JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M106212200 on September 10, 2001

J. Biol. Chem., Vol. 276, Issue 45, 42588-42600, November 9, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/45/42588    most recent
M106212200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bennett, S. E.
Right arrow Articles by Mosbaugh, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bennett, S. E.
Right arrow Articles by Mosbaugh, D. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Fidelity of Uracil-initiated Base Excision DNA Repair in DNA Polymerase beta -Proficient and -Deficient Mouse Embryonic Fibroblast Cell Extracts*

Samuel E. BennettDagger , Jung-Suk SungDagger , and Dale W. MosbaughDagger §||

From the Departments of Dagger  Environmental and Molecular Toxicology and § Biochemistry and Biophysics and the  Environmental Health Sciences Center, Oregon State University, Corvallis, Oregon 97331-7301

Received for publication, July 3, 2001, and in revised form, September 5, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Uracil-initiated base excision DNA repair was conducted using homozygous mouse embryonic fibroblast DNA polymerase beta  (+/+) and (-/-) cells to determine the error frequency and mutational specificity associated with the completed repair process. Form I DNA substrates were constructed with site-specific uracil residues at U·A, U·G, and U·T targets contained within the lacZalpha gene of M13mp2 DNA. Efficient repair was observed in both DNA polymerase beta  (+/+) and (-/-) cell-free extracts. Repair was largely dependent on uracil-DNA glycosylase activity because addition of the PBS-2 uracil-DNA glycosylase inhibitor (Ugi) protein reduced (~88%) the initial rate of repair in both types of cell-free extracts. In each case, the DNA repair patch size was primarily distributed between 1 and 8 nucleotides in length with 1 nucleotide repair patch constituting ~20% of the repair events. Addition of p21 peptide or protein to DNA polymerase beta  (+/+) cell-free extracts increased the frequency of short-patch (1 nucleotide) repair by ~2-fold. The base substitution reversion frequency associated with uracil-DNA repair of M13mp2op14 (U·T) DNA was determined to be 5.7-7.2 × 10-4 when using DNA polymerase beta  (+/+) and (-/-) cell-free extracts. In these two cases, the error frequency was very similar, but the mutational spectrum was noticeably different. The presence or absence of Ugi did not dramatically influence either the error rate or mutational specificity. In contrast, the combination of Ugi and p21 protein promoted an increase in the mutation frequency associated with repair of M13mp2 (U·G) DNA. Examination of the mutational spectra generated by a forward mutation assay revealed that errors in DNA repair synthesis occurred predominantly at the position of the U·G target and frequently involved a 1-base deletion or incorporation of dTMP.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Uracil residues accumulate in DNA following incorporation of dUMP in place of dTMP during DNA synthesis as well as by spontaneous deamination of existing cytosine residues that form premutagenic U·G mispairs (1-3). In mammalian cells, the presence of uracil in DNA may have cytotoxic, mutagenic, and lethal consequences (1, 4-6). To avoid these deleterious effects, the uracil-initiated base excision repair pathway has evolved to remove uracil residues from the genome (2, 3, 7). The fundamental chemo-mechanical steps of uracil-mediated BER1 have been described previously in considerable molecular detail (8, 9).

Several enzymes capable of uracil-excision (UNG, TDG, MED1, and SMUG) have been identified in mammalian cells (10-13); however, the extent to which each participates in BER in vivo remains to be determined. Although these uracil-DNA glycosylases share a common mode of action for cleavage of the N-glycosylic bond linking the uracil base to the deoxyribose phosphate DNA backbone, they differ in substrate specificity. The major uracil-DNA glycosylase activity detected in mammalian cell extracts is UNG (UNG1 and UNG2) (14-16). UNG preferentially recognizes uracil residues in single-stranded DNA and is also active on duplex DNA containing U·G mispairs and U·A base pairs (17). In contrast, human thymine-DNA glycosylase does not recognize uracil in single-stranded DNA but does excise uracil residues in double-stranded DNA with the following specificity: U·G > U·C > U·T U·A (18, 19). The human MED1 (also termed MBD4) enzyme acts on U·G mispairs in the context of methylated or unmethylated CpG sites, but activity against uracil-containing single-stranded DNA and U·A, U·C, or U·T double-stranded DNA substrates was not detected (20). Finally, the single strand-selective monofunctional uracil-DNA glycosylase (SMUG1) removes uracil residues preferentially from single-stranded DNA relative to U·G-containing duplex DNA; however, the catalytic efficiency of xSMUG1 compared with UNG for both single- and double-stranded DNA was reduced 10- and 70-fold, respectively (13).

The uracil-DNA glycosylases described above can also be differentiated based on their sensitivity to inhibition by the bacteriophage PBS-1 and -2 uracil-DNA glycosylase inhibitor (Ugi) protein (1, 13, 21). Ugi acts as a DNA mimic and binds to UNG, forming a stable 1:1 complex that is essentially irreversible under physiological conditions (22-25). High resolution x-ray structures of Ugi in complex with the human UNGDelta 84 (22) or Escherichia coli Ung (23) have revealed an intricate shape, electrostatic and hydrophopic complementarity between the interacting proteins. The observation that Ugi inactivates these biologically distinct enzymes was not surprising because these proteins share 55.7% identical amino acid residues (23, 26). In contrast, TDG, MED1, and SMUG, which do not share similar amino acid homology with UNG, are insensitive to inhibition by Ugi (13, 18, 27, 28). Thus, addition of Ugi to cell-free extracts has been effectively used to investigate Ugi-sensitive and Ugi-insensitive modes of uracil-initiated BER (21, 29).

Following removal of the uracil base and incision of the ensuant apyrimidinic site, a DNA repair tract is synthesized by DNA polymerase(s) that results in either a short (1 nucleotide) or long (2 or more nucleotides) repair patch (30-33). Short-patch BER of a uracil-containing duplex oligonucleotide (51-mer) has been reconstituted in vitro using the following four purified human enzymes: uracil-DNA glycosylase (UNGDelta 84), apurinic/apyrimidinic endonuclease (HAP1), DNA polymerase beta  (POL beta ), and DNA ligase I (LIG I) (34). Alternatively, DNA ligase III (LIG III) has been successfully substituted for LIG I in short-patch BER reactions (35). In the latter case, addition of XRCC1 protein was found to suppress strand displacement DNA synthesis by POL beta  and promote efficient ligation after the single nucleotide gap-filling reaction that is necessary for short-patch BER (35, 36). In BER reactions containing plasmid DNA bearing a single AP site and extracts of xrcc1 mutant hamster cells, a partial defect in ligation was detected that disrupted only the short-patch BER pathway (37). It is important to indicate that short-patch BER has also been observed in extracts of POL beta -deficient mouse embryonic fibroblast cells (31, 38, 39) indicating that one or more other DNA polymerases, such as POL delta  or POL epsilon , can act in the single nucleotide gap-filling reaction. Recently, DNA polymerase iota  (POL iota ) was shown to possess an intrinsic 5'-deoxyribose phosphodiesterase activity similar to that of POL beta  (40). Furthermore, in vitro reconstitution reactions were conducted that showed POL iota  can substitute for POL beta  and can perform complete BER with UNG, HAP1, and LIG I using an oligonucleotide (34-mer) substrate containing either a U·A or U·G target (40). A reconstituted enzyme system has also been developed for long-patch BER of a reduced AP site located in a defined oligonucleotide (60-mer) utilizing purified HAP1, POL beta , DNase IV (FEN 1), and LIG I (41). In this system, addition of proliferating cell nuclear antigen (PCNA) was observed to strongly stimulate the repair reaction and promote strand displacement gap-filling DNA synthesis involving two to six nucleotides (41). Furthermore, purified POL delta  was found to substitute for POL beta , providing PCNA was present in the reaction (41). In extracts of mouse embryonic fibroblast POL beta -deficient cells, both short- and long-patch BER were found to be strictly dependent on PCNA (31). PCNA-dependent long-patch BER has been also demonstrated in reconstituted systems, where it was shown to be heavily dependent on the circularity of the in vitro BER DNA substrate (30, 42-44).

