|
Originally published In Press as doi:10.1074/jbc.M104112200 on July 27, 2001
J. Biol. Chem., Vol. 276, Issue 43, 40001-40007, October 26, 2001
Smad-interacting Protein 1 Is a Repressor of
Liver/Bone/Kidney Alkaline Phosphatase Transcription in Bone
Morphogenetic Protein-induced Osteogenic Differentiation of C2C12
Cells*
Przemko
Tylzanowski §,
Kristin
Verschueren¶,
Danny
Huylebroeck¶, and
Frank P.
Luyten
From the Laboratory of Skeletal Development and Joint
Disorders, University of Leuven, Herestraat 49, 3000 Leuven, Belgium
and the ¶ Department of Cell Growth, Differentiation and
Development (VIB-07), the Flanders Interuniversity Institute for
Biotechnology (VIB) and the Laboratory of Molecular Biology, University
of Leuven, Herestraat 49, B-3000 Leuven, Belgium
Received for publication, May 7, 2001, and in revised form, July 19, 2001
 |
ABSTRACT |
Up-regulation of liver/bone/kidney alkaline
phosphatase (LBK-ALP) has been associated with the onset of
osteogenesis in vitro. Its transcription can be
up-regulated by bone morphogenetic proteins (BMPs), constitutively
active forms of their cognate receptors, or appropriate Smads.
The promoter of LBK-ALP has been characterized partially,
but not much is known about its transcriptional modulation by BMPs. A
few Smad-interacting transcriptional factors have been isolated to
date. One of them, Smad-interacting protein 1 (SIP1), belongs to the
family of two-handed zinc finger proteins binding to E2-box sequences
present, among others, in the promoter of mouse LBK-ALP. In
the present study we investigated whether SIP1 could be a candidate
regulator of LBK-ALP transcription in C2C12 cells. We
demonstrate that SIP1 can repress LBK-ALP promoter activity induced by constitutively active Alk2-Smad1/Smad5 and that this repression depends on the binding of SIP1 to the CACCT/CACCTG cluster
present in this promoter. Interestingly, SIP1 and alkaline phosphatase expression domains in developing mouse limb are mutually exclusive, suggesting the possibility that SIP1 could also be involved
in the transcriptional regulation of LBK-ALP
in vivo. Taken together, these results offer an intriguing
possibility that ALP up-regulation at the onset of BMP-induced
osteogenesis could involve Smad/SIP1 interactions, resulting in the
derepression of that gene.
 |
INTRODUCTION |
Major advances have been made toward the understanding of
molecular pathways involved in the progression and termination of the
osteo/chondrogenic differentiation. The identity of the molecular, cell-autonomous players involved in the onset of those processes remains elusive. Significant progress came with the discovery of Cbfa1
(1-4) and Sox9 (5) and the characterization of their role in the onset
of osteo- and chondrogenic differentiation, respectively. Nonetheless,
some of the issues remain unresolved. One of the most important ones is
that although, unquestionably, various members of the TGF-
superfamily are involved in these differentiation processes, their
precise role and the gene transcription programs they modulate are not clear.
The molecular aspects of signaling by the
TGF- 1 family of ligands
are well characterized and have been reviewed extensively (6, 7).
Briefly, dimeric ligands bind to a cognate type II receptor, allowing
it to associate with type I receptor into a tetrameric complex. After
the formation of signaling receptor complexes, the type I receptor
phosphorylates various intracellular proteins such as the
receptor-activated Smads (R-Smads). Following the phosphorylation, the
activated R-Smads heterodimerize with Smad4 and translocate to the
nucleus of the cell. There they directly bind to DNA and/or
interact with transcription factors/cofactors, affecting gene
expression. The issue of the signaling specificity is not yet
completely resolved, because ligands display a certain degree of
promiscuity towards different combinations of receptors. Based on
experiments in vitro, it is generally acknowledged that the
R-Smads 1, 5, and 8 are involved in transducing BMP, whereas R-Smads 2 and 3 signal TGF- activity.
Because activated R-Smads function predominantly in the cell nucleus,
the investigation of their mechanism of action has resulted in the
isolation and characterization of various nuclear Smad-interacting proteins. One such protein is Smad-interacting protein 1 (8). SIP1 is
one of a few novel proteins isolated by the virtue of its interaction
with activated, but not latent, R-Smads. It is a member of an emerging
family of two-handed zinc finger transcription factors including two
other proteins: Drosophila melanogaster zfh1 (9),
Daniorerio kheper (10), and EF1 (in many
vertebrate species) (11). The DNA binding specificity of SIP1 is
defined by a CACCT/CACCTG bipartite site wherein the two sequences are separated by a variable distance ranging from 8 bp in the mouse follistatin promoter2 to 44 bp in
the E-cadherin promoter (12). Analysis of other known
TGF- -responsive promoters revealed that a few other genes contain
putative SIP1 binding sites, among them the liver/bone/kidney alkaline
phosphatase (LBK-ALP) gene.
