JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M103596200 on September 10, 2001

J. Biol. Chem., Vol. 276, Issue 46, 42851-42856, November 16, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/46/42851    most recent
M103596200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berkovich, E.
Right arrow Articles by Ginsberg, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berkovich, E.
Right arrow Articles by Ginsberg, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Ras Induces Elevation of E2F-1 mRNA Levels*

Eli Berkovich and Doron GinsbergDagger

From the Department of Molecular Cell Biology, The Weizmann Institute of Science, Rehovot 76100, Israel

Received for publication, April 23, 2001, and in revised form, August 30, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Both E2F-1 and Ras play pivotal roles in the regulation of cell proliferation, and in some biological settings, they collaborate in cell transformation. We show here that activated Ras induces an increase in E2F-1 mRNA and protein levels. This Ras-induced increase in E2F-1 levels is dependent on both MEK and PKB, and it is retinoblastoma-independent. The effect of Ras on the up-regulation of E2F-1 mRNA is at the level of mRNA stability. Our data describe a novel functional link between Ras and the retinoblastoma/E2F pathway. Furthermore, we suggest that one of the molecular mechanisms underlying the collaboration between Ras and E2F-1 involves a Ras-induced elevation of transcriptionally active E2F-1 levels.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The E2F transcription factors control cell cycle-dependent expression of genes that are essential for cell proliferation (for review see Ref. 1 and 2). The DNA binding complex named E2F is a heterodimeric complex consisting of an E2F component and a dimerization partner (DP).1  To date, 6 E2F genes and 2 DP genes have been cloned (2). E2F-1, -2, and -3 represent a subgroup of the E2F family, and they are specifically regulated by retinoblastoma (RB) and not by the RB-related proteins, p107 and p130. In agreement with the regulation of many growth-related genes by E2F, the overexpression of E2F-1, -2, or -3 is sufficient to induce quiescent cells to enter S-phase (3-7).

The Ras gene family encodes small GTP-binding proteins that play a critical role in cell growth control as pivotal mediators of mitogenic signals from tyrosine kinase receptors (reviewed in Ref. 8). The mutations in Ras genes, which result in constitutively activated Ras proteins, are frequent in human tumors (reviewed in Ref. 9). The co-expression of activated Ras together with E2F-1 and its heterodimeric partner DP-1 leads to the formation of morphologically transformed foci in primary rat embryo fibroblasts, and these cells induce tumor formation in nude mice (10). Furthermore, double transgenic animals overexpressing E2F-1 and activated Ras in their epidermis develop skin tumors (11). The molecular mechanisms underlying the co-operation between Ras and E2F-1 in cell transformation are currently not fully understood. When expressed alone, either deregulated E2F-1 or constitutively active Ras transform immortal rodent cells (12, 13) but not primary cells. In fact, the expression of either E2F-1 or activated Ras in primary cells leads to cell cycle arrest resembling premature senescence (14-16). In both cases, the induction of the senescence-like phenotype involves an up-regulation of the expression of p19ARF, which neutralizes MDM2 and thereby stabilizes p53 (6, 17).

E2F activity is tightly regulated by a number of mechanisms during cell cycle progression. E2F/DP heterodimer formation facilitates the binding and negative regulation by the product of the RB gene and its related proteins p107 and p130, collectively referred to as the pocket proteins. Indeed, the complexes of unphosphorylated RB and E2F/DP act as transcriptional repressors, which contribute to RB-dependent cell cycle arrest in G1. Complex formation is cell cycle regulated via phosphorylation of the pocket proteins by Cdk4/cyclin D and Cdk2/cyclin E heterodimers. These phosphorylations lead to dissociation of E2F/pocket protein complexes, resulting in free transcriptionally active E2F/DP heterodimers. The combination of cessation of repression of some E2F-regulated genes and activation of others by the current activated transcription factor(s) is a major step in promoting G1 exit. The additional controls of E2F-1 activity include up-regulation of its DNA binding activity by acetylation (18) and down-regulation of this activity via phosphorylation of DP-1 by Cdk2/cyclin A (19-21). E2F-1 mRNA and protein levels are also tightly regulated. It is subjected to cell cycle-dependent transcriptional control and its mRNA level peak in late G1. In addition, E2F-1 is a short-lived protein and is degraded by the proteasome pathway (22-24).

In view of the ability of both Ras and E2F-1 to play a role in cellular transformation on one hand and to induce premature cell senescence on the other hand, we studied possible functional relationships between Ras and E2F-1. We report here that activated Ras up-regulates both E2F-1 mRNA and protein levels. This constitutes a novel mechanism of regulating E2F-1 levels.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- Rat-1a-MT-wtE2F-1 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) and G418 (500 µg/ml, Life Technologies, Inc.). HEK293 and 293T cells were grown in DMEM supplemented with 10% FCS. H1299 cells were grown in RPMI 1640 medium supplemented with 10% FCS. Swiss 3T3, NIH 3T3, and 3T3 fibroblasts derived from RB-/- mice were grown in DMEM supplemented with 10% bovine calf serum. All cells were maintained at 37 °C in a humidified 8% CO2-containing atmosphere. After infection of Rat-1a-MT-wtE2F-1 cells for actinomycin D treatment, cells were selected with 2 µg/ml puromycin for 24 h. Actinomycin D (10 µg/ml, Sigma A-9415) was then added for the indicated times. 24 h after transfection of HEK293 cells for cyclohexamide treatment, 10 µg/ml cyclohexamide (Sigma C0934) were added to the plates for the indicated times, and then cells were harvested. 24 h after transfection of HEK293 cells for MG-132 treatment, 50 µM MG-132 (Calbiochem 474790) were added to the plates for 2 h, and then cells were harvested.

