Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M101764200 on July 31, 2001

J. Biol. Chem., Vol. 276, Issue 43, 39522-39532, October 26, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
276/43/39522    most recent
M101764200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trickett, J. I.
Right arrow Articles by Pease, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trickett, J. I.
Right arrow Articles by Pease, R. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Characterization of the Rodent Genes for Arylacetamide Deacetylase, a Putative Microsomal Lipase, and Evidence for Transcriptional Regulation*,

Jeffrey I. TrickettDagger §, Dilip D. Patel||**, Brian L. Knight||**, E. David SaggersonDagger , Geoffrey F. Gibbons**Dagger Dagger , and Richard J. PeaseDagger §§

From the Dagger  Department of Biochemistry and Molecular Biology, University College London, Gower Street, London WC1E 6BT, || Lipoprotein Group, Medical Research Council Clinical Sciences Center, Hammersmith Hospital, Ducane Road, London W12 ONN, and Dagger Dagger  Metabolic Research Laboratory, Nuffield Department of Clinical Medicine, Radcliffe Infirmary, Woodstock Road, Oxford OX2 6HE, United Kingdom

Received for publication, February 26, 2001, and in revised form, July 19, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the current study, we have determined the cDNA and the genomic sequences of the arylacetamide deacetylase (AADA) gene in mice and rats. The AADA genes in the rat and mouse consist of five exons and have 2.4 kilobases of homologous promoter sequence upstream of the initiating ATG codon. AADA mRNA is expressed in hepatocytes, intestinal mucosal cells (probably enterocytes), the pancreas and also the adrenal gland. In mice, there is a diurnal rhythm in hepatic AADA mRNA concentration, with a maximum 10 h into the light (post-absorptive) phase. This diurnal regulation is attenuated in peroxisome proliferator-activated receptor alpha  knockout mice. Intestinal but not hepatic AADA mRNA was increased following oral administration of the fibrate, Wy-14,643. The homology of AADA with hormone-sensitive lipase and the tissue distribution of AADA are consistent with the view that AADA plays a role in promoting the mobilization of lipids from intracellular stores and in the liver for assembling VLDL. This hypothesis is supported by parallel changes in AADA gene expression in animals with insulin-deficient diabetes and following treatment with orotic acid.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

It is now clear that one or more lipases must play a role in the secretion of very low density lipoprotein triacylglycerol (VLDL-TAG)1 from the liver. A large proportion of the VLDL-TAG secreted is derived from the cytosolic TAG storage pool in hepatocytes (1). This pool enables short term storage of TAG in the immediate post-prandial period and its subsequent secretion as VLDL-TAG when the level of circulating chylomicrons falls. Thus the store may act as a buffer to prevent post-prandial hyperlipidemia (for review see Ref. 2). For VLDL assembly, the stored TAG undergoes intracellular lipolysis either to glycerol plus fatty acids (3) or to mono-plus diacylglycerol (4) followed by re-esterification to TAG (3, 4). In addition to the mobilization of stored TAG, there is also evidence that the lipids associated with nascent VLDL in the endoplasmic reticulum lumen undergo remodeling prior to secretion (5), and this may also involve the action of the same or of a distinct lipase. The identities of the relevant lipases have not been established. Lehner et al. (6-8) have proposed that both triglyceride hydrolase (TGH, an endoplasmic reticulum luminal carboxylesterase) and other lipases together play a role in the mobilization of stored lipid for secretion. Of particular interest, they have shown that TGH is not expressed during the suckling period of life and have suggested that this results in decreased VLDL secretion during this phase (7).

Arylacetamide deacetylase (AADA) is a 45-kDa esterase with an uncleaved amino-terminal signal anchor sequence. The enzyme was purified from human liver (9) and the human cDNA cloned by Probst et al. (10) during studies of carcinogen metabolism. Immunoblotting of human tissues led Probst et al. (10) to conclude that the enzyme is expressed in liver and small intestine but not in the bladder, which is particularly susceptible to arylamine induced carcinogenesis. The presumed active site domain of AADA shows considerable homology to that present in hormone-sensitive lipase (HSL), so that the enzyme has been classified as a lipase (10) (see Fig. 1). We have proposed that AADA, also, may function as a lipase during the process of lipoprotein secretion, and preliminary transfection evidence has supported the possibility that AADA promotes TAG secretion from hepatoma cells (2).

In the current study, we have determined the cDNA and the genomic sequences of the AADA gene in mice and rats. This has enabled the development of an RT-PCR assay and has indicated that transcription varies throughout the diurnal cycle in a manner consistent with its proposed role and also changes under certain regimes associated with altered hepatic lipid secretion.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Identification and Characterization of cDNA and Genomic Clones

Mouse AADA EST clone AA419661 was identified by homology with the published human cDNA sequence (10) and was obtained from the Medical Research Council Human Genome Mapping Project (Cambridge, UK). A mouse cDNA probe was obtained by PCR amplification of AA419661 with Taq polymerase of a 405-bp fragment using the forward oligonucleotide ATCTCTGTGGTCCTTGTA and reverse oligonucleotide GCCTCCATCATGAATGTAAAACA. The product was labeled with [32P]dCTP (Rediprime II, Amersham Pharmacia Biotech, Little Chalfont, UK), purified on a Sephadex G50 spin column (Amersham Pharmacia Biotech), and was then used to screen a rat liver lambda  triplex cDNA library (CLONTECH) plated at 25,000 plaques/dish. Positive plaques were identified by hybridization at medium stringency (3 sequential 0.4× SSC washes at 62 °C) to duplicate Hybond N filters (Amersham Pharmacia Biotech) and were purified by secondary and tertiary plating. To analyze the cDNA inserts, bacteriophage were converted to ampicillin resistance-conferring plasmids using the cre-lox excision sites present in lambda  triplex. Plasmid DNA was purified on anion exchange columns (Qiagen, Crawley, UK) and then sequenced using the ABI Prism (Applied Biosystems, Foster City, CA) Big Dye cycle sequencing kit, and the products were analyzed on an ABI model 377 automated sequencer.

5'-RACE was carried out using Marathon RACE-ready rat liver cDNA exactly as described by the manufacturers (CLONTECH). Total cDNA was PCR-amplified with the Advantage 2 polymerase mix using a primer to the 5' tag sequence and a gene-specific primer (CAGCACTCCCCAAACACCAGCCAC) derived from the cDNA sequence. Bands approximating the predicted size of the desired product were excised from the gel and reamplified using Taq DNA polymerase. Southern blotting confirmed the presence of AADA-related sequences among the reamplified products. The reamplified fragments were gel-purified and subcloned into T-vector (Promega, Southampton, UK), positive subclones were detected by colony hybridization, and the recombinant plasmids were sequenced.

Rat cDNA inserts and the mouse 405-bp PCR product (above) were next used to screen gridded filters representing mouse and rat PAC genomic libraries (constructed by Kazutoya Osoegawa and Pieter de Jong and supplied by the Medical Research Council Human Genome Mapping Project). Hybridizing clones were grown to an optical density of 0.15 units in 400 ml of 2× YT medium (bacto-tryptone 16 g/liter, bacto-yeast extract 10 g/liter, NaCl 5 g/liter) and induced with 0.15 mM isopropyl-1-thio-beta -D-galactopyranoside to promote P element replication. Plasmid DNA was purified on silica-based columns (Qiagen), and elution was performed at 65 °C to enhance recovery of large DNA molecules. The large insert size of the PAC clones (130-150 kb) precluded direct analysis, and therefore restriction fragments were shotgun subcloned into BamHI-, EcoRI-, or HindIII-digested and dephosphorylated pUC 18 (Amersham Pharmacia Biotech). Subclones containing AADA exonic sequences were identified by hybridization of 32P-labeled cDNA to denatured bacterial colonies immobilized on Hybond N filters. To obtain internal sequence within subclones, either high pressure liquid chromatography-purified gene specific oligonucleotides (Amersham Pharmacia Biotech) were used as primers, or deletions were made between suitably positioned internal restriction sites and polylinker sites; where necessary, blunt ends were generated with T4 DNA polymerase. The pUC subclones mH4 and mE1, which do not span exonic sequences, were obtained by screening with fragments of intronic sequence derived from the subclones mB1 (see Fig. 3) (following amplification with oligonucleotides GATTGGATTGGGTAGGCGCTG and AGTGCCTTTGAAACAGTG) and mH1 (following isolation of a 646-bp HindIII-EcoRI fragment).

