Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M107773200 on September 14, 2001

J. Biol. Chem., Vol. 276, Issue 46, 42737-42743, November 16, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/46/42737    most recent
M107773200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blaine, S. A.
Right arrow Articles by Nemenoff, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blaine, S. A.
Right arrow Articles by Nemenoff, R. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Induction of cPLA2 in Lung Epithelial Cells and Non-small Cell Lung Cancer Is Mediated by Sp1 and c-Jun*

Stacy A. BlaineDagger , Marilee Wick§, Christina Dessev§, and Raphael A. NemenoffDagger §

From the Departments of § Medicine and Dagger  Pharmacology, University of Colorado Health Science Center, Denver, Colorado 80262

Received for publication, August 13, 2001, and in revised form, September 14, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Activating mutations in ras genes are frequently associated with non-small cell lung cancer cells (NSCLC) and contribute to transformed growth in these cells. Expression of oncogenic forms of Ras in these cells is associated with increased expression and activity of cytosolic phospholipase A2 (cPLA2) and cyclooxygenase-2 (COX-2), leading to constitutively elevated levels of prostaglandin production. Expression of oncogenic Ras is sufficient to induce these enzymes in normal lung epithelial cells. We have previously reported that the JNK and ERK pathways are necessary for induction of cPLA2 and have defined a minimal region of the cPLA2 promoter from -58 to -12 that is required for Ha-Ras-mediated induction. To further characterize the cis-regulatory elements within this region involved in this response, site-directed mutagenesis was used to make mutations at various sites. Three cis-regulatory elements were identified: regions -21/-18, -37/-30, and -55/-53. Mutations in any of these elements decreased basal and Ha-Ras-induced cPLA2 promoter activity in both normal lung epithelial cells, as well as steady state promoter activity in A549 cells, with a mutation in element -21/-18 completely eliminating all promoter activity. Overexpression studies and gel shift assays indicated that Sp1 may serve as a transcription factor functionally regulating promoter activity by directly interacting with two of the cis-regulatory elements, -21/-18 and -37/-30. Expression of Ha-Ras led to induction of c-Jun protein, which showed functional cooperation with Sp1 in driving promoter activity. Additional unidentified transcription factors bound to the regions from -55/-53 and -37/-34.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Lung cancer is the leading cause of cancer death in the United States, but, despite a significant research effort, the critical pathways mediating transformed growth remain poorly understood. Non-small cell lung cancer (NSCLC)1 constitutes the majority of lung cancers, and gain of function mutations in ras genes are frequently associated with NSCLC, occurring in 30% of adenocarcinomas, and just under 10% of other NSCLC types (1). Activating mutations in ras genes have also been detected in other types of human cancer, including colon, prostate, and pancreatic. It is believed that these mutated forms of Ras lacking intrinsic GTPase activity mediate transformation by constitutively activating downstream effector pathways. We recently reported that expression of oncogenic forms of Ras was associated with increased expression of cytosolic phospholipase A2 (cPLA2) and cyclooxygenase-2 (COX-2) in a panel of NSCLC cell lines (2).

cPLA2 is the major intracellular form of PLA2, which preferentially hydrolyzes membrane phospholipids at the sn-2 position to release arachidonic acid and represents the rate-limiting enzyme in eicosanoid production (3-5). Free arachidonic acid is metabolized through three major pathways to produce eicosanoids. COX converts arachidonic acid to prostaglandins and thromboxane, lipoxygenases produce leukotrienes and hydroxyeicosatetraenoic acids, and cytochrome P-450 epoxygenase produces epoxyeicosatrienoic acids. Two forms of cyclooxygenase have been identified (6). COX-1 is constitutively expressed in most cell types and involved in maintaining vascular tone, whereas COX-2 is an immediate early response gene (7) induced by mitogenic stimuli and associated with inflammation. Constitutively high levels of prostaglandin production are observed in NSCLC as a result of elevated levels of cPLA2 and COX-2 (8, 9). We (2) and others (10-12) have shown that nonsteroidal anti-inflammatory agents, which inhibit eicosanoid production, block the transformed growth of NSCLC expressing Ras mutations. These drugs do not hinder the growth of most nontransformed cells, suggesting that this pathway plays a critical role in transformation.

Although studies in NSCLC cell lines have implicated a role for Ras in the induction of cPLA2, these cells contain a large number of mutations and aberrations in signaling pathways, making it difficult to define the critical molecular pathways regulating cPLA2 expression. We therefore sought to examine the effects of constitutively active forms of Ras on cPLA2 expression in untransformed lung epithelial cells. Ras has been shown to connect to numerous effector pathways, leading to the activation of diverse physiological responses (see Ref. 13 for review). These pathways regulate cell proliferation as well as changes in the cytoskeleton. We have recently demonstrated that expression of oncogenic forms of Ras directly increased cPLA2 expression in normal lung epithelial cells through activation of the JNK and ERK pathways (14).