At least five different genes, Akp 1-5, encode various
forms of alkaline phosphatase (EC 3.1.3.1.) (www.jax.org). Depending on
the expression pattern of those genes, we can distinguish embryonic, intestinal, or liver/bone/kidney (also known as tissue-nonspecific) alkaline phosphatases (13, 14). Although the expression of the
LBK-ALP gene in vivo is not restricted to bone,
the up-regulation of this gene in vitro has been generally
associated with the onset of osteogenic differentiation. The gene is
using at least two promoters; one of them, located upstream of exon 1A,
is responsible for the expression of LBK-ALP in multiple
tissues including bone. The second promoter, located upstream from exon
1B, is activated only in heart muscle. Few regulatory sequences were
identified in the first promoter, but none of them has been linked
directly to the previously documented induction of endogenous
LBK-ALP gene transcription by BMP (15-17).
We decided to reanalyze the regulatory region of the LBK-ALP
gene upstream of the exon IA using the well characterized system of
BMP-induced osteogenic differentiation of C2C12 cells. This mouse
skeletal muscle progenitor cell line was used initially to study
myogenesis induced by serum starvation (18). It has been subsequently
discovered that the differentiation process could be inhibited by
exposure of cells to ligands of the TGF- family. Interestingly,
TGF- and BMP2 have different effects on C2C12 differentiation
in vitro. Both ligands are able to inhibit myogenesis, but
only BMP2 can redirect C2C12 cells into the osteogenic differentiation
pathway (19, 20). The reason for that striking difference is not quite clear.
In the present study we investigated whether SIP1 could be a candidate
regulator of LBK-ALP transcription in C2C12 cells. We
demonstrate here that SIP1 can repress LBK-ALP promoter
activity. Moreover, we show that this repression is related to the
binding of SIP1 to the CACCT/CACCTG sites in this promoter.
Interestingly, SIP1 and alkaline phosphatase expression domains in
developing mouse limb are mutually exclusive, suggesting a possibility
that SIP1 might also be involved in the transcriptional regulation of
LBK-ALP in vivo.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
All culture media, sera, and supplements were
purchased from Life Technologies, Inc. unless stated otherwise.
The C2C12 cell line was grown in Dulbecco's modified Eagle's medium
high glucose (4.5 g/liter) with 10% fetal bovine serum supplemented
with 100 units/ml ampicillin and 100 µg/ml streptomycin. The cells
were passaged at 90% confluence and split 1:10 or 1:20, depending on the desired density. To induce differentiation the cells were placed in
starvation medium consisting of Dulbecco's modified Eagle's medium
high glucose, 2% horse serum supplemented with 10 mg of bovine
insulin/ml, 10 mg of transferrin/ml, and 3 × 10 8
M selenium. All cells were grown in a 95% air/5%
CO2 atmosphere, in 95% humidity, at 37 °C.
Cos-1 cells used for eukaryotic expression were maintained in the same
medium and supplements as described above. The cells were split 1:10
upon reaching 80% confluence. For transfections, the cells were seeded
in 24-well plates (NUNC) 24 h prior to the transfection.
Plasmids--
The fragments of the first and the second
LBK-ALP promoters were provided kindly by E. Garattini
(Laboratory of Molecular Biology, Istituto di Ricerche Farmacologiche
Mario Negri, Milan, Italy), and constitutively active type I receptors
(CA Alks) were obtained from P. ten Dijke (Netherlands Cancer
Institute, Amsterdam, The Netherlands). All other constructs were
generated in our laboratories using PCR. PCR fragments used in reporter
assays were cloned into the pGL3 reporter plasmid (Promega, Madison,
WI) containing thymidine kinase minimal promoter cloned upstream of the
luciferase gene.
Transfections--
Transfections were carried out using the
Fugene 6 reagent (Roche) according to manufacturer instructions. We
found that in our case the optimal Fugene/DNA ratio was 2 µl of
Fugene to 1 µg of DNA; therefore, when necessary, the amount of DNA
was adjusted to 1 µg/well with the empty expression vector DNA. In
all the assays the results were normalized to -galactosidase
activity values obtained from the cotransfected RSVLacZ expression
plasmid (1 ng/well).
Reporter Assays--
Transfected cells were washed once with PBS
at room temperature, and then 50 µl of PBS/0.05% Triton X-100
(Ultrapure, Pierce) was added to the wells. After two freeze-thaw
cycles at 80 °C the lysates were transferred to round-bottom
96-well plates, and the cell debris was removed by centrifugation at
2000 × g. For all subsequent assays 5 µl of the
lysates was used, and the remaining lysates were stored at 80 °C
for future use. For the luciferase reporter assays we used a luciferase
kit from Promega, -galactosidase expression was measured with the
TropiX Kit (PerkinElmer Life Sciences), and the endogenous ALP was
measured with the ALP kit (KPL Laboratories). The protein concentration
of cell extracts was determined with the Bradford reagent
(Bio-Rad).
Electric Mobility Shift Assay (EMSA)--
The expression plasmid
encoding N-terminally Myc-tagged SIP1 (12) was transfected into
Cos-1 cells. Processing of the cells and subsequent EMSAs were carried
out as described before (8, 12). Appropriate probes were obtained by
PCR, purified as described below, and end-labeled with 32P
using Klenow polymerase (New England Biolabs) at 37 °C for
1 h. The probe was subsequently purified on MiniElute Columns
(Qiagen), and 40,000 cpm of the labeled probe was used for one EMSA reaction.
Mutagenesis and Cloning--
DNA fragments used for EMSAs and
reporter cloning were generated as follows. The appropriate
oligonucleotides (Life Technologies, Inc.) carrying the desired point
mutations were used as primers in a PCR reaction on a wild-type DNA
target. All PCRs were carried out in a 10-µl volume in a 9600 thermal
cycler (PerkinElmer Life Sciences). The PCR conditions were as follows:
95 °C for 1 min, followed by denaturation at 96 °C for 5 s,
annealing at 60 °C for 10 s, and extension at 72 °C for
30 s. The first five cycles were applied using Taq
polymerase (Eurogentec, Belgium). Subsequently, a 1-µl aliquot of the
product was used as a template in a reaction with a proofreading
Pfu-turbo polymerase (Stratagene). Using this strategy, we
produced a small amount of template containing the mutation that would
otherwise be repaired by the Pfu enzyme. Subsequently, Pfu was used to produce blunt-ended fragments used either in
EMSAs or for cloning to generate the necessary reporter plasmids. The PCR fragments were purified using the MiniElute PCR purification system
(Qiagen). The cloning of the PCR products was done using the PCR Script
kit (Stratagene) according to manufacturer protocol with minor
modifications. All cloned fragments were subsequently sequenced to
ascertain that only the desired mutations were present. LBK-ALP primers used in the course of this work were:
PT133-Alp-sense, AAGGGTGTGAGGCTCAGAGG; PT135-Alp-Asense2,
TCTGTGAACCCACCTGGCTC; PT153-Alp-sense-mut, AAGGGTGTGAGGCTCAGAGATG; and
PT154-Alp-Asense1-mut, TCTGTGAACCCATCTGGCTC.
Western Blotting--
Detection of Myc-tagged SIP1 by Western
blotting was carried out as described elsewhere (8).
In Situ Hybridizations--
The in situ
hybridizations were carried out using dioxygenin-labeled probe and the
in situ hybridization kit from Roche Diagnostics (21).
Signal detection was carried out using alkaline phosphatase-conjugated antibodies. The photographs were taken with a Leica HC microscope using
a Spot2 digital camera and collection software (Diagnostic Instruments,
Inc.).
 |
RESULTS |
SIP1 Binds to Specific Sites in the ALP Promoter--
High
affinity binding of SIP1 to DNA requires a bipartite and spaced
CACCT(G) (12). An analysis of available promoter sequences of genes
known to be regulated by BMPs
(hercules.tigem.it/TargetFinder.html) revealed that one of these
genes, mouse LBK-ALP, contains a cluster of potential SIP1
binding sites separated by 54 bp located in the promoter upstream of
exon 1A near the TATA box (Fig.
1A, upper panel).
Additionally, we found a similar site distribution in the human
LBK-ALP gene (Fig. 1A, lower panel).
Because two other examples of promoters were published in which SIP1
binding sites formed a very similar cluster near the putative TATA
boxes (12), we decided to carry out EMSA to determine whether
N-terminally tagged Myc-SIP1 could bind to the mouse
LBK-ALP promoter in vitro. As a probe, we used a
32P end-labeled 92-bp fragment of the mouse
LBK-ALP promoter containing CACCT/CACCTG sites (using the
PT133xPT135 primer combination; see Fig. 1B). Indeed, SIP1
did interact with the promoter fragment of LBK-ALP as
demonstrated by EMSA and subsequent supershift of the SIP1 band with a
monoclonal anti-Myc antibody (Fig.
2A).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
A schematic representation of the promoter
fragment of LBK-ALP upstream of the exon 1A.
A, a comparison of the distribution of CACCT/CACCTG clusters
in the mouse (upper panel) and human (lower
panel) promoters of the LBK-ALP gene. The
downward arrows indicate clusters that contain the
CACCT/CACCTG cluster separated by less than 60 bp. The first exon in
both cases is indicated with a black arrow. The
horizontal bar represents 100 bp. B, a part of
the mouse LBK-ALP promoter with indicated positions of the
primers used to generate DNA fragments for EMSAs and reporter
construction (black arrows PT133 and
PT135).
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
SIP1 binds to the LBK-ALP
promoter fragment. A, the end-labeled PCR product
of 92 bp containing SIP1 binding sites separated by 54 bases was
incubated with extracts from Cos-1 cells transfected with an expression
construct encoding Myc-tagged SIP1. Lane 1, mock-transfected
cells; lane 2, extracts from cells expressing Myc-tagged
SIP1; lane 3, the same extract as described in lane
2 but incubated with the anti-Myc antibody. The arrows
indicate the shift (lane 2) and supershift (Lane
3) of SIP1-DNA complexes. B, schematic representation
of the location of primers on the LBK-ALP promoter. The
primers PT133 and PT135 containing wild-type CACCT and CACCTG sequences
were used to generate a wild-type probe. Primers PT153 and PT154
containing mutation CACCT(G)-CATCT(G) were
used to generate mutated probes. C, results of a competition
assay between the labeled wild-type probe and a 30-fold molar excess of
different, competing PCR fragments. Lane 1 represents
competition with the wild-type probe, lane 2 with the right
mutant, lane 3 with the left mutant, and lane 4 with the double mutant. The arrow indicates the SIP1-shifted
band.
|
|
To verify whether the binding depended on the presence of the bipartite
CACCT ... CACCTG motive, we carried out competition assays. We
generated four different competing probes: wild-type PT133xPT135,
right-site mutant PT133xPT154, left-site mutant PT153xPT135, and the
double mutant PT153xPT154 (primers are shown in Fig.
2B).
As can be seen in Fig. 2C, lane 1, the wild-type
promoter fragment competed for SIP1 binding with a 30-fold molar excess
of the wild-type, unlabeled, probe. The double mutant (Fig.
2B, lane 4), as expected, was unable to compete
for binding to SIP1, but single-site mutants competed in a distinct
fashion. The right-site mutant (lane 2) was not able to
abrogate the SIP1 binding to the radiolabeled probe, whereas the
left-site mutant (lane 3) did compete partially for the
binding. This indicated that the right site (the E2 site CACCTG) alone
was still able to bind SIP1, although with apparently lower affinity,
whereas the left site alone could not.
Taken together, the above results indicate that SIP1 can bind to the
LBK-ALP promoter fragment in vitro and that this
binding depends on the presence of an intact bipartite CACCT/CACCTG
binding site.
SIP1 Interferes with the Induction of Endogenous ALP--
BMP
signaling induces LBK-ALP activity in vitro in a
number of cellular systems. In addition, previous studies of the
regulation of the Xbra gene (8, 12, 22) have indicated that
SIP1 could act in that case as a transcriptional repressor. Therefore
we decided to test whether SIP1 could repress BMP-induced
LBK-ALP activity in vitro. To investigate the
response only in cells overexpressing SIP1, instead of using ligand, we
cotransfected cells with constitutively active forms of BMP type I receptors.
We first determined the conditions leading to the highest up-regulation
of LBK-ALP by transiently transfecting C2C12 cells with CA
BMP receptors in conjunction with various wild-type R-Smads. Neither CA
Alk4 nor CA Alk5 induced measurable LBK-ALP activity (data
not shown and Ref. 23). Constitutively active Alk1, Alk2, Alk3, or Alk6
did induce the endogenous LBK-ALP activity (Fig. 3). Smads 1 or 5, separately or combined,
also led to increased levels of endogenous ALP, but that induction
always remained low (Fig. 3, pCS2 lane, and data not shown),
whereas the cotransfection of CA Alks with R-Smads induced the
endogenous Alp in a synergistic manner (Fig. 3, gray
columns). Because CA Alk2 in combination with Smad1/Smad5
consistently gave the strongest induction of the endogenous ALP, we
chose these conditions for all subsequent experiments.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
Endogenous LBK-ALP is induced
synergistically by a combination of CA Alks and Smad1/Smad5. C2C12
cells were transiently transfected with various expression plasmids
encoding selected CA ALKs or/and Smads. The levels of endogenous
LBK-ALP were determined as described under "Experimental
Procedures" and are presented on the graph as relative ALP activity
(R-ALP). Well-to-well variations were normalized against the
expression levels of -galactosidase encoded by cotransfected
RSV-LacZ expression plasmid. The black columns represent
endogenous ALP activity in the cells transfected with CA Alks alone,
and gray columns represent activities in the presence of
cotransfected Smad1/Smad5. Error bars represent a standard
deviation from four different experiments. An empty expression plasmid,
pCS2, was used as a negative control.
|
|
We then transiently transfected C2C12 cells with CA Alk2/Smad1/Smad5
combinations and cotransfected with expression constructs encoding
SIP1. The induction of endogenous ALP activity by CA Alk2/Smad1/Smad5
was repressed strongly by cotransfection with SIP1 (Fig.
4). To test whether the repression was
related to SIP1 binding to DNA, we transfected a SIP1 mutant that could
not bind to the DNA target because both zinc finger clusters had been
mutated (SIP1NZF3CZF3) (12). As can be seen in Fig. 4.,
this mutant failed to repress efficiently the endogenous
LBK-ALP activity. The lack of repression was not related to
the levels of produced SIP1 (data not shown).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 4.
SIP1 interferes with the induction of
endogenous LBK-ALP. A, the results of
cotransfection of CA-Alk2/Smad1/Smad5
(CA-Alk2/S1/S5) and SIP1 or Sip1NZF3CZF3 into
C2C12 cells. The bars represent relative endogenous ALP
(R-ALP) activity corrected for the levels of
-galactosidase (see "Experimental Procedures"). B, a
schematic representation of the domain structure of SIP1 and the mutant
used in the experiment. NZF and CZF denote N- and
C-terminal zinc finger clusters, respectively. Zinc fingers are
indicated with dark squares (C2H2) and light
squares (C3H). SBD indicates a Smad binding
domain, and HD indicates a homeodomain-like domain.
|
|
SIP1 Can Interfere with Induction of LBK-ALP Promoter Reporter
Plasmids--
Next, we determined whether the repressive activity of
SIP1 could be assigned to the DNA fragment containing the SIP1
bipartite binding site. First, we cloned the available promoter
fragment located upstream of the exon 1A of LBK-ALP into
pGL3. Subsequently, we transfected this plasmid into C2C12 cells and
cotransfected with CA-Alk2 and Smad1/Smad5. As demonstrated in Fig.
5A, this reporter was, similar
to the endogenous gene, induced by CA-Alk2/Smad1/Smad5 and repressed by
cotransfection with SIP1. Thus, the 1.9-kilobase promoter fragment of
LBK-ALP contains the regulatory sequences directing the
response of the reporter gene to CA ALK2/Smad1/Smad5 induction and SIP1
repression.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 5.
SIP1 represses ALP reporter constructs.
A, the 1.9 kilobases of available promoter I
LBK-ALP/luciferase reporter is repressed by overexpressing
SIP1 in C2C12 cells. The columns represent relative
luciferase activity corrected for -galactosidase. The error
bars represent a standard deviation from four experiments.
S1, Smad1; S5, Smad5. B, a 92-bp
fragment containing a CACCT/CACCTG cluster separated by 54 nucleotides
confers the same effect on the reporter plasmid as the full-size
promoter. Gray columns represent luciferase activity of the
wild-type reporter (PT133xPT135), and the dotted bars
represent luciferase activity of the mutated reporter (PT133xPT154).
Error bars represent the standard deviation calculated from
a quadruplicate experiment.
|
|
Because EMSA demonstrated that a 92-bp fragment of this promoter could
specifically bind SIP1, we repeated the reporter assays using this
promoter fragment. As shown in Fig. 5B, shaded
bars, the reporter containing the wild-type sequences was induced
in a similar way by CA Alk2/Smad1/Smad5 and again repressed by SIP1 as
we have shown for the endogenous gene or the 1.9-kilobase promoter fragment (Figs. 4 and 5A, respectively). To confirm that the
reporter response was related directly to SIP1 binding to DNA, we used a mutant reporter in which the right binding site (CACCTG)
was mutated to CAACTG. This mutant reporter could still be
induced by CA Alk2/Smad1/Smad5 but failed to be repressed by SIP1 (Fig. 5B).
To demonstrate that the above effect was related directly to SIP1
binding to DNA, we cotransfected the cells with the
SIP1NZF3CZF3 expression plasmid. This SIP1 mutant protein,
which binds to DNA with very low affinity (12), failed to interfere
with the induction of the wild-type reporter, although its synthesis
levels were comparable with the wild-type SIP1 (data not shown).
The above results identify in the promoter of the mouse
LBK-ALP gene a region (between 326 and 381) necessary
and sufficient for SIP1-mediated repression.
SIP1 and ALP Are Expressed in Distinct Nonoverlapping Domains in
Developing Mouse Limbs--
The results obtained during our in
vitro studies indicated that, at least mechanistically, SIP1 could
be involved in the transcriptional regulation of the mouse
LBK-ALP gene. To begin addressing the biological
significance of this observation we compared the expression of SIP1
mRNA and ALP in developing mouse limbs. As can be seen in Fig.
6, the expression patterns of both genes
are quite distinct and not overlapping. At 12.5 dpc, ALP was not yet
detectable (Fig. 6A, left panel and Ref. 24).
SIP1 mRNA, on the other hand, was expressed in a discrete pattern
as seen in Fig. 6A, right panel.

View larger version (73K):
[in this window]
[in a new window]
|
Fig. 6.
SIP1 and ALP display distinct expression
patterns in developing mouse limb. A, a coronal section
through a 12.5-dpc mouse forelimb at the metacarpal level. The
left panel shows a result of ALP staining, and the
right panel shows the results of in situ
hybridization with a SIP1 probe carried out on another section. The ALP
expression is not detectable, whereas Sip1 expression is clearly
detectable in the central part of the section. B, a coronal
section through the 13.5-dpc mouse forelimb at the metacarpal level.
The left panel shows a pattern of ALP activity visualized by
enzyme staining, and the right panel shows results of
in situ hybridization with SIP1 probe done on the subsequent
section. The expression is clearly elevated on the ventral side of the
limb, ventrally to the phalangeal component. Sense control was negative
(data not shown). PT, putative tendon; CA,
cartilage anlage; D, dorsal side; V, ventral
side.
|
|
One day later, at 13.5 dpc, the ALP could be detected around the
cartilaginous core of the phalanges. SIP1 mRNA expression was
excluded from that area but was present in a broad area around the
putative tendon. Detailed expression analysis of the midgestation mouse
embryo did not reveal any tissues in the developing mouse limb that
would show a clear overlap of the expression domains of both genes
(data not shown).
 |
DISCUSSION |
In this paper we provide evidence that SIP1 can bind in
vitro to a CACCT/CACCTG sequence cluster in the promoter of the
mouse LBK-ALP gene. Not only is this binding specific, but
it is also responsible for the repression of reporter constructs
carrying that promoter fragment. These data suggest that SIP1 could be a candidate repressor protein for the LBK-ALP gene.
The promoter of the LBK-ALP gene has been analyzed partially
in mouse as well as in rat. The initial characterization of the mouse
gene (17) led to the discovery of two promoters of that gene. The first
promoter, located upstream of the exon 1A, is responsible for the
expression of LBK-ALP in a number of tissues including bone.
The second promoter, located upstream from the exon 1B is activated
uniquely in heart. Subsequent studies focused on the identification of
cis-regulatory elements in the promoter of the gene. They
resulted in the identification of promoter elements directly involved
in the up-regulation of LBK-ALP by retinoic acid (25) or by
a combination of vitamin D3 and TGF- (26). Interestingly, despite
the fact that BMPs are known to be very potent inducers of the
endogenous LBK-ALP in vitro, no cis-acting promoter elements in that gene could be linked directly to this effect
(27).
In this report we delineate a promoter region from position 326 to
381 that is sufficient to mediate BMP-dependent induction and SIP1-dependent repression through the bipartite
CACCT/CACCTG cluster. Similar domain distribution has been found in the
human LBK-ALP promoter, suggesting evolutionary conservation
of the regulatory elements between mouse and human.
How might SIP1 be involved in the regulation of LBK-ALP
transcription? One possible explanation could involve the induction of
LBK-ALP transcription through a derepression mechanism
whereby the activity of SIP1 is extinguished. A similar mode of action was reported for Drosophila brinker, a transcriptional
repressor of dpp-responsive genes. In that case,
dpp (a Drosophila homologue of BMP2)
down-regulated brinker transcription and consequently up-regulated a
number of downstream targets (28, 29).
A recent analysis of the regulation of the collagen type II promoter by
EF1 (30) provides an interesting context for our observations. SIP1
and EF1 are two distinct members of the same family of two-handed
zinc finger proteins. Their domain structure is very similar, with the
highest degree of amino acid sequence conservation in the areas
encoding the N- and C-terminal zinc finger clusters (8). The DNA
binding specificity of these zinc finger clusters is identical in
vitro (12), and the in vivo mRNA expression data
suggest only a limited overlap between Sip1 and EF1 expression in
developing mouse limbs3 (31). It
is thus likely that both genes might act as transcriptional repressors
in different tissues and that SIP1-mediated repression of
LBK-ALP transcription prior to osteogenic differentiation is akin to EF1-mediated repression of collagen type II prior to the
chondrogenic one (30). Interestingly, targeted inactivation of EF1
in mouse yielded a specific albeit complex skeletal phenotype (31).
Some aspects of that phenotype such as hypoplasia of Meckell's cartilage and intervertebral disks as well as shortening and broadening of the long bones and joint fusions resemble phenotypes arising from
inactivation of other genes known to be involved in chondrogenesis, e.g. Indian hedgehog, PTH/PTHrP, noggin (www.jax.org), or
from GDF5/CDMP1 overexpression (32). Thus it will be interesting to see
if the targeted inactivation of SIP1 would result in skeletal abnormalities.
Finally, a limited analysis of the gene expression pattern in the
developing mouse revealed that SIP1 and ALP have distinct nonoverlapping areas of expression. ALP expression in the developing limb was detected from 13.5 dpc onward around the developing cartilage anlage demarcating the cells actively undergoing osteogenic
differentiation. SIP1, on the other hand, was detected earlier (12.5 dpc), initially in the central part of the limb. Subsequently, at 13.5 dpc, the expression was seen ventrally to the cartilage anlage and
around putative tendon but excluded from the alkaline
phosphatase-positive areas. This mutual exclusivity of expression
patterns resemble that of EF1 and collagen type II (30, 31). Indeed,
if the extinguishing of EF1 expression is a prerequisite for the
induction of collagen type II, one could envision a similar situation
for SIP1 in the case of LBK-ALP. Here, only tissues not
expressing SIP1 would be competent to express LBK-ALP.
Obviously, in vivo, the situation is most probably more
complicated, and a number of other transcription factors may contribute
to the regulated expression of alkaline phosphatase. On the other hand,
the absence of SIP1 could be a prerequisite for the activation of
LBK-ALP transcription.
It is noteworthy that SIP1 is expressed around developing tendons. Not
much is known about the molecular players participating in tendon
formation, although expression of a few genes has been associated with
that tissue. The Six1 and Six2 genes, both
encoding homeodomain proteins, have been reported to be expressed in
tendon and muscle during mouse development (33). The
Eph-related receptor tyrosine kinase gene Cek-8
was detected in developing chick tendons (34) and Eya1 and Eya2
transcriptional activators (35) have been associated with patterning of
tendons during mouse development. Finally, GDF5 and GDF7 have been
implicated in the induction of tendons (36). The broad expression
pattern of SIP1 around but not inside developing mouse tendon might
suggest that only the cells that are at early stages of differentiation
would be expressing this gene. Indeed, perhaps down-regulation of SIP1
expression is one of the prerequisites for terminal differentiation
also in this tissue.
The biological function of SIP1 and other family members of that group
of transcription factors remains an open question. Some indication came
from experiments in transgenic frog embryos. In this case, a mutation
of 1 bp in the promoter of Xbra abolishing SIP1 binding
caused ectopic expression of Xbra mRNA in the gastrula (22).
Interestingly, this ectopic expression was suppressed in later stages
of frog development clearly indicating that there are other players
involved in the regulation of Xbra. Thus, the SIP1/ EF1 group of
transcriptional repressors might be required to control spatio-temporal
expression of target genes by repression rather than activation and
thus be involved in the maintenance of a pool of undifferentiated cells
required for later stages of development and/or tissue repair.
In summary, we have shown that a CACCT/CACCTG DNA cluster in the
promoter of mouse LBK-ALP can bind SIP1 in vitro
and that this binding depended on the integrity of those sites.
Moreover, CA Alk2/Smad1/Smad5 could up-regulate a reporter plasmid
carrying this construct and SIP1 could repress it. SIP1 had the same
effect on the activity of the endogenous ALP indicating that the intact CACCT/CACCTG DNA cluster in the promoter of mouse LBK-ALP
was necessary and sufficient for the SIP1-mediated repression of its activity.
 |
ACKNOWLEDGEMENTS |
We thank Vera Maes and Jenny Peeters for
technical assistance.
 |
FOOTNOTES |
*
This work was supported by Flemish Funds for Scientific
Research Grant FWO G.0192.99.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. E-mail:
przemko@med.kuleuven.ac.be.
Published, JBC Papers in Press, July 27, 2001, DOI 10.1074/jbc.M104112200
2
K. Verschueren and D. Huylebroeck, unpublished data.
3
P. Tylzanowski, K. Verschueren, D. Huylebroeck,
and F. P. Luyten, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
TGF- , transforming growth factor ;
R-Smad, receptor-activated Smad;
SIP1, smad-interacting protein 1;
bp, base pair(s);
LBK, liver/bone/kidney;
ALP, alkaline phosphatase;
BMP, bone morphogenetic protein;
CA, constitutively active;
Alk, type I receptor;
PCR, polymerase chain
reaction;
EMSA, electric mobility shift assay;
dpc, days
post-coitus.
 |
REFERENCES |
| 1.
|
Ducy, P.,
Zhang, R.,
Geoffroy, V.,
Ridall, A. L.,
and Karsenty, G.
(1997)
Cell
89,
747-754[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Komori, T.,
Yagi, H.,
Nomura, S.,
Yamaguchi, A.,
Sasaki, K.,
Deguchi, K.,
Shimizu, Y.,
Bronson, R. T.,
Gao, Y. H.,
Inada, M.,
Sato, M.,
Okamoto, R.,
Kitamura, Y.,
Yoshiki, S.,
and Kishimoto, T.
(1997)
Cell
89,
755-764[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Otto, F.,
Thornell, A. P.,
Crompton, T.,
Denzel, A.,
Gilmour, K. C.,
Rosewell, I. R.,
Stamp, G. W.,
Beddington, R. S.,
Mundlos, S.,
Olsen, B. R.,
Selby, P. B.,
and Owen, M. J.
(1997)
Cell
89,
765-771[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Mundlos, S.,
Otto, F.,
Mundlos, C.,
Mulliken, J. B.,
Aylsworth, A. S.,
Albright, S.,
Lindhout, D.,
Cole, W. G.,
Henn, W.,
Knoll, J. H.,
Owen, M. J.,
Mertelsmann, R.,
Zabel, B. U.,
and Olsen, B. R.
(1997)
Cell
89,
773-779[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Bi, W.,
Deng, J. M.,
Zhang, Z.,
Behringer, R. R.,
and de Crombrugghe, B.
(1999)
Nat. Genet.
22,
85-89[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Massague, J.,
and Chen, Y. G.
(2000)
Genes Dev.
14,
627-644[Free Full Text]
|
| 7.
|
Massague, J.,
and Wotton, D.
(2000)
EMBO J.
19,
1745-1754[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Verschueren, K.,
Remacle, J. E.,
Collart, C.,
Kraft, H.,
Baker, B. S.,
Tylzanowski, P.,
Nelles, L.,
Wuytens, G.,
Su, M. T.,
Bodmer, R.,
Smith, J. C.,
and Huylebroeck, D.
(1999)
J. Biol. Chem.
274,
20489-20498[Abstract/Free Full Text]
|
| 9.
|
Fortini, M. E.,
Lai, Z. C.,
and Rubin, G. M.
(1991)
Mech. Dev.
34,
113-122[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Muraoka, O.,
Ichikawa, H.,
Shi, H.,
Okumura, S.,
Taira, E.,
Higuchi, H.,
Hirano, T.,
Hibi, M.,
and Miki, N.
(2000)
Dev. Biol.
228,
29-40[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Sekido, R.,
Takagi, T.,
Okanami, M.,
Moribe, H.,
Yamamura, M.,
Higashi, Y.,
and Kondoh, H.
(1996)
Gene (Amst.)
173,
227-232[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Remacle, J. E.,
Kraft, H.,
Lerchner, W.,
Wuytens, G.,
Collart, C.,
Verschueren, K.,
Smith, J. C.,
and Huylebroeck, D.
(1999)
EMBO J.
18,
5073-5084[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Hahnel, A. C.,
Rappolee, D. A.,
Millan, J. L.,
Manes, T.,
Ziomek, C. A.,
Theodosiou, N. G.,
Werb, Z.,
Pedersen, R. A.,
and Schultz, G. A.
(1990)
Development
110,
555-564[Abstract/Free Full Text]
|
| 14.
|
Manes, T.,
Glade, K.,
Ziomek, C. A.,
and Millan, J. L.
(1990)
Genomics
8,
541-554[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Weiss, M. J.,
Ray, K.,
Henthorn, P. S.,
Lamb, B.,
Kadesch, T.,
and Harris, H.
(1988)
J. Biol. Chem.
263,
12002-12010[Abstract/Free Full Text]
|
| 16.
|
Matsuura, S.,
Kishi, F.,
and Kajii, T.
(1990)
Biochem. Biophys. Res. Commun.
168,
993-1000[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Terao, M.,
Studer, M.,
Gianni, M.,
and Garattini, E.
(1990)
Biochem. J.
268,
641-648[Medline]
[Order article via Infotrieve]
|
| 18.
|
Blau, H. M.,
Pavlath, G. K.,
Hardeman, E. C.,
Chiu, C. P.,
Silberstein, L.,
Webster, S. G.,
Miller, S. C.,
and Webster, C.
(1985)
Science
230,
758-766[Abstract/Free Full Text]
|
| 19.
|
Filvaroff, E. H.,
Ebner, R.,
and Derynck, R.
(1994)
Development
120,
1085-1095[Abstract]
|
| 20.
|
Katagiri, T.,
Yamaguchi, A.,
Komaki, M.,
Abe, E.,
Takahashi, N.,
Ikeda, T.,
Rosen, V.,
Wozney, J. M.,
Fujisawa-Sehara, A.,
and Suda, T.
(1994)
J. Cell Biol.
127,
1755-1766[Abstract/Free Full Text]
|
| 21.
|
Wilkinson, D. G.
(1999)
In Situ Hybridization: A Practical Approach
, IRL Press, Oxford
|
| 22.
|
Lerchner, W.,
Latinkic, B. V.,
Remacle, J. E.,
Huylebroeck, D.,
and Smith, J. C.
(2000)
Development
127,
2729-2739[Abstract]
|
| 23.
|
Fujii, M.,
Takeda, K.,
Imamura, T.,
Aoki, H.,
Sampath, T. K.,
Enomoto, S.,
Kawabata, M.,
Kato, M.,
Ichijo, H.,
and Miyazono, K.
(1999)
Mol. Biol. Cell
10,
3801-3813[Abstract/Free Full Text]
|
| 24.
|
MacGregor, G. R.,
Zambrowicz, B. P.,
and Soriano, P.
(1995)
Development
121,
1487-1496[Abstract]
|
| 25.
|
Heath, J. K.,
Suva, L. J.,
Yoon, K.,
Kiledjian, M.,
Martin, T. J.,
and Rodan, G. A.
(1992)
Mol. Endocrinol.
6,
636-646[Abstract/Free Full Text]
|
| 26.
|
Johnson-Pais, T. L.,
and Leach, R. J.
(1996)
Exp. Cell Res.
226,
67-74[CrossRef]
|
| 27.
|
Kobayashi, T.,
Sugimoto, T.,
Kanzawa, M.,
and Chihara, K.
(1998)
Biochem. Mol. Biol. Int.
44,
683-691[Medline]
[Order article via Infotrieve]
|
| 28.
|
Jazwinska, A.,
Kirov, N.,
Wieschaus, E.,
Roth, S.,
and Rushlow, C.
(1999)
Cell
96,
563-573[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Marty, T.,
Muller, B.,
Basler, K.,
and Affolter, M.
(2000)
Nat. Cell Biol.
2,
745-749[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Murray, D.,
Precht, P.,
Balakir, R.,
and Horton, W. E., Jr.
(2000)
J. Biol. Chem.
275,
3610-3618[Abstract/Free Full Text]
|
| 31.
|
Takagi, T.,
Moribe, H.,
Kondoh, H.,
and Higashi, Y.
(1998)
Development
125,
21-31[Abstract]
|
| 32.
|
Tsumaki, N.,
Tanaka, K.,
Arikawa-Hirasawa, E.,
Nakase, T.,
Kimura, T.,
Thomas, J. T.,
Ochi, T.,
Luyten, F. P.,
and Yamada, Y.
(1999)
J. Cell Biol.
144,
161-173[Abstract/Free Full Text]
|
| 33.
|
Oliver, G.,
Wehr, R.,
Jenkins, N. A.,
Copeland, N. G.,
Cheyette, B. N.,
Hartenstein, V.,
Zipursky, S. L.,
and Gruss, P.
(1995)
Development
121,
693-705[Abstract]
|
| 34.
|
Patel, K.,
Nittenberg, R.,
D'Souza, D.,
Irving, C.,
Burt, D.,
Wilkinson, D. G.,
and Tickle, C.
(1996)
Development
122,
1147-1155[Abstract]
|
| 35.
|
Xu, P. X.,
Cheng, J.,
Epstein, J. A.,
and Maas, R. L.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
11974-11979[Abstract/Free Full Text]
|
| 36.
|
Wolfman, N. M.,
Hattersley, G.,
Cox, K.,
Celeste, A. J.,
Nelson, R.,
Yamaji, N.,
Dube, J. L.,
DiBlasio-Smith, E.,
Nove, J.,
Song, J. J.,
Wozney, J. M.,
and Rosen, V.
(1997)
J. Clin. Invest.
100,
321-330[Medline]
[Order article via Infotrieve]
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Collart, J. E. Remacle, S. Barabino, L. A. van Grunsven, L. Nelles, A. Schellens, T. Van de Putte, S. Pype, D. Huylebroeck, and K. Verschueren
Smicl is a novel Smad interacting protein and cleavage and polyadenylation specificity factor associated protein
Genes Cells,
September 1, 2005;
10(9):
897 - 906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sooy and M. B. Demay
Transcriptional Repression of the Rat Osteocalcin Gene by {delta}EF1
Endocrinology,
September 1, 2002;
143(9):
3370 - 3375.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|