Promoter Function

Sequences (2180, 1679, 941, and 66 bp) spanning the putative mouse promoter region and extending into the 5'UTR were PCR-amplified with Taq polymerase using the following forward gene-specific oligonucleotides: 5'-GCAGTAAGTGGTACCGTAGTTCT-3', 5'-GACTCTCATTTTCTTTCATAG-3', 5'-AGATCTAAATTCAACATCCAA-3', and a common reverse oligonucleotide, 5'-TAACCTGCCAAAAGCAGATCTAAGCTTAGG-3'. Products were isolated from agarose gels and subcloned into T-vector (Promega). Fragments were excised by digestion in each case at the introduced HindIII (underlined) site, together with either the introduced KpnI (underlined) site or the natural BamHI or SacI sites, and were transferred to suitably digested pGL3 basic vector (Promega). The recombinant plasmids (1 µg) were cotransfected with pSV-beta gal (0.5 µg, Promega) into subconfluent HepG2 cells (0.5 × 106/well) using the Lipofectin procedure as described by the manufacturer (Life Technologies, Inc.). Cells were harvested after 48 h and assayed for beta -galactosidase and luciferase activity as described previously (11).

Northern Blotting

For Northern blotting, total RNA was purified using a column binding protocol (RNeasy) as described by the manufacturer (Qiagen). Approximately 30 mg of rat male adult liver (Harlan Sprague-Dawley, 200 g), fetal liver (Harlan Sprague-Dawley, embryonic day 19), neonate liver (Harlan Sprague-Dawley, 14 days post-natal), or mouse liver (ex-breeder female C57/black 6) was ground to a fine powder with a mortar and pestle under liquid N2. RNA was also prepared from 2 × 107 HepG2 cells (a gift from Dr. Philippa Talmud, the Rayne Institute, University College London) cultured in Dulbecco's modified Eagle's medium containing Glutamax (Life Technologies, Inc.) supplemented with 10% fetal calf serum. Total RNA was eluted in a volume of 50 µl of RNase-free water. The integrity of the total RNA preparation was checked by electrophoresis of 5 µl of eluate (prestained with 10 ng of ethidium bromide) onto a 1% MOPS-formaldehyde-agarose gel (12) and visualization of the 28- and 18-S rRNA bands. Resolved RNA was transferred to Hybond N+ membranes (Amersham Pharmacia Biotech) by capillary transfer in 10× SSC (1.5 M NaCl, 0.15 M sodium citrate) and the membranes probed with 32P cDNA as described. Additionally, these blots were probed with a 203-nucleotide fragment of mouse triglyceride hydrolase (EST AA245304) amplified with the forward oligonucleotide AGTCCTGGGGAAGTACGTC and the reverse oligonucleotide ATCTTGGGAGCACATAGG or with a full-length human lysosomal lipase cDNA (13), a kind gift from Dr. Richard Anderson (Wake Forest University School of Medicine, Winston-Salem, NC) or with beta -actin cDNA (CLONTECH).

A human multiple tissue RNA dot blot and human multiple tissue Northern blots were obtained from CLONTECH and were probed initially with a human AADA full-length cDNA probe derived by ligating fragments from EST clones N76660, H71389, T83264, H71337, and H65969. Hybridization and washing conditions were exactly as described by the manufacturers. Subsequently the blots were stripped and reprobed with the HSL cDNA (14), a kind gift from Dr. Cecilia Holm (Lund University, Sweden) and beta -actin cDNA.

Quantitation of mRNA in Animal Tissues and in Isolated Cells

Animals-- Male Harlan Sprague-Dawley rats (220 g starting weight) were rendered diabetic by subcutaneous injection of streptozotocin (80 mg/kg body weight of a freshly prepared 80 mg/ml solution in 25 mM sodium citrate, 150 mM NaCl, pH 4.5). A control group was injected with citrate-buffered saline alone. Both groups were maintained on a standard laboratory chow diet ad libitum and additionally were given access to a 10% D-glucose solution overnight following injection to offset acute hypoglycemia. In some cases, diabetic animals were treated with 3 units of soluble insulin and 4 units of Zn2+ insulin complex 24 h before killing as described (15). Animals from the control and diabetic groups were killed after 7 days, and tissues were frozen immediately in liquid N2. Glycosuria (>10 mM) was verified in each of the diabetic animals but was excluded in the controls by withdrawal of urine from the bladder for a Clinistix test (Bayer PLC, Newbury, UK). The establishment of diabetes was also apparent from changes in body weight. An average 38 ± 3.44 g (S.E.) increase was apparent in the control animals, whereas a 28 ± 6.7 g (S.E.) decrease in body weight was observed in the treated animals.

In other experiments, male Harlan Sprague-Dawley rats were fed with fish oil, orotic acid, or fructose for 14 days essentially as described previously (16-18). Powdered low-fat laboratory chow (breeding diet no. 3, Special Diet Service, Witham, Essex, UK) was reconstituted after mixing either with 8 g/800 g of orotic acid (mixed as an aqueous solution) or with 18% (w/w) fish oil (Max EPA, containing 18% C20:5 and 12% C22:6 Seven Seas Ltd., Kingston-upon-Hull, UK). The modified diets were reformed into pellets and then dried with the appropriate antioxidants as described (16, 17). For fructose administration, 10% (w/v) fructose was present in the drinking water throughout (18).

The diurnal regulation of AADA transcription was investigated in male PPARalpha knockout mice bred onto a SV/129 genetic background and using wild type SV/129 mice as a control. Mice were maintained in temperature-controlled rooms (22-24 °C) on a 12 h-light/12-h dark cycle. Food (low-fat pellets as above) was available ad libitum. Mice were used between the ages of 14 and 20 weeks as described (19). Food consumption for both genotypes was similar between the groups and in each case was ~4-fold higher in the dark than the light phase (p < 0.001 in each case). The livers were removed, frozen, ground to a powder under liquid N2, and then used to prepare total RNA by the acid guanidinium thiocyanate method (20). In other experiments, control and PPARalpha knockout mice were fed ad libitum for 14 days on a diet reconstituted with Wy-14,643 (0.1%, Chemsin Laboratories, Lenexa, KS) (21). Animals were killed either at the midpoint of the dark (D6) or light (L6) phases.

Isolated Cells-- Adipocytes were obtained from rat epidydimal fat pads essentially as described (22) by digesting finely chopped pieces in Krebs-Ringer bicarbonate buffer (containing 20 mg/ml bovine serum albumin, 1 mg/ml collagenase (type II, 210 units/mg, Worthington), and 5 mM glucose) with vigorous shaking and aeration (O2/CO2 (95:5)) at 37 °C. Following filtration through nylon gauze, the cell mass was centrifuged for 20 s at low speed, and the floating adipocyte layer was aspirated and rewashed in fresh buffer plus albumin and glucose. Total RNA was prepared by the RNeasy protocol (Qiagen) from ~4 ml of packed adipocytes.

Intestinal cells enriched in enterocytes were obtained by immersing and flushing rat small intestine in ice-cold Krebs-Ringer bicarbonate solution, everting the intestine over a glass rod, and scraping the mucosal cells into plastic tubes precooled with liquid N2. Total RNA was prepared by the Qiagen protocol from ~30 mg of tissue. Samples of whole intestine tissue were also flash-frozen in liquid N2 and ground to a fine powder prior to isolation of total RNA. J774 cultured mouse macrophages were a kind gift from Dr. Lisa O'Rourke (Dept. of Biochemistry and Molecular Biology, University College London). Total RNA was prepared by the Qiagen protocol from ~5 × 107 cells.

RT-PCR-- AADA mRNA was assayed by reverse transcription (12) followed by real-time PCR using an ABI Prism sequence detection system (Applied Biosystems) essentially as described by the manufacturer. PCR oligonucleotides and dually modified probe oligonucleotides containing TAMRA (N'N'N'N'-tetramethyl-6-rhodamine) and either FAM (carboxyfluorescein) or VICTM were manufactured by PerkinElmer Life Sciences, and are shown in Table I.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Oligonucleotides used for RNA quantitation by RT-PCR

AADA mRNA assays were carried out in 30 µl of TaqMan Universal PCR master mix containing 300 nM of each primer and 200 nM probe under the standard conditions recommended by the manufacturers. Primers (67 nM) and probe (85 nM) for beta -actin were included in each sample to act as an internal standard to correct for assay variation. Amplifications of 18-S rRNA were carried out with the primers supplied as a standard kit by Applied Biosystems in triplicate reactions. All values were related to a curve generated by a standard liver preparation.

