HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 43, 39765-39771, October 26, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/43/39765    most recent M102502200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by LaFleur, D. W. Articles by Moore, P. A. Search for Related Content PubMed PubMed Citation Articles by LaFleur, D. W. Articles by Moore, P. A. Social Bookmarking                      What's this?

Interferon-, a Novel Type I Interferon Expressed in Human Keratinocytes^*

David W. LaFleur, Bernardetta Nardelli, Tatiana Tsareva, Don Mather, Ping Feng, Mark Semenuk, Kara Taylor, Markus Buergin, Diana Chinchilla, Viktor Roshke, Guoxian Chen, Steven M. Ruben, Paula M. Pitha, Timothy A. Coleman, and Paul A. Moore^§

From Human Genome Sciences, Rockville, Maryland 20850 and  Department of Oncology, The Johns Hopkins University, Baltimore, Maryland 21231

Received for publication, March 20, 2001, and in revised form, August 13, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

High throughput cDNA sequencing has led to the identification of interferon-, a novel subclass of type I interferon that displays ~30% homology to other family members. Interferon- consists of 207 amino acids, including a 27-amino acid signal peptide and a series of cysteines conserved in type I interferons. The gene encoding interferon- is located on the short arm of chromosome 9 adjacent to the type I interferon gene cluster and is selectively expressed in epidermal keratinocytes. Expression of interferon- is significantly enhanced in keratinocytes upon viral infection, upon exposure to double-stranded RNA, or upon treatment with either interferon- or interferon-. Administration of interferon- recombinant protein imparts cellular protection against viral infection in a species-specific manner. Interferon- activates the interferon-stimulated response element signaling pathway and a panel of genes similar to those regulated by other type I interferons including anti-viral mediators and transcriptional regulators. An antibody that neutralizes the type I interferon receptor completely blocks interferon- signaling, demonstrating that interferon- utilizes the same receptor as other type I interferons. Interferon- therefore defines a novel subclass of type I interferon that is expressed in keratinocytes and expands the repertoire of known proteins mediating host defense.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Interferons (IFNs)¹ are a family of functionally related cytokines that confer a range of cellular responses including antiviral, antiproliferative, antitumor, and immunomodulatory activities (1, 2). They are classified as type I or type II according to their structural and functional properties. Although the sole member of the type II family is IFN-, there are multiple members of the type I interferon class, which is divided into the IFN-, IFN-, and IFN- subclasses (1, 2). In humans, excluding psuedogenes, there are 13 non-allelic IFN- genes, a single  gene, and a single  gene. Members of the IFN- family display greater than 80% identity to each other, IFN- displays ~60% identity to IFN-, and IFN- is ~40% identical to the other family members. The evolutionary conservation of the type I IFN genes is reflected in their common intron-less structure and their co-localization to the short arm of chromosome 9, which suggest that type I IFNs arose by gene duplication (3). The subtypes were initially categorized further by their cell of origin. IFN- and IFN- genes were thought to be produced predominantly by leukocytes and IFN- by fibroblasts. However, upon appropriate induction, most human cell types can generate type I IFNs (2). Exposure to a variety of agents triggers the rapid and transient production of type I IFNs, with viruses being the most efficient natural inducers (4, 5). Certain bacteria can also induce expression, as can double-stranded RNA (dsRNA) and endotoxin. In contrast, trophoblast IFNs or IFN-, which are found only in ruminant ungulate species, are not induced by viral challenge (6). These genes are expressed by the embryonic trophoectoderm at a specific time during early pregnancy, and though they have the typical properties of other type I IFNs, their major function is to create conditions for the completion of pregnancy (6).

Despite the diversity in their sequence, all type I IFNs employ a common type I IFN receptor complex (IFNAR) that is composed of two chains, a 135-kDa subunit (IFNAR1) and a 115-kDa subunit (IFNAR2c) (7-9). IFN-induced receptor dimerization of the IFNAR1 and IFNAR2c chains initiates a signaling cascade that involves tyrosine phosphorylation of the Tyk2 and Jak1 tyrosine kinases and subsequent phosphorylation of the STAT1 and STAT2 proteins (10, 11). Association of the phosphorylated STAT proteins with the p48 DNA binding subunit forms the interferon stimulated gene factor 3 multisubunit complex, which translocates to the nucleus and binds to interferon-stimulated response elements (ISRE) found upstream of interferon-inducible genes. IFN signaling culminates in the modulation of a wide range of cellular responses including anti-viral activity, tumor anti-proliferation, enhancement of natural killer cell activity, and induction of major histocompatibility complex antigen expression (1, 2, 10, 11). The cellular activities of IFNs have attracted much interest for clinical applications, with IFNs now being used to treat a broad range of diseases including multiple sclerosis, leukemia, and hepatitis (2, 12). We report here the identification and characterization of a novel subclass of the type I IFN family that we have named IFN-, which is expressed in keratinocytes, signals through the type I receptor complex, and mediates anti-viral activity.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation of IFN- cDNA and Gene Sequence-- The Human Genome Sciences expressed sequence tag (EST) data base of ~3 million cDNA sequences derived from over 900 human cDNA libraries was screened for homologues of the interferon family using the BLAST algorithm. A single EST (HKAPI15) with significant type I interferon homology was identified and sequenced completely to reveal an open reading frame of 207 amino acids. The amino acid sequence has been deposited in GenBank^TM under accession number AF315688. The IFN- genomic region was generated in two steps. The genomic sequence that contains the IFN- coding region was PCR-amplified from human genomic DNA using oligonucleotide primers (CGTCCGGGATTTTTTAGCTTGCA and GTACATTTCAGATATATTTCA) that correspond to nucleotides 472-494 and 2232-2252 in Fig. 1. The upstream promoter region was isolated by long PCR amplification from a -EMBL3 human genomic library using a vector-specific primer (ATGCCCGAGAAGATGTTGAGC) and nested, IFN- cDNA-specific primers (GCAATGAATATACCCATAAGGAT and GGTGAACGTTCAGTAAGTTA) that correspond to nucleotides 546-568 and 590-609 in Fig. 1. The nucleotide sequence of the 2659-bp IFN- genomic region including promoter region and intron sequence has been deposited in GenBank^TM under accession number AF384048.

