JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M104446200 on September 12, 2001

J. Biol. Chem., Vol. 276, Issue 46, 43221-43230, November 16, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/46/43221    most recent
M104446200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, X.
Right arrow Articles by Bates, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, X.
Right arrow Articles by Bates, P. J.

Inhibition of DNA Replication and Induction of S Phase Cell Cycle Arrest by G-rich Oligonucleotides*

Xiaohua XuDagger , Fofi HamhouyiaDagger , Shelia D. ThomasDagger , Tom J. Burke§, Allicia C. Girvan, W. Glenn McGregorDagger §, John O. TrentDagger ||, Donald M. MillerDagger , and Paula J. BatesDagger **

From the Human Molecular Biology Group, James Graham Brown Cancer Center, Departments of Dagger  Medicine, § Pharmacology/Toxicology,  Biochemistry/Molecular Biology, and || Chemistry, University of Louisville, Louisville, Kentucky 40202

Received for publication, May 16, 2001, and in revised form, September 6, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The discovery of G-rich oligonucleotides (GROs) that have non-antisense antiproliferative activity against a number of cancer cell lines has been recently described. This biological activity of GROs was found to be associated with their ability to form stable G-quartet-containing structures and their binding to a specific cellular protein, most likely nucleolin (Bates, P. J., Kahlon, J. B., Thomas, S. D., Trent, J. O., and Miller, D. M. (1999) J. Biol. Chem. 274, 26369-26377). In this report, we further investigate the novel mechanism of GRO activity by examining their effects on cell cycle progression and on nucleic acid and protein biosynthesis. Cell cycle analysis of several tumor cell lines showed that cells accumulate in S phase in response to treatment with an active GRO. Analysis of 5-bromodeoxyuridine incorporation by these cells indicated the absence of de novo DNA synthesis, suggesting an arrest of the cell cycle predominantly in S phase. At the same time point, RNA and protein synthesis were found to be ongoing, indicating that arrest of DNA replication is a primary event in GRO-mediated inhibition of proliferation. This specific blockade of DNA replication eventually resulted in altered cell morphology and induction of apoptosis. To characterize further GRO-mediated inhibition of DNA replication, we used an in vitro assay based on replication of SV40 DNA. GROs were found to be capable of inhibiting DNA replication in the in vitro assay, and this activity was correlated to their antiproliferative effects. Furthermore, the effect of GROs on DNA replication in this assay was related to their inhibition of SV40 large T antigen helicase activity. The data presented suggest that the antiproliferative activity of GROs is a direct result of their inhibition of DNA replication, which may result from modulation of a replicative helicase activity.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Oligonucleotides can recognize both nucleic acids and proteins with a high degree of specificity. This is a major reason why they have been widely investigated as potential therapeutic agents for cancer, viral infections, and inflammatory diseases. Oligonucleotides can achieve target recognition by sequence-specific interactions with nucleic acids or proteins such as in the antisense, antigene, or decoy approaches (1-4). Alternatively, target recognition can be due to the specific three-dimensional structure of an oligonucleotide, as in the aptamer approach (5, 6). These aptameric oligonucleotides often contain secondary structure elements such as hairpins or G-quartets. The formation of G-quartet structures is also thought to contribute to non-antisense growth inhibitory effects of G-rich phosphodiester and phosphorothioate oligonucleotides (7-9).

Recently, we reported (9) on a novel class of phosphodiester G-rich oligonucleotides (GROs)1 that could strongly inhibit the in vitro proliferation of tumor cells derived from prostate, breast, and cervical carcinomas. The antiproliferative GROs were able to form stable secondary structures consistent with G-quartet formation. It was determined that these GROs bound to a specific nuclear protein and, furthermore, that the growth inhibitory activity of the GROs was positively correlated with their ability to bind to this protein. The specific GRO-binding protein was captured using biotinylated GROs and was identified by polyclonal and monoclonal antibodies to nucleolin. Therefore, we concluded that these potentially therapeutic oligonucleotides worked by a novel mechanism that involved binding to nucleolin or a nucleolin-like protein. Our hypothesis was that binding of GROs causes inhibition of nucleolin function(s) that results in an arrest of proliferation.