Nuclear Run-on Transcription-- Nuclei were prepared as described previously (23) from diabetic, orotic-acid treated, and diabetic rats treated with insulin (as above). Nuclear run-on was performed essentially as described (24, 25). 32P-Labeled RNA was hybridized to AADA or GAPDH cDNA that had been spotted onto Hybond N membranes. After extensive washing the spots were excised and the radioactivity assayed by scintillation counting.

Nucleotide and peptide alignments and searches were carried out using the programs Multalin (26), GCG (27),and BLAST (28).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

cDNA and Genomic Sequences-- Fig. 1 shows alignments of the predicted peptide sequences of human (10), rat, and mouse arylacetamide deacetylase. The rat cDNA sequence was determined by comparison of 21 independent cDNA clones derived from a liver cDNA library. The mouse peptide sequence was deduced from the sequences of the relevant EST clones (AI182380 and AI574013) and was subsequently confirmed by determining exonic sequences from the mouse gene (see below). The predicted rat and mouse sequences are each one amino acid residue shorter than the human sequence within the amino-terminal signal anchor domain. As previously described (10), homology is apparent with HSL particularly over a region spanning an upstream HGGG box characteristic of lipases and the active site motif, GXSXG. In addition, a further segment of homology between AADA and HSL includes an aspartic acid and histidine residue known to comprise the catalytic triad of HSL (29).


View larger version (78K):
[in this window]
[in a new window]
  		Fig. 1.   Alignment of the predicted amino acid sequences of rat (RA), human (HA), and mouse (MA) AADA. The presumed active site and an upstream His-Gly-Gly-Gly box, which is characteristic of lipases, are shown in bold. A partial alignment with two sequences of human HSL (HH residues 350-387 and 681-724) and mouse HSL (MH residues 349-386 and 682-725) is also shown (i) containing the His-Gly-Gly-Gly box and the active site Gly-X-Ser-X-Gly motif and (ii) containing the aspartic acid and histidine residues of HSL, which complete the catalytic triad (29).

Fig. 2A shows alignments of the 3' region of the AADA cDNAs. The 3'UTR of the available mouse EST clones is shorter than the human 3' region because of the presence of a polyadenylation signal 47 nucleotides from the termination codon. The rat 3'UTR of three independent rat clones was similar in length to the human 3'UTR. Although a cryptic polyadenylation signal was present in the rat sequence at a similar point to the polyadenylation signal in the mouse (underlined in Fig. 2A), the 3'UTR extended instead to a downstream polyadenylation signal. Preferential use of the second polyadenylation signal in the rat is apparent on Northern blots of mouse and rat liver RNA (Fig. 2B) in which the rat transcript appears ~300 bp longer. Sequencing of the cDNA clones did not allow us to define the extent of the 5'UTR in the rat nor were the available mouse EST clones fully informative. It was anticipated that the identification of potential promoter elements in the rat and mouse genomic sequences would clarify the situation.


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 2.   A, alignment of the 3' regions of the rat (RA) human (HA), and mouse (MA) AADA cDNA sequences. Termination codons and polyadenylation sequences are shown in bold and are underlined. A potential, but apparently unused, polyadenylation signal in the rat is also underlined. B, total RNA from adult rat liver (lane 1) and mouse liver (lane 2) was resolved on a 1% formaldehyde-agarose gel, and a blot was probed with a cDNA for mouse AADA. The mouse AADA cDNA recognizes bands of similar intensity in mouse and rat liver, although the rat transcript migrated more slowly than the mouse. Similar results were obtained when the blot was reprobed with the rat AADA cDNA (not shown). The apparent sizes of the rat and mouse transcripts are 1.8 and 1.5 kb, respectively, which correspond to the deduced cDNA lengths plus ~200 nucleotides of poly(A) tail (30).

The genomic sequencing strategy (Fig. 3) revealed that the rodent AADA gene comprises five exons with intron-exon boundaries that were clearly identifiable by consensus splice donor and acceptor sequences (Table II). The active site motif is encoded in exon 4. There was extensive homology between the rat and mouse sequences, which extended across both introns and exons (not shown). Additionally, a 6.4-kb retroposon (LINE1 element) had integrated into intron 2 of the mouse gene, whereas a partial retroposon sequence (1.1 kb) was present in intron 4 of the rat gene.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 3.   The genomic arrangements of the rat AADA gene (A) and the mouse AADA gene (B) were deduced from sequencing reactions (arrows) of subcloned restriction fragments: hind = HindIII; bam = BamHI; bgl = BglII; eco = EcoRI; pvu = PvuII; sac = SacI. Subclones were obtained by hybridization with cDNA probes except mE and mH4, which were obtained with genomic probes derived from subclones mB1 and mH1, respectively. Clone mB1 derived from a BglII digestion but had an atypical end (*), which did not correspond to a restriction site.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Organization of the AADA gene
The sequences at the intron (lower case)/exon (upper case) boundaries of the rat and mouse AADA genes are shown. The 5' splice sites resemble the consensus g(100%)-t(100%)-a(60%)-a(74%)-g(84%)-t(50%), and the 3' splice sites the consensus Pyd11-N-c(78%)-a(100%)-g(100%). NA, not applicable.

The 5' flanking regions of the rodent and human AADA genes were homologous and were 64% A + T-rich in the rat and mouse and 56% A + T-rich in the human for 2.4 kb upstream of the initiating ATG codon, at which point the sequences diverged into two distinct simple repeats (Fig. 4). Many but not all eukaryotic genes have a TATA box ~25 nucleotides upstream of the transcriptional start (30). A search of the TRANSFAC data base with the mouse and rat genomic sequences using the Matinspector program (31) led to the detection of a strongly predicted TATA box (32) (TATAAACAGAACA) ~500 nucleotides upstream of the translational start codon (Fig. 4). No TATA boxes were identified closer to the initiation codon. An alternative initiator sequence (Inr) is present in certain TATA-less genes, which causes initiation at an adenine nucleotide (A+1) through the sequence Pyd-Pyd-(A+1)-N-(T/A)-Pyd-Pyd (33). A single potential Inr sequence was detected at position -79 in the rat (shown in bold, Fig. 4), which was not present in the mouse or human. Certain genes, lacking either TATA boxes or Inr sites, have multiple transcriptional start sites, causing heterogeneous 5'-ends to be present on the transcripts (33). In the case of the AADA gene, the longest 5'UTR in rat clones obtained by lambda  triplex library screening was 50 nucleotides, with two additional groups of clones of about 25 nucleotides and some of about 6 nucleotides (Fig. 4).2 A similar distribution of 5'UTR sizes was apparent by analyzing 16 independent rat 5' clones obtained by RACE. The longest reported mouse EST clones have 5'UTRs of about 44 nucleotides with others of about 25 nucleotides. In contrast the human 5'UTR reported in Probst et al. (10) was 85 nucleotides. An EST search using the 5'UTR of human AADA revealed a clone (AV705031) with a similar sized 5'UTR to that of Probst et al. (10) and a longer clone (AV686493) that was 128 nucleotides in length. Human 5'UTRs of about 19 nucleotides were also found in two clones (AA377126 and AW951425). Although artifacts of cDNA cloning may contribute to the heterogeneity observed, the distribution of 5'UTR sequences may also indicate that transcription of the AADA gene begins at multiple start sites and that different sites of initiation predominate in the different species.


View larger version (68K):
[in this window]
[in a new window]
  		Fig. 4.   Nucleotide alignments of three selected regions of the 5' flanking sequences of the AADA gene. The human AADA gene sequence was derived from clone AC068647 (chromosome 3q) (65) from the total human genome data base. The initiating ATG codon is shown in bold as nucleotide (+1). Italicized bases (-2408 to -2369) show the point at which homology disappears at the start of simple repeat sequences in the mouse (MA), rat (RA), or human (HA). The first nucleotides of the 5'UTR sequences of independent cDNA clones are in bold and underlined. Where more than one clone starts on a particular nucleotide, the frequency is shown underneath the sequence. In the rat these represent either lambda  triplex clones or individual RACE clones. In the mouse and human, these are the available EST clones. Possible promoter elements were detected with the Matinspector program. The closest predicted TATA box (present in rat and mouse but not in human) is between nucleotides -515 and -503. A potential Inr sequence, which is present in the rat only, is shown in bold. A predicted glucocorticoid response element is present at nucleotide -1710 in the rat and mouse with a conserved COUP-TF/HNF 4 site 150 bases downstream. A similar motif (GRE in the opposite orientation followed by a COUP-TF/HNF 4 site) is also present in the human sequence at a downstream site. The human COUP-TF/HNF 4 site overlaps (TGA underlined) with a predicted aryl hydrocarbon response element (AHR); however, this element is not present in the rat or mouse.