The regulatory elements within the cPLA2 promoter critical for this induction by oncogenic Ras have not been defined. The cPLA2 promoter has been isolated from both human (15) and rat (16) and contains a number of putative regulatory elements including AP-1 sites, NF-kappa B sites, and glucocorticoid regulatory elements. The promoter region resembles that of a housekeeping gene in that it contains no TATA box and no CAAT box, but it is atypical in that it is not GC-rich (34.5%) and has no consensus Sp1 sites (15, 17). We reported previously that the region of the promoter covering residues -58 to -12 is crucial for induction of promoter activity by oncogenic Ras (14) in RL-65 cells, a neonatal, untransformed rat epithelial cell line (18). In this study, we define three cis-regulatory elements within this region of the promoter critical for both basal and Ha-Ras-induced cPLA2 promoter activity, and have begun to define transcription factors acting at these sites.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents and Constructs-- The cPLA2 promoter construct contains 2.4 kilobase pairs of the 5' region ligated into the promoterless luciferase vector PA3-Luc (16). The truncation mutant encoding the region from -102 to +40 (16) was used to generate additional truncations by polymerase chain reaction as described previously (14). Mutations within this region were generated using the QuikChange site-directed mutagenesis kit (Stratagene). The following primers were used with mutations underlined in bold: mutation -55/-53 sense primer, CTGGATCCCGGGTACCGTTTTAACATCCACAGAGACCAG; mutation -55/-53 antisense primer, CTGGTCTCTGTGGATGTTAAAACGGTACCCGGGATCCAG; mutation -49/-47 sense primer, CTCGATCCCGGGTACCACCTTAAGTACCACAGAGACCAG; mutation -49/-47 antisense primer, CTGGTCTCTGTGGTACTTAAGGTGGTACCCGGGATCGAG; mutation -37/-34 sense primer, CACCTTAACATCCACAGAGGTTAGCCCATTACTTAGCCCCTCCTACCAG; mutation -37/-34 antisense primer, CTGGTAGGAGGGGCTAAGAAA-TGGGCTAACCTCTGTGGATGTTAAGGTG; mutation -33/-30 sense primer, CACCTTAACATCCACAGAGACCATATGATTTCTTAGCCC-CTCCTACCAG; mutation -33/-30 antisense primer, CTGGTAGGAGGGGCTAAGAAATCATATGGTCTCTGTGGATGTTAAGGTTG; mutation -21/-18 sense primer, GACCAGCCCATTTCTTAATTTCTCCTACCAGCGGGAGA; mutation -21/-18 antisense primer, TCTCCC-GCTGGTAGGAGAAATTAAGAAATGGGCTGGTC; double mutation -37/-30 sense primer, CACCTTAACATCCACAGAGGTTATATGATTTCTTAGCCCCTCCTACCAG; double mutation -37/-30 antisense primer, CTGGTAGGAGGGGCTAAGAAATCATATAACCTCTGTGGAT-GTTAAGGTG.

Cell Culture and Transfection-- RL-65 lung epithelial cells were obtained from American Type Tissue Culture and grown in Dulbecco's modified Eagle's medium/F-12 medium supplemented with NaHCO3 (25 mM), sodium selenite (25 nM), insulin (5 µg/ml), human transferrin (10 µg/ml), ethanolamine (100 µM), phosphoethanolamine (100 µM), hydrocortisone (0.5 µM), forskolin (5 µM), retinoic acid (50 nM), bovine pituitary extract (150 µg/ml), penicillin (100 units/ml), and streptomycin (100 units/ml), according to the producer's recommendation. A549 human lung cancer cells were obtained from the University of Colorado Cancer Center Tissue Culture Core, and were grown in RPMI containing 10% fetal calf serum.

For transient transfections, cells were electroporated as described previously (2). Briefly, 2 million cells were electroporated in duplicate dishes using a geneZAPPER (IBI). Unless otherwise stated, cells were transfected with 2 µg of the -58 truncation mutant of the cPLA2 promoter, 2 µg of CMV-beta -galactosidase, and 2 µg of other DNA (e.g. CMV-Ha-Ras, CMV-Sp1). Total DNA concentration for each transfection was matched with pcDNA-3.1. Following electroporation, cells were incubated in standard media for 48 h. Cells were then harvested, and luciferase and beta -galactosidase activity determined as described previously (2). Results are expressed as luciferase units normalized to beta -galactosidase units.

Electrophoretic Mobility Shift Assay (EMSA)-- Cells were harvested by trypsinization and nuclear extracts prepared by a modification of the method of Dignam (19). Briefly, cell pellets containing 107 cells were washed and resuspended in a 5-fold volume of Buffer A (10 mM HEPES-KOH, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol (DTT), 0.2 mM PMSF) at 4 °C for 10 min, vortexed, and centrifuged at 25,000 × g for 20 min. The pellet was resuspended in 100 µl of high salt buffer (20 mM HEPES-KOH, pH 7.9, 25% glycerol, 420 mM KCl, 1.5 MgCl2, 0.2 mM EDTA, 0.5 mM DTT, and 0.2 mM PMSF), homogenized with a Dounce homogenizer, and incubated at 4 °C for 20 min. Samples were centrifuged for 20 min at 25,000 × g and the supernatant recovered. Extracts were dialyzed against buffer D (20 mM HEPES-KOH, pH 7.9, 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.2 mM PMSF, 0.5 mM DTT), aliquoted, and stored at -70 °C.

Double-stranded oligonucleotides for gel shift assays were fill-in labeled with [32P]dCTP and the Klenow fragment of DNA polymerase. Unincorporated nucleotides were removed, and the buffer was exchanged with a Centri-Sep column (Princeton Separations). The following oligonucleotides, with mutations indicated in underlined bold type, were synthesized: for wild type -42/-13, 5'-AGAGACCAGCCCATTTCTTAGCCCCTCCTA-3'; for mutation -37/-34, 5'-AGAGGTTAGCCCATTTCTTAGCCCCTCCTA-3'; for mutation -33/-30, 5'-AGAGACCATATGATTTCTTAGCCCCTCCTA-3'; for double mutation -37/-30, 5'-AGAGGTTATATGATTTCTTAGCCCCTCCTA-3'; for wild type -28/-8, 5'-TTTCTTAGCCCCTCCTACCAG-3'; for mutation -21/-18, 5'-TTTCTTAATTTCTCCTACCAG-3'; for wild type -65/-40, 5'-CTTGAATTCCACCTTAACATCCACAG-3'; for mutation -55/-53, 5'-CTTGAATTCCGTTTTAACATCCACAG-3' (only the coding strand sequence provided).