Expression Vectors-- The full-length IFN- open reading frame (Met¹-Lys²⁰⁷) was PCR-amplified using oligonucleotide primer sequences that tailed the amplicon with a 5' BamHI site, a consensus Kozak translation sequence (13), and a 3' Asp⁷¹⁸ restriction site. The amplicon was digested with BamHI/Asp⁷¹⁸ and subcloned into like-digested pC4, a proprietary mammalian expression vector derived from pSV2-neo (14), which contains a chimeric cytomegalovirus enhancer, the Rous sarcoma virus promoter, and the 3' intron, polyadenylation, and termination signals of the rat pre-proinsulin gene. The full-length IFNAR1 cDNA sequence was subcloned as a SalI/NotI fragment into pCMV-Sport2 (Invitrogen) whereas the IFNAR2c open reading frame was PCR-amplified, tailed with BglII and Asp⁷¹⁸ sites, and subcloned into BamHI/XbaI-digested pcDNA3 (Invitrogen). The original cDNA clone, HKAPI15, contains the full-length IFN- cDNA inserted between the SalI and NotI sites of pCMV-Sport2 (Invitrogen) and was used as template for the SP6-driven transcription coupled translation reticulocyte lysate system (Promega) according to the manufacturers recommendation.

Identification of the NH₂-terminal Cleavage Site-- Chinese hamster ovary cells were stably transfected with pC4:IFN- using LipofectAMINE (Invitrogen). Stable cell lines expressing IFN- mRNA as determined by Taqman analysis were expanded, and 100 ml of conditioned supernatant was collected. Secreted IFN- was captured by Porors HS-50 cation exchange chromatography at pH 6.0. IFN- was eluted using a salt gradient of 0 to 1.5 M sodium chloride. By SDS-polyacrylamide gel electrophoresis, a protein of molecular mass of ~30 kDa was observed for samples that eluted between 0.6 and 0.8 M NaCl. Several of these samples were trans-blotted to a polyvinylidene difluoride membrane, and the NH₂ terminus sequence was determined using an ABI-494 sequencer (Applied Biosystems).

Chromosomal Mapping-- A panel of 24 monochromosomal somatic cell hybrids was obtained from Quantum Biotechnologies, and the G3 panels of 83 radiation hybrids were obtained from Research Genetics. The following oligonucleotides, which span a 600-bp region of the IFN- coding region, were used for polymerase chain reaction analysis, CGTCCGGGATTTTTTAGCTTGCA (5' primer) and CTTCTGATTTCCACTCGGACA (3' primer). 35 cycles of polymerase chain reaction (94 °C for 30 s, 58 °C for 45 s, and 72 °C for 1 min) were performed on 100 ng of each hybrid in a 50-µl reaction. Analysis of the radiation hybrid data was performed using the Stanford Human Genome Center radiation hybrid server.

Keratinocyte Cultures-- Primary keratinocytes (Clonetics, San Diego, CA) were cultured in serum-free medium (KGM-2 medium; Clonetics). Second- or third-passage keratinocytes at 70-80% confluence were used in the experiments. Cells were treated with 100 µg/ml poly(I-C) (Sigma), 2500 units/ml of human IFN- (specific activity, 8.23 × 10⁷ units/mg; PBL Biomedical Laboratories, New Brunswick, NJ), and 500 units/ml of human IFN- (specific activity, 2 × 10⁷ units/mg; PeproTech, Rocky Hill, NJ) or infected with EMCV (2 × 10⁵ TCID₅₀/ml) for 1, 5, or 15 h. For RNA analysis, culture supernatants were aspirated, and keratinocytes were lysed with Trizol (Invitrogen). For ELISA measurements, the keratinocytes were cultured for 24 h in KGM-2 medium without hydrocortisone.

Northern Analysis-- 40 µg of total RNA isolated from keratinocytes was analyzed by Northern analysis. The cDNAs used for IFN- and IFN- probes correspond to amino acids Met¹-Lys²⁰⁷ and Met²²-Asn¹⁸⁷, respectively. Between probings, blots were stripped and exposed to film to ensure probe removal. Multiple-tissue Northern blots obtained from CLONTECH (Palo Alto, California), which were probed for IFN- expression, were as follows: human I, human IV, human endocrine system, human fetal, human cancer cell line, human brain I, and human brain IV.