Nucleolin is an abundant 110-kDa phosphoprotein, thought to be located predominantly in the nucleolus of proliferating cells. Levels of nucleolin are known to relate to the rate of cellular proliferation (10, 11), being elevated in rapidly dividing cells such as malignant cells. Therefore, nucleolin may be an attractive molecular target for cancer therapy. The remarkable multifunctionality of nucleolin and its role in cell growth and proliferation have been highlighted in recent reviews (12-14). The most studied aspects of nucleolin function are its roles in ribosome biogenesis, which include the control of rDNA transcription, pre-ribosome packaging, and organization of nucleolar chromatin (12, 15). It is also thought that nucleolin can act as a shuttle protein that transports viral and cellular proteins between the cytoplasm and nucleus/nucleolus of the cell (16-18). In addition, nucleolin has been implicated, directly or indirectly, in other roles including nuclear matrix structure (19), DNA replication (20), cytokinesis and nuclear division (21), and as a nucleic acid helicase (12, 22). There have been numerous reports describing the presence of nucleolin in the plasma membrane of cells (9, 23-28), suggesting a further function of nucleolin as a cell surface receptor. Clearly, inhibition of nucleolin function, which we propose is an effect of GRO binding, would likely result in inhibition of cell proliferation and/or cell death.

To elucidate further the mechanism of the GRO antiproliferative activity, we decided to study the effects of GROs on cellular processes, such as nucleic acid and protein synthesis, and cell cycle progression. We report our findings that GROs specifically inhibit DNA replication, and we discuss the implications of these results in terms of potential mechanisms for GRO activity.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Oligonucleotides-- Except where indicated, oligonucleotides had phosphodiester backbones and 3'-C-3 aminoalkyl modifications. They were purchased from Oligos Etc. (Wilsonville, OR) or synthesized on a Beckman 1000M synthesizer using 3'-C-3-amine CPG columns from Glen Research (Sterling, VA). Oligonucleotides were resuspended in water, precipitated with butan-1-ol, washed with 70% ethanol, dried and resuspended in sterile 10 mM Tris·HCl, pH 7.5, or phosphate-buffered saline (PBS). They were then sterilized by filtration through a 0.2-µm filter and diluted with sterile buffer to give stock solutions of 400 or 500 µM that were stored in aliquots at -20 °C. Each oligonucleotide was checked for integrity by 5'-radiolabeling followed by polyacrylamide gel electrophoresis. Sequences of oligonucleotides used were as follows: GRO29A, 5'-TTTGGTGGTGGTGGTTGTGGTGGTGGTGG; GRO15B, 5'-TTGGGGGGGGTGGGT; GRO15A, 5'-GTTGTTTGGGGTGGT; GRO26A, 5'-GGTTGGGGTGGGTGGGGTGGGTGGGG; GRO26B,5'-GGTGGTGGTGGTTGTGGTGGTGGTGG; and CRO, 5'-TTTCCTCCTCCTCCTTCTCCTCCTCCTCC.

Flow Cytometry Analysis of Cell Cycle-- For the experiments shown in Figs. 1 and 2B, cells were plated in Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Inc.) supplemented with 10% (v/v) fetal calf serum (FCS, Life Technologies, Inc.) and 1% penicillin/streptomycin solution (Life Technologies, Inc.) at a density of 105 cells per well in a 6-well plate. After incubation at 37 °C for 4 h to permit adherence, cells were treated by direct addition of oligonucleotide to the culture medium to give a final concentration of 10 µM. For MDA-MB-231 cells only, a second dose of oligonucleotide was added 24 h after the first. At 72 h after the first dose, cells were harvested by trypsinization, fixed, and stained with propidium iodide using the Cycle Test Plus kit (Becton Dickinson). Cells were then analyzed using a FACScan cytometer. The percentage of cells in G1/G0, S, and G2/M were determined using the Modfit program or, in a few cases where Modfit was unable to assign these parameters, by integrating peak areas using the CellQuest program. For the experiments shown in Fig. 2B, cells were treated as above and harvested at the times shown and analyzed as described.