The Sp1 consensus binding site oligonucleotide (5'-CCCTTGGTGGGGGCGGGGCCTAAGCTGCG-3'; Sp1 consensus site in bold italics) was purchased from Geneka Biotechnology (Toronto, Canada). Supershift assays were carried out using a specific monoclonal Sp1 antibody and a specific polyclonal c-Jun antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Nuclear extracts (2 µg) were incubated in binding reaction buffer with a final KCl concentration of 100 mM for 30 min on ice. For supershift or competition assays, the relevant antibodies or unlabeled oligonucleotides were incubated with nuclear extracts prior to adding the labeled probe. [32P]dCTP-labeled probe (100,000 cpm) was added for an additional 30 min in a total volume of 20 µl. For competition assays, a 50- or 100-fold excess of unlabeled double-stranded oligonucleotide was added to the binding reaction. Samples were resolved on a nondenaturing 5% acrylamide gel (29:1 acrylamide:bisacrylamide), in 1× TGE (25 mM Tris, 1.0 mM EDTA, and 190 mM glycine) at 20 mA/gel for ~90 min. Gels were dried and exposed to film for autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In earlier studies, we defined a minimal region of the rat cPLA2 promoter spanning residues -58 to -12, which was necessary and sufficient for Ha-Ras-mediated induction of cPLA2 in RL-65 cells and expression in NSCLC (14). An additional 5'-truncation down to -37 reduced basal promoter activity, and inhibited but did not completely block induction by Ha-Ras. Ultimately, truncation down to -12 completely abolished both basal and Ha-Ras-induced promoter activity. These studies were paralleled in A549 cells, a human NSCLC cell line expressing an activating mutation in Ras. Promoter activity was slightly elevated upon truncation from -2.4 kilobase pairs to -58 bp. Further deletion to -37 decreased promoter activity by ~60%, and truncation to -12 entirely abolished promoter activity.

Examination of the sequence of the cPLA2 promoter revealed that the 58-bp region contained no consensus sites for any known transcription factors. Therefore, to define regulatory elements, a series of mutations were introduced throughout the region with the original -58 truncation mutant as a template (Fig. 1). With the exception of mutation -37/-34, all mutations correspond to regions of the promoter that are conserved between the rat and human promoter (15). Plasmids encoding each mutation were transiently co-transfected into RL-65 cells along with an expression plasmid for Ha-Ras or pcDNA-3 as a control. Expression of Ha-Ras increased wild type promoter activity by 3-5-fold (Fig. 2A), consistent with earlier studies. Mutation -21/-18 almost completely abolished both basal and Ha-Ras stimulated promoter activity. Mutations -37/-34 and -33/-30 inhibited both basal and Ha-Ras-mediated promoter activity by ~80-90%. With the double mutant -37/-30, activity was further inhibited to ~10% of wild-type promoter. Mutation at -55/-53 decreased both basal promoter activity and Ha-Ras-mediated induction by 66%. There was no significant change in either basal promoter activity or Ha-Ras-mediated induction with mutation -49/-47.


View larger version (21K):
[in this window]
[in a new window]
  		Fig. 1.   Site-directed mutagenesis of the -58/+40 region of the rat cPLA2 promoter. QuikChange site-directed mutagenesis was used to construct plasmids containing the 58-bp region of the rat cPLA2 promoter with the shown mutations inserted into a promoterless pA3-LUC vector. The various mutations are bold and underlined. The probes used in electrophoretic mobility shift assays are underlined in the wild type sequence.


View larger version (23K):
[in this window]
[in a new window]
  		Fig. 2.   Effect of mutations on cPLA2 promoter activity in RL-65 cells. A, RL-65 cells were transiently transfected with cPLA2 promoter constructs containing the indicated mutations, along with either an Ha-Ras expression plasmid or pcDNA-3 as a control. Promoter activity normalized to beta -galactosidase was determined after 48 h in standard medium. Results represent the means of at least four independent experiments performed in duplicate with mean and S.E. indicated. *, p < 0.01 versus WT + Ha-Ras. B, RL-65 cells were transiently transfected with cPLA2 promoter constructs containing the indicated mutations. After 24 h, cells were given media containing 10-8 µM EGF. Promoter activity normalized to beta -galactosidase was determined after 24 h of EGF treatment. Results represent the means of at least three independent experiments performed in duplicate with mean and S.E. indicated. *, p < 0.05 versus EGF.

Stimulation of RL-65 cells with EGF also increased cPLA2 promoter activity (Fig. 2B). This induction was blocked by co-expression with N17-Ras (data not shown), indicating that the effects of EGF are mediated at least in part through the Ras signaling pathway. EGF stimulation was blocked with mutants -55/-53, -37/-34, -33/-30, or -21/-18 to an extent similar to that seen with expression of Ha-Ras (Fig. 2B). Finally, the effects of these mutations in the cPLA2 promoter were also examined in A549 cells. Steady-state promoter activity was almost entirely eliminated with mutation -21/-18. Mutations -55/-53, -37/-34, and -33/-30 inhibited steady-state promoter activity by ~85-95% (Fig. 3). The double mutant -37/-30 decreased promoter activity by about 95%. Mutation -49/-47 reduced promoter activity by ~60%.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 3.   Effect of mutations on cPLA2 promoter activity in A549 cells. A549 cells were transiently transfected with cPLA2 promoter constructs containing the indicated mutations. Promoter activity was determined as in Fig. 2. Results represent the means of five independent experiments performed in duplicate with the mean and S.E. indicated. *, p < 0.05 versus WT.

The data from these studies suggest that three regions of the cPLA2 promoter appear to be critical for expression: regions -37/-30, -21/-18, and -55/-53. To examine complexes formed at these sites, EMSAs were performed using 32P-labeled probes spanning each of the three cis-regulatory elements (Figs. 4-6).


View larger version (35K):
[in this window]
[in a new window]
  		Fig. 4.   EMSA analysis in region -42/-13 of the cPLA2 promoter. Oligonucleotides corresponding to region -42/-13 of the cPLA2 promoter (WT probe), or oligonucleotides containing the indicated mutations were labeled with 32P as described under "Materials and Methods." Nuclear extracts were prepared from RL-65 cells (A-D), or A549 cells (E) and incubated (2 µg) with labeled probe with or without addition of Sp1 antibody. A, lane 1, extracts from RL-65 incubated with WT probe; lane 2, extracts incubated with a 100-fold excess of unlabeled oligonucleotide; lane 3, extracts in the presence of Sp1 antibody; lane 4, extracts in the presence of c-Jun antibody. B-D, RL-65 extracts incubated with the indicated mutant probe. Lane 1, extract alone; lane 2, extract + 100-fold excess of unlabeled oligonucleotide; lane 3, extract +Sp1 antibody. E, A549 extracts incubated with WT probe (lanes 1 and 2) or probe mutated at -33/-30 (lanes 3 and 4) with (lanes 2 and 4) or without Sp1 antibody (lanes 1 and 3). Complex a (a) was supershifted to a slower migrating species (b) by Sp1 antibody. With mutations at -33/-30 probe, a fast migrating complex was detected (c).


View larger version (42K):
[in this window]
[in a new window]
  		Fig. 5.   EMSA analysis in region -28/-8 of the cPLA2 promoter. Left panel, extracts from RL-65 cells were incubated with 32P-labeled probe corresponding to region -28 to -8 of the cPLA2 promoter (lanes 1-4) or with probe containing mutations at -21/-18 (lane 5). Extracts were incubated with Sp1 antibody, c-Jun antibody, or no addition as described in Fig. 4. A specific complex (a) was supershifted to a slower migrating form (b) in the presence of Sp1 antibody. Right panel, extracts from A549 cells were incubated with WT probe in the presence or absence of Sp1 or c-Jun antibody.


View larger version (49K):
[in this window]
[in a new window]
  		Fig. 6.   EMSA analysis in region -65/-40 of the cPLA2 promoter. Oligonucleotides were constructed encoding region -65 to -40 of the cPLA2 promoter and labeled with [32P]dCTP. These were used as probes in electrophoretic mobility shift assays. Binding reactions were carried out by incubating each probe with nuclear extracts prepared from RL-65 cells (A and B) or A549 cells (C). A, lane 1, extract from RL-65 cells; lane 2, extract + 100× double-stranded cold oligonucleotide. The arrowhead indicates the specific complex formed. B, extracts from control (lanes 1 and 2) or EGF-treated (lanes 3 and 4) RL-65 cells were incubated with labeled probe in the absence (lanes 1 and 3), or presence (lanes 2 and 4) of Sp1 antibody. C, extracts from A549 cells and labeled oligonucleotides were incubated without additions (lane 1), with 100-fold excess of cold oligonucleotide (lane 2), or in the presence of Sp1 antibody (lane 3).

Using an oligonucleotide encoding -42 to -13, a number of specific bands were detected using nuclear extracts prepared from RL-65 cells (Fig. 4A). At least three complexes were competed off by excess cold oligonucleotide. Extracts from EGF-stimulated cells showed the same pattern of bands, with no significant change in intensity (data not shown). Sp1 is a ubiquitously expressed transcription factor, which binds to GC-rich elements frequently found in a number of housekeeping genes. The region of the cPLA2 promoter from -58 to -1 is 55% GC-rich, and several areas within this region represent putative, but not consensus Sp1 binding sites. Sp1 has been demonstrated to activate numerous TATA-less promoters (20, 21) and has recently been shown to control expression of tissue specific genes as well (22, 23). To examine whether Sp1 can form complexes with this region of the cPLA2 promoter, we employed a specific Sp1 antibody in a "supershift" EMSA. In the presence of Sp1 antibody and nuclear extracts from RL-65 cells, a major complex (a) was supershifted to a slower migrating complex (b) (Fig. 4A). Using a probe with mutations at -33/-30, the intensity of band a was greatly diminished, and a new band (c) was detected (Fig. 4B). This band was not supershifted with anti-Sp1 antibody. Using a probe with mutations at -37/-34, resulted in decreased intensity of band a, and a detectable, but faint supershifted band b (Fig. 4C). The double mutation -37/-30 eliminated all three bands (Fig. 4D). A similar pattern of bands was observed using nuclear extracts prepared from A549 cells (Fig. 4E), with the slowest migrating band supershifted with anti-Sp1 antibodies. Mutations at -33/-30 caused a similar disappearance of band a and appearance of a new band (c).

With a labeled probe encoding the region from -28 to -8, three major bands were detected using extracts from either RL-65 cells or A549 cells (Fig. 5). All of these bands were competed off by excess cold oligonucleotide (data not shown). The slowest migrating band (a) was supershifted with anti-Sp1 antibodies to a slower migrating complex (b). When the identical extracts were incubated with probe containing a mutation at -21/-18, no specific bands were detected with extracts from RL-65 (Fig. 5A, lane 5) or A549 cells (data not shown). Finally, EMSA analysis was performed using a labeled probe corresponding to the region from -65 to -40. A single major complex was detected, which was competed off by excess cold oligonucleotide (Fig. 6A). Extracts from EGF-treated cells showed the same pattern, with no significant difference in the intensity of the band. Antibodies against Sp1 failed to supershift this band (Fig. 6B). Once again, extracts from A549 cells gave a complex of the same mobility, which was competed off by cold oligonucleotide and not shifted by Sp1 antibody (Fig. 6C). Based on these data, it appears that Sp1 can bind to both the -37/-30 region and the -21/-18 region. Because the -21/-18 region is also encoded within the -42/-13 oligonucleotide (Fig. 4), we performed an additional EMSA, with the -42/-13 oligonucleotide mutated at -21/-18. The pattern of bands observed with this oligonucleotide (data not shown) was indistinguishable from that obtained with the wild-type -42/-13 probe (Fig. 4A).

To determine whether Sp1 plays a functional role in regulation of cPLA2 promoter activity, RL-65 cells were transiently co-transfected with cPLA2 promoter constructs along with a Sp1 expression vector. Overexpression of Sp1 increased wild type promoter activity ~1.6-fold in RL-65 cells (Fig. 7). However, with the promoter construct with a mutation at -33/-30, no transactivation of promoter activity was detected in the context of Sp1 overexpression. Mutations at -37/-34 or -21/-18 resulted in lower basal promoter activity, with some residual stimulation in the presence of Sp1.


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 7.   Effects of overexpression of Sp1 and c-Jun on cPLA2 promoter activity. A, RL-65 cells were transiently transfected with a wild-type cPLA2 promoter constructor constructs containing the indicated mutations, along with expression plasmids for Sp1, c-Jun, v-Jun, or pcDNA-3 as a control. Promoter activity normalized to beta -galactosidase was determined after 48 h in standard media. Results represent the means of five independent experiments with mean and S.E. indicated. *, p < 0.02 versus basal; **, p = 0.02 versus Sp1 alone. B, individual dishes of RL-65 cells were left untreated (WT; lane 1), or were transiently transfected with pcDNA-3 (Neo, lane 2) or Ha-Ras (lanes 3 and 4) for 48 h. Cell lysates were prepared and matched for protein. Lysates were immunoblotted for expression of c-Jun.

Sp1 is capable of forming multimeric complexes through homotypic interactions (24, 25) as well as interacting heterotypically with different types of nuclear proteins such as NF-Y (26, 27), E2F (28), and AP-2 (29). The 12-lipoxygenase promoter has many similarities with the cPLA2 promoter in that it is also a TATA-less promoter whose activity is regulated by the ERK and JNK mitogen-activated protein kinase pathways and induced by Ha-Ras expression (30, 31). Sp1 has been reported to bind to several consensus sites within this promoter (32). The transcription factor c-Jun has been implicated in induction of the 12-lipoxygenase promoter through direct binding to Sp1 (33). Others have reported that c-Jun superactivates Sp1 to drive the human p21(WAF/Cip1) promoter by directly binding to Sp1 but not to the promoter (34). To determine whether c-Jun is involved in the induction of the cPLA2 promoter, RL-65 cells were co-transfected with the cPLA2 promoter construct along with expression plasmids encoding c-Jun and Sp1 either individually or in combination. Overexpression of c-Jun alone increased cPLA2 promoter activity by itself and, in the setting of Sp1 overexpression, resulted in a synergistic increase in promoter activity (Fig. 7A). Overexpression of either Sp1 or c-Jun individually or together had a blunted effect on promoter activity with the -37/-34 mutant, and failed to cause significant increases for mutants -33/-30, or -21/-18 (Fig. 7A). Direct binding of c-Jun to the promoter was assessed by EMSA with an anti-c-Jun antibody. However, no supershifted complex was detected with this antibody using either region -42/-13 (Fig. 4) or -28/-8 (Fig. 5). Incubation of extracts with either oligonucleotide in the presence of antibodies against Sp3, NF-Y, or gut Kruppel-like factor (GKLF) failed to result in a supershifted complex (data not shown). Expression of v-Jun, which lacks the JNK docking domain (35), also stimulated promoter activity, and synergized with Sp1. In fact, co-expression of v-Jun and Sp1 increased promoter activity to levels comparable with that seen with expression of Ha-Ras.

One possible mechanism to account for the role of c-Jun in regulating the cPLA2 promoter is that activation of Ras leads to increased expression of c-Jun. We therefore examined levels of c-Jun expression in RL-65 cells transfected with Ha-Ras. Expression of Ha-Ras induced c-Jun expression 3-4-fold, as assessed by immunoblotting (Fig. 7B). Increased phosphorylation of c-Jun was also increased as assessed by immunoblotting with a phospho-Jun-specific antibody (data not shown).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Activating mutations in Ras are characteristic of a variety of cancer cells and play a critical role in the transformation of these cells. We have shown previously that expression of oncogenic Ras is necessary for elevated expression of cPLA2 and COX-2 in NSCLC (2), and sufficient to induce expression of both enzymes in nontransformed lung epithelial cells (14). In both cell types, induction of cPLA2 involved activation of the ERK and the JNK families of mitogen-activated protein kinases.

Through truncational analysis, we have previously defined the minimal region of the promoter required for induction of cPLA2 from -58 to -12 (14). Further truncation of this region indicated two smaller regions, which contribute to regulated expression. Promoter activity decreased when truncating from -58 to -37, but some basal activity was retained and the -fold induction of the promoter achieved by expression of Ha-Ras was similar. An additional truncation to -12 abolished both basal and Ha-Ras stimulated activity. We sought to further characterize the cis-regulatory elements in this region responsible for these effects. From the present study, we have identified three cis-regulatory elements from -55/-53, from -37/-30, and from -21/-18, which appear to be critical for regulated expression of cPLA2. In normal lung epithelial cells, mutations in each of these regions significantly decreased both basal promoter activity and stimulated promoter activity in response to expression of Ha-Ras or exposure to EGF. Similarly, each mutation decreased steady-state promoter activity in an NSCLC line expressing oncogenic Ras (A549). Overall, region -21/-18 appears to be the most crucial element in regulating promoter activity because mutation of this region abolishes all promoter activity.