The ability of the mouse promoter to drive luciferase expression was assessed following transfection of HepG2 cells. As shown in Fig. 5, pronounced promoter activity was observed with a construct spanning 1679 bp of the mouse promoter, with somewhat lower activity associated with the 2180 and 941-bp constructs. As expected no activity was associated with the 66-bp construct spanning the 5'UTR. Promoter activity was also observed with a rat construct similar to the mouse 941-bp construct (not shown).


View larger version (11K):
[in this window]
[in a new window]
  		Fig. 5.   AADA promoter activity in vitro. Human hepatoma cells, HepG2, were transfected with reporter constructs containing different sized fragments of the 5'-flanking region of the mouse (m) AADA gene cloned upstream of the luciferase gene in the pGL3 basic vector. The sizes of the fragments are given in bp. In the absence of a defined transcriptional start site, constructs extended to a common site within the AADA 5'UTR, 9 nucleotides upstream of the initiating ATG codon. Luciferase activity was corrected for transfection efficiency using co-transfected beta -galactosidase vector. Within each experiment luciferase values were expressed as a percentage of that observed with the 941-bp fragment. Results represent the means ± S.E. of four separate transfection experiments for each of the four constructs and for the promoterless vector. The m941 construct conferred significantly more activity than the pGL3 basic vector or m66 (p < 0.0001 in each case). The m1679 construct conferred significantly more activity than m2180 or m941 constructs (p < 0.02 in each case).

Sites of AADA Gene Expression-- To determine the tissues in which AADA is expressed, a human multiple tissue dot blot was probed. Strong signals were apparent in liver, fetal liver, and adrenal glands, with weak signals detected in other tissues including small intestine, stomach, kidney, and pancreas (Fig. 6A). Northern blotting confirmed that a hybridizing band of the same size as the predominant liver transcript was present in both the cortex and medulla of the adrenal gland (Fig. 6B). Reprobing the adrenal blot with the cDNA for HSL revealed a similar distribution of HSL mRNA between the cortex and the medullary fractions, suggesting that the medullary fraction did not contain exclusively chromaffin cells. Stomach and pancreas showed similar signals by dot blots, but Northern blotting could only confirm expression in the pancreas. AADA mRNA was not detected in total RNA fractions from HepG2 cells (Fig. 7A), which had previously been shown to be deficient in lipid mobilization (34). AADA mRNA could be detected in livers from both fetal and neonate (suckling) rats (Fig. 7B). This finding contrasts with the expression of TGH mRNA, which was absent in utero and expressed at very low levels in suckling animals (Fig. 7B), exactly in agreement with Lehner et al. (7).


View larger version (74K):
[in this window]
[in a new window]
  		Fig. 6.   A, a human RNA master blot (CLONTECH) representing 50 tissues (rows A-G) and 8 controls (row H) was probed with a human cDNA representing the complete coding sequence of human AADA. At the high stringency employed no cross-reaction was observed with yeast total RNA (H1), yeast tRNA (H2), Escherichia coli rRNA (H3), poly(rA) (H5), or cot1 DNA (H6). Weak reaction was observed with E. coli DNA (100 ng) (H4) and human DNA at 100 ng (H7) and 500 ng (H8). Evidence for strong AADA expression was found in adult liver (E2), adult adrenal gland (D5), and fetal liver (G4). 14 separate neural tissues (rows A and B) were negative for AADA expression. Expression was not detected in heart, aorta, skeletal muscle, colon, bladder, uterus, or prostate (row C, 1-7); in testis, ovary, pituitary, thyroid gland or salivary gland (row D, 1, 2, 4, 6, 7); in spleen, thymus, leukocytes, lymph node, or bone marrow (row E, 4-8); in appendix, trachea, placenta (row F, 1, 3, 4); or in fetal brain, heart, kidney, spleen, or thymus (row G, 1, 2, 3, 5, 6). A weak signal, comparable with controls in row H but above the background from negative tissues, was apparent in some tissues including stomach (C8), pancreas (D3), mammary gland (D8), kidney (E1), small intestine (E3), lung (F2), and fetal lung (G7). B, multiple tissue Northern blots representing human adult tissues were probed with human AADA cDNA. A band of the expected size was present in liver (track 1), adrenal cortex (track 6), adrenal medulla (track 8), and pancreas (track 9) but not in stomach (track 2), thymus (track 4), testis (track 5), or thyroid (track 7). A very weak signal at the limits of detection was present in the small intestine (track 3). HSL mRNA was detected in testis, adrenal medulla and cortex, and in pancreas. beta -Actin RNA was present in all samples examined.


View larger version (39K):
[in this window]
[in a new window]
  		Fig. 7.   A, mouse liver (lanes 1 and 3) and HepG2 cells (lanes 2 and 4) total RNAs were resolved on 1% formaldehyde-agarose gels, and blots were probed with the cDNA for lysosomal lipase (lanes 1 and 2) and human AADA (lanes 3 and 4). Both human cDNAs hybridized with their cognate mouse mRNA. AADA mRNA was absent from this and three other independent preparations of HepG2 RNA. B, total RNA from six pooled fetal livers (lane 1), adult rat liver (lane 4) and two separate neonate rat livers (lanes 2 and 3) was resolved on 1% formaldehyde agarose gels, and blots were probed with cDNA for mouse TGH and rat AADA. TGH was strongly expressed only in adults, whereas AADA mRNA was apparent at all stages. beta -Actin RNA was present in all samples examined.

An RT-PCR assay was developed using oligonucleotides to amplify the cDNA between exons 1 and 2. The length of intron 1 (3.8 kb in both the rat and mouse), coupled with DNase I treatment of the samples, ensured that genomic contamination did not compromise the analysis. Further use of exon 1 conferred specificity, because the signal anchor sequence to which the primer was designed is not present in other (currently known) lipase family members. For quantitation, RT-PCR was carried out under real-time conditions, but to confirm the fidelity of the PCR reactions it was also shown that amplification of liver RNA generated products of the expected size (~85 bp). Highly reproducible quantitation of AADA mRNA in nine adult rat livers was achieved from animals killed at a similar body weight and time of day (S.E. < 5.5% of mean value, data not shown). AADA mRNA levels in various tissues are shown relative to liver levels in Table III. Similar average levels of expression were observed in livers from 19-day fetal rats and from 14-day-old neonate rats, but in contrast to adult livers, mRNA levels in immature animals were somewhat variable. However, expression was apparent in all samples assayed by RT-PCR and in the Northern blot shown above. Low levels of AADA mRNA were detected by RT-PCR in two separate preparations of rat kidney (Table III) and also on Northern blots of rat kidney total RNA (data not shown). This finding agrees with previous reports that the protein was not detected in human kidney (10). It was also shown that AADA mRNA was not present at significant levels in rat epidydimal adipocytes. Some expression was detected in cultured J774 mouse macrophages (0.165 units relative to mouse liver = 1). Comparable levels of AADA mRNA to that in adult liver were detected in rat small intestine, and a small enrichment was apparent in scraped mucosal cells. The levels of AADA mRNA in small intestine are further confirmed by experiments on the mouse described below.

                              
View this table:
[in this window]
[in a new window]
 
Table III
Quantitation of AADA mRNA in rat tissues
AADA mRNA content is expressed relative to the concentrations in the reference livers. Replicate measurements on single samples did not disagree by more than 5% of the stated values. Levels of AADA mRNA in each sample were corrected for the content of 18-S rRNA determined in parallel PCR reactions rather than internally coamplified beta -actin mRNA, because this transcript is very high in the intestine.

Regulation of Hepatic Gene Expression in Vivo-- The expression of several genes, including various ones involved in fuel homeostasis, is under diurnal regulation in rodents. As shown in Fig. 8, AADA mRNA is also diurnally regulated in wild type mice, with steady state levels being maximal toward the end of the light phase (L10) in the post-absorptive period. Each mRNA assay point has been adjusted for the concentration of internally coamplified beta -actin mRNA (which does not undergo diurnal fluctuations), although the diurnal rhythm in AADA mRNA was also apparent in the nonadjusted data (not shown). The diurnal regulation of AADA mRNA was suppressed in PPARalpha knockout mice such that there were no statistically significant differences in AADA mRNA concentration at any of the time points examined. To test the hypothesis that the diurnal regulation of AADA mRNA might reflect direct activation of transcription by PPARalpha , control and PPARalpha knockout mice were treated with the PPARalpha ligand Wy-14,643, which has been shown to strongly induce acyl-CoA oxidase (21). Liver wet weight increased ~3-fold in the treated wild type animals, but there was no change in the liver weights of treated knockout mice. Hepatic acyl-CoA oxidase mRNA levels were increased at least 7-fold in the control animals when killed at the L6 point of the diurnal cycle but were not increased in the knockout animals (Table IV). However, there was no comparable increase in AADA mRNA levels in the livers of either the wild type or the knockout animals. In contrast, a 2-fold increase in AADA mRNA was apparent in the intestine of the wild type but not the knockout mice (Table IV). Similar results (not shown) were obtained at the D6 point in the cycle. Steady state hepatic AADA mRNA levels were also measured under conditions associated with altered VLDL-TAG secretion. Significant decreases in AADA mRNA steady state levels (corrected for 18-S rRNA) were apparent in both acutely diabetic and in orotic acid-treated rats (Table V), two conditions that markedly inhibit VLDL-TAG secretion (17, 35). AADA mRNA levels were not significantly altered by simple dietary manipulations such as fructose or fish oil feeding. To confirm that changes in steady state mRNA levels in diabetes and orotic acid treatment resulted from altered transcriptional rates, nuclear run-on assays were carried out. The rate of production of AADA transcripts normalized to GAPDH transcripts was decreased by 50% in diabetes and 70% following orotic acid treatment. Administration of insulin to diabetic animals reversed the effects of diabetes (Fig. 9).


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 8.   The diurnal variation in AADA mRNA measured by real-time RT-PCR in control mice (open circles) and in PPARalpha -deficient mice (filled circles) (n = 5, in each case). Each mRNA assay point has been adjusted for the concentration of a coamplified internal standard and is expressed relative to a standard mouse liver preparation. The diurnal maximum in AADA mRNA concentration occurs 10 h into the light phase (L10). There is a highly significant elevation in AADA mRNA at L10 in the control animals relative to both the control animals at D10 (p = 0.029) and the knockout animals at L10 (p = 0.002).

                              
View this table:
[in this window]
[in a new window]
 
Table IV
Effects of fibrates on hepatic and intestinal levels of AADA and acyl-CoA oxidase mRNA levels
AADA and acyl-CoA oxidase mRNA levels were determined by real-time PCR in the liver and small intestine of untreated (-) and Wy-14,643-treated (+) wild type (wt) or PPARalpha knockout (ko) mice, (n = 4 in each case). Mice were sacrificed at L6. Levels (mean and S.E.) are normalized to internally coamplified beta -actin mRNA content (to maximize accuracy) and are shown relative to a single reference wild type mouse liver or intestine as appropriate. Statistically significant changes in mRNA are shown. An essentially similar elevation in hepatic and intestinal acyl-CoA oxidase mRNA and intestinal AADA mRNA was observed in wild type animals sacrificed at D6 (data not shown, but p < 0.001 in each case and with other differences not significant). The concentration of AADA mRNA in the intestine relative to liver is much lower than in shown in Table III. This reflects normalization to beta -actin. Mouse intestinal AADA mRNA is expressed at comparable levels to mouse liver mRNA when normalized to 18-S rRNA (not shown).

                              
View this table:
[in this window]
[in a new window]
 
Table V
Steady state AADA mRNA levels in rats under regimes that alter VLDL-TAG secretion
Table V shows the mean and S.E. (n = 4) for AADA mRNA levels (corrected for 18-S rRNA content and relative to a standard rat liver preparation) in two separate groups of control animals and in animals treated as described under "Materials and Methods." OA, orotic acid.


View larger version (14K):
[in this window]
[in a new window]
  		Fig. 9.   Run-on assays of nascent nuclear AADA RNA transcripts. Rats were treated as indicated and nuclei prepared from the livers. Nuclei from two livers were pooled, lysed, and subjected to run-on assays as outlined under "Materials and Methods." Labeled transcripts were hybridized to membranes containing three spots of a full-length AADA cDNA probe (obtained during the present study) and three spots of a full-length GAPDH cDNA probe (kindly supplied by Dr. David Carling, Medical Research Council Clinical Sciences Center, London). After extensive washing, the spots were cut out and the radioactivity assayed. A blank (32.5 cpm), given by an unincubated sample, was subtracted from all values. The value for each spot with the AADA probe was divided by the mean of the three GAPDH spots for the same sample. Values with the GAPDH probe were ~120 cpm, and those with the AADA probe were as much as 200 cpm above background. Points represent the mean for the 3 AADA spots, with the S.E. to give an indication of the reproducibility of the assay. Results are given for two separate samples (each from two livers) for each condition, with the bars showing the averages.

Probst et al. (10) suggested that AADA is the predominant activity in liver capable of deacetylating 2-acetoaminofluorene (2-AAF). We therefore assayed 2-AAF deacetylation by microsomes (9) from control and treated animals to determine whether this mirrored the observed changes in AADA mRNA concentration. A 50% decrease in microsomal 2-AAF deacetylase was apparent in streptozotocin diabetes (38 ± 5.0 S.E., nmol h-1 mg-1 protein n = 3, p < 0.01) relative to control animals (77 ± 1.2 nmol h-1 mg-1), and the effect of diabetes was partially reversed by insulin administration (51 ± 4.2 nmol h-1 mg-1 p = 0.06). Orotic acid administration increased 2-AAF deacetylase activity (98 ± 8.6 nmol h-1 mg-1 p < 0.05) in contrast to its effect on AADA mRNA levels. However, in our hands,3 purification of microsomal 2-AAF deacetylases has shown that other esterases contribute significantly to total activity, and therefore the above values may not accurately reflect the behavior of AADA itself. In support of this view, hydrolysis by each of the microsome preparations of an alternative amide substrate for esterases (36) (proline beta -naphthylamide) paralleled their relative activities using 2-AAF (r = 0.846, p = 0.0005).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Abnormal regulation of hepatic VLDL secretion is a major cause of hyperlipidemia in humans (37). The enzymology involved in the incorporation of triacylglycerols into VLDL is complex. It is known that a significant proportion of the hepatic TAG secreted as VLDL undergoes a cycle of lipolysis and re-esterification prior to or during VLDL assembly (3, 4). However, neither the identity of the lipase(s) involved nor the intracellular location(s) of the lipolytic event have been established. The number of molecules of TAG lipolysed by isolated hepatocytes greatly exceeds that secreted as VLDL, the majority of re-esterified TAG being redeposited in the storage pool (a process termed recycling) (3). Under some conditions, changes in the rate of TAG lipolysis correlate with changes in the rate of VLDL-TAG secretion, suggesting that the lipase is subject to physiological regulation (16-18). Two candidates, TGH (6-8) and AADA (2), have been proposed as the physiological lipase. AADA was first described in studies of carcinogen metabolism (9, 10). In this respect it is interesting that a potential aryl hydrocarbon response element was detected in the promoter of the human gene (Fig. 4), which could cause the AADA gene to be induced in response to xenobiotics (38). However, similar elements were not detected in either the mouse or rat. Irrespective of any role it may play in xenobiotic metabolism, AADA also has properties that might be predicted for the TAG mobilization lipase. First, AADA is the only currently described mammalian protein that shows strong active site homology with HSL (10), the enzyme that mobilizes TAG and cholesterol ester stores in extrahepatic mammalian tissues (39, 40). Second, AADA has an unusual tyrosine-rich signal anchor sequence (similar to that of steroid 11 beta -hydroxylase (41)), which directs AADA to the endoplasmic reticulum, and which, judged by the high mannose content of the isolated enzyme (41), may cause it to be retained there. A lipase targeted to the endoplasmic reticulum would ensure efficient delivery of lipolytic products to diacylglycerol acyltransferase and prevent equilibration with other intracellular fatty acid pools (2). Third, AADA was found to show a limited tissue distribution but to be present in liver and small intestine, two tissues for which the major common function is lipoprotein secretion. Finally, deacetylation of the model substrate for AADA, 2-acetylaminofluorene (9), by partially purified protein fractions from detergent-solubilized rat liver microsomes is strongly inhibited by tetrahydrolipstatin,4 which is a specific inhibitor of lipases (42).