Plasmids-- The following plasmids have been previously described: pcDNAI-E2F-1, pcDNAI-HA-DP-1, pcDNAI-E2F-1Delta 18 (25), pRcCMV-HA-E2F-2, pRcCMV-HA-E2F-3 (12), pBABE-RasN17, pCMV-HA-RasV12 (26), pCMV-HA-E2F4, pCMV-beta -galactisodase (27), E1beta -luciferase (17), pECEmyrDelta 4-129Akt (28), pCMV-Delta N-EE-MEK (29), and pSV-psi -E-MLV (30). pcDNAIII-HA-E2F-1(381-1311) was generated by polymerase chain reaction using pcDNAI-E2F-1 as template and oligonucleotides GTTGGATCCGCCATGTATGAGACCTCACTGAATCTGACC and GCCGAATTCTCAGAAATCCAGGGGGGTGAG. pcDNAIII-HA-E2F-1(1-1089) was generated from pRcCMV-HA-E2F1(1-363) (22) by digestion with HindIII and partial digestion with BglII followed by subcloning of the fragment containing 1-1089 base pairs of the E2F-1-coding region into pcDNAIII.

Retroviral Infection, Transfections, and Reporter Assay-- Cells of the packaging cell line 293T (2 × 106 cells) were co-transfected with 10 µg of psi -ecotropic packaging plasmid, pSV-psi -E-MLV, providing packaging helper function and 10 µg of the relevant plasmid using the calcium phosphate method. Chloroquin (25 µM final concentration, Sigma C6628) was added to the transfection medium. After 8 h, the transfection medium was replaced with fresh DMEM supplemented with 10% FCS, and 5 ml of medium containing retroviruses were collected at 6-h intervals. Five collections were pooled together and frozen in aliquots. For infection of Swiss 3T3 or Rat1a, cells were incubated for 5 h at 37 °C in 3 ml of retroviral supernatant, supplemented with 8 µg/ml polybrene (Sigma H9268). 7 ml of DMEM containing 10% FCS was then added, and after 24 h, the medium was replaced with fresh medium containing 10% FCS and 2 µg/ml puromycin (Sigma P7130). H1299 and HEK293 cells were transfected by a calcium phosphate method. NIH 3T3 cells and 3T3 fibroblasts derived from RB-/- mice were transfected using LipofectAMINE reagent (Life Technologies, Inc.). Cells were harvested 24-40 h following transfection. Cell lysis, beta -galactisodase, and luciferase assays were performed essentially as described previously (27).

Western Blot Analysis-- For Western blot analysis 30 µg of protein from each lysate as determined by the Bradford assay or 20 µl from the luciferase assay extracts were loaded, resolved by electrophoresis on an SDS-10% polyacrylamide gel, and transferred to filters (Protran, BA 85, S&S). Filters were incubated with the indicated antibodies overnight in phosphate-buffered saline with 0.05% Tween and 5% dry milk. The binding of the primary antibodies was detected using an enhanced chemiluminescence kit (ECL, Amersham Pharmacia Biotech).

Northern Blot Analysis-- RNA was extracted from cells using the tri-reagent method (Molecular Research Center, TR-118). 30 µg of total RNA from each sample were separated on a formaldehyde gel and then blotted to GeneScreen Plus membrane (DuPont) according to manufacturer instructions.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Oncogenic Ras Elicits an Increase in E2F-1 Levels-- The effect of Ras on E2F-1 was studied initially using co-transfection experiments. Co-expression of E2F-1 and oncogenic Ras (H-RasV12) in HEK293 cells led to a significant increase of the E2F-1 protein level. This increase in the levels of E2F-1 did not depend on the co-expression of its heterodimeric partner DP-1, because it was detected in both the absence and presence of DP-1 (Fig. 1A). Similar results were obtained using the human lung carcinoma cell line H1299 (data not shown). Levels of E2F-2 and E2F-3 were similarly elevated upon co-expression of oncogenic Ras (Fig. 1B). However, this Ras-induced increased of E2F levels was not shared by all E2Fs, and as previously reported (31), activated Ras did not cause a significant change in the levels of another E2F family member E2F-4. This finding suggests that the effect of H-RasV12 on E2F level is specific to the E2F-1, -2, -3 subfamily. Additional studies focused on the effect of oncogenic Ras on E2F-1 levels.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Ras increases protein levels of both exogenous and endogenous E2F-1. A, Ras increases protein levels of exogenous E2F-1. HEK293 cells were transfected with the indicated combinations of expression vectors of E2F-1, DP-1, and H-RasV12. An expression plasmid for beta -galactisodase was included in all transfections. Cell extracts were prepared 24 h after transfection and used for beta -galactisodase assay. Extracts containing equal beta -galactisodase activity were used for Western blot analysis with an anti-E2F-1 monoclonal antibody (SC-251, Santa-Cruz). A molecular size marker in kDa is shown on the left. None, cells transfected only with an expression plasmid for beta -galactisodase. B, Ras increases protein levels of exogenous E2F-1, -2, and 3 but not E2F-4. HEK293 cells were transfected with the expression vectors of HA-E2F-1, HA-E2F-2, HA-E2F-3, and HA-E2F-4 either alone or with H-RasV12. An expression plasmid for beta -galactisodase was included in all transfections. Cell extracts were prepared 24 h after transfection and used for beta -galactisodase assay. Extracts containing equal beta -galactisodase activity were used for Western blot analysis with an anti-HA monoclonal antibody (MMS-101R, BABCO). A molecular size marker in kDa is shown on the left. C, Ras augments the serum-induced expression of endogenous E2F-1. H1299 cells expressing an ecotropic retrovirus receptor were infected with a retrovirus expressing H-RasV12 (Ras), H-RasN17 (RasN17), or a retroviral vector (Vector). 20 h post-infection, puromycin was added to the cultures for 24 h, and then cells were kept in medium containing 0.5% serum for additional 24 h. At this point, cells were either collected (-) or kept for additional 15 h in medium containing 15% serum and then collected (+). Equal amounts of cell extracts (determined by the Bradford assay) were used for Western blot analysis with an anti-E2F-1 monoclonal antibody (SC-251, upper panel). The blot was reblotted with an anti-Ras monoclonal antibody (R02120, Transduction Laboratories, lower panel). In vitro transcribed/translated E2F-1 (TNT E2F-1) is shown in the far right lane.

In certain settings E2F-1 can induce apoptosis (4, 32, 33), and Ras can inhibit apoptosis (34). Therefore, we tested whether the differences we detect in the E2F-1 protein level are because of changes in cell viability. H1299 cells were transfected with a green fluorescent protein expression vector together with E2F-1 either alone or with H-RasV12, and then viable transfectants were counted. No apoptotic cells were detected among the green fluorescent protein-positive cells. In the presence of E2F-1, 7.15% of all viable cells were green fluorescent protein-positive, whereas in the presence of both E2F-1 and H-RasV12, 6.3% of the viable cells were green fluorescent protein-positive. These similar values indicate that under these experimental settings, the inhibition of E2F-1-induced apoptosis by H-RasV12 is not the cause for the elevated E2F-1 protein levels. Immunostaining for E2F-1 demonstrated that as previously reported (27), it is a nuclear protein. More importantly, the Ras-induced increase in E2F-1 levels did not affect the subcellular localization of E2F-1 (data not shown), ruling out changes in subcellular localization as the reason for changes in protein levels.

The effect of Ras on E2F-1 protein levels was not limited to exogenous E2F-1. The expression of endogenous E2F-1 is cell cycle-dependent. In cells emerging from growth arrest, it peaks during late G1 (35, 36). We analyzed endogenous E2F-1 levels in H1299 cells infected with either a retrovirus expressing H-RasV12, H-RasN17, or an empty retroviral vector. As expected, E2F-1 levels increased upon serum stimulation of starved cells. Interestingly, H-RasV12 augmented the increase of endogenous E2F-1 protein level in serum-stimulated cells (Fig. 1C). Moreover, endogenous Ras activity was required for the cell cycle-dependent induction of endogenous E2F-1, because dominant negative H-RasN17 interfered with this induction (Fig. 1C). Similar results were obtained using Swiss 3T3 murine fibroblasts (data not shown). These results corroborate our data with exogenous E2F-1 and further implicate Ras in the physiological regulation of E2F-1 levels.

E2F-1 is a short-lived protein and is degraded through the ubiquitin-proteasome pathway (22, 24). Therefore, a plausible mechanism explaining the Ras-induced increase in E2F-1 protein levels involves interfering with E2F-1 degradation. However, this is not the case, because analysis of E2F-1 protein stability by measurement of its half-life time indicated that the E2F1 protein stability was not significantly altered in the presence of activated Ras (Fig. 2, A and B). The inhibition of proteasome activity further supported the notion that activated Ras does not have a notable effect on E2F-1 degradation. As expected, treating cells with a proteasome inhibitor MG-132 resulted in an increase in E2F-1 protein levels. In cells co-expressing E2F-1 and Ras, E2F-1 protein level was significantly higher before the addition of MG-132, but it was further increased to a similar extent upon the addition of MG-132 (Fig. 2C). Thus, the Ras-induced increase in E2F-1 protein levels is most probably not because of the inhibition of E2F-1 protein degradation.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2.   Ras does not stabilize E2F-1 protein. A, HEK293 cells were transfected with the expression vector of E2F-1 either alone (left panel) or with RasV12 (right panel). Protein synthesis was blocked by cycloheximide (10 µg/ml). Cell extracts were prepared at different time points after the addition of cycloheximide (indicated at the top of each lane) and analyzed by Western blot with an anti-E2F-1 monoclonal antibody (SQ-41). Molecular size markers in kDa are shown on the left. B, E2F-1 and E2F-1/RasV12 cyclohexamide chase shown in A were quantified using NIH image densitometry software. The background of the relevant blot was calculated from an equivalent lane area and subtracted from each value of E2F-1 optical density (O.D.). Zero time was set to 100%, and all other time points were plotted on the graph as a percentage of Zero time (y axis) cross-indexed with the relevant time point (x axis). Linear correlation curves were calculated using Microsoft Excel software. C, HEK293 cells were transfected with the expression vector of E2F-1 either alone or with RasV12. 24 h after transfection, the cells were subjected to Me2SO (-) or 50 µM MG-132 (+) for 2 h. Cell extracts were prepared 24 h after transfection and used for Western blot analysis with an anti-E2F-1 monoclonal antibody (SQ-41). Molecular size markers in kDa are shown on the left.

We next studied the effect of Ras on E2F-1 levels using a Rat-1a-derived cell line containing a stably integrated Zinc-inducible E2F-1 (Rat-1a-MT-wtE2F-1) (4). Infection of these cells with a retrovirus harboring H-RasV12 resulted in a significant increase in E2F-1 protein after the addition of Zinc (Fig. 3A). This increase was accompanied by an elevation in E2F-1 mRNA (Fig. 3B). A similar elevation was detected in endogenous E2F-1 mRNA levels upon the infection of Swiss 3T3 cells with a retrovirus harboring H-RasV12. Hence, Ras elevates E2F-1 mRNA levels. Ras-dependent transcriptional regulation of the E2F-1 gene is probably not the underlying mechanism, because the increase in E2F-1 was detected also when E2F-1 expression was driven by heterologous promoters (Figs. 1A and 3A). Therefore, we next studied the effect of Ras on the half-life of E2F-1 mRNA. As can be seen in Fig. 3C, exogenous E2F-1 mRNA was easily detectable in Rat-1a-MT-wtE2F-1 cells, however, its levels were reduced below detection level 3 h after the addition of actinomycin D. In the presence of activated Ras E2F-1, mRNA levels were not significantly changed after 3 h and were only slightly reduced after 5 h of the same treatment. These data indicate that activated Ras leads to a significant increase in E2F-1 mRNA stability.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3.   Ras increases levels of E2F-1 mRNA. A, Ras causes an increase of inducible E2F-1 protein. Rat-1a-MT-wtE2F-1 cells were infected with a retroviral vector (Vector) or a retrovirus harboring H-RasV12 (Ras). 20 h post-infection, puromycin was added to the cultures for 24 h, and then the cells were kept with (+) or without (-) 100 µM Zncl2 for 16 h. Cell extracts were prepared, and equal protein amounts (determined by the Bradford assay) were used for Western blot analysis with an anti-E2F-1 monoclonal antibody (SQ-41). In vitro transcribed/translated E2F-1 (TNT E2F-1) is in the far right lane. B, E2F-1 mRNA levels are up-regulated by Ras. Left panel, Rat-1a-MT-wtE2F-1 (Rat1wtE2F-1) cells were infected and treated as in A. Total RNA was prepared from the cells, and equal amounts of RNA were subjected to Northern analysis using an E2F-1 probe. A probe for acidic ribosomal protein (ARPP (PO)) was used as a loading control. Right panel, Swiss fibroblasts were infected with a retroviral vector (Vector) or a retrovirus harboring H-RasV12 (Ras). 20 h post-infection, puromycin was added to the cultures for 24 h, and then the cells were kept in medium containing 0.5% bovine calf serum for 25 h. Total RNA was prepared from the cells, and equal amounts of RNA were subjected to Northern analysis using an E2F-1 probe. C, Ras stabilizes E2F-1 mRNA. Upper panel, Rat-1a-MT-wtE2F-1 cells were infected with an empty retroviral vector (E2F-1) or a retrovirus harboring H-RasV12 (E2F-1/RasV12). 20 h post-infection, puromycin was added to the cultures for 24 h, and then the cells were washed and kept with 100 µM Zncl2 for 12 h before adding actinomycin D (10 µg/ml, Sigma). Total RNA was extracted at the indicated time after the addition of actinomycin D and assayed by Northern blotting with an E2F-1 probe. Lower panel, a photo of the gel before transfer. rRNA levels were used as a loading control. D, the effect of Ras on E2F-1 mRNA is mediated by 1-381 bases of E2F-1-coding sequence. HEK293 cells were transfected with pCMV-beta -galactisodase together with either an expression vector of E2F-1 or the indicated E2F-1 mutants. E2F-1(1-1089) and E2F-1(381-1311) contain the indicated bases of E2F-1-coding region. An expression vector of H-RasV12 was added where indicated (+). 24 h post-transfection, proteins and total RNA were extracted from the cells. Protein extracts were used for beta -galactisodase assay. RNA amounts after normalization for beta -galactisodase activity were subjected to Northern analysis using an E2F-1 probe.

The Ras-induced increase in E2F-1 mRNA levels was detected when oncogenic Ras was co-expressed with an E2F-1 expression plasmid containing the full E2F-1-coding region and no 3' or 5' non-coding sequences (i.e. 1-1311 base pairs of the coding region). A similar Ras-induced increase was detected when using an E2F expression plasmid containing 1-1089 bases of the coding region (encoding amino acids 1-363). In contrast, the co-expression of oncogenic Ras did not elevate the mRNA levels of a truncated E2F-1, containing only 381-1311 bases of its coding region (Fig. 3D). These data indicate that the effect of oncogenic Ras on E2F-1 mRNA stability is mediated by an element within 1-381 bases of the E2F-1-coding sequence.

The Ras-induced Increase in E2F-1 Levels Is Mediated by MEK and PKB, and It Is RB-independent-- Because Ras activates a number of signal transduction pathways, we tested which of these pathways plays a role in controlling E2F-1 protein levels. Co-expression of either activated PKB or activated MEK together with E2F-1 resulted in elevated E2F-1 protein levels (Fig. 4, A and B), indicating that both the PI3K/PKB pathway and the mitogen-activated protein kinase/MEK pathway can contribute to the Ras-dependent increase in E2F-1 levels. The Ras-induced increase in E2F-1 protein levels was not blocked by either the PI3K inhibitor Wortmanin alone or by the MEK inhibitor PD-098059 alone (Fig. 4C). However, it was diminished upon simultaneous treatment of cells with both inhibitors (Fig. 4C), further supporting the notion that both PKB and MEK play a role in the Ras-induced increase of E2F-1 levels.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4.   Both PKB and MEK increase E2F-1 protein levels. A, HEK293 cells were transfected with the indicated combinations of expression vectors of E2F-1, PKB (PKB), and H-RasV12 (Ras). Cell extracts were prepared 24 h after transfection and used for Western blot analysis with an anti-E2F-1 monoclonal antibody (SQ-41). Molecular size markers in kDa are shown on the left. In vitro transcribed/translated E2F-1 (TNT E2F-1) is in the far right lane. None, untransfected cells. B, HEK293 cells were transfected with the indicated combinations of expression vectors of E2F-1, H-RasV12 (Ras), and Delta N-EE-MEK (MEK) and processed as in A. C, H1299 cells were transfected with expression vector of E2F-1 either alone or together with H-RasV12 (Ras). 2.5 h before harvesting, 10-7 M Wortmanin or 25 µM PD-098059 or both were added as indicated (+). Cell extracts were prepared 40 h after transfection and processed as in A.

A well established effect of activated Ras on the RB/E2F pathway involves Ras-induced accumulation of cyclin D1. This accumulated cyclin D1 complexes with Cdk4, resulting in the phosphorylation of RB and the release of active E2Fs. Indeed, the presence of functional RB was shown to be essential for some of the effects of Ras on cell proliferation (26, 37). However, this effect of Ras on the cyclin D/Cdk4/RB/E2F pathway does not lead to an increase in E2F-1 levels. To test whether RB is required for the increase that we observe, we studied the effect of H-RasV12 on the levels of an E2F-1 mutant lacking the RB binding domain E2F-1Delta 18. As can be seen in Fig. 5A, the levels of both wtE2F-1 and E2F-1Delta 18 were similarly increased upon the co-expression of activated Ras, suggesting that the effect of Ras is RB-independent. Furthermore, the co-expression of H-RasV12 and E2F-1 in 3T3 fibroblasts derived from RB-/- mice led to an increase in E2F-1 protein levels, similar to that detected in WT 3T3 cells (Fig. 5B). Thus, RB is dispensable for this increase.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5.   Ras-induced increase in E2F-1 protein levels is Rb-independent. A, HEK293 cells were transfected with the indicated combinations of expression vectors of E2F-1, E2F-1Delta 18, and H-RasV12 (Ras). Cell extracts were prepared 24 h after transfection and used for Western blot analysis with an anti-E2F-1 monoclonal antibody (SQ-41). Molecular size markers in kDa are shown on the left. None, untransfected cells. B, 3T3 mouse fibroblasts from Rb+/+ and Rb-/- genotype were transfected with the indicated combinations of expression vectors of E2F-1 and H-RasV12 (Ras). An expression plasmid for beta -galactisodase was included in all transfections. Cell extracts were prepared 40 h after transfection and used for beta -galactisodase assay. Extracts containing equal beta -galactisodase activity were subjected to Western blot analysis with an anti-E2F-1 monoclonal antibody (SQ-41, upper panel). The blot was reblotted with anti-Rb monoclonal antibody (PharMingen 14001A, middle panel) and then further reblotted with an anti-Ras monoclonal antibody (R02120, Transduction Laboratories, lower panel). Molecular size markers in kDa are shown on the left.

The Ras-induced increase in E2F-1 levels is accompanied by an increase in the promoter activity of an E2F-regulated gene, suggesting that the Ras-induced E2F-1 is transcriptionally active (Fig. 6). Overall, the data presented here demonstrate that activated Ras leads to an increase in E2F-1 mRNA and protein levels that results in enhanced E2F transcriptional activity.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 6.   Ras-induced E2F-1 is transcriptionally active. HEK293 cells were transfected with the reporter plasmids E1beta -luciferase and pCMV-beta -galactisodase together with increasing amounts of the expression vector of E2F-1 either alone or together with H-RasV12 (300 ng) (Ras). Cell extracts were prepared 24 h after transfection and used for beta -galactisodase assay, luciferase assay, and Western blot analysis with an anti-E2F-1 monoclonal antibody (SQ-41). A fold of activation in the luciferase assay after normalization for beta -galactisodase activity is depicted in the bar graph (upper panel). None, cells transfected only with reporter plasmids.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Both Ras and E2F-1 play pivotal roles in the control of cell proliferation, and they collaborate in cell transformation both in tissue culture experiments and in transgenic mice. However, the molecular mechanism(s) by which these two regulators of cell growth cooperate are not fully understood. This collaboration may involve initiation of distinct cascades of events that converge downstream to E2F-1 and Ras, although an effect of one of these two proteins on the activity of the other may also contribute to such a collaboration. We demonstrate here that oncogenic Ras induces an increase in the levels of E2F-1 mRNA and protein levels. Moreover, the dominant negative RasN17 abolishes the induction of E2F-1 in quiescent cells upon serum stimulation, indicating that endogenous Ras plays a role in the regulation of endogenous E2F-1 levels.

High levels of transcriptionally active E2F-1 were shown to induce S-phase entry in quiescent immortal cells (3, 4, 38). Ras brings about the accumulation of transcriptionally active E2F-1 (Fig. 6), and therefore, this ability of Ras to up-regulate E2F-1 levels may be an important factor in the biological activities of E2F-1. Furthermore, its ability may play an important role in the collaboration between Ras and E2F-1 in controlling cell growth, although additional molecular mechanisms most probably are involved. For example, Ras and E2F-1 might collaborate on the activation of the phosphatase Cdc25A that is a known E2F target gene (7) and is directly phosphorylated and activated by the Ras/Raf pathway (39). Another possible point of convergence of E2F-1 and Ras activities may be the control of the kinase activity of the cyclin E·Cdk2 complex. Both E2F-1 and Ras affect its activity because cyclin E is an E2F target gene (40, 41), whereas Ras plays a central role in the control of protein levels of the Cdk2 inhibitor p27kip1 (39, 42)

The Ras-dependent increase in E2F-1 levels described here is reminiscent of the recently reported Ras-dependent increase in the levels of another critical regulator of cell proliferation c-Myc (31). Both c-Myc and E2F-1 are transcription factors that regulate cell growth and cooperate with Ras in cell transformation. Ras activity results in an increase in the protein levels and the transcriptional activity of both c-Myc and E2F-1 (Ref. 31 and this work). However, our data suggest that the molecular mechanisms underlying these increases are different. Whereas in the case of c-Myc, Sears et al. (31) clearly demonstrate that Ras induces an increase in the c-Myc protein stability. We did not detect a significant change in the half-life of the E2F-1 protein in the presence of constitutively active Ras (Fig. 2). Instead we observed a Ras-induced increase in the levels of E2F-1 mRNA (Fig. 3, B and D). This increase in E2F-1 mRNA levels was seen when E2F-1 expression was driven by different promoters, making a specific Ras-dependent transcriptional effect improbable. The mechanism underlying this Ras-induced increase in E2F-1 mRNA level is the enhancement of mRNA stability. This is evident from the Ras-induced increase in E2F-1 mRNA levels in the presence of actinomycin D (Fig. 3C). The first 381 bases of E2F-1-coding sequence mediate the response to Ras-induced signals, because the mRNA levels of E2F-1 lacking these 381 bases are not affected by the co-expression of oncogenic Ras (Fig. 3D). The effects of Ras on mRNA stability have been documented for other mRNA molecules, such as vascular endothelial growth factor, fibronectin, nuclear factor 1, and ornithine decarboxylase (43-46).

Our data indicate that E2F-1 levels are affected by both the PI3 kinase/PKB pathway and by the Raf/MEK/ERK pathway. In support of this notion, the combined action of Worthmanin and PD-098059, inhibitors of PI3K and MEK, respectively, is required to significantly diminish the Ras-mediated increase in E2F-1 levels. Interestingly, the Raf/ERK and the PI3K/PKB pathways are involved also in the Ras-induced stabilization of c-Myc (47). In addition, a similar involvement of two independent Ras effectors has been observed in a number of other Ras-induced phenomena, including the induction of parathyroid hormone-related peptide, repression of the homeobox gene product TTF-1 and prevention of caspase-3 activation (48-50).

The Ras-dependent regulation of E2F-1 levels is a novel functional link between Ras and the RB/E2F pathway. It comes in addition to the well established effect of Ras on the RB/E2F pathway, namely its ability to elicit an increase in the levels of cyclin D1. Ras stimulates cyclin D1 accumulation via different mechanisms including the induction of cyclin D1 gene expression (42, 51-54) increasing the translation of cyclin D1 mRNA (55) and the stabilization of the cyclin D1 protein (56, 57). Complexing of the accumulated cyclin D1 with Cdk4 results in the phosphorylation of RB and the release of an active E2F from the RB·E2F complex. Indeed, the expression of the dominant negative RasN17 was shown to prevent both RB phosphorylation and the concomitant increase in E2F activity in quiescent cells stimulated by the addition of serum (37). The effect of Ras on cyclin D results in an RB-dependent effect on E2F activity, and it leads to increased E2F activity without significant changes in E2F levels. In contrast, the Ras-induced increase in E2F-1 levels described here is RB-independent, and it occurs in the absence of RB and also in the absence of the RB binding domain in the E2F-1 molecule.

The Ras-induced increase in E2F-1 levels and activity reported here constitutes a novel functional link between Ras and E2F-1, and it may be part of the explanation for their ability to collaborate in affecting cell growth.

    ACKNOWLEDGEMENTS

We are grateful to Yocheved Lamed for excellent technical assistance. We thank Drs. Marie Classon, Ed Harlow, Richard Roth, Daniel Peeper, and Roni Zeger for plasmids, Dr. David M. Livingston for Rb-/- 3T3 cells, Dr. William G. Kaelin for Rat-1a cells containing inducible E2F-1, and Dr. Moshe Oren for H1299 cells expressing an ecotropic retrovirus receptor. We also thank Drs. David Givol, Adi Kimchi, and Moshe Oren for critical reading of the manuscript.

    FOOTNOTES

* This work was supported in part by grants from the Israel Cancer Association (ICA), Minerva Foundation (Germany), the Israel Cancer Research Fund (ICRF), and Yad Abraham Research Center for Diagnostics and Therapy.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Incumbent of the Recanati Career Development Chair of Cancer Research. To whom correspondence should be addressed. Tel.: 972- 8-934-2239; Fax: 972-8-934-4125; E-mail: doron.ginsberg@ weizmann.ac.il.

Published, JBC Papers in Press, September 10, 2001, DOI 10.1074/jbc.M103596200

    ABBREVIATIONS

The abbreviations used are: DP, dimerization partner; RB, retinoblastoma; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; HEK, human embryonic kidney; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; HA, hemagglutinin; PKB, protein kinase B..

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Muller, H., and Helin, K. (2000) Biochim. Biophys. Acta. 1470, M1-M12[Medline] [Order article via Infotrieve]
2. Dyson, N. (1998) Genes Dev. 12, 2245-2262[Free Full Text]
3. Johnson, D. G., Schwarz, J. K., Cress, W. D., and Nevins, J. R. (1993) Nature 365, 349-352[CrossRef][Medline] [Order article via Infotrieve]
4. Qin, X. Q., Livingston, D. M., Kaelin, W. G., and Adams, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10918-10922[Abstract/Free Full Text]
5. Lukas, J., Petersen, B. O., Holm, K., Bartek, J., and Helin, K. (1996) Mol. Cell. Biol. 16, 1047-1057[Abstract]
6. DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Nevins, J. R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7245-7250[Abstract/Free Full Text]
7. Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M. C., and Helin, K. (1999) Mol. Cell. Biol. 19, 6379-6395[Abstract/Free Full Text]
8. Cahill, M. A., Janknecht, R., and Nordheim, A. (1996) Curr. Biol. 6, 16-19[CrossRef][Medline] [Order article via Infotrieve]
9. Bos, J. L. (1988) Mutat. Res. 195, 255-271[CrossRef][Medline] [Order article via Infotrieve]
10. Johnson, D. G., Cress, W., Jakoi, L., and Nevins, J. R. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 12823-12827[Abstract/Free Full Text]
11. Pierce, A. M., Fisher, S. M., Conti, C. J., and Johnson, D. G. (1998) Oncogene 16, 1267-1276[CrossRef][Medline] [Order article via Infotrieve]
12. Xu, G., Livingston, D. M., and Krek, W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 1357-1361[Abstract/Free Full Text]
13. Newbold, R. F., and Overell, R. W. (1983) Nature 304, 648-651[CrossRef][Medline] [Order article via Infotrieve]
14. Lin, A. W., Barradas, M., Stone, J. C., van, A., L., Serrano, M., and Lowe, S. W. (1998) Genes Dev. 12, 3008-3019[Abstract/Free Full Text]
15. Serrano, M., Lin, A. W., McCurrach, M. E., Beach, D., and Lowe, S. W. (1997) Cell 88, 593-602[CrossRef][Medline] [Order article via Infotrieve]
16. Dimri, G. P., Itahana, K., Acosta, M., and Campisi, J. (2000) Mol. Cell. Biol. 20, 273-285[Abstract/Free Full Text]
17. Bates, S., Phillips, A. C., Clark, P. A., Stott, F., Peters, G., Ludwig, R. L., and Vousden, K. H. (1998) Nature 395, 124-125[CrossRef][Medline] [Order article via Infotrieve]
18. Marzio, G., Wagener, C., Gutierrez, M. I., Cartwright, P., Helin, K., and Giacca, M. (2000) J. Biol. Chem. 275, 10887-10892[Abstract/Free Full Text]
19. Dynlacht, B. D., Flores, O., Lees, J. A., and Harlow, E. (1994) Genes Dev. 8, 1772-1786[Abstract/Free Full Text]
20. Krek, W., Ewen, M. E., Shirodkar, S., Arany, Z., G., Kaelin, W. G., and Livingston, D. M. (1994) Cell 78, 161-172[CrossRef][Medline] [Order article via Infotrieve]
21. Xu, M., Sheppard, K.-A., Peng, C.-Y., Yee, A. S., and Piwnica-Worms, H. (1994) Mol. Cell. Biol. 14, 8420-8431[Abstract/Free Full Text]
22. Hofmann, F., Martelli, F., Livingston, D. M., and Wang, Z. (1996) Genes Dev. 10, 2949-2959[Abstract/Free Full Text]
23. Hateboer, G., Kerkhoven, R. M., Shvarts, A., Bernards, R., and Beijersbergen, R. L. (1996) Genes Dev. 10, 2960-2970[Abstract/Free Full Text]
24. Marti, A., Wirbelauer, C., Scheffner, M., and Krek, W. (1999) Nat. Cell Biol. 1, 14-19[CrossRef][Medline] [Order article via Infotrieve]
25. Krek, W., Livingston, D. M., and Shirodkar, S. (1993) Science 262, 1557-1560[Abstract/Free Full Text]
26. Peeper, D. S., Upton, T. M., Ladha, M. H., Neuman, E., Zalvide, J., Bernards, R., DeCaprio, J. A., and Ewen, M. E. (1997) Nature 386, 177-181[CrossRef][Medline] [Order article via Infotrieve]
27. Lindeman, G. J., Gaubatz, S., Livingston, D. M., and Ginsberg, D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 5095-5100[Abstract/Free Full Text]
28. Kohn, A. D., Takeuchi, F., and Roth, R. A. (1996) J. Biol. Chem. 271, 21920-21926[Abstract/Free Full Text]
29. Jaaro, H., Rubinfeld, H., Hanoch, T., and Seger, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3742-3747[Abstract/Free Full Text]
30. Muller, A. J., Young, J. C., Pendergast, A. M., Pondel, M., Landau, N. R., Littman, D. R., and Witte, O. N. (1991) Mol. Cell. Biol. 11, 1785-1792[Abstract/Free Full Text]
31. Sears, R., Leone, G., DeGregori, J., and Nevins, J. R. (1999) Mol. Cell. 3, 169-179[CrossRef][Medline] [Order article via Infotrieve]
32. Kowalik, T. F., DeGregori, J., Schwarz, J. K., and Nevins, J. R. (1995) J. Virol. 69, 2491-2500[Abstract]
33. Wu, X., and Levine, A. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3602-3606[Abstract/Free Full Text]
34. Downward, J. (1998) Curr. Opin. Genet. Dev. 8, 49-54[CrossRef][Medline] [Order article via Infotrieve]
35. Kaelin, W. G. J., Krek, W., Sellers, W. R., DeCaprio, J. A., Ajchenbaum, F., Fuchs, C. S., Chittenden, T., Li, Y., Farnham, P. J., Blanar, M. A., Livingston, D. M., and Flemington, E. K. (1992) Cell 70, 351-364[CrossRef][Medline] [Order article via Infotrieve]
36. Slansky, J. E., Li, Y., Kaelin, W. G., and Farnham, P. J. (1993) Mol. Cell. Biol. 13, 1610-1618[Abstract/Free Full Text]
37. Leone, G., DeGregori, J., Sears, R., Jakoi, L., and Nevins, J. R. (1997) Nature 387, 422-426[CrossRef][Medline] [Order article via Infotrieve]
38. Shan, B., and Lee, W.-H. (1994) Mol. Cell. Biol. 14, 8166-8173[Abstract/Free Full Text]
39. Galaktionov, K., Jessus, C., and Beach, D. (1995) Genes Dev. 9, 1046-1058[Abstract/Free Full Text]
40. Ohtani, K., DeGregori, J., and Nevins, J. R. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 12146-12150[Abstract/Free Full Text]
41. Geng, Y., Eaton, E. N., Picon, M., Roberts, J. M., Lundberg, A. S., Gifford, A., Sardet, C., and Weinberg, R. A. (1996) Oncogene 12, 1173-1180[Medline] [Order article via Infotrieve]
42. Aktas, H., Cai, H., and Cooper, G. M. (1997) Mol. Cell. Biol. 17, 3850-3857[Abstract]
43. White, F. C., Benehacene, A., Scheele, J. S., and Kamps, M. (1997) Growth Factors 14, 199-212[Medline] [Order article via Infotrieve]
44. Chandler, L. A., Ehretsmann, C. P., and Bourgeois, S. (1994) Mol. Cell. Biol. 14, 3085-3093[Abstract/Free Full Text]
45. Nebl, G., Mermod, N., and Cato, A. C. (1994) J. Biol. Chem. 269, 7371-7378[Abstract/Free Full Text]
46. Holtta, E., Sistonen, L., and Alitalo, K. (1988) J. Biol. Chem. 263, 4500-4507[Abstract/Free Full Text]
47. Sears, R., Nuckolls, F., Haura, E., Taya, Y., Tamai, K., and Nevins, J. R. (2000) Genes Dev. 14, 2501-2514[Abstract/Free Full Text]
48. Aklilu, F., Gladu, J., Goltzman, D., and Rabbani, S. A. (2000) Cancer Res. 60, 1753-1760[Abstract/Free Full Text]
49. Missero, C., Pirro, M. T., and Di, L. R. (2000) Mol. Cell. Biol. 20, 2783-2793[Abstract/Free Full Text]
50. Terada, K., Kaziro, Y., and Satoh, T. (2000) Biochem. Biophys. Res. Commun. 267, 449-455[CrossRef][Medline] [Order article via Infotrieve]
51. Albanese, C., Johnson, J., Watanabe, G., Eklund, N., Vu, D., Arnold, A., and Pestell, R. G. (1995) J. Biol. Chem. 270, 23589-23597[Abstract/Free Full Text]
52. Lavoie, J. N., L'Allemain, G., Brunet, A., Muller, R., and Pouyssegur, J. (1996) J. Biol. Chem. 271, 20608-20616[Abstract/Free Full Text]
53. Winston, J. T., Coats, S. R., Wang, Y. Z., and Pledger, W. J. (1996) Oncogene 12, 127-134[Medline] [Order article via Infotrieve]
54. Weber, J. D., Raben, D. M., Phillips, P. J., and Baldassare, J. J. (1997) Biochem. J. 326, 61-68
55. Muise, H. R., Grimes, H. L., Bellacosa, A., Malstrom, S. E., Tsichlis, P. N., and Rosen, N. (1998) J. Biol. Chem. 273, 29864-29872[Abstract/Free Full Text]
56. Diehl, J. A., Zindy, F., and Sherr, C. J. (1997) Genes Dev. 11, 957-972[Abstract/Free Full Text]
57. Diehl, J. A., Cheng, M., Roussel, M. F., and Sherr, C. J. (1998) Genes Dev. 12, 3499-3511[Abstract/Free Full Text]


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
R. Blum, R. Elkon, S. Yaari, A. Zundelevich, J. Jacob-Hirsch, G. Rechavi, R. Shamir, and Y. Kloog
Gene Expression Signature of Human Cancer Cell Lines Treated with the Ras Inhibitor Salirasib (S-Farnesylthiosalicylic Acid)
Cancer Res., April 1, 2007; 67(7): 3320 - 3328.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S.-O. Yoon, S. Shin, and A. M. Mercurio
Ras Stimulation of E2F Activity and a Consequent E2F Regulation of Integrin {alpha}6{beta}4 Promote the Invasion of Breast Carcinoma Cells.
Cancer Res., June 15, 2006; 66(12): 6288 - 6295.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Pintus, B. Tadolini, A. M Posadino, B. Sanna, M. Debidda, C. Carru, L. Deiana, and C. Ventura
PKC/Raf/MEK/ERK signaling pathway modulates native-LDL-induced E2F-1 gene expression and endothelial cell proliferation
Cardiovasc Res, October 1, 2003; 59(4): 934 - 944.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Petrenko, G. Fingerle-Rowson, T. Peng, R. A. Mitchell, and C. N. Metz
Macrophage Migration Inhibitory Factor Deficiency Is Associated with Altered Cell Growth and Reduced Susceptibility to Ras-mediated Transformation
J. Biol. Chem., March 21, 2003; 278(13): 11078 - 11085.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. B. Hansen, R. K. Petersen, C. Jorgensen, and K. Kristiansen
Deregulated MAPK Activity Prevents Adipocyte Differentiation of Fibroblasts Lacking the Retinoblastoma Protein
J. Biol. Chem., July 12, 2002; 277(29): 26335 - 26339.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/46/42851    most recent
M103596200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berkovich, E.
Right arrow Articles by Ginsberg, D.
Right arrow Search for Related Content
PubMed