Specific interactions have been detected between PCNA and a number of proteins involved in DNA repair, such as LIG I (45), FEN1 (46, 47), UNG2 (48), and p21(Cip1/WAF1) (49). These proteins share a consensus PCNA-binding motif composed of eight amino acids (50) and bind to the same region of PCNA (51, 52). p21 is a p53-inducible bi-modal inhibitor of DNA replication that binds PCNA with 1:1 stoichiometry at the C-terminal domain while maintaining the PCNA homotrimeric ring structure (49, 52). Thus, the inhibitory effect of p21 appears to lie in masking the interface required for protein interactions (52). Intriguingly, a p21 peptide (20 amino acids) spanning the C-terminal PCNA-binding motif was found to be sufficient for inhibition of PCNA function in DNA replication and repair (51). Both the p21 peptide and protein have proved to be useful tools with which to probe the role of PCNA in DNA repair (53, 54).

Although the biochemical steps of both uracil-initiated short- and long-patch BER pathways have been studied, the fidelity and mutational specificity associated with mammalian BER have not been directly investigated. Whereas in vitro studies to determine the fidelity of the gap-filling DNA synthesis for various purified mammalian DNA polymerases provide useful information (55-57), an assessment of the mutation frequency associated with completed uracil-initiated BER remains to be fully elucidated. In the present study, we have developed M13mp2 lacZalpha DNA-based assays to assess the accuracy of uracil-initiated BER using mouse embryonic fibroblast cells. We have examined the efficiency, fidelity, mutational specificity, and patch size of uracil-initiated BER in extracts of isogenic POL beta -proficient and POL beta -deficient cells in the presence and absence of the uracil-DNA glycosylase inhibitor protein. In addition, the influence of p21 peptide and protein on the kinetics, patch size, and fidelity of uracil-initiated BER was investigated.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- PCR primers FP-18-mer, RP-18-mer, and DNA sequencing primer S-21-mer have been described previously (58). Oligodeoxynucleotides U-23-mer and A-23-mer, used in the construction of M13mp2op14 (U·T)2 heteroduplex and M13mp2op14 (A·T) homoduplex, have been described (58). Oligodeoxynucleotides CCCAGTCACGUCATTGTAAAACG (U80-23-mer),3 GGTTTTCCCAGTCUCGTCATTGAAAACG (U83-29-mer), CCAGGGTTTTCCCAGTCACGACG (C89-23-mer), and CCAGGGTTTTCUCAGTCACGACG (U89-23-mer) were obtained from Oligos Etc. and were used to prepare M13mp2op14 (U·A) and (5'-U·T)4 DNA and M13mp2 (C·G) and (U·G) DNA, respectively. Oligodeoxynucleotide preparations were purified by denaturing polyacrylamide gel electrophoresis and 5'-end phosphorylated as described (29).

E. coli strains NR9162 and CSH50 were obtained from T. A. Kunkel (NIEHS, National Institutes of Health), as was M13mp2 phage. DNA polymerase beta -proficient (MB16tsA, clone 1B5) or -deficient (MB19tsA, clone 2B2) SV40-immortalized mouse embryonic fibroblast (MEF) cell lines were obtained from American Type Culture Collection. Purified human DNA polymerase beta  (Mono S fraction) (59) and rabbit anti-DNA polymerase beta  polyclonal antibodies were provided by S. H. Wilson (NIEHS, National Institutes of Health). Sources of purified enzymes (E. coli Ung, Nfo, and Xth; PBS-2 Ugi; T4 DNA polymerase, T4 polynucleotide kinase, and T4 DNA ligase; restriction endonucleases EcoRI and SmaI) have been reported previously (58). The p21 peptide GRKRRQTSMTDFYHSKRRLIFS that binds PCNA was synthesized by Research Genetics and resuspended in p21 peptide solubilization buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 100 mM NaCl) as described by Pan et al. (53). The human C-terminal hexahistidine-tagged p21 expression plasmid pET-Cip1 (49) was provided by J. Massague (Sloan-Kettering Cancer Institute), and p21 protein was purified as described below.

Purification of p21 Protein-- His-tagged p21 was overproduced in E. coli BL21-DE3/pET-Cip1 cells (1.5 liters) according to established protocols (pET Manual, Novagen). Bacterial cells were pelleted by centrifugation at 4000 × g for 15 min, resuspended in 40 ml of sonification buffer (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol) supplemented with 1 mg/ml chicken egg white lysozyme (Sigma), and stored at -80 °C. After thawing on ice, cells were subjected to sonification at 0 °C (Branson 450 Sonifier, 1/2-inch horn, 50% duty cycle, 20 pulses), and inclusion bodies containing p21 protein were collected by centrifugation at 12,000 × g for 15 min (fraction I). The supernatant fraction was discarded, and the pellet was washed briefly with ice-cold distilled H2O and centrifuged as before. After discarding the supernatant, the pellet was resuspended in 10 ml of denaturing buffer (100 mM sodium phosphate, 10 mM Tris-HCl, 8 M urea (pH 8.0)) and again subjected to centrifugation. The resultant supernatant (fraction II) was applied directly to a Ni2+-nitrilotriacetic acid-agarose (Qiagen) column (0.79 cm2 × 3 cm) equilibrated in denaturing buffer and washed with 5 column volumes of denaturing buffer (pH 8.0) followed by 15 column volumes of denaturing buffer (pH 6.3). Finally, the p21 protein was eluted from the column by the addition of 20 ml of denaturing buffer (pH 4.5). Fractions (1 ml) were collected, and those enriched for p21 protein as determined by 12% SDS-polyacrylamide gel electrophoresis (25) were pooled and extensively dialyzed at 4 °C against AE buffer (2 M urea, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol, 10% (w/v) glycerol). The dialysate was applied to a DEAE-Sephadex A-50 (Amersham Pharmacia Biotech) column (1.79 cm2 × 5 cm) equilibrated in AE buffer, washed with 12 column volumes of equilibration buffer, and eluted with a linear gradient (40 ml) from 0 to 1 M NaCl in AE buffer. Fractions (2 ml) were collected, and those containing p21 were pooled, dialyzed against p21 storage buffer (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol, 500 mM NaCl, 10% (w/v) glycerol), concentrated using Centricon 30 concentrators, and stored at -80 °C. Protein concentrations were determined by the Bradford reaction (60) using the Bio-Rad Protein Assay reagent with BSA as the standard.

Preparation of Base Excision Repair DNA Substrates-- M13mp2op14 DNA containing an opal codon located at nucleotide positions 78-80 of lacZalpha gene was constructed and isolated as described previously by Sung et al. (58); M13mp2 DNA was isolated using the same procedure. Briefly, purified single-stranded M13 DNA was annealed to the appropriate 5'-end phosphorylated oligodeoxynucleotide, and the primed template DNA was subjected to a primer extension reaction as described previously (29). Covalently closed circular duplex DNA reaction products were subjected to cesium chloride/ethidium bromide gradient equilibrium centrifugation, and form I DNA was isolated, extracted, concentrated, and buffer exchanged into TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA) as described (58). The isolated DNA was >95% form I as determined by 0.8% agarose gel electrophoresis (29).

Preparation of Mouse Embryonic Fibroblast Cell-free Extracts-- MEF cells (POL beta  (+/+)) were grown in DMEM/Ham's F-12 medium (1:1) (Life Technologies, Inc.) supplemented with 10% fetal bovine serum, 4.8 mg/ml NaHCO3, and 50 units/ml each of penicillin and streptomycin. Cell cultures were incubated at 37 °C, 5% CO2, and 90% humidity and grown to ~90% confluency in 175-cm2 tissue culture flasks. Cells were harvested using trypsin/EDTA (0.25% trypsin, 1 mM EDTA) and resuspended in phosphate-buffered saline (8.1 mM Na2HPO4, 1.5 mM KH2PO4, 2.7 mM KCl, 137 mM NaCl, pH 7.4). Cell-free extracts were prepared as described by Sanderson and Mosbaugh (29), dialyzed against 25 mM Hepes-KOH (pH 7.9), 100 mM KCl, 12 mM MgCl2, 1 mM EDTA, 2 mM dithiothreitol, and 17% (w/v) glycerol, and flash-frozen in liquid N2 as small droplets. The protein concentration of the cell-free extracts (5-10 mg/ml) was determined using Bio-Rad Protein Assay reagent.

Western Blot Analysis of MEF POL beta  Cell-free Extracts-- Proteins were resolved by 12.5% SDS-polyacrylamide gel electrophoresis (25) with a Mini-Protean II apparatus (Bio-Rad), equipped with 0.8-mm spacers, and transferred to a polyvinylidene difluoride membrane (Immobilon-P, Millipore) using a semi-dry transfer method (Milliblot-Graphite Electroblotter I, Millipore). After transfer at 2.5 mA/cm2 for 25 min, the membrane was blocked overnight in BSA buffer (10 mM Hepes-KOH (pH 7.6), 150 mM NaCl, 0.2% BSA, 0.02% Tween 80). Anti-POL beta  serum was diluted 1:5,000 in BSA buffer and incubated with the membrane 1 h at room temperature. After washing three times with BSA buffer, alkaline phosphatase secondary antibody (goat anti-rabbit IgG, Roche Molecular Biochemicals) was diluted 1:2,000 in BSA buffer and incubated with the membrane for 30 min. The membrane was again washed and then developed with nitro blue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate according the manufacturer's recommendations (Bio-Rad).

Uracil-DNA Glycosylase Inhibitor Assays-- Two assays were employed to measure Ugi-mediated inhibition of uracil-DNA glycosylase activity in MEF POL beta  (+/+) cell-free extracts. In the first assay, reaction mixtures (100 µl) contained M13mp2op14 (U·T) [32P]DNA (1 µg), 100 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol, and Ugi (0-1000 units) as indicated. Following incubation at 30 °C for 5 min, the reactions were terminated by heating at 70 °C for 3 min, treated with RNase A and proteinase K, and the DNA recovered by electroelution as described below. The DNA from each reaction was resuspended in 20 µl of TE buffer, and a sample (~100 ng) was subjected to digestion with excess EcoRI and SmaI for 1 h at 25 °C; reactions were terminated by heating at 70 °C for 10 min. After each sample was treated with Nfo (1 unit) for 30 min at 37 °C, the reaction products were resolved by 12% polyacrylamide, 8.3 M urea gel electrophoresis (29). After drying the gel under vacuum, autoradiography was performed, and the amount of 32P radioactivity associated with the substrate (40-mer) and product (19-mer) band for each reaction was quantified using a PhosphorImager. The uracil-DNA glycosylase activity in each reaction was determined as the quotient of the 32P radioactivity associated with the product band divided by the sum of the 32P radioactivity associated with both product and substrate bands. In turn, these values were expressed as a percentage of the amount of uracil-DNA glycosylase activity observed in the absence of Ugi. To calculate the degree of inhibition caused by a Ugi addition, the amount (%) of uracil-DNA glycosylase activity was subtracted from 100.

In the second uracil-DNA glycosylase inhibitor assay, uracil-DNA glycosylase activity was quantified by liquid scintillation counting of free [3H]uracil as excised from [uracil-3H]calf thymus DNA. Uracil-DNA glycosylase reaction mixtures (100 µl) contained 70 mM Hepes-KOH (pH 7.9), 1 mM EDTA, 1 mM dithiothreitol, 10 µg [uracil-3H]calf thymus DNA (specific activity 150 cpm/pmol), 50 µg of MEF POL beta  (+/+) cell-free extract, and Ugi as indicated. Following incubation at 30 °C for 30 min, reactions were terminated on ice by the addition of 250 µl of 10 mM ammonium formate (pH 4.2). Free [3H]uracil was resolved from non-hydrolyzed [uracil-3H]DNA using a Bio-Rad 1-X8 (formate form) column equilibrated in 10 mM ammonium formate (pH 4.2) as described previously by Bennett and Mosbaugh (24).

Base Excision DNA Repair Reactions-- Standard BER reaction mixtures (100 µl) contained 100 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 1 mM dithiothreitol, 0.1 mM EDTA, 2 mM ATP, 0.5 mM beta -NAD, 20 µM each of dATP, dTTP, dGTP, and dCTP, 5 mM phosphocreatine, 200 units/ml phosphocreatine kinase, 10 µg/ml of the appropriate M13mp2 (form I) DNA substrate, and 0.5 mg/ml cell-free extract. Following incubation at 30 °C, the reactions were terminated after various times by adjustment to 20 mM EDTA and heated at 70 °C for 3 min. RNase A was then added to 80 µg/ml, and the reaction mixtures were incubated at 37 °C for 10 min. Each reaction was then adjusted to 0.5% SDS and 190 µg/ml proteinase K, incubated for 30 min at 37 °C, and the duplex M13mp2 DNA was isolated and resuspended in 20 µl of TE buffer as described by Sanderson and Mosbaugh (29).

Analysis of Base Excision DNA Repair Reaction Products-- Samples (5 µl) of the M13mp2 DNA isolated from base excision DNA repair reactions were treated with Ung (100 units) for 30 min at 37 °C to remove uracil residues that had escaped repair during the BER reaction. After quenching the uracil-DNA glycosylase reaction by adding Ugi (1000 units), the samples were further incubated with Nfo (1 unit) for 30 min at 37 °C to incise AP sites. Nfo was inactivated by heating at 70 °C for 3 min, and form I DNA that was resistant to the combined Ung/Nfo treatment (i.e. repaired) was resolved from form II DNA by 0.8% agarose gel electrophoresis. The amount of form I and form II DNA was determined by comparing the fluorescent intensity at 300 nm of the ethidium bromide-stained DNA reaction products to that of co-electrophoresed form I and form II DNA standards (58, 61). The fluorescent intensity data was captured with a gel documentation system (Ultraviolet Products) and quantified using the ImageQuant computer program (Molecular Dynamics).

Determination of Repair Patch Size-- Standard BER reaction mixtures were prepared as described except that a 2'-deoxyribonucleoside alpha -thiotriphosphate was used in place of each of the four 2-deoxyribonucleoside triphosphates, and 32P-labeled M13mp2op14 (U·T) DNA (form I) was used as the BER substrate. The [32P]DNA substrate was constructed as described previously (61, 62) and contained a 32P radiolabel located 13 nucleotides upstream of the target uracil and 7 nucleotides downstream of the SmaI restriction site on the transcribed strand of the lacZalpha gene sequence. Following the BER reactions, DNA products were isolated as described above and resuspended in 20 µl of TE buffer. Samples (4 µl, ~200 ng) were removed for digestion with 10 units of EcoRI for 1 h at 25 °C. The reaction was terminated at 70 °C for 10 min, and samples were incubated in the absence or the presence of various amounts of E. coli exonuclease III (Xth) for 1 h at 37 °C. After incubation, each sample was heated at 70 °C for 10 min, and the [32P]DNA was then cleaved with 10 units of SmaI for 1 h at 25 °C. An equal volume of denaturing formamide dye buffer was added, and [32P]DNA products were resolved by 12% polyacrylamide, 8.3 M urea gel electrophoresis. After drying the gel under vacuum, autoradiography was performed, and the amount of 32P radioactivity associated with each band was quantified using a PhosphorImager and the ImageQuant computer program.

Isolation of Repaired Form I DNA-- Repaired form I DNA was isolated from standard BER reaction mixtures following Ung/Nfo treatment and 0.8% agarose gel electrophoresis, as described above. Form I DNA was recovered from agarose gel slices by electroelution using an Elutrap apparatus (Schleicher & Schuell); electroelution was conducted for 3 h at 150 V in TAE buffer (40 mM Tris acetate, 1 mM EDTA, pH 8.0). The recovered form I DNA was concentrated using a Centricon 30 concentrator (Amicon) and buffer-exchanged into distilled water for further analysis.

Determination of Mutation Frequencies and Mutational Spectra-- E. coli NR9162 (mutS) cells were transfected with repaired M13 DNA (form I), combined with E. coli CSH50 (indicator strain) and top agar containing 0.4 mM beta -D-thiogalactopyranoside and 1 mg/ml 5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside, and plated on M9 plates as described (29). After scoring the phage plaques as either colorless or blue, the mutation frequency was calculated as the ratio of the number of mutant plaques to total plaques detected. Mutant plaques were blue in reversion assays (M13mp2op14 (A·T), (U·T), (5'-U·T), and (U·A) DNAs) and white in forward mutation assays (M13mp2 (C·G) and (U·G) DNAs). Secondary screening of each mutant plaque was then conducted in preparation for PCR amplification of the lacZalpha gene (58) and subsequent nucleotide sequence analysis that was conducted by the Center for Gene Research and Biotechnology (Oregon State University).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Uracil-initiated Base Excision DNA Repair Assay-- Sanderson and Mosbaugh (29) previously developed an M13mp2op14 lacZalpha (U·T) DNA-based reversion assay to detect uracil-initiated BER in cell-free extracts and determine the base substitution error frequency associated with the completed repair reaction (Fig. 1, A and B). By replacing the arginine amino acid codon 14 (CGT) with the opal codon (TGA), lacZalpha was rendered incapable of alpha -complementation (29). Heteroduplex DNA (form I) was synthesized that contained a uracil residue in the complementary (-)-strand at the first position of the opal codon to create a U·T mispair at position +78; excision of the target uracil residue served to initiate the BER reaction (Fig. 1B). If BER DNA synthesis was unfaithful and incorporated either dGMP, dCMP, or dTMP at position 78, reversion of the opal codon occurred, resulting in restored lacZalpha complementation and a blue plaque phenotype. As control, homoduplex DNA containing an A·T base pair at position +78 was also constructed to evaluate the background level of non-uracil-mediated reversion of the opal codon in the cell-free extract (Fig. 1A). By using this assay with M13mp2op14 lacZalpha (U·T) DNA and other DNA substrates (Fig. 1, C-F), the fidelity and mutational specificity of the uracil-initiated BER pathway was investigated using isogenic DNA polymerase beta -proficient (+/+) and DNA polymerase beta -deficient (-/-) mouse embryonic fibroblast cells.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   Substrates for measurement of uracil-initiated base excision DNA repair fidelity in mammalian cell-free extracts. M13mp2 lacZalpha DNA substrates (A-F) were constructed as described under "Experimental Procedures." The EcoRI (+59 cleavage site) and SmaI (+98 cleavage site) restriction endonuclease recognition sites within the lacZalpha gene of M13mp2 DNA are indicated, as is the direction of DNA synthesis (arrow) during BER. Nucleotide positions 59-95 of the E. coli lacZalpha gene are depicted where position +1 corresponds to the first lacZalpha transcribed base. The transcribed and template DNA strands are labeled as (-) and (+), respectively. Substrates A-D are based on M13mp2op14 DNA (29), in which positions 78-80 have been changed to an opal codon, and position 98 has been altered to create a unique SmaI site; substrates E and F are based on M13mp2 DNA. Substrates A-F are referred to in the text as M13mp2op14 (A·T), (U·T), (U·A), (5'-U·T) DNA, and M13mp2 (C·G) and (U·G) DNA substrates, respectively. The uracil target for initiation of BER is underlined, and a 20 nt-long horizontal arrow indicates the direction of uracil mediated DNA repair synthesis; a line denotes the complementary (-)-strand nucleotide sequence.

Detection of Uracil-initiated BER in DNA Polymerase beta -Proficient Cell Extracts-- To detect uracil-initiated BER, M13mp2op14 (U·T) DNA (form I) was combined with MEF POL beta  (+/+) cell-free extract, and the reaction products produced after various times (0-60 min) were resolved by agarose gel electrophoresis (Fig. 2A). In a second BER reaction, Ugi was added to the reaction mixture to inactivate uracil-DNA glycosylase activity (Fig. 2B). Following the BER reaction, each sample was treated with excess Ung and Nfo to remove uracil residues that had escaped excision during the BER reaction and to nick the resultant AP sites, ensuring the conversion of the uracil-DNA (form I) substrate to form II DNA molecules. In contrast, DNA molecules that had undergone complete uracil-DNA repair (i.e. uracil excision, AP site incision, BER DNA synthesis, and DNA ligation) were resistant to Ung/Nfo treatment and migrated as form I DNA. This step was taken to eliminate unrepaired or incompletely repaired DNA molecules from further analysis. Inspection of the ethidium bromide-stained agarose gels showed that repaired form I DNA accumulated in a time-dependent manner in both BER reactions (Fig. 2, A and B, lanes 1-6). After 10 min, the percentage of Ung/Nfo-resistant form I DNA had increased substantially (~35%) in the POL beta  (+/+) reaction and, by 30 min, had essentially reached a plateau, whereas the appearance of repaired form I DNA in the BER reaction containing Ugi was considerably less (~8%) and its accumulation more gradual (Fig. 2C).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2.   Detection of uracil-initiated BER in POL beta -proficient mouse embryonic fibroblast cell-free extracts. Standard BER reaction mixtures (100 µl) containing 1 µg of M13mp2op14 (U·T) DNA and 50 µg of MEF POL beta  (+/+) cell-free extract were incubated at 30 °C for 0, 10, 20, 30, 40, and 60 min (lanes 1-6, respectively) in the absence (A) or presence (B) of Ugi (1000 units). Following each reaction, the M13mp2op14 DNA was recovered, subjected to Ung/Nfo treatment, and analyzed by 0.8% agarose gel electrophoresis as described under "Experimental Procedures." Untreated and mock-reacted M13mp2op14 (U·T) DNA (80 ng each) were used as reference standards (lanes S and C, respectively); only the latter was Ung/Nfo-treated. C, the fluorescent intensity of ethidium bromide-stained DNA bands was quantified using the method described by Sung et al. (58). After adjusting for the reduced staining intensity of form I DNA relative to form II (~0.7-fold), the percentage of form I DNA was calculated by dividing the amount of form I DNA by the sum of form I and form II DNA and multiplying by 100. The percentage of repaired (form I) DNA in each sample was plotted as a function of incubation time: open circle , POL beta  (+/+) minus Ugi; , POL beta  (+/+) plus Ugi. D, the effect of various amounts of Ugi on the uracil-DNA glycosylase activity of MEF POL beta  (+/+) cell-free extract (50 µg) was measured using calf thymus [uracil-3H]DNA (24). In the absence of Ugi, 0.2 units (1 unit of uracil-DNA glycosylase is defined as the amount that released 1 nmol of uracil/h under standard conditions) of uracil-DNA glycosylase were detected, which represented 100% activity. E, Ugi-mediated inhibition of uracil-DNA glycosylase activity in MEF POL beta  (+/+) cell-free extracts was measured using M13mp2op14 (U·T) DNA (form I) as described under "Experimental Procedures." In the absence of Ugi, ~95% of the uracil residues in M13mp2op14 (U·T) DNA (form I) were converted to AP sites during a 5-min incubation; this level of uracil-excision represented 100% activity.

To establish that the amount of Ugi added to the reaction mixture was sufficient to inhibit the Ugi-sensitive uracil-DNA glycosylase activity, two different assays were conducted. In the first assay, the uracil-DNA glycosylase activity in the POL beta  (+/+) extract was measured in the presence of various amounts of Ugi using a calf thymus [uracil-3H]DNA substrate, which contained U·A base pairs (Fig. 2D). The results showed that 20 units of Ugi was sufficient to inhibit all but ~12% of uracil-DNA glycosylase activity and that additional Ugi did not produce further inhibition. In the second assay, uracil-DNA glycosylase activity was measured using an M13mp2op14 (U·T) DNA substrate. The results indicated that 20 units of Ugi was sufficient to produce maximal inhibition of uracil-DNA glycosylase activity (Fig. 2E). Taken together, these observations confirmed that 1000 units of Ugi was sufficient to inactivate the Ugi-sensitive uracil-DNA glycosylase activity present in the MEF POL beta  cell-free extracts. The small amount of Ugi-resistant uracil-DNA glycosylase activity detected was attributed to uracil-excision enzymes other than UNG.

Kinetics of Uracil-initiated BER in POL beta  (+/+) and POL beta  (-/-) Cell Extracts-- Because initial experiments suggested that uracil-initiated BER in POL beta  (+/+) extracts was in large part complete by 20 min, the kinetics of repair at shorter times in the BER reaction was examined in both POL beta  (+/+) and POL beta  (-/-) cell-free extracts (Fig. 3). In addition, experiments were also conducted to determine the effect of Ugi on the BER repair kinetics. The results indicated that in both cell extracts the kinetics of uracil-initiated BER were essentially biphasic in the absence of Ugi. Because the rate and extent of uracil-initiated BER were remarkably similar in both POL beta  (+/+) and POL beta  (-/-) cell extracts, Western blot analysis of both cell extracts was conducted to ascertain the POLB genotype of the two cell lines (Fig. 3B, inset). Inspection of the Western blot showed that DNA polymerase beta  protein was detected in the POL beta  (+/+) but not in the POL beta  (-/-) cell extract. When Ugi was added to the POL beta  (+/+) and POL beta  (-/-) BER reactions, the initial rate of repaired was reduced by 9.1- and 7.5-fold, respectively (Fig. 3, A and B).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Kinetics of uracil-initiated BER in extracts of mouse embryonic fibroblast POL beta -proficient and POL beta -deficient cells. Standard BER reaction mixtures (100 µl) containing 1 µg of M13mp2op14 (U·T) DNA and 50 µg of (A) POL beta  (+/+) or (B) POL beta  (-/-) cell-free extract were incubated at 30 °C for 0, 2, 5, 10, 20, and 30 min in the absence (open symbols) or presence (closed symbols) of Ugi (1000 units) as described under "Experimental Procedures." Analysis of the recovered M13mp2op14 DNA was carried out as described in Fig. 2, and the percentage of repaired (form I) DNA in each sample was plotted as a function of incubation time. Western blot analysis of the MEF POL beta  cell-free extracts was conducted as described under "Experimental Procedures," and the results are shown in the inset of B. Samples contained 20 ng of purified human POL beta  (lane 1) or 50 µg of MEF POL beta  (+/+) (lane 2) or MEF POL beta  (-/-) (lane 3) cell-free extracts. An arrow indicates the position of the band corresponding to purified POL beta .

Patch Size Associated with Uracil-initiated BER-- The patch size of DNA repair synthesis associated with uracil-initiated BER of M13mp2op14 (U·T) [32P]DNA in MEF POL beta  (+/+) and POL beta  (-/-) cell-free extracts was determined using the method developed by Huang et al. (63) and modified by Sung et al. (58). Briefly, this approach relies on the incorporation of 2'-deoxyoligonucleoside alpha -thiol monophosphates during the BER reaction to render the repaired DNA strand resistant to in vitro digestion by E. coli exonuclease III (Xth). As illustrated in Fig. 4, the uracil target residue was located on the (-)-strand 20 nucleotides 5' and 19 nucleotides 3' to the unique EcoRI and SmaI restriction endonuclease recognition sites, respectively. A site-specific [32P]dCMP residue was introduced 5' to the uracil target at position 90 as described previously (58). Two reference standards were generated to assist in determining the BER patch size. First, a 32P-labeled 40-mer standard was produced by treating the M13mp2op14 (U·T) [32P]DNA substrate with EcoRI and SmaI and resolving the reaction products by denaturing gel electrophoresis (Fig. 4B, lane 1). Second, a 32P-labeled 19-mer was generated after the uracil target, and the 32P-labeled 40-mer was excised by Ung, and the ensuing AP site was cleaved by Nfo (Fig. 4B, lane 2). The 19-mer standard corresponded to the BER intermediate prior to DNA synthesis and defined the 5'-boundary of the repair patch. To determine the 3'-boundary of a repair patch, M13mp2op14 (U·T) [32P]DNA recovered from BER reactions was first linearized with EcoRI and then digested in the 3'- to 5'-direction with excess Xth. Because Xth-mediated DNA degradation of the (-)-strand was expected to terminate upon encountering the first phosphorothioate linkage (64), this 3'-terminal 2'-deoxyribonucleoside alpha -thiol monophosphate residue defined the 3'-boundary of the repair patch. Subsequent cleavage with SmaI produced a [32P]DNA fragment, the length of which indicated the BER patch size (Fig. 4A).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4.   Analysis of the DNA repair patch size associated with uracil-mediated BER. A, scheme for detecting uracil-initiated BER DNA synthesis patch size. A segment of the M13mp2op14 (U·T) [32P]DNA is shown that contains the EcoRI and SmaI restriction endonuclease sites. The location of the [32P]dCMP residue at nucleotide (nt) position 90 on the (-)-strand is indicated by an asterisk. Uracil-mediated BER DNA synthesis resulting in 2'-deoxyribonucleoside alpha -thiol monophosphate incorporation is represented by black-diamond  for patch sizes of 1-4 nucleotides. Following EcoRI, Xth, and SmaI treatments, the BER patch sizes of 1-4 nucleotides in length correspond to [32P]DNA fragments of 20-23 nucleotides, respectively. B, standard BER reaction mixtures (100 µl) containing 1 µg of M13mp2op14 (U·T) [32P]DNA, 20 µM each of dATP[alpha S], dTTP[alpha S], dGTP[alpha S], and dCTP[alpha S] and 50 µg of either MEF POL beta  (+/+) or POL beta  (-/-) cell-free extract were incubated for 60 min at 30 °C in presence (+) or absence (-) of Ugi. Following the reaction, DNA products were isolated, and samples (~100 ng) were digested with EcoRI and subsequently incubated with 0 (lanes 3, 6, 9, 12, and 15), 2 (lanes 4, 7, 10, 13, and 16), and 20 (lanes 5, 8, 11, 14, and 17) units of E. coli exonuclease III. After exonuclease III digestion, the DNA was cleaved with excess SmaI, and the 32P-labeled DNA fragments were resolved by 12% polyacrylamide, 8.3 M urea gel electrophoresis as described under "Experimental Procedures." The [32P]DNA size markers, 40-nucleotide (lane 1), generated by digesting 200 ng of M13mp2op14 (U·T) [32P]DNA with EcoRI and SmaI, and 19-nucleotide (lane 2), produced by treatment of the 40-mer with Ung and Nfo, are indicated by arrows. C, the amount of 32P radioactivity detected in each band in B was quantitatively measured using a Phos- phorImager. The relative amount of 32P label in each band was determined by dividing the amount of 32P radioactivity detected per band by the total 32P signal detected for all bands in the particular lane and multiplying by 100. The frequency with which a specific BER patch size (i.e. one nucleotide) occurred was expressed as the percent distribution of that patch size. The results for reactions digested with 20 units of E. coli exonuclease III are shown as follows: POL beta  (+/+) without Ugi (black bars), POL beta  (+/+) with Ugi (white bars), POL beta  (-/-) without Ugi (horizontal stripes), POL beta  (-/-) with Ugi (diagonal stripes). Mean values and standard deviations of the patch size distributions from four experiments are indicated.

Patch size analysis was conducted following uracil-initiated BER in POL beta  (+/+) and POL beta  (-/-) cell-free extracts both in the presence and absence of Ugi (Fig. 4B). As a control, mock-treated M13mp2op14 (U·T) [32P]DNA was examined. For each of the five reaction sets, the EcoRI-SmaI 32P-labeled 40-mer restriction fragment, not treated with Xth, is shown first (Fig. 4B, lanes 3, 6, 9, 12, and 15), followed by digestion of the 40-mer fragment with 2 (Fig. 4B, lanes 4, 7, 10, 13, and 16) or 20 units (Fig. 4B, lanes 5, 8, 11, 14, and 17) of Xth. As expected, a repair patch was not detected for the mock-treated [32P]DNA since 2'-deoxyribonucleoside alpha -thiol monophosphates were not incorporated into the [32P]DNA substrate in the absence of cell-free extract (Fig. 4B, lanes 3-5). When treated similarly, each of the other four reactions yielded discrete [32P]DNA fragments, following digestion with Xth, which were used to define the 5'-boundary of BER DNA synthesis. Quantitative determination of the BER repair patch size was made using a PhosphorImager, and the patch size distribution for each reaction was expressed as a percentage of the total BER detected (Fig. 4C). The results showed that one-nucleotide repair patches were the single most prevalent patch size in both POL beta  (+/+) and POL beta  (-/-) BER reactions, constituting ~23 and ~18% of total repair patches, respectively. Greater than 50% of the repair patches produced in both POL beta  (+/+) and POL beta  (-/-) BER reactions were 2 to 8 nucleotides in length. The results also illustrated that Ugi addition did not appreciably alter the distribution of patch size in BER reactions containing either cell-free extract.

Effect of p21 on Uracil-initiated BER Patch Size-- Repair patch size experiments were conducted to examine the influence of the PCNA-binding p21 peptide and protein on uracil-initiated BER of M13mp2op14 (U·T) [32P]DNA in POL beta  (+/+) cell-free extracts (Fig. 5). As before, the two reference standards, 32P-labeled 40-mer (Fig. 5, lanes 1 and 7) and 32P-labeled 19-mer (Fig. 5, lanes 2 and 8), were produced as markers and resolved by electrophoresis. An examination of the BER reaction products revealed that the p21 buffer had no apparent influence on patch size (Fig. 5A, lanes 3 versus 4 and 9 versus 10). In contrast, addition of p21 peptide (8 µM) or p21 protein (0.7 µM) provoked a readily discernible increase in the one-nucleotide repair patch and a corresponding decrease in longer repair patches (Fig. 5A, lanes 5 and 11, respectively). Supplementation of the BER reactions with the higher concentration of p21 peptide (32 µM) or protein (2.8 µM) resulted in severe curtailment of longer BER repair patches (Fig. 5A, lanes 6 and 12, respectively). The results were quantitatively analyzed and plotted for the p21 peptide and protein BER reactions as shown in Fig. 5, B and C, respectively. Addition of p21 peptide (8 µM) increased the percentage of the one-nucleotide repair patch ~2-fold relative to the buffer control (52 versus 27%), and p21 protein (0.7 µM) promoted a similar ~2.1-fold change (62 versus 29%). Longer patch sizes (2-8 nucleotides) decreased 36% upon addition of p21 peptide and 46% with p21 protein supplementation. Overall, the amount of BER DNA synthesis was reduced 69 and 72% relative to controls in the presence of p21 peptide (Fig. 5A, lane 6) and p21 protein (Fig. 5A, lane 12), respectively. These results suggested that PCNA plays a significant role in determining the patch size associated with uracil-initiated BER.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of p21 peptide and protein on the DNA repair patch size associated with uracil-mediated BER. Standard BER reaction mixtures (100 µl) containing 1 µg of M13mp2op14 (U·T) [32P]DNA, 20 µM each of dATP[alpha S], dTTP[alpha S], dGTP[alpha S], and dCTP[alpha S], and 50 µg of MEF POL beta  (+/+) cell-free extract were incubated for 60 min at 30 °C. The following additions (2.5 µl) were included in the reaction mixtures: standard BER reaction buffer (lanes 3 and 9); p21 peptide solubilization buffer (lane 4); p21 storage buffer (lane 10); p21 peptide (lanes 5 and 6, 8 and 32 µM, respectively) or p21 protein (lanes 11 and 12, 0.7 and 2.8 µM, respectively). After terminating the BER reactions, the [32P]DNA products were isolated, digested with EcoRI as described in Fig. 4, and subsequently incubated with 20 units of E. coli exonuclease III. Following exonuclease III digestion, the [32P]DNA was cleaved with SmaI, and the reaction products were resolved by 12% polyacrylamide, 8.3 M urea gel electrophoresis as described under "Experimental Procedures." The DNA size markers, 40-mer (lanes 1 and 7) and 19-mer (lanes 2 and 8), are indicated by arrows. The amount of 32P radioactivity detected in BER reactions containing p21 peptide (B) or p21 protein (C) was quantitatively measured using a PhosphorImager, and the relative amount of 32P label in each band was determined as described in Fig. 4. The frequency with which a specific patch size occurred is expressed as the percent distribution of that patch size, and the height of the bars in the histogram correspond to the observed frequencies. The four BER reaction conditions are represented by bars as follows: standard BER reaction buffer, white; p21 storage buffer, dotted; lower p21/peptide concentration, diagonal stripes; higher p21/peptide concentration, black.

Error Frequency and Mutational Specificity Associated with BER of M13mp2op14 (U·T) DNA-- The frequency of mutations produced during uracil-initiated BER of M13mp2op14 (U·T) DNA was determined using the M13mp2op14 lacZalpha -based reversion assay. First, the background reversion frequency of M13mp2op14 (A·T) DNA was measured in extracts of MEF POL beta  (+/+) and POL beta  (-/-) cells (Table I). A similar reversion frequency (~0.1 × 10-4) was observed for both cell extracts. Second, the reversion frequency associated with BER of M13mp2op14 (U·T) DNA was determined to be 7.18 × 10-4 and 5.71 × 10-4 for reactions conducted with POL beta  (+/+) and POL beta  (-/-) cell-free extracts, respectively. Third, Ugi was added to reaction mixtures, and the reversion frequencies associated with the BER reactions were found to be 6.56 × 10-4 for POL beta  (+/+) and 7.19 × 10-4 for POL beta  (-/-) cell-free extracts (Table I). Thus, the error frequency of uracil-initiated BER was essentially unaffected by the addition of Ugi and did not appear to correlate with the POLB gene status.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Frequency of mutations produced by BER of U · T-containing M13mp2op14 DNA in mouse embryonic fibroblast DNA polymerase beta  (+/+) and (-/-) cell-free extracts
Standard BER reaction mixtures (100 µl) were prepared that contained 50 µg of MEF pol beta  (+/+) or pol beta  (-/-) cell-free extract, 1 µg of M13mp2op14 (A · T) or (U · T) DNA, and Ugi (1000 units) as indicated. After incubation at 30 °C for 60 min, the reactions were terminated and DNA products recovered, and form I DNA resistant to Ung/Nfo treatment was isolated by 0.8% agarose gel electrophoresis as described under "Experimental Procedures." E. coli NR9162 cells were then transfected with the form I DNA, and the M13mp2 lacZalpha DNA-based reversion assay was performed as described under "Experimental Procedures."

The mutational spectrum of M13mp2op14 (A·T) DNA was determined to define the nature and distribution of background base substitutions induced by incubation with POL beta  (+/+) and POL beta  (-/-) cell-free extracts (Fig. 6 A and D, respectively). Examination of the mutational spectrum produced in POL beta  (+/+) reactions showed that ~60% of the reversion mutations occurred at the third position (A) of the opal (TGA) codon (Fig. 6A), whereas only ~35% of the total reversions occurred at the first position (T) of the opal codon. The spectrum observed in POL beta  (-/-) cell-free extracts revealed that ~80% of all reversions occurred at the third position of the opal codon and ~15% resided at the first position (Fig. 6D). Taken together, these results indicate a bias toward third position mutations in the background error spectrum.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6.   Specificity of mutations produced during uracil-initiated BER of M13mp2op14 (U·T) DNA. Six standard BER reactions were conducted as described in Table I using 50 µg of MEF POL beta -proficient (A-C) or POL beta -deficient (D-F) cell-free extracts and M13mp2op14 DNA as shown in each panel with the target uracil residue underlined in the opal codon 14. Two reactions contained M13mp2op14 (A·T) DNA (A and D), whereas the other four reactions were prepared with M13mp2op14 (U·T) DNA (B, C, E, and F); Ugi (1000 units) was added to two reactions (C and F). Following the BER reactions, the M13mp2op14 DNA was recovered, treated with excess Ung and Nfo, and used to conduct the M13mp2 lacZalpha DNA-based reversion assay as described under "Experimental Procedures." Revertant (blue and light blue) plaques were isolated and subjected to PCR-mediated lacZalpha DNA amplification, and DNA sequence analysis was conducted as described under "Experimental Procedures." The nucleotide sequence of the opal codon (TGA) used as the template for uracil-initiated BER DNA synthesis is shown, as are the four deoxyribonucleoside triphosphates available for incorporation into the primer strand during BER; the corresponding amino acid encoded by each single deoxyribonucleoside triphosphate incorporation event is indicated within parentheses. For each BER reaction, the number of base substitutions detected by DNA sequence analysis at each nucleotide position was divided by the total number of mutants sequenced and plotted as a percentage. In BER reactions containing POL beta  (+/+) cell-free extract (A-C), the number of mutants sequenced was 20, 30, and 30, respectively. In BER reactions containing POL beta  (-/-) cell-free extract (D-F), the number of mutants sequenced was 20, 31, and 30, respectively.

The mutational spectrum of uracil-initiated BER of M13mp2op14 (U·T) DNA in reactions containing POL beta  (+/+) cell extract is presented in Fig. 6B. A large majority (87%) of reversions was identified at the first position of the opal codon where the uracil target was located. The most common mutation was T to G (37%), followed by T to C (30%) and T to A (20%). In reactions containing POL beta  (-/-) cell-free extract, 90% of all base substitutions occurred at the first position, where T to G transversions also prevailed (Fig. 6E). Supplementation of BER reactions with Ugi had a modest effect on the specificity on mutations in POL beta  (+/+) reactions (Fig. 6C). However, in reactions containing POL beta  (-/-) cell-free extract, the propensity for forming T·C mispairs increased to 83% of mutations sequenced (Fig. 6F).

Error Frequency and Mutational Specificity Associated with BER of M13mp2op14 (U·A) DNA-- Mutational analysis was repeated using a uracil target contained within a U·A base pair of the opal codon 14 (Fig. 1C). The frequency of mutations produced during uracil-initiated BER of M13mp2op14 (U·A) DNA was found to be 6.75 ± 2.06 × 10-4 and 2.60 ± 0.91 × 10-4 for reactions conducted with POL beta  (+/+) and POL beta  (-/-) cell-free extracts, respectively (Table II). When Ugi was added to the BER reactions, the error frequencies associated with POL beta  (+/+) and POL beta  (-/-) cell-free extracts were 2.64 ± 1.23 × 10-4 and 5.02 ± 2.02 × 10-4 (Table II). Comparison of the mutation frequencies obtained using the U·A target, located at the third position of the opal codon 14, with the U·T target situated at the first position (Table I), showed that the frequency of reversion did not vary significantly for BER reactions containing POL beta  (+/+) cell extract. However, the same comparison for BER reactions containing POL beta  (-/-) cell extracts indicated that U·A repair was somewhat less mutagenic than U·T repair.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Frequency of mutations produced by BER of U · A- or 5'-U · T-containing M13mp2op14 DNA in mouse embryonic fibroblast DNA polymerase beta  (+/+) and (-/-) cell-free extracts
Standard BER reaction mixtures (100 µl) were prepared that contained 50 µg of MEF pol beta  (+/+) or pol beta  (-/-) cell-free extract, 1 µg of M13mp2op14 (U · A) or (5'-U · T) DNA, and Ugi (1000 units) as indicated. After incubation at 30 °C for 60 min, the reactions were terminated and DNA products recovered, and form I DNA resistant to Ung/Nfo treatment was isolated by 0.8% agarose gel electrophoresis as described under "Experimental Procedures." E. coli NR9162 cells were then transfected with the form I DNA, and the M13mp2 lacZalpha DNA-based reversion assay was performed as described under "Experimental Procedures."

The mutational spectrum of uracil-initiated BER of M13mp2op14 (U·A) DNA in reactions containing POL beta  (+/+) cell extract is presented in Fig. 7A. The dominant base substitution mutation (77%) was insertion of dCMP opposite A, where the uracil residue was located. Addition of Ugi to the BER reaction did not appear to alter the mutational specificity (Fig. 7B).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7.   Specificity of mutations produced during uracil-initiated BER of M13mp2op14 (U·A) DNA. Four standard BER reactions were conducted as described in Table II using 50 µg of MEF POL beta -proficient (A and B) or POL beta -deficient (C and D) cell-free extracts and M13mp2op14 (U·A) DNA as shown in each panel; Ugi (1000 units) was added to two reactions (B and D). The M13mp2op14 (U·A) DNA was recovered from each BER reaction, processed, and analyzed as described in Fig. 6. Revertant (blue and light blue) plaques were isolated and subjected to PCR-mediated lacZalpha DNA amplification, and DNA sequence analysis was conducted as described under "Experimental Procedures." For each BER reaction, the number of base substitutions detected by DNA sequence analysis at the positions of the opal codon was divided by the total number of mutants sequenced and plotted as a percentage. The number of mutant sequences determined for A-D was 30, 29, 30, and 30, respectively.

An examination of the mutational spectrum of uracil-initiated BER on the same DNA substrate but containing POL beta  (-/-) cell extract is shown in Fig. 7C. In this spectrum, insertion of dGMP opposite A competed equally with dCMP insertion (33%). The addition of Ugi to the POL beta  (-/-) BER reactions altered the specificity of opal codon 14 reversion such that 93% (28 of 30) of reversions was the result of dCMP insertion opposite A at the third position.

Error Frequency and Mutational Specificity Associated with BER of M13mp2op14 (5'-U·T) DNA-- Determination of the error frequency of uracil-initiated BER on the 3'-side of the uracil excision site was made using M13mp2op14 (5'-U·T) DNA (Fig. 1D). In this substrate, the uracil target (U·T) was situated three nucleotides on the 5'-side of the last base of the TGA opal codon. Following excision of the "upstream" uracil residue, DNA synthesis must extend 6 nucleotides "downstream" to traverse the opal codon where base substitution errors could result in reversion mutations. The mean reversion frequency of M13mp2op14 (5'-U·T) DNA recovered from BER reactions containing extracts of POL beta  (-/-) cells was 0.39 ± 0.04 × 10-4 and 0.32 ± 0.1 × 10-4 in the presence and absence of Ugi, respectively (Table II). These values were only slightly elevated over the background observed for M13mp2op14 (A·T) DNA (Table I), indicating that the fidelity of downstream BER DNA synthesis was relatively high. However, the mutational specificity associated with the repaired (5'-U·T) DNA differed from the reversion spectrum of the (A·T) DNA. Reversion at opal codon 14 in repaired (5'-U·T) DNA occurred more frequently at the first position (57%) than at the third position (40%) (Fig. 8A), whereas reversion in (A·T) DNA occurred predominantly at the third position (80%) relative to the first position (20%) of opal codon 14 (Fig. 6D). In addition, the specificity of BER DNA synthesis errors contrast with that obtained using the (U·T) substrate (Fig. 6, E and F), where errors introduced at the site of uracil excision consisted predominantly of incorporation of dCMP opposite T and not dGMP opposite T, as observed in Fig. 8, A and B.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 8.   Specificity of mutations produced during uracil-initiated BER of M13mp2op14 (5'-U·T) DNA. Two standard BER reactions were conducted as described in Table II using 50 µg of MEF POL beta -deficient cel