Hepatoma cells are deficient in lipid mobilization (34), and the present work indicates that they under-express AADA as was previously shown for TGH (8). Transfection of the cDNA for either AADA or TGH into hepatoma cells has resulted in a modest increase in lipid secretion (2, 7), although full restoration of lipid mobilization to levels comparable with primary hepatocytes has not so far been reported. Because hepatoma cells may also lack other factors required for efficient VLDL assembly, we have examined physiological regulation in animal models. The absence of a specific assay to determine AADA enzyme activity has meant that we have examined mRNA expression by real-time PCR. To this end, the rat and mouse genomic sequences were cloned. A 6-kb retroviral insertion was detected in intron 2 of the mouse. Although unusual, this need not impair gene function because in at least one other instance (a mouse annexin gene), a complete retroposon sequence is efficiently spliced out of an intron (43). The mouse and rat AADA genes reported here appear in all other respects to be functional because mutations have not accumulated in the coding sequences, the untranslated regions, or the splice sites. Although common core promoter elements could not be identified, transfection assays showed that the mouse promoter sequence acted efficiently in transfected hepatoma cells, with lower but clear activity associated with the rat promoter.

Tissue Distribution of AADA Gene Expression-- AADA gene expression is limited to a few tissue types. A high level of expression in adult liver was expected from the previous reports (9, 10). Lehner et al. (7) have suggested that any lipase which mobilizes hepatic TAG for VLDL assembly may be down-regulated in suckling rats. In particular, they showed that TGH is absent in utero and is only strongly induced as the animals reach the adult stage (7). Although we observe a similar pattern of TGH expression, it is clear from our results that AADA is expressed both in utero and during the suckling period. In fact, although circulating VLDL levels may be low in rats in utero, VLDL are nevertheless produced from day 21 of gestation and rise sharply over the first 5-10 days of suckling (44, 45). A similar induction of VLDL secretion occurs during the first week of suckling in humans (46). Moreover, isolated fetal rat hepatocytes are competent to secrete triacylglycerols at a significant rate (40% the rate of that in adult hepatocytes) if supplied with exogenous fatty acids (47). Assuming that a process of lipolysis and re-esterification is involved in VLDL secretion by fetal and immature animals, as in adults, this confirms the view of Lehner and Vance (8) that TGH cannot be the only lipase responsible for lipid mobilization in the liver and suggests that a perinatally expressed lipase such as AADA may also be involved.

In the current study AADA was also found to be strongly expressed in the adrenal cortex and in the medulla. However, because HSL was also detected in both fractions, the possibility of mixed tissue types cannot be excluded. Assuming that AADA is present within cortical tissues, it may contribute to the mobilization of cholesterol esters for glucocorticoid production. Although HSL has been presumed previously to mediate this process (39, 40), it may not be the only lipase involved, because transgenic mice deficient in HSL continue to produce glucocorticoids (48). The current results also suggest that AADA is expressed in the pancreas. Although the significance of this is unclear, it is notable that HSL is expressed in beta  cells and may play a role in regulating insulin secretion (49).

Immunoreactive AADA protein was previously detected in human small intestine (10), and in the current study it was shown by RT-PCR that AADA mRNA levels in rat small intestine were comparable with those in liver in from animals fed ad libitum. Immunoreactive protein was not detected in human colon (10), which might imply that the gene is expressed in the enterocytes of the small intestine rather than the smooth muscle common to both organs. The enrichment of AADA mRNA in mucosal cells relative to total small intestine observed here is also consistent with a localization to enterocytes. Lipolysis within enterocytes yields 2-monoacylglycerol, which is re-esterified to TAG prior to chylomicron secretion (50, 51). The poor detection of AADA mRNA in blots of human small intestinal poly(A) (+) RNA (Fig. 6) was surprising in view of the above. The precise circumstances of the human organ donor may have determined whether detectable amounts of mRNA were present in particular post-mortem samples of small intestine. Moreover, the normalization of the poly(A) (+) RNA to beta -actin mRNA content, which is high in the intestine, may have caused AADA mRNA to appear underrepresented.

In Vivo Regulation of AADA Gene Expression-- The expression of several genes involved in lipid metabolism in rodents and in man is regulated diurnally according to the pattern of food intake over the 24-h cycle. As shown in Fig. 8, AADA mRNA is also regulated diurnally in normal mice with a peak during the later part of the light phase, which corresponds to the post-absorptive period in rodents. Hepatic VLDL secretion shows an identical pattern in vivo (52-54). Although further work will be required to relate AADA mRNA levels to enzyme activity, diurnal regulation of AADA transcription in rodents is consistent with the view that AADA plays a role in the integration of hepatic fuel homeostasis.

The transcription of some genes related to the feeding cycle in rodents is dependent on the function of the peroxisomal proliferator-activated receptor alpha  (PPARalpha ) (55, 56). In certain instances (including apolipoproteins and enzymes of fatty acid oxidation), transcriptional control by PPARalpha is directly mediated by PPARalpha response elements (PPRE) located in the promoters of the genes and generally within 1000 nucleotides of the transcriptional start site (55, 56). In other instances transcriptional control by PPARalpha is indirect, as in the case of the genes encoding the lipogenic and cholesterogenic enzymes, acetyl-CoA carboxylase, fatty acid synthase, and 3-hydroxymethylglutaryl-CoA reductase. These genes exhibit diurnal rhythms of transcription with maximal mRNA levels in the dark period when feeding occurs, contributing to the circadian periodicity of fatty acid synthesis (57, 58) and cholesterogenesis (59). Although these genes lack PPRE in their promoters, their normal diurnal rhythms of transcription are markedly suppressed in mice deficient in the PPARalpha receptor (19, 60). The circadian rhythm of AADA expression is similarly attenuated in the livers of the PPARalpha knockout mice and may contribute to the disturbance of hepatic TAG metabolism (61, 62).

To determine whether the PPARalpha -dependent control of the AADA gene is direct or indirect, the PPARalpha ligand, Wy-14,643, was used. A 2-fold rise in intestinal AADA mRNA was observed following oral administration to the wild type mice. No increase in hepatic AADA mRNA was observed, whereas changes in expression of liver acyl-CoA oxidase (this study) and other hepatic genes5 were clearly demonstrable in the wild type animals. It would be reasonable to suppose that if the AADA gene had an associated PPRE it would be located in the 2.4-kb upstream region shown here to have promoter activity. However, only a few weak matches with authentic PPRE were detected within the mouse sequence, and no PPRE were identified in the rat sequence. A potential COUP-TF/HNF4 site was predicted in both rodent promoters, which may be capable of binding PPARalpha weakly under certain circumstances (63). The increase in intestinal AADA mRNA content apparent in wild type mice may have arisen from activation of the weak PPRE-like sequences in the mouse promoter by prolonged high gut concentrations of fibrate associated with the oral route. The absence of a similar effect in liver may reflect efficient competition for these sites by liver-specific factors such as HNF4. Irrespective of the cause of events in the gut, there is no evidence that hepatic AADA expression is sensitive to PPARalpha agonists. Thus, direct control through the PPARalpha pathway cannot account for the diurnal cycling observed in the liver.

Regulation of the diurnal cycling of acetyl-CoA carboxylase, fatty acid synthase, and 3-hydroxymethyl glutaryl-CoA reductase may involve sterol regulatory elements in their promoters (15, 19). The Matinspector program detected weak sterol regulatory element-like sequences in the AADA gene in each species, although no strong conserved sites were found. Of possible interest, a potential glucocorticoid response element was detected in both the rat and mouse promoters ~1.7 kb upstream of the translational start codon (Fig. 4). Diurnal variations in glucocorticoid concentrations (64) could be suggested to explain the cycling in AADA mRNA levels. However, because glucocorticoids are reported to be higher than PPARalpha in the hierarchy of diurnal regulation (64), this cannot account for the dependence of the AADA diurnal rhythm on PPARalpha expression. Moreover, in preliminary experiments, the addition of dexamethasone did not alter luciferase expression from the AADA promoter in transfected HepG2 cells. Therefore, at present there is no simple explanation for the diurnal regulation of the AADA gene.

It is not a straightforward matter to predict the changes in lipase levels that would be expected under all conditions of altered VLDL-TAG secretion. In addition to regulation of lipolysis, control may also be exerted over the proportion of mobilized fatty acids that are incorporated into VLDL-TAG as opposed to those recycled to the storage pool (3). This may prove to be the site of regulation in response to simple dietary manipulations, because the increased secretion of hepatic VLDL associated with fructose feeding (18) and the suppression with fish oil consumption (16) occurred with no apparent change in hepatic AADA mRNA content. In contrast, both dietary orotic acid and the establishment of insulin-deficient diabetes led to a severe decrease in the secretion of hepatic VLDL-TAG and were accompanied by 40% decreases in hepatic AADA mRNA content. Run-on assays indicated that the decreased steady state mRNA content could result from a decreased rate of transcription. In the case of diabetes the decreased transcription rate was reversible by administration of insulin, although insulin response elements were not predicted in the AADA promoters from any species. Orotic acid treatment is known to cause a 50% decrease in the fractional turnover of TAG in cultured hepatocytes (17). Thus, the decrease in AADA mRNA expression could account for the decrease in lipolysis following orotic acid treatment and in insulin-dependent diabetes, assuming that a comparable lowering of enzyme levels occurs. The ability to measure changes in AADA mRNA will allow us to assess the relative contributions of the two processes to the control of VLDL secretion.

    ACKNOWLEDGEMENTS

We are indebted to Dr. Jeffrey M. Peters and Dr. Frank J. Gonzalez (National Cancer Institute, National Institutes of Health, Bethesda, MD) for their kind gift of mating pairs of the PPARalpha knockout mice. We are grateful to Laura Winskill (Dept. of Biology, University College London) for excellent assistance with the automated sequencing and to Dr. Abdel-Malek Hebbachi for assistance with preparation of nuclei and microsomes.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The on-line version of this article (available at http://www.jbc.org) contains the complete promoter sequence in Fig. 4S.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF182426 (rat cDNA), AF264017 (rat genomic DNA), and AF306788 (mouse genomic DNA).

§ Supported by a British Heart Foundation research studentship.

Each of these authors made a similar contribution to this work.

** Supported by the Medical Research Council, UK.

§§ Supported by a British Heart Intermediate Research Fellowship and a Wellcome Trust project grant. To whom correspondence should be addressed. Tel.: 44-207-679-2185; Fax: 44-207-679-7193.

Published, JBC Papers in Press, July 31, 2001, DOI 10.1074/jbc.M101764200

2 The complete promoter sequence is available as Fig. 4S in the on-line version of this article (http://www.jbc.org).

3 N. Turner, E. D. Saggerson, and R. J. Pease, unpublished observations.

4 R. J. Pease and N. A. Turner, unpublished results.

5 D. D. Patel, B. L. Knight, and G. F. Gibbons, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: VLDL, very low density lipoprotein; TAG, triacylglycerol; TGH, triglyceride hydrolase; AADA, arylacetamide deacetylase; COUP-TF/HNF4, chicken ovalbumin upstream promoter transcription factor/hepatocyte nuclear factor 4; EST, expressed sequence tag; HSL, hormone-sensitive lipase; PAC, phagemid artificial chromosome; PPARalpha , peroxisome proliferator-activated receptor alpha ; PPRE, PPARalpha response element; RACE, rapid amplification of cDNA ends; PCR, polymerase chain reaction; RT-PCR, reverse transcription-PCR; bp, base pair(s); kb, kilobase pair(s); UTR, untranslated region; MOPS, 3-(N-morpholino)propanesulfonic acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 2-AAF, 2-acetoaminofluorene.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Duerden, J. M., and Gibbons, G. F. (1990) Biochem. J. 272, 583-587[Medline] [Order article via Infotrieve]
2. Gibbons, G. F., Islam, K., and Pease, R. J. (2000) Biochim. Biophys. Acta 1483, 37-57[Medline] [Order article via Infotrieve]
3. Wiggins, D., and Gibbons, G. F. (1992) Biochem. J. 284, 457-462
4. Yang, L. Y., Kuksis, A., Myher, J. J., and Steiner, G. (1995) J. Lipid Res. 36, 125-136[Abstract]
5. Yao, Z. M., and Vance, D. E. (1988) J. Biol. Chem. 263, 2998-3004[Abstract/Free Full Text]
6. Lehner, R., and Verger, R. (1997) Biochemistry 36, 1861-1868[CrossRef][Medline] [Order article via Infotrieve]
7. Lehner, R., Cui, Z., and Vance, D. E. (1999) Biochem. J. 338, 761-768
8. Lehner, R., and Vance, D. E. (1999) Biochem. J. 343, 1-10
9. Probst, M. R., Jeno, P., and Meyer, U. A. (1991) Biochem. Biophys. Res. Commun. 177, 453-459[CrossRef][Medline] [Order article via Infotrieve]
10. Probst, M. R., Beer, M., Beer, D., Jeno, P., Meyer, U. A., and Gasser, R. (1994) J. Biol. Chem. 269, 21650-21656[Abstract/Free Full Text]
11. Patel, D. D., Knight, B. L., Soutar, A. K., Gibbons, G. F., and Wade, D. P. (2000) Biochem. J. 351, 747-753
12. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1987) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
13. Anderson, R. A., and Sando, G. N. (1991) J. Biol. Chem. 266, 22479-22484[Abstract/Free Full Text]
14. Holm, C., Davis, R. C., Osterlund, T., Schotz, M. C., and Fredrikson, G. (1994) FEBS Lett. 344, 234-238[CrossRef][Medline] [Order article via Infotrieve]
15. Shimomura, I., Bashmakov, Y., Ikemoto, S., Horton, J. D., Brown, M. S., and Goldstein, J. L. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 13656-13661[Abstract/Free Full Text]
16. Baker, P. W., and Gibbons, G. F. (2000) J. Lipid Res. 41, 719-726[Abstract/Free Full Text]
17. Hebbachi, A. M., Seelaender, M. C., Baker, B. W., and Gibbons, G. F. (1997) Biochem. J. 325, 711-719
18. Wiggins, D., Hems, R., and Gibbons, G. F. (1995) Metabolism 44, 841-847[CrossRef][Medline] [Order article via Infotrieve]
19. Patel, D. D., Knight, B. L., Wiggins, D., Humphreys, S. M., and Gibbons, G. F. (2001) J. Lipid Res. 42, 328-337[Abstract/Free Full Text]
20. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
21. Rose, M. L., Germolec, D., Arteel, G. E., Schoonhoven, R., and Thurman, R. G. (1997) Chem. Res. Toxicol. 10, 1198-204[CrossRef][Medline] [Order article via Infotrieve]
22. Rodbell, M. (1964) J. Biol. Chem. 239, 375-380[Free Full Text]
23. Schibler, U., Hagenbuchle, O., Wellauer, P. K., and Pittet, A. C. (1983) Cell 33, 501-508[CrossRef][Medline] [Order article via Infotrieve]
24. Manjeshwar, S., Rao, P. M., Rajalakshmi, S., and Sarma, D. S. (1999) Mol. Carcinog. 24, 188-196[CrossRef][Medline] [Order article via Infotrieve]
25. Greenberg, M. E. (2001) in Current Protocols in Molecular Biology (Greenberg, M. E. , and Bender, T. P., eds) , pp. 4.10.1-4.10.11, John Wiley & Sons, Inc., New York
26. Corpet, F. (1988) Nucleic Acids Res. 16, 10881-90[Abstract/Free Full Text]
27. Womble, D. D. (2000) Methods Mol. Biol. 132, 3-22[Medline] [Order article via Infotrieve]
28. Tatusova, T. A., and Madden, T. L. (1999) FEMS Microbiol. Lett. 174, 247-250[CrossRef][Medline] [Order article via Infotrieve]
29. Contreras, J. A., Karlsson, M., Osterlund, T., Laurell, H., Svensson, A., and Holm, C. (1996) J. Biol. Chem. 271, 31426-31430[Abstract/Free Full Text]
30. Lewin, B. (2000) Genes , Vol. VII , pp. 617-648, Oxford University Press, Oxford, UK
31. Heinemeyer, T., Chen, X., Karas, H., Kel, A. E., Kel, O. V., Liebich, I., Meinhardt, T., Reuter, I., Schacherer, F., and Wingender, E. (1999) Nucleic Acids Res. 27, 318-322[Abstract/Free Full Text]
32. Bucher, P. (1990) J. Mol. Biol. 212, 563-578[CrossRef][Medline] [Order article via Infotrieve]
33. Smale, S. T. (1997) Biochim. Biophys. Acta 1351, 73-88[Medline] [Order article via Infotrieve]
34. Gibbons, G. F., Khurana, R., Odwell, A., and Seelaender, M. C. (1994) J. Lipid Res. 35, 1801-1808[Abstract]
35. Duerden, J. M., and Gibbons, G. F. (1993) Biochem. J. 294, 167-171
36. Matsushima, M., Inoue, H., Ichinose, M., Tsukada, S., Miki, K., Kurokawa, K., Takahashi, T., and Takahashi, K. (1991) FEBS Lett. 293, 37-41[CrossRef][Medline] [Order article via Infotrieve]
37. Havel, R. J. (1995) Curr. Opin. Lipidol. 6, 312-316[Medline] [Order article via Infotrieve]
38. Rowlands, J. C., and Gustafsson, J. A. (1997) Crit. Rev. Toxicol. 27, 109-134[Medline] [Order article via Infotrieve]
39. Holm, C., Belfrage, P., and Fredrikson, G. (1987) Biochem. Biophys. Res. Commun. 148, 99-105[CrossRef][Medline] [Order article via Infotrieve]
40. Kraemer, F. B., Tavangar, K., and Hoffman, A. R. (1991) J. Lipid Res. 32, 1303-1310[Abstract]
41. Ozols, J. (1998) Biochemistry 37, 10336-44[CrossRef][Medline] [Order article via Infotrieve]
42. Borgstrom, B. (1988) Biochim. Biophys. Acta 962, 308-316[Medline] [Order article via Infotrieve]
43. Rodriguez-Garcia, M. I., Morgan, R. O., Fernandez, M. R., Bances, P., and Fernandez, M. P. (1999) Biochem. J. 337, 125-131
44. Argiles, J., and Herrera, E. (1981) Biol. Neonate 39, 37-44[Medline] [Order article via Infotrieve]
45. Johansson, M. B. (1983) Biol. Neonate 44, 278-286[Medline] [Order article via Infotrieve]
46. Rosseneu, M., Van Biervliet, J. P., Bury, J., and Vinaimont, N. (1983) Pediatr. Res. 17, 788-794[Medline] [Order article via Infotrieve]
47. Coleman, R. A., Haynes, E. B., Sand, T. M., and Davis, R. A. (1988) J. Lipid Res. 29, 33-42[Abstract]
48. Osuga, J., Ishibashi, S., Oka, T., Yagyu, H., Tozawa, R., Fujimoto, A., Shionoiri, F., Yahagi, N., Kraemer, F. B., Tsutsumi, O., and Yamada, N. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 787-792[Abstract/Free Full Text]
49. Mulder, H., Holst, L. S., Svensson, H., Degerman, E., Sundler, F., Ahren, B., Rorsman, P., and Holm, C. (1999) Diabetes 48, 228-232[Abstract]
50. Yang, L. Y., and Kuksis, A. (1991) J. Lipid Res. 32, 1173-1186[Abstract]
51. Yang, L. Y., Kuksis, A., Myher, J. J., and Steiner, G. (1996) J. Lipid Res. 37, 262-274[Abstract]
52. Gibbons, G. F. (1990) Biochem. J. 268, 1-13[Medline] [Order article via Infotrieve]
53. Zammit, V. A. (1996) Biochem. J. 314, 1-14
54. Chirieac, D. V., Chirieac, L. R., Corsetti, J. P., Cianci, J., Sparks, C. E., and Sparks, J. D. (2000) Am. J. Physiol. 279, E1003-E1011[Abstract/Free Full Text]
55. Schoonjans, K., Staels, B., and Auwerx, J. (1996) J. Lipid Res. 37, 907-925[Abstract]
56. Fruchart, J. C., Duriez, P., and Staels, B. (1999) Curr. Opin. Lipidol. 10, 245-257[CrossRef][Medline] [Order article via Infotrieve]
57. Hems, D. A., Rath, E. A., and Verrinder, T. R. (1975) Biochem. J. 150, 167-173[Medline] [Order article via Infotrieve]
58. Fukuda, H., Katsurada, A., and Iritani, N. (1985) Biochim. Biophys. Acta 835, 163-168[Medline] [Order article via Infotrieve]
59. Brown, M. S., Goldstein, J. L., and Dietschy, J. M. (1979) J. Biol. Chem. 254, 5144-5149[Free Full Text]
60. Peters, J. M., Hennuyer, N., Staels, B., Fruchart, J. C., Fievet, C., Gonzalez, F. J., and Auwerx, J. (1997) J. Biol. Chem. 272, 27307-27312[Abstract/Free Full Text]
61. Kersten, S., Seydoux, J., Peters, J. M., Gonzalez, F. J., Desvergne, B., and Wahli, W. (1999) J. Clin. Invest. 103, 1489-1498[Medline] [Order article via Infotrieve]
62. Leone, T. C., Weinheimer, C. J., and Kelly, D. P. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 7473-7478[Abstract/Free Full Text]
63. Hertz, R., Bishara-Shieban, J., and Bar-Tana, J. (1995) J. Biol. Chem. 270, 13470-13475[Abstract/Free Full Text]
64. Lemberger, T., Staels, B., Saladin, R., Desvergne, B., Auwerx, J., and Wahli, W. (1994) J. Biol. Chem. 269, 24527-30[Abstract/Free Full Text]
65. Yamazaki, K., Kusano, K., Tadano, K., and Tanaka, I. (1997) Genomics 44, 248-250[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 IOVSHome page
T. Suzuki, F. Schirra, S. M. Richards, R. V. Jensen, and D. A. Sullivan
Estrogen and Progesterone Control of Gene Expression in the Mouse Meibomian Gland
Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1797 - 1808.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. M. Hebbachi, B. L. Knight, D. Wiggins, D. D. Patel, and G. F. Gibbons
Peroxisome Proliferator-activated Receptor {alpha} Deficiency Abolishes the Response of Lipogenic Gene Expression to Re-feeding: RESTORATION OF THE NORMAL RESPONSE BY ACTIVATION OF LIVER X RECEPTOR {alpha}
J. Biol. Chem., February 22, 2008; 283(8): 4866 - 4876.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
J. M. Brown, S. Chung, A. Das, G. S. Shelness, L. L. Rudel, and L. Yu
CGI-58 facilitates the mobilization of cytoplasmic triglyceride for lipoprotein secretion in hepatoma cells
J. Lipid Res., October 1, 2007; 48(10): 2295 - 2305.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
O. A. Gudbrandsen, T. H. Rost, and R. K. Berge
Causes and prevention of tamoxifen-induced accumulation of triacylglycerol in rat liver
J. Lipid Res., October 1, 2006; 47(10): 2223 - 2232.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
A. H. Lichtman, D. Leung, C. C. Shelton, A. Saghatelian, C. Hardouin, D. L. Boger, and B. F. Cravatt
Reversible Inhibitors of Fatty Acid Amide Hydrolase That Promote Analgesia: Evidence for an Unprecedented Combination of Potency and Selectivity
J. Pharmacol. Exp. Ther., November 1, 2004; 311(2): 441 - 448.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Frick, A. G. Atanasov, P. Arnold, J. Ozols, and A. Odermatt
Appropriate Function of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in the Endoplasmic Reticulum Lumen Is Dependent on Its N-terminal Region Sharing Similar Topological Determinants with 50-kDa Esterase
J. Biol. Chem., July 23, 2004; 279(30): 31131 - 31138.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
I. J. Waterman, N. T. Price, and V. A. Zammit
Distinct ontogenic patterns of overt and latent DGAT activities of rat liver microsomes
J. Lipid Res., September 1, 2002; 43(9): 1555 - 1562.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
276/43/39522    most recent
M101764200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trickett, J. I.
Right arrow Articles by Pease, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trickett, J. I.
Right arrow Articles by Pease, R. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement