HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 44, 40402-40410, November 2, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/44/40402    most recent M105090200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hollande, F. Articles by Baldwin, G. S. Search for Related Content PubMed PubMed Citation Articles by Hollande, F. Articles by Baldwin, G. S. Social Bookmarking                      What's this?

Involvement of Phosphatidylinositol 3-Kinase and Mitogen-activated Protein Kinases in Glycine-extended Gastrin-induced Dissociation and Migration of Gastric Epithelial Cells^*

Frédéric Hollande^§, Armelle Choquet^§, Emmanuelle M. Blanc^¶, Debra J. Lee, Jean-Pierre Bali, and Graham S. Baldwin^**

From the  Laboratoire de Signalisation Cellulaire Normale et Tumorale, EA MNRT 2995, Faculté de Pharmacie, Montpellier 34060, France, and  University of Melbourne, Department of Surgery, Austin Hospital, Melbourne, Victoria 3084, Australia

Received for publication, June 4, 2001, and in revised form, August 1, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The various molecular forms of gastrin can act as promoters of proliferation and differentiation in different regions of the gastrointestinal tract. We report a novel stimulatory effect of glycine-extended gastrin₁₇ only on cell/cell dissociation and cell migration in a non-tumorigenic mouse gastric epithelial cell line (IMGE-5). In contrast, both amidated and glycine-extended gastrin₁₇ stimulated proliferation of IMGE-5 cells via distinct receptors. Glycine-extended gastrin₁₇-induced dissociation preceded migration and was blocked by selective inhibitors of phosphatidylinositol 3-kinase (PI3-kinase) but did not require mitogen-activated protein (MAP) kinase activation. Furthermore, glycine-extended gastrin₁₇ induced a PI3-kinase-mediated tyrosine phosphorylation of the adherens junction protein -catenin, partial dissociation of the complex between -catenin and the transmembrane protein E-cadherin, and delocalization of -catenin into the cytoplasm. Long lasting activation of MAP kinases by glycine-extended gastrin₁₇ was specifically required for the migratory response, in contrast to the involvement of a rapid and transient MAP kinase activation in the proliferative response to both amidated and glycine-extended gastrin₁₇. Therefore, the time course of MAP kinase activation appears to be a critical determinant of the biological effects mediated by this pathway. Together with the involvement of PI3-kinase in the dissociation of adherens junctions, long term activation of MAP kinases seems responsible for the selectivity of this novel effect of G₁₇-Gly on the adhesion and migration of gastric epithelial cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Gastrin is an important hormone for the development and function of the gastrointestinal tract (for review see Ref. 1). Amidated gastrin (G₁₇-NH₂)¹ has been shown to activate various events such as gastric acid secretion, endocrine secretion of histamine and somatostatin, expression of epidermal growth factors (2), activation of early genes (3), and proliferation (4). Compelling evidence also demonstrates that alternative forms of progastrin processing, such as glycine-extended gastrin 17 (G₁₇-Gly) (1, 5, 6) and progastrin-(6-80) (7), have a biological role in the stimulation of proliferation. Recently, G₁₇-Gly has been shown to promote the invasiveness of the colon cancer cell line LoVo (8), and various reports showed that gastrin-related peptides are capable of activating a set of focal adhesion proteins such as p125^FAK, p130^Cas, and paxillin, which participate in the regulation of various cell functions such as preservation of morphology and migration (see Ref. 9 for review). However, direct effects of gastrins on epithelial cell adhesion have not yet been described.

Binding of G₁₇-NH₂ to the gastrin/cholecystokinin B (gastrin/CCK-B) receptor has been shown to activate various intracellular transduction pathways depending on the cell type. In the rat pancreatic cell line AR4-2J, gastrin-induced cell proliferation is thought to be mediated by activation of MAP kinases, leading to subsequent expression of immediate early genes like c-fos and c-jun (3, 10), whereas gastrin-promoted cell growth in the rat pituitary adenoma cell line GH3 is supported by a Ca²⁺-dependent mechanism (11). Furthermore, in a rat intestinal epithelial cell line (IEC-6) (12) and in Chinese hamster ovary cells expressing transfected gastrin/CCK-B receptors (13), gastrin stimulates c-Src-like tyrosine kinases upstream of phosphatidylinositol 3-kinase (PI3-kinase) and MAP kinase.

To date, G₁₇-Gly-induced transduction pathways have been studied mostly in tumor cell lines. In AR4-2J cells (3), as well as in the human colon cancer cell lines HT29 and LoVo (14), G₁₇-Gly stimulates c-Jun amino-terminal kinase activation independently of the MAP kinase pathway. Binding studies strongly suggest that G₁₇-Gly effects are mediated by a novel receptor that is insensitive to G₁₇-NH₂ and classical gastrin/CCK-B receptor antagonists (5, 6, 14), although a different receptor binding with a similar affinity to G₁₇-Gly and G₁₇-NH₂ was also identified on Swiss 3T3 fibroblasts (15). More studies are necessary in order to determine the signal transduction pathways activated by G₁₇-Gly on other tumoral and non-tumoral cell lines and to correlate these processes with the biological roles of the peptide.

For this work, we used a recently established gastric epithelial cell line (IMGE-5) (16) to compare the effects of amidated and glycine-extended gastrins on proliferation as well as cell adhesion and migration. The phenotype of these non-tumorigenic cells can be modulated in vitro by shifting them from a permissive temperature (33 °C) in the presence of -interferon to a non-permissive temperature (39 °C), allowing their differentiation toward an epithelial phenotype (16). The gastric origin of IMGE-5 cells together with their differentiated phenotype make them particularly suitable to study the cellular effects of gastrin-related peptides.

In this paper, we report for the first time that, while both molecular forms of gastrin stimulate proliferation of IMGE-5 cells, dissociation and migration of these cells in a wound healing assay was induced only by G₁₇-Gly. G₁₇-Gly also induced tyrosine phosphorylation of the adherens junction protein -catenin and dissociation of the complex between -catenin and the transmembrane protein E-cadherin, followed by the partial disappearance of -catenin from the cell membrane. We also show that a differential time course in the activation of MAP kinases by the two gastrin derivatives, as well as the involvement of PI3-kinase in the effect of G₁₇-Gly on -catenin, seem responsible for the selectivity of the effects of G₁₇-Gly on the adhesion and migration of IMGE-5 cells.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Antibodies and Cell Culture-- G₁₇-NH₂ was from Research Plus (Bayonne, NJ), and G₁₇-Gly was from Auspep (Melbourne, Australia). The CCK-A receptor antagonist L364,718 (17) and the gastrin/CCK-B receptor antagonist L365,260 (18) were gifts from Dr. V. J. Lotti (Merck). LY 294002 was from Sigma. E-cadherin, -catenin, PI3-kinase, and phosphotyrosine (PY20) antibodies were from Transduction Laboratories (Lexington, KY). Antibodies against total and phosphorylated p42/44 MAP kinases and total and phosphorylated Akt, as well as PD 98059, were from New England Biolabs (Beverly, MA).

The IMGE-5 cell line was established from the gastric mucosa of H-2 Kb-tsA58 transgenic mice as described previously (16). These mice are transgenic for a -interferon- and temperature-sensitive mutant of the SV40 large T antigen. The origins and detailed characteristics of this strain have been described previously (19, 20). IMGE-5 cells were generally grown in DMEM + 1 unit/ml -interferon + 5% FCS at 33 °C (permissive conditions). For all experiments, they were transferred to 39 °C in the same medium without -interferon (non-permissive conditions), where they display differentiated characteristics such as expression of functional adherens and tight junctions. All experiments have been performed on cells between passages 15 and 35.

Bromodeoxyuridine (BrdUrd) Incorporation and Immunocytochemical Detection of -Catenin-- Immunocytochemistry and BrdUrd incorporation experiments were performed on cells grown under non-permissive conditions on 14-mm glass coverslips. Cells were treated with the agents to be tested for 18 h in DMEM containing 0.1% heat-inactivated FCS and 100 µM BrdUrd (for BrdUrd staining) or in a similar medium without BrdUrd for the indicated times (for detection of membrane proteins). They were then fixed in ice-cold methanol for 3 min at 4 °C (BrdUrd staining) or in 2% paraformaldehyde in PBS for 10 min at room temperature (for other immunocytochemistry). After three PBS washes, cells were incubated for 5 min in PBS + 1.5 M HCl (for BrdUrd staining) or in PBS + 0.2% Triton X-100 followed by PBS + 0.2% gelatin for 10 min (for immunocytochemistry). Primary antibodies were then incubated for 2 h, and coverslips were washed three times in PBS, and the appropriate secondary antibody was incubated for 1 h. After two PBS washes and one rinse in water, coverslips were mounted on slides in Cytifluor (Oxford Instruments). Images were acquired using a Leica DC200 digital camera and DC viewer software (1280 × 1024 pixels/image).

Detection of G-CCK-B Receptors by Reverse Transcriptase-PCR-- Total RNA was prepared from confluent and non-confluent cells cultured in DMEM + 5% FCS in permissive or non-permissive conditions according to Chomczynski and Sacchi (21). Reverse transcription experiments were performed with 10 µg of total RNA using the Superscript II Reverse Transcriptase (Life Technologies, Inc.), according to the manufacturer's instructions. PCR was performed in a final volume of 25 µl using 0.27 mM of each dNTP, 1 µM of each G/CCK-B specific primer (sense, GCCCTTCACACTCCTGCCCAACC; antisense, GCGGAGCCCTAGGTAGAGTTCGCGGG), 1.5 mM MgCl₂, 1× PCR buffer, 0.3 unit of Taq polymerase (Promega, Madison, WI), and 2 µl of template cDNA. The standard PCR procedure involved denaturation of samples at 94 °C, annealing at 65 °C, and elongation of DNA strands at 72 °C. 10 µl of the samples were run on a 1.8% agarose gel containing ethidium bromide and photographed under UV light.

Binding Assay for ¹²⁵I-G₁₇-Gly-- G₁₇-Gly was iodinated using the IODO-GEN method (22) and purified by HPLC. 2.7 × 10⁵ IMGE-5 cells/well were seeded in 6-well plates and grown at 33 °C until 70% confluent. They were then shifted to 39 °C for 24 h and incubated for 90 min at 39 °C in 200 mM Tris-HCl (pH 7.2) containing 100 mM KCl, 2 mM MgCl₂, 1 mM DTT, 1 mM benzamidine, 0.1% bovine serum albumin, and 5 × 10⁵ cpm [¹²⁵I-Met¹⁵]gastrin₁₇-Gly. Cells were then washed three times in ice-cold PBS and lysed with 1 M NaOH, and the amount of radioactivity bound was measured in a -counter (LKB, Wallac, Finland).

Western Blotting-- Cells were grown in 100-mm Petri dishes under permissive conditions until they reached 90% confluency. They were then transferred to non-permissive conditions and serum-starved for 24 h, stimulated with the indicated concentrations of G₁₇-NH₂ or G₁₇-Gly for various times with or without 15 min of preincubation with either 10 µM LY 294002 or 50 µM PD 98059, and lysed using the standard procedure described previously (23). In the case of -catenin/E-cadherin association studies, 100 µg of protein lysate per sample was immunoprecipitated in Tris/NaCl (pH 7.5) containing 1% Nonidet P-40, 100 µM sodium orthovanadate, and 1 mM DTT (WLB buffer), using 1 µg of anti--catenin antibody for 2 h at 4 °C, followed by 100 µl of 20% protein A-Sepharose CL-4B (Amersham Pharmacia Biotech) overnight. Samples were washed three times in WLB buffer, and spun for 10 s at 10,000 × g. The pellet was resuspended in loading buffer, denatured for 3 min at 95 °C, and spun for 30 s at 10,000 × g, and proteins in the supernatant were separated on an 8.5% SDS-polyacrylamide gel. For detection of MAP kinase and Akt activation as well as measurement of phosphorylation, cells were lysed with RIPA buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.2 mM sodium orthovanadate, 0.5 mM DTT, and protease inhibitors in 20 mM Tris, 150 mM NaCl (pH 7.5)). 20 µg of total protein lysates were then mixed with loading buffer, denatured, and separated on a gel as described. Proteins were transferred onto a nitrocellulose membrane using a semi-dry blotting system (Bioblock, Nancy, France). Membranes were then incubated with the appropriate primary antibodies, and detection was performed with alkaline phosphatase-coupled anti-rabbit or anti-mouse IgG followed by incubation with a 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium solution, pH 9.2 (Sigma). Membranes were scanned using a Hewlett-Packard ScanJet 5200C, and densitometric analysis of protein bands was performed with a Fuji BAS software.

Migration Experiments-- Wound healing experiments were performed in order to assess the effects of gastrins on cell migration. Cells were grown in 12-well plates under permissive conditions until they reached 80% confluence, then shifted to 39 °C, and serum-starved for 24 h. The confluent monolayer was then wounded linearly using a pipette tip, washed three times with PBS, and treated with or without the agents to be tested for the indicated length of time in the presence of 0.1% FCS. Morphology and migration of cells was then observed and photographed at regular intervals for 24 h. When combined with immunofluorescence experiments, wound healing was performed similarly, except that cells were seeded onto 12-mm glass coverslips. At each time point, cells were photographed and then fixed in paraformaldehyde (2% in PBS) for 10 min at room temperature. Immunocytochemical localization of -catenin was then performed as described earlier.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Dual Biological Effect of G₁₇-Gly but Not G₁₇-NH₂ on IMGE-5 Cells-- The proliferative effects of G₁₇-NH₂ and G₁₇-Gly on IMGE-5 cells under non-permissive conditions were investigated. Both forms of the peptide were found to stimulate BrdUrd incorporation into IMGE-5 cell nuclei in a dose-dependent manner and with a similar amplitude (Fig. 1A). G₁₇-Gly was found to be significantly more potent than G₁₇-NH₂ as a stimulant of IMGE-5 proliferation (EC₅₀ = 22.8 ± 1.5 pM for G₁₇-Gly and 84.3 ± 2.9 pM for G₁₇-NH₂).

View larger version (71K): [in this window] [in a new window]   Fig. 1.   Different roles for G17-NH2 and G17-Gly in the proliferation and migration of gastric epithelial cells. A, cells were serum-starved for 24 h at 39 °C and stimulated for 18 h with the indicated concentrations of G17-Gly (closed circles) or G17-NH2 (open circles) in the presence of 100 µM BrdUrd. After fixation for 3 min in ice-cold methanol, BrdUrd incorporation was assessed by immunofluorescence using an anti-BrdUrd antibody. Data represent percent of total cells incorporating BrdUrd and are the means ± S.E. of four separate experiments, each performed in triplicate. B, cells were grown until subconfluent, serum-starved for 24 h at 39 °C, wounded linearly with a pipette tip, and then grown in the presence of 0.1% heat-inactivated FCS, without further treatment (a) or with 100 pM (b), 500 pM (c), 1 nM (d), 5 nM (e), 10 nM (f), or 50 nM (g) G17-Gly. Microphotographs of a similar randomly chosen field for each one of the wounded monolayers were taken when the wound was created (0 h) as well as 16 and 24 h after wounding the cells. C, histogram representing the change in wound size (in µm) over time in untreated IMGE-5 cells (control) or cells treated with 100 pM to 10 nM G17-Gly. For each sample, measurements were performed on 5 distinct fields along the wound at t = 0 (black bars), 16 (light gray), and 24 h (dark gray). Statistical significance was assessed by one-way analysis of variance (*, p < 0.05, and **, p < 0.01 compared with untreated cells, n = five experiments).

We then investigated whether either form of gastrin was able to trigger changes in morphology and motility of IMGE-5 cells under non-permissive conditions. Morphology and migration were assessed using a wound healing model on a near-confluent cell monolayer. In the presence of 0.1% serum, untreated cells slowly proliferated into the open wound but did not significantly change morphology or display any significant motility for up to 48 h (Fig. 1Ba, at t = 0, 16 and 24 h). However, morphological changes were detected from 8 h after addition of 100 pM to 100 nM G₁₇-Gly, with an elongation and spreading of cells. Cells started to migrate into the open wound about 12-15 h after treatment, and migration was maximal with 5-10 nM G₁₇-Gly (Fig. 1, Bb and Bg). The wound was on average completely repaired by 24-26 h in the presence of 5-50 nM G₁₇-Gly (Fig. 1, Be-Bg). On the contrary, no effect of G₁₇-NH₂ was detected on morphology or migration for up to 48 h, at concentrations ranging from 0.1 nM to 10 µM (data not shown).

We also assessed whether G₁₇-Gly or G₁₇-NH₂ (100 pM to 100 nM) had any effect on IMGE-5 cell differentiation under the same experimental conditions. However, the cells did not display any staining for markers of various specialized gastric cell types, such as H⁺/K⁺ ATPase (parietal cells), mucin M1 peptide (mucus-secreting cells), histamine (ECL cells), or chromogranin A (endocrine cells) for up to 48 h after G₁₇-Gly and G₁₇-NH₂ treatment (data not shown).

G₁₇-Gly Destabilizes Cell/Cell Contacts Prior to Cell Migration-- In order to determine whether G₁₇-Gly was also capable of inducing or stimulating the dissociation of epithelial cells at the front edge of the wound prior to migration, we performed further wound healing assays in the presence of 10-100 nM G₁₇-Gly using cells grown on glass coverslips, and we combined these assays with immunodetection of -catenin. -Catenin staining on IMGE-5 cells was typically strongly membrane associated, with a small proportion also present in the nucleus. In untreated samples, the cells at the edge of the wound did not seem to dissociate from one another at any stage, and the -catenin staining remained similar to that detected before or upon wounding for up to 24 h (Fig. 2, A1-A8). On the contrary, cells treated with G₁₇-Gly significantly dissociated from each other at the front edge of the wound as early as 8 h after treatment (shown here for 10 nM G₁₇-Gly, Fig. 2B6), and dissociation correlated with a strong shift of -catenin localization from the membrane, mainly to the nucleus of these cells (Fig. 2B2). Interestingly, once the treated cells started to migrate into the wound, only about 30% consistently maintained a strong nuclear staining for -catenin, whereas staining in the others was evenly decreased (Fig. 2B3). In all cases, upon closure of the wound, cells lost their spindle-like morphology and re-established contact with their neighbors, and -catenin returned to a mostly membrane-bound localization (Fig. 2B4), around 24-26 h after treatment with G₁₇-Gly concentrations above 5 nM.

View larger version (151K): [in this window] [in a new window]   Fig. 2.   G17-Gly stimulates the subcellular delocalization of -catenin and cell/cell dissociation prior to cell migration. Cells were seeded onto 12-mm glass coverslips and then grown and wounded as described in Fig. 1B. They were thereafter left untreated (A1-A8) or treated with 10 nM G17-Gly (B1-B8). At t = 0 (A1, A5, B1, and B5), 8 (A2, A6, B2, and B6), 16 (A3, A7, B3, and B7), and 24 h (A4, A8, B4, and B8), one sample each of untreated (A5-A8) and treated cells (B5-B8) was photographed and then fixed in paraformaldehyde (2% in PBS) for 10 min at room temperature, and -catenin was detected by immunofluorescence as described under "Experimental Procedures" (A1-A4 and B1-B4). White bars represent 5 (A1-A3 and B1-B3), 10 (A4 and B4), or 25 µm (A5-A8 and B5-B8). Loss of -catenin from the cell membrane (B2) and cell/cell dissociation (B6) were detected after 8 h of treatment with G17-Gly. Migration was only detected after about 16 h (B3 and B7), and the wound was repaired around 24 h after treatment (B4 and B8).

Different Receptors Are Responsible for Effects of G₁₇-NH₂ and G₁₇-Gly on IMGE-5 Cells-- The only receptor selective for G₁₇-NH₂ cloned to date is the gastrin/CCK-B receptor, expression of which in IMGE-5 cells was assessed by reverse transcriptase-PCR. IMGE-5 cells expressed gastrin/CCK-B receptor mRNA only under non-permissive conditions (Fig. 3A).

View larger version (29K): [in this window] [in a new window]   Fig. 3.   IMGE-5 cells express Gastrin/CCK-B and G17-Gly-selective receptors under non-permissive conditions. A, cells were grown for 24 h at 33 °C and then for another 48 h under the same conditions or at 39 °C as indicated. Gastrin/CCK-B receptor mRNA expression was assessed on total RNA prepared from IMGE-5 cells by reverse transcriptase-PCR (St., mouse stomach RNA as positive control; NC, non-confluent cells; C, confluent cells). B, 2.7 × 105 cells/well were seeded in 6-well plates, grown for 24 h at 33 °C and then at 39 °C until 90% confluent. Binding of 125I-G17-Gly to IMGE-5 cells was then measured directly in the wells for 90 min at 39 °C, with or without the indicated concentration of unlabeled G17-Gly (G-Gly), G17-NH2 (G-NH2), or L365,260 (L365). Data are the means ± S.E. of three independent experiments, each performed in triplicate. Statistical significance was assessed by ANOVA, by comparison with the control 125I-G17-Gly binding value (total binding with 125I-G17-Gly alone, T); *, p < 0.05; **, p < 0.01. C, cells were serum-starved for 24 h at 39 °C, preincubated for 30 min with 1 (black bars) or 100 nM (white bars) of the CCK-A receptor antagonist L364,718, or with 1 nM (gray bars) or 100 nM (hatched bars) of the G/CCK-B receptor antagonist L365,260, and stimulated for 18 h with 1 nM G17-Gly or G17-NH2 in the presence of 100 µM BrdUrd. After fixation for 3 min in ice-cold methanol, BrdUrd incorporation was assessed by immunofluorescence using an anti-BrdUrd antibody. Data are expressed as percent of maximal BrdUrd incorporation (induced by 1 nM G17-Gly or G17-NH2, respectively) and are the means ± S.E. of three independent experiments, each performed in triplicate. Statistical significance between the maximal BrdUrd incorporation value (100%) and antagonist-treated values was determined by ANOVA. *, p < 0.05; **, p < 0.01.

The presence of a selective receptor for G₁₇-Gly was investigated by binding of ¹²⁵I-G₁₇-Gly to adherent IMGE-5 cells. Although specific binding was detected under permissive conditions (data not shown), it was greatly increased under non-permissive conditions. Binding was reduced in a dose-dependent manner by concomitant incubation of cells with increasing concentrations of unlabeled G₁₇-Gly but not with G₁₇-NH₂ or with the G/CCK-B receptor antagonist L365,260 (Fig. 3B).

G/CCK-B and CCK-A receptors are currently the best characterized receptors for gastrin-related peptides. By using reliable selective antagonists, the involvement of these subtypes in the proliferative effects of G₁₇-NH₂ and G₁₇-Gly on IMGE-5 cells was investigated. Interestingly, the stimulation induced by G₁₇-NH₂ was dose-dependently reversed by the selective G/CCK-B antagonist L365,260 (18) (Fig. 3C), whereas L364,718, a selective CCK-A receptor antagonist (17), had a very weak effect, consistent with its interaction at high concentrations with G/CCK-B receptors (Fig. 3C). Neither antagonist had any effect on G₁₇-Gly-induced proliferation, at any of the concentrations tested (Fig. 3C).

Phosphatidylinositol 3-Kinase and MAP Kinase Pathway Are Involved in the Biological Effects Induced by G₁₇-Gly-- The role of PI3-kinase in the mediation of the proliferative signal triggered by G₁₇-Gly and G₁₇-NH₂ was investigated. When IMGE-5 cells were preincubated with either of two PI3-kinase inhibitors (10 nM wortmannin or 10 µM LY 294002), the proliferative effect of G₁₇-Gly was almost abolished, whereas neither inhibitor significantly affected the stimulation induced by G₁₇-NH₂ (Fig. 4A). In contrast, the stimulatory effects of both peptides were significantly decreased by the MEK1/2 inhibitor PD 98059 (50 µM).

View larger version (85K): [in this window] [in a new window]   Fig. 4.   Involvement of PI-3 kinase and p42/44 MAP kinases in the proliferative and migratory effects of G17-Gly. A, effect of PI3-kinase and MEK1/2 inhibitors on G17-Gly-induced BrdUrd incorporation. Cells were grown as in Fig. 1A and then incubated without (A) or with 1 nM G17-NH2 (B) or G17-Gly (C), either alone (white bars) or after a 60-min preincubation with 10 nM wortmannin (dotted bars), 10 µM LY 294002 (thick stripes), or 50 µM PD 98059 (thin stripes). Data represent percent of total cells incorporating BrdUrd and are the means ± S.E. of three separate experiments, each performed in triplicate. Statistical significance was assessed by ANOVA, as compared with untreated, G17-NH2 alone, or G17-Gly alone values, for A-C respectively. *, p < 0.05; **, p < 0.01. B, reversal by the PI3-kinase inhibitor LY 294002 of G17-Gly-induced migration of IMGE-5 gastric epithelial cells. Cells were treated as in Fig. 1B, except for the 60-min preincubation with antagonists prior to G17-Gly stimulation. a, untreated control; b, 10 µM LY 294002; c, 50 µM PD 98059; d, 100 nM G17-Gly; e, 10 µM LY 294002 + 100 nM G17-Gly; f, 50 µM PD 98059 + 100 nM G17-Gly. The data are representative of three separate experiments.

Furthermore, preincubation with 10 µM LY 294002 (Fig. 4Be) prevented the stimulation of IMGE-5 cell migration induced by 10-100 nM G₁₇-Gly (Fig. 4Bd for effect of 100 nM), indicating that PI3-kinase is directly involved in this effect. Interestingly, although pretreatment with the MEK inhibitor PD 98059 abolished the motility response to G₁₇-Gly, numerous cells were still able to dissociate from their neighbors at the edges of the wound (Fig. 4Bf).

Role of Phosphatidylinositol 3-Kinase and MAP Kinases in the Tyrosine Phosphorylation and Membrane Delocalization of -Catenin-- When confluent IMGE-5 cells were incubated for periods ranging from 30 min to 24 h with 100 pM to 100 nM G₁₇-Gly under non-permissive conditions, a marked decrease was detected in the amount of -catenin located at the plasma membrane from 1 h after treatment (shown for 100 nM), whereas cytoplasmic staining for the protein was greatly increased (Fig. 5Ab). The enhanced cytoplasmic localization of -catenin persisted for at least 4 h, but the protein returned to the plasma membrane within 12 h after G₁₇-Gly treatment (Fig. 5Ab). This shift of -catenin from the membrane to the cytoplasm was largely prevented by preincubating the cells with the PI3-kinase inhibitor LY 294002 (Fig. 5Ad) or with the tyrosine kinase inhibitor tyrphostin 25 (Fig. 5Ae), whereas the MEK1/2 inhibitor PD 98059 was found to have no effect on the G₁₇-Gly-induced delocalization of -catenin (Fig. 5Ac). Furthermore, G₁₇-NH₂ did not display any effect on the membrane localization of -catenin during 24 h of treatment (Fig. 5Af).

View larger version (79K): [in this window] [in a new window]   Fig. 5.   G17-Gly induces tyrosine phosphorylation and partial relocalization of -catenin through a PI3-kinase-dependent pathway. A, IMGE-5 cells were serum-starved for 24 h at 39 °C and grown without (a) or with 100 nM G17-Gly (b-e) or G17-NH2 (f) for the indicated times. Some cells were preincubated with the MEK1/2 inhibitor PD 98059 (c), the PI-3 kinase inhibitor LY 294002 (d), or the tyrosine kinase inhibitor tyrphostin 25 (e) for 30 min before G17-Gly treatment. After fixation with 2.5% paraformaldehyde in PBS for 15 min at room temperature, localization of -catenin was assessed by immunofluorescence, and photomicrographs were obtained using a Leica DC200 digital camera with the same 12.5-s acquisition sequence (4 frames/s) for all samples. Results are representative of three similar experiments. B, left panel, after 24 h of serum starvation, cells were left untreated (a) or were treated with 100 nM G17-Gly for 15 (b), 30 (c), or 60 min (d) and 4 (e), 12 (f), or 24 h (g) and then lysed as described under "Experimental Procedures." Cell lysates were immunoprecipitated (IP) using a selective anti--catenin antibody, and precipitates were run on 8.5% SDS-PAGE, Western-blotted (WB), and probed with an anti-phosphotyrosine antibody (PY), an anti-E-cadherin antibody, or the same anti--catenin antibody used for the immunoprecipitation. Right panel, densitometric analyses from three blots similar to that shown on the left panel (-catenin, black bars; phosphotyrosine, white bars; and E-cadherin, gray bars). C, left panel, cells were serum-starved for 24 h at 39 °C and either left untreated (a) or stimulated thereafter with 100 nM G17-Gly (b-d) or with 100 nM G17-NH2 (e) for 30 min. Some cells were preincubated for 30 min with 10 µM LY 294002 (c) or 50 µM PD 98059 (d) before G17-Gly treatment. Cell lysates were immunoprecipitated (IP) with the anti--catenin antibody and probed (WB) with an anti-E-cadherin antibody (E-cadherin) or the same anti--catenin antibody (-catenin) used for the immunoprecipitation. Right panel, densitometric analyses from three blots similar to that shown on the left panel (-catenin, black bars; and E-cadherin, white bars). D, left panel, cells were treated under the same conditions as in C, and cell lysates were immunoprecipitated (IP) using a selective anti--catenin antibody, and precipitates were run on 8.5% SDS-PAGE, Western-blotted (WB), and probed with an anti-phosphotyrosine antibody (PY) or the same anti--catenin antibody used for the immunoprecipitation. Right panel, densitometric analyses from three blots similar to that shown on the left panel (-catenin, black bars; PY, white bars). Statistical significance for densitometric analyses in B-D was determined using Student's t test, in comparison with untreated cells (*, p < 0.05; **, p < 0.01).

The effect of similar doses of G₁₇-Gly on -catenin in IMGE-5 cells was then studied by Western blotting. G₁₇-Gly induced a rapid increase in the tyrosine phosphorylation of -catenin (Fig. 5B) and a partial dissociation of -catenin from its adherens junction partner E-cadherin (Fig. 5B). Increased tyrosine phosphorylation of -catenin, as well as its dissociation from E-cadherin, was significant after 15 min and maximal 30 min after G₁₇-Gly treatment. The association between -catenin and E-cadherin returned to control values 4 h after treatment, while at that time the tyrosine phosphorylation levels of -catenin were still slightly higher than those found in control cells (Fig. 5Be), perhaps because -catenin can partly reassociate with E-cadherin before being completely dephosphorylated. Alternatively, a slight difference in sensitivity may exist between the detection of phosphorylated -catenin and of the amount of E-cadherin co-immunoprecipitated with -catenin. Tyrosine phosphorylation of -catenin returned to control levels within 12 h after addition of G₁₇-Gly (Fig. 5Bf). Thus, the time course of G₁₇-Gly-induced changes in -catenin phosphorylation and association with E-cadherin correlates well with the partial cytoplasmic relocalization of -catenin detected by immunocytochemistry.

Both the G₁₇-Gly-induced tyrosine phosphorylation of -catenin (Fig. 5D) and its dissociation from E-cadherin (Fig. 5C) were abolished by preincubation with the PI3-kinase inhibitor LY 294002. In contrast, the apparent inability of the MEK1/2 inhibitor PD 98059 to block G₁₇-Gly-induced delocalization of -catenin and dissociation of IMGE-5 cells in the wound healing assay was further supported by a similar lack of effect of this inhibitor on the G₁₇-Gly-induced stimulation of tyrosine phosphorylation of -catenin (Fig. 5Dd) and of its dissociation from E-cadherin (Fig. 5Cd).

Finally, G₁₇-NH₂ showed no effect on the phosphorylation level of -catenin (Fig. 5De) or on its association with E-cadherin (Fig. 5Ce).

Differential Activation of the MAP Kinase Pathway by G₁₇-NH₂ and G₁₇-Gly Is Partly Responsible for the Difference in Biological Effects-- The time course of p42/p44 MAP kinase activation by G₁₇-NH₂ and G₁₇-Gly in IMGE-5 cells was then investigated. A very rapid but transient activation of p42/p44 phosphorylation was induced by G₁₇-NH₂ (Fig. 6A, left panel); activation was found to be maximal within 1 min of stimulation, and the phosphorylation level returned to control levels between 15 and 30 min later (Fig. 6A, graph). On the contrary, the profile of activation by G₁₇-Gly was quite different (Fig. 6A, right panel); p42/p44 phosphorylation was also detected from 1 min after stimulation, but the intensity of phosphorylation was found to increase continuously until 30 min after stimulation, to remain high for up to 3 h, and to return to control levels 6 h after stimulation (Fig. 6A, graph).

View larger version (59K): [in this window] [in a new window]   Fig. 6.   Differential effect of short and long term MAP kinase activation by G17-Gly on IMGE-5 cells. A, cells were serum-starved for 24 h at 39 °C and either left untreated (a) or stimulated with 100 nM G17-NH2 or G17-Gly for 1 (b), 5 (c), 15 (d), or 30 min (e), and 1 (f), 3 (g), or 6 h (h). Equivalent amount of lysates were run on parallel 4-20% gradient SDS-PAGE, and Western blots were probed with an anti-phosphorylated p42/44 MAP kinase antibody (upper panel) to measure MAP kinase activation or an anti-p42/44 MAP kinase antibody (lower panel) to control for equal loading of samples. Densitometric analysis (right panel) was from three similar experiments of MAP kinase stimulation by 100 nM G17-NH2 (closed circles) or 100 nM G17-Gly (open circles). B, 20-30% confluent cells grown in duplicate were serum-starved for 24 h at 39 °C and then left untreated (dotted bars), preincubated with 50 µM PD 98059 for 30 min followed by 100 nM G17-Gly (coarse stripes), or incubated simultaneously with both compounds (fine stripes) in the presence of 100 µM BrdUrd. Cells from one of each duplicate well were lysed 15 min later, and the amount of total (bottom panel) and phosphorylated (upper panel) MAP kinase was measured as described in A, whereas cells from the other wells were grown for a further 18 h and fixed for 3 min in ice-cold methanol. BrdUrd incorporation was measured by immunofluorescence using an anti-BrdUrd antibody. Data are means ± S.E. of five separate experiments. Statistical significance was assessed by ANOVA, as compared with the respective value without PD 98059 (dotted bars). *, p < 0.05; **, p < 0.01. C, cells were grown to confluence, serum-starved for 24 h at 39 °C, and then wounded linearly across the monolayer. They were either left untreated (a) or stimulated with 100 nM G17-Gly (b) in the presence or absence of 50 µM PD 98059. When present, the inhibitor was preincubated for 30 min (c), added with the peptide (d), or added 15 (e) or 30 min (f) after the peptide. Microphotographs of the wounded monolayers were taken 20 h after wounding the cells. Results displayed are representative of four separate experiments.

In order to determine whether the differential MAP kinase activation could explain, at least in part, the different biological effects displayed by both molecular forms of gastrin, activation of the MAP kinase pathway was blocked at different stages of the simulation induced by either form of gastrin, and the consequences on their respective biological activities were investigated. When the early (15 min) activation of the MAP kinase pathway was blocked by preincubating the cells with 50 µM PD 98059 prior to G₁₇-NH₂ or G₁₇-Gly stimulation, the increase in proliferation was abolished (Fig. 6B). On the contrary, when the MAP kinase pathway inhibitor was added simultaneously with each one of the peptides, the early activation of p42/p44 MAP kinases was still detected, and the proliferative effect of G₁₇-NH₂ or G₁₇-Gly was no longer abolished (Fig. 6B). In contrast, the stimulation of migration by G₁₇-Gly was always blocked whether the MAP kinase pathway was blocked 5, 15, or 30 min after addition of the peptide, whereas G₁₇-Gly-induced cell dissociation was unaffected in these conditions (Fig. 6C).

G₁₇-Gly Activates Akt/PKB Phosphorylation-- Finally, we assessed whether G₁₇-Gly and G₁₇-NH₂ were capable of regulating a PI3-kinase-dependent pathway related to apoptosis, through control of Akt/PKB phosphorylation. Although G₁₇-NH₂ had no effect (Fig. 7, upper panel), G₁₇-Gly significantly increased Akt phosphorylation. Activation was detected about 15 min after addition of the peptide, was maximal after 30 min (Fig. 7, lower panel), and decreased regularly down to control values after 60 min. This activation was reversed by preincubation with the PI3-kinase inhibitor LY 294002. 

View larger version (39K): [in this window] [in a new window]   Fig. 7.   Activation of Akt/PKB by G17-Gly. Cells were grown until 90% confluent, serum-starved for 24 h at 39 °C, and either left untreated (a) or stimulated with 100 nM G17-NH2 (A) or 100 nM G17-Gly (B) for 1 (b), 5 (c), 15 (d), 30 (e), or 60 min (f), and 3 (g) or 6 h (h) before being lysed. Equivalent amounts of lysates were run on parallel 4-20% gradient SDS-PAGE, and Western blots were probed with an anti-phosphorylated Akt antibody to measure Akt activation (upper panel) or an anti-Akt antibody to control for equal loading of samples (lower panel). The data shown are representative of three similar experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The results presented in this paper demonstrate the exist-ence of similarities but also major differences in the biological effects of G₁₇-Gly and G₁₇-NH₂ on a non-tumorigenic gastric epithelial cell line (IMGE-5). On the one hand, both G₁₇-NH₂ and G₁₇-Gly stimulated IMGE-5 proliferation, as has been described previously in several other models (1, 4-6). On the other hand, a major difference between the two gastrins is the novel effect of G₁₇-Gly only on the dissociation and migration of gastric epithelial cells. Our results underline the existence of a biological role for G₁₇-Gly that seems specific to this peptide and is not exhibited by G₁₇-NH₂. This finding contrasts with previous work on G₁₇-Gly, which described biological effects also displayed by G₁₇-NH₂, such as cell proliferation (1, 5, 6) or stimulation of gastric acid secretion (24). However, it is in agreement with the recent description of a stimulatory effect of G₁₇-Gly on the invasiveness of the human colon cancer cell line LoVo (8). The enhancement of cell migration by G₁₇-Gly reported herein may be profoundly important in the previously reported roles of progastrin-derived peptides during the differentiation of the gastrointestinal tract, as well as during cancer development and metastasis (see Refs. 1 and 9 for review).

Several reports have recently implicated gastrins in the activation of proteins involved in epithelial cell/matrix adhesion and morphology, such as p130^Cas and paxillin (9). Recent results showing the phosphorylation and activation of p125^FAK by G₁₇-NH₂ via a Src-related pathway are also compatible with a role in cell motility (25), as the role of this non-receptor tyrosine kinase in cell migration is well documented (26). It is worth noting, however, that G₁₇-NH₂ was shown to have an inhibitory effect on the spontaneous motility of glioblastoma cell lines (27). The results reported in this paper provide, to our knowledge, the first demonstration of a direct stimulatory effect for a non-amidated progastrin-derived peptide on cell/cell adhesion between epithelial cells.

This effect was detected at G₁₇-Gly concentrations as low as 100 pM. Serum concentrations of G₁₇-Gly are generally thought to be around 20-50 pM in the fasting state. However, gastrin precursor production is significantly increased in various physiological conditions such as birth and weaning (28, 29), as well as during pathological processes such as gastric adenocarcinoma (30) and gastrinoma (31, 32). The migratory effect of G₁₇-Gly was maximal around 5 nM, as compared with 1 nM for the maximal proliferative effect of the peptide. This slight difference in potency could be explained by differences in the sensitivity of the signaling pathways involved. Furthermore, previous in vitro investigations of G₁₇-Gly effects on renal (33), pancreatic (3, 5), colonic (6, 10), or gastric cells (34, 35) showed a maximal effective dose for G₁₇-Gly varying between 0.1 (14) and 10 nM (3), even when the apparent affinity of G₁₇-Gly receptors seemed higher (see Refs. 33-35 and this work). This apparent discrepancy might indicate that the G₁₇-Gly receptors could exist in various affinity states or that fractional occupancy only is necessary to activate the biological effects downstream of these receptors.

The signal transduction pathways activated by G₁₇-NH₂ in IMGE-5 cells have been reported previously in some, but not all, cell types. The results obtained in this study indicate that MAP kinase activation is essential for the proliferative effect of G₁₇-NH₂ on IMGE-5 cells, and Stepan et al. (10) recently showed that G₁₇-NH₂ stimulated proliferation through a pathway involving MAP kinases in AR42J cells. In contrast, in GH3 cells, G₁₇-NH₂ did not activate this pathway but induced proliferation in a Ca²⁺-dependent manner. In previous studies, activation of G/CCK-B receptors by G₁₇-NH₂ has been shown to induce PI3-kinase activation in transfected Chinese hamster ovary cells (13), probably via the prior formation of a p60^Src-p125^FAK complex (25). Thus, there seems to be a certain degree of cell type specificity in the transduction pathways involved in the proliferative effects of G₁₇-NH₂.

Much less is known about the signal transduction pathways activated by G₁₇-Gly. Reports by Todisco et al. (3) on pancreatic carcinoma cells and Stepan et al. (14) on colorectal carcinoma cells indicate that G₁₇-Gly regulates the transcriptional activation of early genes, through the activation of enzymes such as c-Jun kinase. In these cell lines, the MAP kinase pathway is not involved in the proliferative effect of G₁₇-Gly (3, 13). On the contrary, our results show that p42/p44 MAP kinase activation by G₁₇-Gly as well as G₁₇-NH₂ was involved in their proliferative effect on IMGE-5 cells. However, PI3-kinase was involved selectively in the proliferative effect of G₁₇-Gly only. Further studies on other cell lines will be necessary to assess whether there is also a cell type specificity in the transduction pathways triggered by G₁₇-Gly, whether there are several subtypes of G₁₇-Gly receptors, or whether the signal transduction coupled to these receptors is different in tumor cell lines.

The novel effect of G₁₇-Gly on dissociation and migration of gastric epithelial cells involved both PI3-kinase and MAP kinase pathways. Activation of PI3-kinase was essential at least for cell dissociation, whereas the MAP kinase pathway seemed to be involved only in the motility response of IMGE-5 cells, without affecting their dissociation. This result is interesting, as the role of these two pathways in the dissociating effect of growth factors on other cell types is still unclear. PI3-kinase activation has been shown to participate in the ligand-induced migration of several cell types including renal epithelial cells (36) and vascular smooth muscle cells (37). However, the specific involvement of these pathways in the successive steps of a migratory response, i.e. cell dissociation and motility, has not been clearly defined. A report by Potempa and Ridley (38) showed that both PI3-kinase and MAP kinase activation (by Ras) seemed essential to hepatocyte growth factor-induced adherens junction disassembly in Madin-Darby canine kidney cells. However, in the same cell line, Royal et al. (36) reported that hepatocyte growth factor-induced motility required PI3-kinase activation, whereas pathways downstream from Grb2 (including MAP kinases) were involved in branching tubulogenesis. Recent results on HepG2 human hepatoma cells also showed that PI3-kinase was involved in cell dissociation, whereas inhibition of MEK blocked the motility response to growth factors (39). Our results also directly implicate the PI3-kinase pathway in the G₁₇-Gly-induced tyrosine phosphorylation of -catenin, as well as its dissociation from E-cadherin and delocalization from the adherens junctions. In contrast to HepG2 cells, the MAP kinase pathway does not appear to be involved in this G₁₇-Gly-induced event in IMGE-5 cells.

We also found in this study that the time course of MAP kinase activation by G₁₇-Gly and G₁₇-NH₂ was different, with the former triggering a rapid but short lived phosphorylation, whereas the latter induced a long term activation lasting for 3 h. Furthermore, we showed that the early activation of p42/44 MAP kinases is essential to the proliferative effect of G₁₇-NH₂ and G₁₇-Gly, whereas a longer term activation seems necessary for the migratory response to G₁₇-Gly. A previous study (39) suggested a correlation between the lack of effect of epidermal growth factors on HepG2 cell motility and its ability to induce only a short term increase in the phosphorylation of p42/p44 MAP kinases, whereas factors inducing a scattering of these cells, like hepatocyte growth factor, stimulated MAP kinases for a longer time. However, to our knowledge, this is the first direct demonstration that long term activation of MAP kinases is essential to the migratory response to an exogenous factor.

Interestingly, the stimulation induced by G₁₇-Gly triggered a delayed increase in the activation of Akt/PKB, which was not detected after stimulation with G₁₇-NH₂. This result contradicts recent data (40) showing the activation of an Akt-dependent anti-apoptotic pathway by the formation of E-cadherin-mediated cell/cell contacts in Madin-Darby canine kidney cells. However, the existence of a similar mechanism has been recently demonstrated by Taupin et al. (41), who showed that the migratory effect of intestinal trefoil factor on intestinal cell lines is coupled to anti-apoptotic signals. It is possible that a balancing mechanism would induce activation of an anti-apoptotic pathway when cells are induced to migrate by an exogenous physiological activator. Such a mechanism would be necessary when cells need to migrate in vivo during the epithelial/mesenchymal transition or during processes leading to mucosal restitution and ulcer repair.

Our data showed that IMGE-5 cells are sensitive to both amidated and glycine-extended forms of gastrin. To date the only cell line responding to both molecular forms of gastrin is the rat pancreatic carcinoma cell line AR42J (5). The ligand selectivity of the G₁₇-Gly receptor identified on IMGE-5 cells was similar to that described previously (6) both on AR42J and on YAMC cells. Furthermore, the expression of receptors for both G₁₇-Gly and G₁₇-NH₂ was correlated to the differentiation status of IMGE-5 cells. Although IMGE-5 cells do not express G/CCK-B receptors under permissive conditions, they still express binding sites for G₁₇-Gly, albeit at a lower density. IMGE-5 could therefore represent a unique tool for the parallel and independent study of biological effects and signal transduction pathways associated with G₁₇-Gly and G₁₇-NH₂ activation.

Finally, our results demonstrating an effect of G₁₇-Gly on the migration of gastric epithelial cells could reflect a potential physiological role for this peptide during ontogeny, in gastroduodenal ulcer disease, or during the progression of carcinomas. Although the available results are still scarce, there seems to be a general tendency toward the expression of partially processed rather than mature forms of gastrin in the early stages of development (at a stage when migration of cells to form the gastric pits is maximal), as well as during carcinoma development (42-44). The role of these partially processed forms in colonic proliferation is well established in vivo (1, 9, 45). Furthermore, a correlation could exist between serum concentrations of total progastrin products and the presence of liver metastasis in colorectal cancer (46) as well as in patients affected by the rare Zollinger-Ellison syndrome (32). Furthermore, antibodies neutralizing both amidated and glycineextended forms of gastrin have been shown to inhibit the spontaneous metastasis of a human colorectal tumor when injected into immunodeficient mice (47). Therefore, the potential role of progastrin-derived peptides on migration needs to be further investigated in other models, in order to assess to what extent the results presented in this paper extend beyond the gastric mucosa and represent a general regulatory mechanism in the gastrointestinal tract.

	FOOTNOTES

^* This work was supported in part by Grants 940924 and 980625 from the National Health and Medical Research Council of Australia (to G. B), IREX Grant X00001703 from the Australian Research Council, and by the French Ministry for Education and Research and the Association pour la Recherche contre le Cancer.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Both authors contributed equally to this work.

^¶ Supported by the Fondation pour la Recherche Médicale, France.

^** To whom correspondence should be addressed: Dept. of Surgery, Austin Campus, A&RMC, Studley Rd., Heidelberg, Victoria 3084, Australia. Tel.: 613 9496 5592; Fax: 613 9458 1650; E-mail: g.baldwin@surgeryaustin.unimelb.edu.au.

Published, JBC Papers in Press, August 8, 2001, DOI 10.1074/jbc.M105090200

	ABBREVIATIONS

The abbreviations used are: G₁₇-NH₂, amidated gastrin 17; CCK, cholecystokinin; MAP, mitogen-activated protein; PI3-kinase, phosphatidylinositol 3-kinase; FCS, fetal calf serum; PBS, phosphate-buffered saline; BrdUrd, bromodeoxyuridine; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; PCR, polymerase chain reaction; ANOVA, analysis of variance; G₁₇-Gly, glycine-extended gastrin 17; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. Schott, C. Sagert, H. S. Willenberg, S. Schinner, U. Ramp, A. Varro, A. Raffel, C. Eisenberger, K. Zacharowski, A. Perren, et al. Carcinogenic Hypergastrinemia: Signet-Ring Cell Carcinoma in a Patient with Multiple Endocrine Neoplasia Type 1 with Zollinger-Ellison's Syndrome J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3378 - 3382. [Abstract] [Full Text] [PDF]

				W. Rengifo-Cam, S. Umar, S. Sarkar, and P. Singh Antiapoptotic Effects of Progastrin on Pancreatic Cancer Cells Are Mediated by Sustained Activation of Nuclear Factor-{kappa}B Cancer Res., August 1, 2007; 67(15): 7266 - 7274. [Abstract] [Full Text] [PDF]

				H. He, J. Pannequin, J.-P. Tantiongco, A. Shulkes, and G. S. Baldwin Glycine-extended gastrin stimulates cell proliferation and migration through a Rho- and ROCK-dependent pathway, not a Rac/Cdc42-dependent pathway Am J Physiol Gastrointest Liver Physiol, September 1, 2005; 289(3): G478 - G488. [Abstract] [Full Text] [PDF]

				A. Ferrand, C. Bertrand, G. Portolan, G. Cui, J. Carlson, L. Pradayrol, D. Fourmy, M. Dufresne, T. C. Wang, and C. Seva Signaling Pathways Associated with Colonic Mucosa Hyperproliferation in Mice Overexpressing Gastrin Precursors Cancer Res., April 1, 2005; 65(7): 2770 - 2777. [Abstract] [Full Text] [PDF]

				F. Hollande, A. Shulkes, and G. S. Baldwin Signaling the Junctions in Gut Epithelium Sci. Signal., March 29, 2005; 2005(277): pe13 - pe13. [Abstract] [Full Text] [PDF]

				J. Aarbiou, R. M. Verhoosel, S. van Wetering, W. I. de Boer, J. H. J. M. van Krieken, S. V. Litvinov, K. F. Rabe, and P. S. Hiemstra Neutrophil Defensins Enhance Lung Epithelial Wound Closure and Mucin Gene Expression In Vitro Am. J. Respir. Cell Mol. Biol., February 1, 2004; 30(2): 193 - 201. [Abstract] [Full Text] [PDF]

				J. Pannequin, S. Kovac, J.-P. Tantiongco, R. S. Norton, A. Shulkes, K. J. Barnham, and G. S. Baldwin A Novel Effect of Bismuth Ions: SELECTIVE INHIBITION OF THE BIOLOGICAL ACTIVITY OF GLYCINE-EXTENDED GASTRIN J. Biol. Chem., January 23, 2004; 279(4): 2453 - 2460. [Abstract] [Full Text] [PDF]

				T. J. Koh, J. K. Field, A. Varro, T. Liloglou, P. Fielding, G. Cui, J. Houghton, G. J. Dockray, and T. C. Wang Glycine-Extended Gastrin Promotes the Growth of Lung Cancer Cancer Res., January 1, 2004; 64(1): 196 - 201. [Abstract] [Full Text] [PDF]

				H. Wu, A. Owlia, and P. Singh Precursor peptide progastrin1-80 reduces apoptosis of intestinal epithelial cells and upregulates cytochrome c oxidase Vb levels and synthesis of ATP Am J Physiol Gastrointest Liver Physiol, December 1, 2003; 285(6): G1097 - G1110. [Abstract] [Full Text] [PDF]

				C. Wadham, J. R Gamble, M. A Vadas, and Y. Khew-Goodall The Protein Tyrosine Phosphatase Pez Is a Major Phosphatase of Adherens Junctions and Dephosphorylates {beta}-Catenin Mol. Biol. Cell, June 1, 2003; 14(6): 2520 - 2529. [Abstract] [Full Text] [PDF]

				F. Hollande, D. J. Lee, A. Choquet, S. Roche, and G. S. Baldwin Adherens junctions and tight junctions are regulated via different pathways by progastrin in epithelial cells J. Cell Sci., April 1, 2003; 116(7): 1187 - 1197. [Abstract] [Full Text] [PDF]

				Y.-T. Tai, K. Podar, N. Mitsiades, B. Lin, C. Mitsiades, D. Gupta, M. Akiyama, L. Catley, T. Hideshima, N. C. Munshi, et al. CD40 induces human multiple myeloma cell migration via phosphatidylinositol 3-kinase/AKT/NF-kappa B signaling Blood, April 1, 2003; 101(7): 2762 - 2769. [Abstract] [Full Text] [PDF]

				S. Martin, J.-P. Vincent, and J. Mazella Involvement of the Neurotensin Receptor-3 in the Neurotensin-Induced Migration of Human Microglia J. Neurosci., February 15, 2003; 23(4): 1198 - 1205. [Abstract] [Full Text] [PDF]

				P. Singh, X. Lu, S. Cobb, B. T. Miller, N. Tarasova, A. Varro, and A. Owlia Progastrin1-80 stimulates growth of intestinal epithelial cells in vitro via high-affinity binding sites Am J Physiol Gastrointest Liver Physiol, February 1, 2003; 284(2): G328 - G339. [Abstract] [Full Text] [PDF]

				D. Brown, U. Yallampalli, A. Owlia, and P. Singh pp60c-Src Kinase Mediates Growth Effects of the Full-Length Precursor Progastrin1-80 Peptide on Rat Intestinal Epithelial Cells, in Vitro Endocrinology, January 1, 2003; 144(1): 201 - 211. [Abstract] [Full Text] [PDF]

				P. J. M. Noble, G. Wilde, M. R. H. White, S. R. Pennington, G. J. Dockray, and A. Varro Stimulation of gastrin-CCKB receptor promotes migration of gastric AGS cells via multiple paracrine pathways Am J Physiol Gastrointest Liver Physiol, January 1, 2003; 284(1): G75 - G84. [Abstract] [Full Text] [PDF]

				J. Pannequin, K. J. Barnham, F. Hollande, A. Shulkes, R. S. Norton, and G. S. Baldwin Ferric Ions Are Essential for the Biological Activity of the Hormone Glycine-extended Gastrin J. Biol. Chem., December 6, 2002; 277(50): 48602 - 48609. [Abstract] [Full Text] [PDF]

				X. Guo, J. N. Rao, L. Liu, M. Rizvi, D. J. Turner, and J.-Y. Wang Polyamines regulate beta -catenin tyrosine phosphorylation via Ca2+ during intestinal epithelial cell migration Am J Physiol Cell Physiol, September 1, 2002; 283(3): C722 - C734. [Abstract] [Full Text] [PDF]

				A. Pagliocca, L. E. Wroblewski, F. J. Ashcroft, P. J. Noble, G. J. Dockray, and A. Varro Stimulation of the gastrin-cholecystokininB receptor promotes branching morphogenesis in gastric AGS cells Am J Physiol Gastrointest Liver Physiol, August 1, 2002; 283(2): G292 - G299. [Abstract] [Full Text] [PDF]

				A. Graness, C. E. Chwieralski, D. Reinhold, L. Thim, and W. Hoffmann Protein Kinase C and ERK Activation Are Required for TFF- peptide-stimulated Bronchial Epithelial Cell Migration and Tumor Necrosis Factor-alpha -induced Interleukin-6 (IL-6) and IL-8 Secretion J. Biol. Chem., May 17, 2002; 277(21): 18440 - 18446. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/44/40402    most recent M105090200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hollande, F. Articles by Baldwin, G. S. Search for Related Content PubMed PubMed Citation Articles by Hollande, F. Articles by Baldwin, G. S. Social Bookmarking                      What's this?