By EMSA analysis, Sp1 bound to both the -37/-30 region and the -21/-18 region. Although these regions do not contain classical Sp1 sites, they are GC-rich. Our data suggest that at least two factors bind to the -37/-30 region. Mutating the -37/-34 region decreased the binding of Sp1, but still resulted in a fainter band, which was shifted by anti-Sp1 antibody (Fig. 4C). However, mutation of the -33/-30 region resulted in the formation of a complex that was not supershifted (Fig. 4B). We would therefore propose that a factor binding to the -37/-34 cooperates to promote Sp1 binding to the -33/-30 region. The identity of this second factor is unknown, but, based on supershift assays, it is not likely to be another member of the Sp1 family. Sp1 binding correlated with the ability of Ha-Ras to induce the promoter, because mutations that inhibited induction of promoter activity blunted or abolished Sp1 binding. Furthermore, overexpression of Sp1 in RL-65 cells was sufficient to induce promoter activity in the absence of Ha-Ras expression. Overexpressing Sp1 alone did not stimulate promoter activity to the extent seen with Ha-Ras. This may be a result of the fact that Sp1 is already highly expressed in most cells and is difficult to overexpress. Alternatively, Sp1 itself may not be sufficient to drive the promoter and an additional factor(s) is required (see above). Mutations in the -33/-30 region, which resulted in disappearance of complexes containing Sp1, completely abolished transactivation of promoter activity by Sp1 overexpression. With a construct containing mutations in the -21/-18 region, overexpression of Sp1 still resulted in a small increase in promoter activity. Thus, we would suggest that Sp1 binding to both regions (-33/-30 and -21/-18) is required for promoter induction.

Our data suggest that, similar to regulation of the 12-lipoxygenase promoter by Ha-Ras (30, 31), c-Jun cooperates with Sp1 to induce cPLA2 expression. Overexpression of c-Jun alone increased cPLA2 promoter activity; importantly, a synergistic induction of promoter activity occurred when both c-Jun and Sp1 were overexpressed. With oligonucleotides spanning the entire 58-bp region, no complex was detected in EMSA assays that was supershifted with anti-Jun antibodies. This is consistent with the lack of an AP-1 site in this region. These findings suggest that c-Jun does not bind directly to the promoter, but may form a complex with Sp1, leading to activation. Although we have not been able to detect such a complex using an EMSA assay, the affinity of binding may be too low. Others workers have reported that c-Jun is involved in driving expression of the p21(WAF1/Cip1) promoter by binding directly to Sp1 but not to the promoter (34), but also failed to detect a c-Jun/Sp1 complex in an EMSA assay. Our previous studies have implicated a role for JNK activation in Ha-Ras-mediated induction of the cPLA2 promoter. Phosphorylation of c-Jun by JNKs on serines 63 and 73 is critical for activation of c-Jun-mediated transcription at AP-1 sites (36). It is therefore possible that activation of JNKs in response to expression of Ha-Ras mediates induction of cPLA2 promoter activity by phosphorylating c-Jun. However, the ability of v-Jun, which lacks the JNK docking domain, to synergize with Sp1 in inducing promoter activity, suggests that increased expression of c-Jun may mediate induction of the promoter. The role of the JNK pathways may therefore be more important in regulating expression of c-Jun, rather than direct phosphorylation of the protein.

Sp1 belongs to a family of 16 different transcription factors containing a highly conserved zinc finger DNA-binding domain (22). All these proteins bind to similar DNA sites, which are specifically G-rich elements such as GC and GT/CACC boxes (22, 37). Although the Sp subgroup of proteins prefer the GC-rich box and the Kruppel-like factors favor the GT/CACC element, some cis elements have affinities for members of both subfamilies (37). GKLF binds to a GC-rich consensus sequence, but can bind with lower affinity to a classical GC-rich Sp1 site (38), whereas GKLF and Sp1 can bind with strong affinity to the basic transcription element found in the promoters of a family of cytochrome P450 genes (37, 39). Another member of this family is lung Kruppel-like factor (LKLF). The major site of expression of LKLF is the lung (22), and it has been shown to play a role in normal lung development (40). LKLF can bind to the CACC element of the beta -globin promoter known to be a site for erythroid Kruppel-like factor (41). We have preliminary data, using a yeast one-hybrid screen, that LKLF can also bind to the cPLA2 promoter.2 As the minimal region of the cPLA2 promoter (-58 to -12) does not contain any classical Sp1 sites, it may be that multiple family members have an affinity for the cis-regulatory elements within this region. Sp1 may be able to bind to the promoter with some affinity and drive the promoter when it is highly expressed, but multiple Kruppel-like factors may share affinity for these cis-regulatory elements and regulate the promoter in vivo.

In summary, we propose a hypothetical model for induction of cPLA2 expression by oncogenic Ras. Constitutively active Ras signals through the ERK and JNK mitogen-activated protein kinase pathways as well as some additional pathway to activate downstream transcription factors that work to regulate cPLA2 expression through three cis-regulatory elements within its promoter, from -21/-18, -37/-30, and -55/-53. A candidate transcription factor includes Sp1 which may bind to two of the elements, -21/-18 and -33/-30. Additional factors bind to the region from -37/-34 and the third element from -55/-53. c-Jun expression is induced by Ha-Ras and may play a functional role by interacting with Sp1 without directly binding to the promoter. The similarities in the pathways mediating induction of cPLA2 and 12-lipoxygenase by Ha-Ras also suggest that the coordinated induction of these enzymes is required for enhanced eicosanoid production.

    FOOTNOTES

* This work was supported by National Institutes of Health NCI SPORE Grant CA 58187 and National Institutes of Health Grants DK 19928 and DK 39902.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Div. of Renal Diseases and Hypertension, Box C-281, University of Colorado Health Sciences Center, 4200 E. Ninth Ave., Denver, CO 80262. Tel.: 303-315-6733; Fax: 303-315-4852; E-mail: raphael.nemenoff@uchsc.edu.

Published, JBC Papers in Press, September 14, 2001, DOI 10.1074/jbc.M107773200

2 M. Wick, S. A. Blaine, and R. A. Nemenoff, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: NSCLC, non-small cell lung cancer; cPLA2, cytosolic phospholipase A2; COX, cyclooxygenase; EMSA, electrophoretic mobility shift assay; JNK, c-Jun N-terminal kinase; ERK, extracellular signal-regulated kinase; bp, EGF, epidermal growth factor; CMV, cytomegalovirus; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; GKLF, gut Kruppel-like factor; LKLF, lung Kruppel-like factor; WT, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Giaccone, G. (1996) Chest 109, 130S-134S[Abstract/Free Full Text]
2. Heasley, L. E., Thaler, S., Nicks, M., Price, B., Skorecki, K., and Nemenoff, R. A. (1997) J. Biol. Chem. 272, 14501-14504[Abstract/Free Full Text]
3. Bonventre, J. V. (1992) J. Am. Soc. Nephrol. 3, 128-150[Abstract]
4. Dennis, E. A. (1997) Trends Biochem. Sci. 22, 1-2[CrossRef][Medline] [Order article via Infotrieve]
5. Leslie, C. C. (1997) J. Biol. Chem. 272, 16709-16712[Free Full Text]
6. DeWitt, D. L., Meade, E. A., and Smith, W. L. (1993) Am. J. Med. 95, 40S-44S[Medline] [Order article via Infotrieve]
7. Kujubu, D. A., Fletcher, B. S., Varnum, B. C., Lim, R. W., and Herschman, H. R. (1991) J. Biol. Chem. 266, 12866-12872[Abstract/Free Full Text]
8. Hubbard, W. C., Alley, M. C., McLemore, T. L., and Boyd, M. R. (1988) Cancer Res. 48, 4770-4775[Abstract/Free Full Text]
9. Hubbard, W. C., Alley, M. C., Gray, G. N., Green, K. C., McLemore, T. L., and Boyd, M. R. (1989) Cancer Res. 49, 826-832[Abstract/Free Full Text]
10. Avis, I. M., Jett, M., Boyle, T., Vos, M. D., Moody, T., Treston, A. M., Martinez, A., and Mulshine, J. L. (1996) J. Clin. Invest. 97, 806-813[Medline] [Order article via Infotrieve]
11. de Bravo, M. G., de Antueno, R. J., Toledo, J., De Tomas, M. E., Mercuri, O. F., and Quintans, C. (1991) Lipids 26, 866-870[Medline] [Order article via Infotrieve]
12. Hida, T., Leyton, J., Makheja, A. N., Ben-Av, P., Hla, T., Martinez, A., Mulshine, J., Malkani, S., Chung, P., and Moody, T. W. (1998) Anticancer Res. 18, 775-782[Medline] [Order article via Infotrieve]
13. Campbell, S. L., Khosravi-Far, R., Rossman, K. L., Clark, G. J., and Der, C. J. (1998) Oncogene 17, 1395-1413[CrossRef][Medline] [Order article via Infotrieve]
14. Van Putten, V., Refaat, Z., Dessev, C., Blaine, S., Wick, M., Butterfield, L., Han, S. Y., Heasley, L. E., and Nemenoff, R. A. (2001) J. Biol. Chem. 276, 1226-1232[Abstract/Free Full Text]
15. Wu, T., Ikezono, T., Angus, C. W., and Shelhamer, J. H. (1994) Nucleic Acids Res. 22, 5093-5098[Abstract/Free Full Text]
16. Tay, A., Maxwell, P., Li, Z., Goldberg, H., and Skorecki, K. (1994) Biochim. Biophys. Acta 1217, 345-347[Medline] [Order article via Infotrieve]
17. Miyashita, A., Crystal, R. G., and Hay, J. G. (1995) Nucleic Acids Res. 23, 293-301[Abstract/Free Full Text]
18. Roberts, P. E., Phillips, D. M., and Mather, J. P. (1990) Am. J. Physiol. 259, L415-L425[Abstract/Free Full Text]
19. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489[Abstract/Free Full Text]
20. Huber, R., Schlessinger, D., and Pilia, G. (1998) Gene (Amst.) 214, 35-44[CrossRef][Medline] [Order article via Infotrieve]
21. Wick, M., Zubov, D., and Hagen, G. (1999) Gene (Amst.) 232, 97-106[CrossRef][Medline] [Order article via Infotrieve]
22. Philipsen, S., and Suske, G. (1999) Nucleic Acids Res. 27, 2991-3000[Abstract/Free Full Text]
23. Turner, J., and Crossley, M. (1999) Trends Biochem. Sci. 24, 236-240[CrossRef][Medline] [Order article via Infotrieve]
24. Suske, G. (1999) Gene (Amst.) 238, 291-300[CrossRef][Medline] [Order article via Infotrieve]
25. Pascal, E., and Tjian, R. (1991) Genes Dev. 5, 1646-1656[Abstract/Free Full Text]
26. Roder, K., Wolf, S. S., Larkin, K. J., and Schweizer, M. (1999) Gene (Amst.) 234, 61-69[CrossRef][Medline] [Order article via Infotrieve]
27. Yamada, K., Tanaka, T., Miyamoto, K., and Noguchi, T. (2000) J. Biol. Chem. 275, 18129-18137[Abstract/Free Full Text]
28. Rotheneder, H., Geymayer, S., and Haidweger, E. (1999) J. Mol. Biol. 293, 1005-1015[CrossRef][Medline] [Order article via Infotrieve]
29. Pena, P., Reutens, A. T., Albanese, C., D'Amico, M., Watanabe, G., Donner, A., Shu, I. W., Williams, T., and Pestell, R. G. (1999) Mol. Endocrinol. 13, 1402-1416[Abstract/Free Full Text]
30. Chen, B. K., Liu, Y. W., Yamamoto, S., and Chang, W. C. (1997) Biochim. Biophys. Acta 1344, 270-277[Medline] [Order article via Infotrieve]
31. Chen, B. K., Kung, H. C., Tsai, T. Y., and Chang, W. C. (2000) Mol. Pharmacol. 57, 153-161[Abstract/Free Full Text]
32. Liu, Y. W., Arakawa, T., Yamamoto, S., and Chang, W. C. (1997) Biochem. J. 324, 133-140
33. Chen, B. K., and Chang, W. C. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10406-10411[Abstract/Free Full Text]
34. Kardassis, D., Papakosta, P., Pardali, K., and Moustakas, A. (1999) J. Biol. Chem. 274, 29572-29581[Abstract/Free Full Text]
35. Minden, A., and Karin, M. (1997) Biochim. Biophys. Acta 1333, F85-F104[Medline] [Order article via Infotrieve]
36. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes Dev. 7, 2135-2148[Abstract/Free Full Text]
37. Dang, D. T., Pevsner, J., and Yang, V. W. (2000) Int. J. Biochem. Cell Biol. 32, 1103-1121[CrossRef][Medline] [Order article via Infotrieve]
38. Shields, J. M., and Yang, V. W. (1998) Nucleic Acids Res. 26, 796-802[Abstract/Free Full Text]
39. Zhang, W., Shields, J. M., Sogawa, K., Fujii-Kuriyama, Y., and Yang, V. W. (1998) J. Biol. Chem. 273, 17917-17925[Abstract/Free Full Text]
40. Wani, M. A., Wert, S. E., and Lingrel, J. B. (1999) J. Biol. Chem. 274, 21180-21185[Abstract/Free Full Text]
41. Anderson, K. P., Kern, C. B., Crable, S. C., and Lingrel, J. B. (1995) Mol. Cell. Biol. 15, 5957-5965[Abstract]

Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
X.-Q. Wang, H. Li, V. Van Putten, R. A. Winn, L. E. Heasley, and R. A. Nemenoff
Oncogenic K-Ras Regulates Proliferation and Cell Junctions in Lung Epithelial Cells through Induction of Cyclooxygenase-2 and Activation of Metalloproteinase-9
Mol. Biol. Cell, February 1, 2009; 20(3): 791 - 800.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
J.-H. Tsou, K.-Y. Chang, W.-C. Wang, J. T. Tseng, W.-C. Su, L.-Y. Hung, W.-C. Chang, and B.-K. Chen
Nucleolin regulates c-Jun/Sp1-dependent transcriptional activation of cPLA2{alpha} in phorbol ester-treated non-small cell lung cancer A549 cells
Nucleic Acids Res., January 17, 2008; 36(1): 217 - 227.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
B.-K. Chen, C.-C. Huang, W.-C. Chang, Y.-J. Chen, U. Kikkawa, K.-i. Nakahama, I. Morita, and W.-C. Chang
PP2B-mediated Dephosphorylation of c-Jun C Terminus Regulates Phorbol Ester-induced c-Jun/Sp1 Interaction in A431 Cells
Mol. Biol. Cell, March 1, 2007; 18(3): 1118 - 1127.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J.-J. Hung, Y.-T. Wang, and W.-C. Chang
Sp1 Deacetylation Induced by Phorbol Ester Recruits p300 To Activate 12(S)-Lipoxygenase Gene Transcription.
Mol. Cell. Biol., March 1, 2006; 26(5): 1770 - 1785.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
G. D'Orazi, M. G. Sciulli, V. Di Stefano, S. Riccioni, M. Frattini, R. Falcioni, L. Bertario, A. Sacchi, and P. Patrignani
Homeodomain-Interacting Protein Kinase-2 Restrains Cytosolic Phospholipase A2-Dependent Prostaglandin E2 Generation in Human Colorectal Cancer Cells
Clin. Cancer Res., February 1, 2006; 12(3): 735 - 741.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B.-C. Chen, C.-C. Yu, H.-C. Lei, M.-S. Chang, M.-J. Hsu, C.-L. Huang, M.-C. Chen, J.-R. Sheu, T.-F. Chen, T.-L. Chen, et al.
Bradykinin B2 Receptor Mediates NF-{kappa}B Activation and Cyclooxygenase-2 Expression via the Ras/Raf-1/ERK Pathway in Human Airway Epithelial Cells
J. Immunol., October 15, 2004; 173(8): 5219 - 5228.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B.-C. Chen, Y.-S. Chang, J.-C. Kang, M.-J. Hsu, J.-R. Sheu, T.-L. Chen, C.-M. Teng, and C.-H. Lin
Peptidoglycan Induces Nuclear Factor-{kappa}B Activation and Cyclooxygenase-2 Expression via Ras, Raf-1, and ERK in RAW 264.7 Macrophages
J. Biol. Chem., May 14, 2004; 279(20): 20889 - 20897.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Higuchi, A. Grambihler, A. Canbay, S. F. Bronk, and G. J. Gores
Bile Acids Up-regulate Death Receptor 5/TRAIL-receptor 2 Expression via a c-Jun N-terminal Kinase-dependent Pathway Involving Sp1
J. Biol. Chem., January 2, 2004; 279(1): 51 - 60.
[Abstract] [Full Text] [PDF]

Home page
 Innate ImmunityHome page
Shuling Zhang, K. Thomas, J. C.G. Blanco, C. A. Salkowski, and S. N. Vogel
The role of the interferon regulatory factors, IRF-1 and IRF-2, in LPS-induced cyclooxygenase-2 (COX-2) expression in vivo and in vitro
Innate Immunity, October 1, 2002; 8(5): 381 - 390.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/46/42737    most recent
M107773200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blaine, S. A.
Right arrow Articles by Nemenoff, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blaine, S. A.
Right arrow Articles by Nemenoff, R. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement