Biol. Chem., June 24, 2005; 280(25): 24277 - 24285.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
R. Gniadecki and A. Lukowsky
Monoclonal T-Cell Dyscrasia of Undetermined Significance Associated With Recalcitrant Erythroderma
Arch Dermatol, March 1, 2005; 141(3): 361 - 367.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
S. N. HAN, O. ADOLFSSON, C.-K. LEE, T. A. PROLLA, J. ORDOVAS, and S. N. MEYDANI
Vitamin E and Gene Expression in Immune Cells
Ann. N.Y. Acad. Sci., December 1, 2004; 1031(1): 96 - 101.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
Z. G. Nadareishvili, H. Li, V. Wright, D. Maric, S. Warach, J. M. Hallenbeck, J. Dambrosia, J. L. Barker, and A. E. Baird
Elevated pro-inflammatory CD4+CD28- lymphocytes and stroke recurrence and death
Neurology, October 26, 2004; 63(8): 1446 - 1451.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. M. M. van Leeuwen, E. B. M. Remmerswaal, M. T. M. Vossen, A. T. Rowshani, P. M. E. Wertheim-van Dillen, R. A. W. van Lier, and I. J. M. ten Berge
Emergence of a CD4+CD28- Granzyme B+, Cytomegalovirus-Specific T Cell Subset after Recovery of Primary Cytomegalovirus Infection
J. Immunol., August 1, 2004; 173(3): 1834 - 1841.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. E. Lewis, M. Merched-Sauvage, J. J. Goronzy, C. M. Weyand, and A. N. Vallejo
Tumor Necrosis Factor-{alpha} and CD80 Modulate CD28 Expression through a Similar Mechanism of T-cell Receptor-independent Inhibition of Transcription
J. Biol. Chem., July 9, 2004; 279(28): 29130 - 29138.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. O. Schonland, C. Lopez, T. Widmann, J. Zimmer, E. Bryl, J. J. Goronzy, and C. M. Weyand
Premature telomeric loss in rheumatoid arthritis is genetically determined and involves both myeloid and lymphoid cell lineages
PNAS, November 11, 2003; 100(23): 13471 - 13476.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. J. Warrington, A. N. Vallejo, C. M. Weyand, and J. J. Goronzy
CD28 loss in senescent CD4+ T cells: reversal by interleukin-12 stimulation
Blood, May 1, 2003; 101(9): 3543 - 3549.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Vallejo, E. Bryl, K. Klarskov, S. Naylor, C. M. Weyand, and J. J. Goronzy
Molecular Basis for the Loss of CD28 Expression in Senescent T Cells
J. Biol. Chem., November 27, 2002; 277(49): 46940 - 46949.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Snyder, L.-O. Muegge, C. Offord, W. M. O'Fallon, Z. Bajzer, C. M. Weyand, and J. J. Goronzy
Formation of the Killer Ig-Like Receptor Repertoire on CD4+CD28null T Cells
J. Immunol., April 15, 2002; 168(8): 3839