Quantitative Reverse Transcriptase-PCR-- Total RNA (50 ng) was used in a one-step, 50-µl, quantitative reverse transcriptase-PCR. As a control for genomic contamination, parallel reactions were set up without reverse transcriptase. The abundance of specific mRNAs was measured relative to 18 S rRNA using the Applied Biosystems Prism 7700 sequence detection system. Reactions were carried out at 48 °C for 30 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Reactions were performed in triplicate. Using Primer Express software (PerkinElmer Life Sciences), primer and probe sets were designed to target the following human sequences, where the gene name is followed by the sequences of the two primers and then the probe: IFN- (GCCCCAAGAGTTTCTGCAATAC, GGCCTGTAGGGACATTTCATAGA, CAACCTATGAAGAGGGACATCAAGAAGGCC), MxA (GGATCTGCTGGAGGAAGGAAA, TGATGAGCTCGCTGGTAAGTTTT, CCACGGTTCCCTGCCTGGCAG), OAS (CTTTGATGCCCTGGGTCAGT, TCGGTGCACTCCTCGATGA, TGGCAGCTATAAACCTAACCCCCAAATCTATGTC) PKR (GCGATACATGAGCCCAGAACA, TCAGCAAGAATTAGCCCCAAA, TTCGCAAGACTATGGAAAGGAAGTGGACCTCTA), STAT1 (TCAATGTGGACCAGCTGAACAT, CGTCCACGGAATGAGACCAT, AAGCTTCTTGGTCCTAACGCCAGCCC), interferon regulatory factor 1 (AGAGAAGGTATCAGGGCTGGAAT, GAAGTCCAGCCGAGATGCTAA, CCACATGACTTCCTCTTGGCCTTGCT), 18 S (CGGCTACCACATCCAAGGAA, GCTGGAATTACCGCGGCT, TGCTGGCACCAGACTTGCCCTC). Probes were labeled at the 5'-end with the reporter dye 6-FAM and on the 3'-end with the quencher dye TAMRA (BIOSOURCE International, Camarillo, CA).

Purification of Recombinant IFN- Protein-- The mature IFN- coding region (Leu²⁸-Lys²⁰⁷) was chemically synthesized with codons optimized for expression in Escherichia coli by PCR amplification of overlapping oligonucleotides (15). The 546-bp nucleotide sequence of the codon-optimized IFN- coding region that encodes amino acids Leu²⁸-Lys²⁰⁷ and an initiating methionine has been deposited in GenBank^TM under accession number AF384047. The optimized IFN- gene was amplified by PCR using a 5' primer (GTCAGTCATATGTGCAACCTGCTGAACGTTC) and a 3' primer (GGTCATGGTACCTTATTATTTGCGACGGAACAGAG) that tailed the amplicon with NdeI and Asp⁷¹⁸ restriction sites. The resulting amplicon was restriction digested with NdeI and Asp⁷¹⁸, subcloned into like-digested pHE4, a bacterial expression vector (16), and expressed in the E. coli W3110 strain. Cells were grown to the mid-logarithmic growth phase, and after a 5 h induction in the presence of 0.1 mM IPTG, 1.5 liters of fermentation broth was harvested, and 15 g of cell paste was resuspended in 200 ml of 0.1 M NaPO4, 0.15 M NaCl, pH 7.4. The resuspended cell pellet was passed through a microfluidizer and centrifuged to obtain inclusion bodies, and IFN- was purified following a procedure described for IFN- (17) with some modifications. Inclusion bodies were washed with 0.1 M urea, 0.1 M NaPO4, 0.3 M NaCl, pH 7.4, solubilized in 20 ml of 1% SDS, 0.1 M NaPO₄, pH 7.4, and the solubilized pellet was extracted with 2 volumes of 2-butanol. The upper organic layer was diluted 5-fold in 0.1 M NaPO4, 0.1% SDS, pH 7.4, and glacial acetic acid was added until achieving a pH value of 5.0. The resulting precipitate was centrifuged, and the dried pellet was resuspended in 0.1 M NaPO₄, 0.05% SDS, pH 7.4. Reduced SDS-polyacrylamide gel electrophoresis analysis of the purified IFN- revealed the presence of a major band migrating at ~30 kDa, and NH₂-terminal amino acid sequencing confirmed identity to IFN-.

Anti-viral Assay-- Normal human dermal fibroblasts were seeded to an initial density of 2 × 10⁴ cells/well in Dulbecco's modified Eagle's medium/10% fetal bovine serum in flat bottom 96-well plates and were allowed to grow to 95% confluence. Serial dilutions of recombinant IFN- were added to the wells. Following 24 h of incubation, EMCV 2 × 10⁴ TCID₅₀ was added to each well. Following an additional 24 h incubation, the cell monolayers were washed twice with phosphate-buffered saline and stained with 1% crystal violet in 15% ethanol. Scoring of the plates was accomplished by extraction of stained cells with 70% ethanol/1% acetic acid, followed by absorbance determination at 580 nm in a 96-well format ELISA plate reader. Data are expressed as absorbance versus protein concentration.

ISRE Assay-- Five tandem copies of the ISRE element (TAGTTTCACTTTCCC), which mediates type I interferon-inducible expression of the interferon-inducible gene ISG54 (18) and a basal promoter containing a TATA box contained within the pISRE-Luc plasmid (catalog number 219089; Stratagene), was amplified by PCR using oligonucleotide primers with the following sequences: GCTAGCGGTACCAAGCTAGTTTCACTTTCCC and TGCAGTAAGCTTTACCGGAATGCCAAGCTGG. The resulting 161-bp amplicon was digested by Asp⁷¹⁸ and XhoI sites and sub-cloned into like-digested pSEAP2-Basic (catalog number 6049-1; CLONTECH). To facilitate selection of stable transfectants, the neomycin resistance gene cassette was introduced into pISRE-SEAP to generate pISRE-SEAP/neo. The pISRE-SEAP/neo reporter was transfected into human embryonic kidney 293F cells using LipofectAMINE (Life Technologies, Inc.), and neomycin-resistant transfectants were selected and screened for their responsiveness to human IFN- and IFN-. Cells demonstrating sensitivity were used for further study. Transfection of IFN genes and IFN receptor genes was performed by LipofectAMINE. SEAP assays were performed in 96-well microtiter plates following the manufacturer's recommendations (Roche Molecular Biochemicals) and counted in a Dynax luminometer. Interferon receptor-neutralizing antibody IFNaR1 (catalog number MMHAR-2; Research Diagnostics, Inc.) and control antibody M1 (catalog number F3040; Sigma) were also employed in this assay.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation and Structure of IFN- Gene-- BLAST analysis of a data base of over 3 million human EST sequences identified a single EST derived from a keratinocyte library displaying novel homology to the type I interferons. Complete sequence analysis of this 1.1-kb cDNA clone revealed an open reading frame of 207 amino acids with significant homology to the other subclasses of type I IFN and that we have named IFN-. Although the first in-frame methionine (Met¹) is designated as the initiating methionine, the possibility that the methionine at amino acid position 7 (Met⁷) is the initiating methionine cannot be ruled out. Neither the nucleotide context of Met¹ (AAAAAAAUGA) nor Met⁷ (CCUGAUAUGA) compare favorably with the "strong" consensus Kozak translational initiating sequence (GCCACCAUGG) (13). To confirm the sequence of the cDNA clone and to identify the genomic structure of IFN-, the IFN- gene was isolated and sequenced (Fig. 1). In addition to the gene-encoding sequences, ~0.5 kb of upstream sequence including the putative promoter sequence and 1 kb of downstream sequence were isolated. The genomic sequence confirmed the open reading frame sequence identified in the cDNA sequence and also revealed the presence of an intron within the 3' untranslated region immediately following the stop codon (Fig. 1). The presence of an intron in type I IFN genes has not been reported previously (1, 2). Inspection of the promoter region revealed the presence of a putative TATA element and within 200 bp of the transcriptional start site, three GAAANN elements (Fig. 1). GAAANN elements have been demonstrated to mediate the virus inducibility of the IFN- and IFN- genes through the binding of members of the interferon regulatory factor family (19).

View larger version (91K): [in this window] [in a new window]   Fig. 1.   Interferon- gene analysis. A 2659-nucleotide genomic fragment incorporating the nucleotide sequence of the IFN- gene is shown (accession number AF384048). The IFN- cDNA sequence (nucleotides 478-1125 and 2169-2659) and the 207-amino acid IFN- open reading frame are depicted in uppercase. A putative TATA box (nucleotides 426-430) and polyadenylation signal (nucleotides 2631-2636) are boxed and in bold. The splice donor and acceptor sites that span the intron sequence (nucleotides 1126-2168) are boxed. Three putative GAAANN elements that have been demonstrated to mediate the viral inducibility of other interferon genes (19) are underlined.

Comparison of the IFN- protein sequence with the three existing subgroups of human type I IFNs (Fig. 2A) reveals homology throughout the coding region, including within the five -helical regions defined in other type IFNs (20-22). Like other IFNs, IFN- is predicted to be secreted based on PSORT and SignalP algorithm analysis (23) with cleavage anticipated to be between amino acids Ser²⁷ and Leu²⁸. In vitro transcription and translation of the IFN- cDNA revealed a protein that migrates at ~30 kDa (Fig. 2B), somewhat larger than the anticipated molecular mass of 25.2 kDa. In the presence of microsomal membranes the IFN- protein is processed to remove its NH₂-terminal signal peptide (Fig. 2B). To confirm that IFN- is secreted from mammalian cells, the full-length IFN- open reading frame was expressed in Chinese hamster ovary cells. Conditioned supernatant collected from IFN--expressing Chinese hamster ovary cell lines was subjected to ion exchange chromatography, and a protein of the anticipated molecular mass for IFN- was isolated. Amino acid sequencing of the captured protein revealed identity to IFN- and an NH₂ terminus of LDCNL, therefore confirming that IFN- is secreted and that cleavage occurs between Ser²⁷ and Leu²⁸. Although it appears that IFN- utilizes a signal peptide relatively longer than other type I IFNs (Fig. 2A), as discussed above, it cannot be ruled out that Met⁷ is the start methionine resulting in a signal peptide closer in length to that of the other type I interferon family members.

View larger version (40K): [in this window] [in a new window]   Fig. 2.   Interferon- cDNA isolation and open reading frame analysis. A, the amino acid sequence of interferon- is aligned by ClustalW with the sequences of human IFN 2, IFN-, and IFN-. Dark shaded boxes indicate residues that are identical to IFN- whereas light shaded boxes indicate amino acids conserved in relation to IFN-. Signal cleavage occurs between Ser27 and Leu28 (arrow). Sequences overlaid with lines represent the -helices corresponding to human IFN- (21). B, in vitro transcription translation was performed with the SP6 TNT coupled reticulocyte lysate system (Promega) using the complete isolated IFN- cDNA as template in the absence (-) or presence (+) of canine microsomal membranes (CMM), and the 35S-labeled proteins were resolved by polyacrylamide gel electrophoresis. Protein molecular size markers (in kilodaltons) are indicated at the left of the blot. C, percentage identity between interferon type I family members was performed using mature protein sequences.

Within the 180-amino acid mature protein (Leu²⁸-Lys²⁰⁷), IFN- demonstrates 30-32% identity to the other type I IFNs (Fig. 2C) and thus defines a novel subclass of type I IFN. Perhaps the most significant structural difference between IFN- and the other type I IFNs is the length of the CD loop region where IFN- has an insertion of 12 amino acids (Fig. 2A). This also accounts for the larger size of mature IFN- (180 amino acids) compared with the IFN- (165-166 amino acids), IFN- (166 amino acids), and IFN- (172 amino acids) subclasses. The mature protein contains five cysteines, and on the basis of homology and modeling to other IFNs it is expected that Cys³ forms a disulfide bond with Cys¹⁰², whereas Cys³² forms a disulfide bond with Cys¹⁵⁵, leaving Cys¹⁶⁷ as an unpaired cysteine. Unlike human IFN- and IFN-, but in common with most type I IFN- species (22, 24), IFN- does not contain a consensus sequence for N-linked glycosylation.

To determine the chromosomal position of the IFN- gene, a panel of monochromosomal somatic cell hybrids retaining individual chromosomes was screened using IFN--specific primers. A PCR product was detected in chromosome 9, whereas no amplification was observed in any other sample (Fig. 3). To sublocalize IFN- on chromosome 9, a panel of 83 radiation hybrids was used. We observed amplicons in hybrids 13, 15, 25, 28, 35, 40, 48, 66, and 74. Analysis of this data using the Stanford Human Genome Center radiation hybrid server revealed linkage to the SHGC-36542 marker on chromosome 9, which lies between markers D9S161 and D9S1853 on the physical map of chromosome 9. Superposition of this position with the cytogenetic map of human chromosome 9 allowed the assignment of IFN- to chromosomal band 9p21.2. Analysis of the recently deposited human genome sequence confirmed the map position of IFN- to this region on chromosome 9. It has been demonstrated previously that the IFN-, IFN-, and IFN- genes are closely linked within 400 kb in the 9p21-p22 region (3). Based on the radiation hybrid mapping and genomic sequence information, IFN- is located ~6.5 megabases proximal to the centromere relative to the existing type I IFN cluster.

View larger version (47K): [in this window] [in a new window]   Fig. 3.   IFN- chromosomal location. PCR was performed on a panel of human/hamster monochromosomal hybrids (Quantum Biotechnologies) according to manufacturer's recommendations, and the amplicons were resolved by gel electrophoresis. The human chromosomes (1-22, X, Y) are depicted at the top of each well. PCR analysis of Human (Hu), Mouse (Mo), and Hamster (Ha) genomic DNA are also shown together with a DNA size ladder (S).

IFN- Is Expressed in Keratinocytes and Induced by dsRNA, Viral Infection, and by Other IFNs-- Analysis of the Human Genome Sciences data base, which comprises sequences derived from ~900 independent human cDNA libraries generated from both normal and disease tissue and cell types, revealed expression of IFN- only in keratinocytes suggesting that IFN- exhibits a restricted pattern of expression. No detectable expression of IFN- was observed in an analysis of a panel of Northern blots containing RNA from a wide range of human cell and tissue types including brain, kidney, spleen, liver, tonsil, heart, small intestine, colon, placenta, and testis. Real-time Taqman PCR performed on a range of purified cell populations including T and B lymphocytes, monocytes, dendritic cells, endothelial cells, fibroblasts, and keratinocytes confirmed expression of IFN- in keratinocytes and revealed a lower level of expression in dendritic cells and monocytes but failed to detect significant expression elsewhere (data not shown).

Northern analysis performed on adult keratinocytes confirmed the expression of a 1.1-kilobase IFN- mRNA transcript (Fig. 4A). Expression of the IFN- mRNA was observed in multiple independent adult keratinocyte donor populations and also in neonatal keratinocytes (data not shown). In contrast to IFN- expression, IFN- mRNA was undetectable in resting keratinocytes (Fig. 4A). Treatment of keratinocytes with dsRNA, a known inducer of IFN expression, resulted in the expected increase in IFN- expression and also an up-regulation of IFN- mRNA expression (Fig. 4A).

View larger version (18K): [in this window] [in a new window]   Fig. 4.   IFN- mRNA expression profile. A, Northern analysis of IFN- and IFN- mRNA expression in untreated and dsRNA-treated keratinocytes. Equal loading of RNA was verified by 18 S rRNA analysis. B, Taqman real-time PCR analysis of IFN- mRNA expression in EMCV-infected keratinocytes. Levels of IFN- mRNA are expressed relative to the level observed in uninfected keratinocytes. C, Taqman real-time PCR analysis of IFN- mRNA expression in cytokine-treated keratinocytes. Keratinocytes either untreated or treated with IFN- or IFN- for 1, 5, 15, and 30 h were harvested and processed as described under "Experimental Procedures." The level of IFN- mRNA in each sample was determined by Taqman real-time PCR and is expressed relative to the 18 S rRNA level (× 106).

To determine whether keratinocytes express detectable levels of IFN- protein, an ELISA was developed for IFN-. The specificity of the ELISA was demonstrated by an inability of the ELISA or the component polyclonal or monoclonal IFN- antibodies to cross-react with either recombinant IFN- or IFN-. Supernatants collected from three donor populations of adult keratinocytes cultured for 24 h revealed expression of IFN- at the 150-200 pg/ml level. In contrast, no IFN- protein was detectable in primary cell cultures of fibroblasts or in peripheral blood mononuclear cells.

The observation that dsRNA enhances IFN- expression suggests that IFN- will also be up-regulated upon viral infection. Real-time PCR analysis of keratinocytes infected with EMCV demonstrated that the IFN- mRNA is induced ~10-fold 15 h after viral infection (Fig. 4B). To determine whether expression of IFN- is regulated by other interferons, cultured human keratinocytes were treated with IFN- or IFN-. As shown in Fig. 4C, both IFN- and IFN- direct a significant increase in the level of IFN- mRNA expression with both inducing an approximate 20-fold increase in the IFN- mRNA level after 30 h. The kinetics of the IFN- mRNA response to the two interferons, however, is somewhat different, with IFN- mediating a more rapid response (an approximate 8-fold increase in the level of IFN- after 1 h) compared with the response to IFN- treatment (an approximate 10-fold increase after 15 h).

IFN- Displays Species-specific Antiviral Activity-- A hallmark of all interferons is the ability to elicit anti-viral protection (1, 2). To determine whether IFN- has this activity, recombinant IFN- protein purified from E. coli was analyzed for its ability to protect either normal human dermal fibroblasts or murine L929 cells from infection with encephalomyocarditis virus. As shown in Fig. 5, IFN- protected human fibroblasts from ECMV infection in a dose-dependent manner with protection observed in the presence of 1-10 ng/ml IFN- protein. In addition, human 2FTGH fibrosarcoma cell lines transfected with an IFN- expression vector were also protected from infection with vesicular stomatitis virus (data not shown). In contrast, IFN- displayed no anti-viral activity on mouse L929 cells (Fig. 5). IFN- is therefore able to impart anti-viral protection in a species-specific manner and is capable of protecting against cellular infection by at least two families of RNA viruses.

View larger version (10K): [in this window] [in a new window]   Fig. 5.   Recombinant IFN- mediates anti-viral activity. IFN--induced protection against EMCV challenge of human dermal fibroblasts (closed triangles) or mouse L929 cells (open squares), measured as optical density values of the infected cultures, is shown. NIC, non-infected control values. IC, infected control.

IFN- Activates the ISRE Pathway and Signals through the Type I IFN Receptor-- It has been demonstrated previously that all type I IFNs signal through a common receptor complex and modulate gene expression through activation of a set of interferon-inducible genes (as reviewed in Refs. 10 and 11). To determine whether IFN- can likewise activate this pathway, a reporter plasmid containing tandem copies of a consensus ISRE element upstream of the SEAP reporter gene was stably transfected into the cell line HEK293. A clear and dose-dependent induction of the ISRE signaling pathway was observed upon treatment of the reporter line with recombinant IFN- protein (Fig. 6A). To determine whether this activation was dependent on the type I IFN receptor complex, a monoclonal antibody that binds to IFNAR2c and inhibits signaling through the IFN-type receptor complex was employed (25). This antibody, termed IFNaR1, binds with high affinity to the IFN receptor complex and neutralizes the activity of human IFN- species, IFN- and IFN- (25). The ability of this antibody to block IFN- signaling on the 293/ISRE-SEAP reporter line (Fig. 6B) indicates that IFN- signals through the type I IFN receptor signaling complex. Further evidence for the involvement of both the IFNAR2c and IFNAR1 chains in the cellular response to IFN- was addressed by over-expressing the genes encoding the receptor subunits IFNAR1 and IFNAR2c in the reporter cell line either alone or in combination. Although overexpression of IFNAR1 or IFNAR2 alone resulted in a modest increase in reporter gene activation in response to treatment with IFN-, maximal induction required expression of both subunits (Fig. 6C).

View larger version (14K): [in this window] [in a new window]   Fig. 6.   IFN- mediates ISRE activation through the type I IFN receptor. A, five tandem copies of the ISG54 ISRE element (TAGTTTCACTTTCCC) upstream of a basal promoter and SEAP reporter gene were stably transfected in to HEK293 cells. These reporter cells were then treated with a range of recombinant IFN- protein concentrations in triplicate. 24 h post-treatment, supernatants were collected, and SEAP activity was determined. B, HEK293 cells stably transfected with ISRE-SEAP were treated with 1 µg/ml of IFN-, together with a range of type I IFN-neutralizing monoclonal antibody (IFNaR1) or a control antibody (M1). Treatments were performed in triplicate. 24 h post-treatment supernatants were collected, and SEAP activity was determined. C, the HEK293/ISRE-SEAP stable cell line was transfected with the pcDNA3 vector alone or with the interferon receptors (IFNAR1, IFNAR2c) alone or in combination. 24 h post-transfection, cells were treated with 2.5 µg/ml of IFN-. 24 h post-treatment supernatants were collected, and SEAP activity was determined as described under "Experimental Procedures."

IFN--mediated Gene Activation-- To determine whether IFN- induces the expression of some of the same genes that other IFNs do, Daudi cells, which are particularly sensitive to type I IFNs (26), were treated with IFN-. After 6 h of treatment, RNA was harvested and subjected to real-time quantitative PCR analysis to determine the level of expression of a subset of genes demonstrated previously to be regulated by type I IFNs (Fig. 7). The best characterized IFN-induced pathways are the anti-viral pathways, the PKR pathway, the OAS system, and the Mx pathway (2, 10, 11). Genes that are induced at the mRNA level by interferons and are part of these pathways (PKR, OAS, and MxA) were analyzed for their response to IFN-. As demonstrated in Fig. 7, the three genes were all activated by IFN-, suggesting that IFN- also induces the three defined anti-viral pathways. The level of two transcription factors that play integral roles in the IFN signal transduction pathway were also activated by IFN- (IRF-1 and STAT1).

View larger version (10K): [in this window] [in a new window]   Fig. 7.   Transcriptional profile of IFN--treated Daudi cells. Daudi cells were treated with IFN- (1 µg/ml) for 6 h, and RNA was isolated and subjected to Taqman real-time PCR analysis. The mRNA level was determined for OAS, PKR, MxA, STAT1, and IRF1, and the level of induction was determined relative to buffer-treated cells.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

IFN- represents a novel subclass of type I interferon that is selectively expressed in keratinocytes and is ~30% identical to the other type I interferon family members. The gene encoding IFN- is located on the short arm of chromosome 9, adjacent to the type I IFN cluster, but is relatively proximal to the centromere. In contrast to the other interferons, which are devoid of introns (1), IFN- contains an intron within the 3' untranslated region. In addition, the IFN- protein is somewhat larger than the other type I IFNs because of a 12-amino acid insertion between the predicted C and D -helices. Taken together, the gene location and structure suggest that IFN- evolved separately from the other type I interferons. Analysis of available cDNA and genomic sequences from other species has failed to identify an ortholog of IFN- suggesting it may have evolved later to play a specific role in humans or primates. Clearly confirmation of this will require a detailed search for orthologs of IFN-. The relevance of the relatively long CD loop in IFN- is unclear but perhaps influences cellular location, association with binding proteins, interaction with its cognate receptor(s), and subsequent downstream signaling. Despite its sequence and structural differences, IFN- does employ the common IFN receptor and activates the ISRE signal transduction pathway activated by other type I IFNs. Whether IFN- utilizes additional receptors remains to be determined.

The emergence of IFN- expands the repertoire of human type I IFNs into four distinct subgroups, IFN-, IFN-, IFN-, and IFN-. An additional subclass, IFN-, has been identified in ruminant species (5), and more recently, limitin, a mouse gene distantly related to the type I IFNs that also signals through the common type I IFN receptor, was isolated (27). Although the type I IFNs mediate many similar biological activities, they do exhibit significant differences in the relative potency of their activities and some different immunomodulatory effects (1, 2, 10, 11, 28-32). Presumably differences in signaling downstream from the receptor (11-12, 33) combined with differences in their spatial and temporal expression dictate specificity of function for each type I IFN subgroup. Considering most type I IFNs are predominantly expressed only upon viral infection or cellular challenge, the expression of IFN- protein in resting keratinocytes and cell types of the innate immune system (monocytes and dendritic cells) is an important characteristic of this subclass. Earlier studies also demonstrated the existence of a type I IFN (possibly IFN-) distinct from IFN- or IFN- that is expressed in uninfected keratinocytes (34). In contrast, neither IFN- nor IFN- are expressed in unstimulated keratinocytes, although IFN- protein is detectable in culture supernatants of activated keratinocytes (35). In view of the critical role played by skin as primary defense organ the expression of IFN- in resting keratinocytes may provide a novel mechanism of host defense that will require further evaluation. IFN- is capable of mediating cellular protection against at least two families of RNA viruses although it should be emphasized that the level of anti-viral activity of IFN- displayed against EMCV infection of fibroblasts is relatively weak compared with other type I interferons (1, 31). Further studies will be required to determine whether other viruses, including those that infect skin such as the herpes and papillomaviruses, are more susceptible to IFN-. Upon viral infection of keratinocytes or treatment with dsRNA, the expression of IFN- is further enhanced supporting a role in host defense. The observation that both IFN- and IFN- also significantly increase IFN- expression suggests a role for IFN- in sustaining the host interferon response. An analysis of the IFN- promoter, including the three putative virus-inducible GAAANN elements (19) identified in this study, will aid in uncovering the molecular mechanisms that direct IFN- expression in keratinocytes and regulate its response to IFN-, IFN-, and viral infection.

In addition to imparting anti-viral activity, interferons mediate a wide range of other cellular effects through the activation of a wide spectrum of interferon-inducible genes. These activities include inhibition of proliferation of normal and tumor cells, stimulation of natural killer cells, enhancement of major histocompatibility complex antigen expression, and the stimulation of tumor antigens (1, 2, 26, 36). The observation that IFN- utilizes the common IFN receptor and activates the ISRE, as evidenced by its ability to activate transcriptional activation of the ISG54 ISRE, suggests that it will elicit activities similar to those elicited by other interferons. Indeed, initial transcriptional profiling demonstrates that IFN- activates the three well defined anti-viral pathways mediated by PKR, OAS, and Mx proteins. IFN- also up-regulates the transcription factors STAT-1 and IRF-1, which play integral roles in mediating the interferon response (11). Mice lacking the STAT1 gene have no innate response to either viral or bacterial infection due to the disruption of the IFN response (37), whereas IRF-1 regulates the expression of many inducible genes including major histocompatibility complex class 1 antigens (11, 38). The observation that IFN- is induced by the inflammatory mediator IFN-, and also other type I interferons, further supports involvement of IFN- in host defense. Clearly, further analysis will be required to determine how the range and potency of cellular activities mediated by IFN- compares to the effects of other type I interferons and to determine the contribution IFN- makes to host defense and cellular maintenance, particularly in the skin and within the innate immune system.

The therapeutic utility of IFN- should also be considered. Existing type I interferons have been used successfully to treat a range of diseases such as various forms of leukemia, hepatitis, and multiple sclerosis (2, 12). However, existing IFN therapies do elicit side effects, including fever, fatigue, anorexia, and flu-like symptoms. In addition their efficacy may be limited by the production of neutralizing antibodies (12, 30, 31). Although studies will be required to establish clinical utility it is plausible that IFN- could provide an alternative interferon treatment to complement existing type I interferons in the clinic, by either expanding utility and/or by reducing undesirable side effects.

	ACKNOWLEDGEMENTS

The technical help of Thomas Kaufman, Devanshi Shah, and Lan Nguyen and comments on the manuscript by Wendy Green are appreciated.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

 The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF315688, AF384048, and AF384047.

^§ To whom correspondence should be addressed: Human Genome Sciences, 9410 Key West Ave., Rockville, MD 20850. Tel.: 301-610-5790 (Ext. 2026); Fax: 301-340-7159; E-mail: paul_moore@hgsi.com.

Published, JBC Papers in Press, August 20, 2001, DOI 10.1074/jbc.M102502200

	ABBREVIATIONS

The abbreviations used are: IFN, interferon; dsRNA, double-stranded RNA; IFNAR, type I IFN receptor complex; STAT, signal transducer and activator of transcription; ISRE, interferon-stimulated response element; EST, expressed sequence tag; PCR, polymerase chain reaction; bp, base pair(s); EMCV, encephalomyocarditis virus; ELISA, enzyme-linked immunosorbent assay; OAS, 2-5A oligoadenylatesynthetase; PKR, dsRNA-dependent protein kinase; kb, kilobase pair; HEK, human embryonic kidney.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Wang, R. Oberley-Deegan, S. Wang, M. Nikrad, C. J. Funk, K. L. Hartshorn, and R. J. Mason Differentiated Human Alveolar Type II Cells Secrete Antiviral IL-29 (IFN-{lambda}1) in Response to Influenza A Infection J. Immunol., February 1, 2009; 182(3): 1296 - 1304. [Abstract] [Full Text] [PDF]

				A. M. Davis, K. A. Hagan, L. A. Matthews, G. Bajwa, M. A. Gill, M. Gale Jr., and J. D. Farrar Blockade of Virus Infection by Human CD4+ T Cells via a Cytokine Relay Network J. Immunol., May 15, 2008; 180(10): 6923 - 6932. [Abstract] [Full Text] [PDF]

				T. Matsumiya, S. M. Prescott, and D. M. Stafforini IFN-{epsilon} Mediates TNF-{alpha}-Induced STAT1 Phosphorylation and Induction of Retinoic Acid-Inducible Gene-I in Human Cervical Cancer Cells J. Immunol., October 1, 2007; 179(7): 4542 - 4549. [Abstract] [Full Text] [PDF]

				J. Zou, C. Tafalla, J. Truckle, and C. J. Secombes Identification of a Second Group of Type I IFNs in Fish Sheds Light on IFN Evolution in Vertebrates J. Immunol., September 15, 2007; 179(6): 3859 - 3871. [Abstract] [Full Text] [PDF]

				J. Huang, S. V. Smirnov, A. Lewis-Antes, M. Balan, W. Li, S. Tang, G. V. Silke, M. M. Putz, G. L. Smith, and S. V. Kotenko Inhibition of type I and type III interferons by a secreted glycoprotein from Yaba-like disease virus PNAS, June 5, 2007; 104(23): 9822 - 9827. [Abstract] [Full Text] [PDF]

				B. Nardelli, L. Zaritskaya, W. McAuliffe, Y. Ni, C. Lincoln, Y. H. Cho, C. E. Birse, W. Halpern, S. Ullrich, and P. A. Moore Osteostat/Tumor Necrosis Factor Superfamily 18 Inhibits Osteoclastogenesis and Is Selectively Expressed by Vascular Endothelial Cells Endocrinology, January 1, 2006; 147(1): 70 - 78. [Abstract] [Full Text] [PDF]

				V. van Pesch, H. Lanaya, J.-C. Renauld, and T. Michiels Characterization of the Murine Alpha Interferon Gene Family J. Virol., August 1, 2004; 78(15): 8219 - 8228. [Abstract] [Full Text] [PDF]

				D. Muller-Doblies, A. Arquint, P. Schaller, P. M. H. Heegaard, M. Hilbe, S. Albini, C. Abril, K. Tobler, F. Ehrensperger, E. Peterhans, et al. Innate Immune Responses of Calves during Transient Infection with a Noncytopathic Strain of Bovine Viral Diarrhea Virus Clin. Vaccine Immunol., March 1, 2004; 11(2): 302 - 312. [Abstract] [Full Text] [PDF]

				T. Ito, N. Ito, A. Bettermann, Y. Tokura, M. Takigawa, and R. Paus Collapse and Restoration of MHC Class-I-Dependent Immune Privilege: Exploiting the Human Hair Follicle as a Model Am. J. Pathol., February 1, 2004; 164(2): 623 - 634. [Abstract] [Full Text] [PDF]

				R. Deonarain, A. Verma, A. C. G. Porter, D. R. Gewert, L. C. Platanias, and E. N. Fish Critical roles for IFN-{beta} in lymphoid development, myelopoiesis, and tumor development: Links to tumor necrosis factor {alpha} PNAS, November 11, 2003; 100(23): 13453 - 13458. [Abstract] [Full Text] [PDF]

				G. Vassileva, S.-C. Chen, M. Zeng, S. Abbondanzo, K. Jensen, D. Gorman, B. M. Baroudy, Y. Jiang, N. Murgolo, and S. A. Lira Expression of a Novel Murine Type I IFN in the Pancreatic Islets Induces Diabetes in Mice J. Immunol., June 1, 2003; 170(11): 5748 - 5755. [Abstract] [Full Text] [PDF]

				B. L. Osborn, H. S. Olsen, B. Nardelli, J. H. Murray, J. X. H. Zhou, A. Garcia, G. Moody, L. S. Zaritskaya, and C. Sung Pharmacokinetic and Pharmacodynamic Studies of a Human Serum Albumin-Interferon-alpha Fusion Protein in Cynomolgus Monkeys J. Pharmacol. Exp. Ther., November 1, 2002; 303(2): 540 - 548. [Abstract] [Full Text] [PDF]

				B. Nardelli, L. Zaritskaya, M. Semenuk, Y. H. Cho, D. W. LaFleur, D. Shah, S. Ullrich, G. Girolomoni, C. Albanesi, and P. A. Moore Regulatory Effect of IFN-{kappa}, A Novel Type I IFN, On Cytokine Production by Cells of the Innate Immune System J. Immunol., November 1, 2002; 169(9): 4822 - 4830. [Abstract] [Full Text] [PDF]

				C. S. Rosenfeld, C.-S. Han, A. P. Alexenko, T. E. Spencer, and R. M. Roberts Expression of Interferon Receptor Subunits, IFNAR1 and IFNAR2, in the Ovine Uterus Biol Reprod, September 1, 2002; 67(3): 847 - 853. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/43/39765    most recent M102502200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by LaFleur, D. W. Articles by Moore, P. A. Search for Related Content PubMed PubMed Citation Articles by LaFleur, D. W. Articles by Moore, P. A. Social Bookmarking                      What's this?