Synchronization of Cells-- To synchronize by serum starvation, cells were plated in complete medium (DMEM, 10% FCS, 1% antibiotic) at a density of 5 × 104 per well in 6-well plates and incubated overnight. Cells were washed three times with sterile PBS, and the medium was replaced with DMEM with 0.1% (v/v) FCS. After incubation in low serum medium for 48 h, medium was replaced with complete medium, and GRO29A was added directly to the medium to give 10 µM final concentration. To synchronize cells in S phase, cells were incubated for 16 h in complete medium containing 1 µg/ml aphidicolin. Cells were released by washing three times with PBS and adding complete medium. GRO29A was then added directly to the medium to give a final concentration of 10 µM. For each method of synchronization, samples were prepared in parallel to be harvested for flow cytometric analysis before release or 24 h after addition of GRO29A. Analysis of cell cycle was carried out as described above.

DNA Synthesis Assay-- Cells were plated at a density of 1.5 × 103 cells per well, in a 48-well plate. Cells were incubated for 16 h and then treated by direct addition of oligonucleotide to the culture medium at a final concentration of 12 µM (or untreated samples received an equal volume of sterile PBS). A second identical dose was given 60 h after the first. 72 h after the first treatment, cells were pulsed by addition of BrdUrd (Sigma, final concentration 10 µM) to the medium for 1 h at 37 °C. Cells were washed three times with PBS and fixed with methanol for 10 min at room temperature. Samples were washed with PBS, incubated with 2 M HCl (to denature DNA) for 10 min on ice, washed, and neutralized with 0.1 M sodium borate. The cells were then incubated with anti-BrdUrd monoclonal antibody (Becton Dickinson, used at 1.7 µg/ml) for 30 min at room temperature, washed, and incubated with Alexa488-labeled goat anti-mouse IgG (Molecular Probes, used at 4 µg/ml) for 20 min at room temperature. After washing, cells were viewed with a Nikon Eclipse TS100 microscope with ELWD epifluorescence attachment, and digital images were captured using a Olympus DP10 camera.

RNA Synthesis Assay-- Samples shown in Fig. 4B were prepared exactly as described for DNA synthesis, and after 72 h of incubation with oligonucleotide samples were pulsed by addition of BrU (Aldrich) at a final concentration of 1 mM for 1 h at 37 °C. Cells were fixed with 4% (w/v) paraformaldehyde in PBS, stained as above (1.7 µg/ml anti-BrdUrd followed by 4 µg/ml Alexa488-labeled anti-mouse IgG), and photographed as described above. For the samples shown in Fig. 4A, cells were treated with 0.1 µg/ml actinomycin D for 1 h at 37 °C prior to pulsing with BrU or were incubated with 2.5 mg/ml RNase A for 30 min after fixing.

Protein Synthesis Assay-- Samples were prepared exactly as described for DNA synthesis. After 72 h of incubation with oligonucleotide, cells were washed twice with methionine/cysteine-free medium (Life Technologies, Inc.), incubated for 15 min at 37 °C in this medium, and then pulsed by addition of [35S]methionine (final concentration 40 µCi/ml) for 1 h at 37 °C. After washing, proteins were extracted by addition of 100 µl of citrate saline solution and precipitated by addition of 400 µl of 10% trichloroacetic acid and 20 mM pyrophosphate. An aliquot of this solution was used to quantitate total protein using the BCA Protein Assay (Pierce), and the remainder was filtered through a glass filter to determine trichloroacetic acid-precipitable counts. Protein synthesis was expressed as counts/min per µg of total protein. Experiments were performed in triplicate, and error bars represent the S.E.

TUNEL Staining and Cell Morphology-- Cells were plated (1.5 × 104 cells per well for DU145 or 4 × 104 cells per well for MDA-MB-231) in 24-well plates containing glass coverslips (Fisher) that had been washed and sterilized. Oligonucleotide was added directly to the medium to a final concentration of 10 µM at 4 h after plating. Further identical doses were given at 24 and 72 h subsequent to the first dose (cells shown in Fig. 6A did not receive the third dose). At the appropriate time, cells were washed with PBS and fixed for 15 min at room temperature with 4% (w/v) paraformaldehyde in PBS. Cells were permeabilized by incubation in 0.1% Triton X-100, 0.1% sodium citrate for 2 min on ice. Terminal transferase-mediated labeling of fragmented DNA with dUTP was carried out using In Situ Cell Death Detection kit (Roche Molecular Biochemicals), according to the manufacturer's instructions. For morphology analysis cells were prepared as above and viewed using an Olympus BX60 microscope.

SV40 DNA Replication Assay-- Replication-competent cell extracts were prepared from HeLa cells by a modification of the method of Li and Kelly (29, 30). HeLa cells were grown in DMEM (Life Technologies, Inc.) with 10% supplemented calf serum (HyClone) and antibiotics and were maintained in logarithmic growth. Briefly, the cells were released, combined, and washed once with isotonic buffer (20 mM HEPES, 5 mM KCl, 1.5 mM MgCl2, 1 mM dithiothreitol, 250 mM sucrose) and twice with hypotonic buffer (isotonic buffer without sucrose). Following the second hypotonic wash, the cell count was adjusted to 7 × 107 cells/ml, and the suspension was placed on ice for 30 min. The cells were gently lysed using a Dounce glass homogenizer and a tight-fitting plunger and then placed on ice for 30 min. The suspension was centrifuged at 10,000 rpm for 10 min at 4 °C, and the supernatant was frozen by dripping it through liquid nitrogen. Replication reactions were carried out using the M13mp2SV replication template (7406 base pairs), which is an M13mp2 molecule containing the SV40 origin of replication (31). Replicative form templates were prepared from infected recA Escherichia coli by standard methods, and covalently closed circular (form I) DNA was isolated by two successive CsCl gradients. Template (40 ng) was preincubated with water or the oligonucleotide (400 nM final concentration) as indicated for 30 min at 37 °C and then added to reaction mixes as described previously (32). Replication reactions (25 µl) contained 30 mM HEPES, pH 7.8, 7 mM MgCl2, 4 mM ATP, 200 µM each of CTP, GTP, and UTP, 100 µM each of dATP, dGTP, dCTP, TTP, and [alpha -32P]dCTP (6,600 dpm/fmol), 40 mM creatine phosphate, 2 µg of creatine kinase, and 15 mM sodium phosphate, pH 7.5. The SV40 large T antigen (Molecular Biology Resources) was omitted from the negative control (Fig. 7, 1st lane), and 1 µg was added to all other tubes. After addition of cell extract (75 µg of protein) to each tube, the reactions proceeded for 2 h at 37 °C. At this time, an equal volume of stop solution (2% SDS, 50 mM EDTA, 2 mg/ml proteinase K) was added, and the samples were incubated for an additional 30 min at 37 °C. An aliquot (1/10 volume) was taken for determination of [alpha -32P]dCTP into acid-insoluble material, and picomoles of dCTP incorporated was calculated. The relative dCTP incorporation stated in the text represents the average of three independent experiments, and standard errors of the data are shown. The DNA was extracted, and aliquots were electrophoresed on 1% (w/v) agarose gels containing 0.5 µg/ml ethidium bromide. The dried gels were imaged on a Storm PhosphorImager (Molecular Dynamics), and the density of the bands corresponding to covalently closed circular (form I) DNA was quantified using ImageQuant software.

Cell Proliferation Assay-- HeLa cells were plated at 103 cells per well in 96-well plates. After incubation for 16 h, oligonucleotide was added directly to the culture medium to give a final concentration of 12 µM. Culture medium was not changed throughout the duration of the experiment. The relative number of viable cells in each well was determined 96 h after addition of oligonucleotides using the MTT assay (33). Briefly, 15 µl of 5 mg/ml 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT, Sigma) was added to each well. Following 16 h of incubation at 37 °C, cells were lysed by addition of 75 µl per well of 10% SDS, 10 mM HCl, and after a further 16 h of incubation at 37 °C, absorbance at 570 nm was determined using a Molecular Devices microplate reader. Experiments were performed in triplicate, and bars represent the S.E.

Helicase Assay-- These assays were carried out according to a method similar to that of Veaute et al. (34). Oligonucleotide 55A (5'-TGAAGGTTTCGAATCAGAGGTAGGTGCCCGGCCTCCAACTTGCCGTATTCCTGGT, unmodified phosphodiester, purchased from Life Technologies, Inc.) was 5'-labeled using T4 kinase and [gamma -32P]ATP. After removal of unincorporated [32P]ATP it was annealed (95 °C for 5 min followed by slow cooling to room temperature) to a partially complementary oligonucleotide 55B (5'-ACCAGGAATACGGCAAGTTGGAGGCCGGGCTGGATGGAGACTAAGCTTTGGAAGT, unmodified phosphodiester, purchased from Life Technologies, Inc.) in order to form the synthetic replication fork substrate containing a region of 30 base pairs (underlined). Unwinding of this substrate by recombinant SV40 large T antigen (Chimerx, Milwaukee, WI) was carried out by incubating 10 fmol of substrate with 100 ng of large T antigen in the absence or presence of competitor unlabeled oligonucleotides in a final volume of 10 µl of HA buffer (20 mM Tris·HCl, pH 7.5, 7 mM MgCl2, 5 mM dithiothreitol, 2 mM ATP, and 25 µg/ml bovine serum albumin). Large T antigen was preincubated for 15 min at 37 °C prior to addition. The reaction was allowed to proceed for 15 min at 37 °C before being terminated by addition of STOP buffer (200 mM EDTA, 40% glycerol, 0.6% SDS, 0.15% bromphenol blue, 0.15% xylene cyanol). Samples were analyzed by native polyacrylamide electrophoresis on 8% polyacrylamide gels containing 1× TBE (90 mM Tris borate, pH 8.3, 2 mM EDTA) with 1× TBE, 0.1% SDS as running buffer. For the assay shown in Fig. 8A, the nonspecific competitor oligonucleotide was (NS) (5'-AGGACTGTATACTGTCTTGGA, unmodified phosphodiester, purchased from Life Technologies, Inc.), and 29A is this assay was also unmodified. For the assay shown in Fig. 8B, all oligonucleotides except NS were modified with a 3'-C-3 aminoalkyl group.

Nucleolin-Replication Protein A (RPA) Interaction-- Immunoprecipitation was carried out in 0.5 ml of RIPA buffer (50 mM Tris·HCl, pH 7.5, 0.5 M NaCl, 0.1 mM EDTA, 100 µM NaF, 1 mM Na3VO4, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, 1 µM leupeptin, 10 µM aprotinin) for 30 min at 37 °C using 25 µg of HeLa extracts (as used for in vitro replication) and 5 µg of monoclonal antibody to 14-kDa subunit of RPA (Novus Biologicals). Antibodies were captured for 1 h at 4 °C using magnetic beads linked to goat anti-mouse IgG (Magnabind, Pierce), washed three times with 0.5 ml of RIPA, and eluted by heating the beads for 15 min at 65 °C in a buffer containing 2% SDS and 5% 2-mercaptoethanol. To investigate the effect of GROs on nucleolin-RPA interaction, the HeLa extracts were preincubated for 30 min at 37 °C in the absence or presence of oligonucleotides. Precipitated proteins were electrophoresed on 8% polyacrylamide/SDS gels, transferred to polyvinylidene difluoride membrane, Western-blotted using nucleolin monoclonal antibody (Santa Cruz Biotechnology, 1:200 dilution) and peroxidase-linked goat anti-mouse (Santa Cruz Biotechnology, 1:1000), and visualized by chemiluminescence.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Accumulation of GRO29A-treated Cells in S Phase-- To investigate cell cycle perturbations induced by antiproliferative G-rich oligonucleotides, flow cytometry analysis of propidium iodide stained nuclei was performed. Cell cycle parameters were compared for untreated cells and cells that had been treated for 72 h with an active GRO (GRO29A) or a control inactive GRO (GRO15B). The cell lines examined were DU145 (derived from prostate carcinoma), MDA-MB-231 (breast carcinoma), HeLa (cervical carcinoma), and HS27 (normal foreskin fibroblasts). In all of the carcinoma lines, we observed a significant increase in the fraction of cells in the S phase of the cell cycle for cells treated with GRO29A, as shown in Fig. 1. This was accompanied by a decrease in the proportion of cells in the G0/G1 and G2/M phases of the cell cycle, as indicated in Fig. 1. These changes were specific for GRO29A and not simply due to the presence of oligonucleotide, because cells treated with GRO15B were similar to untreated cells.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1.   Flow cytometric analysis of cell cycle parameters following 72 h of treatment with active GRO29A or inactive control GRO15B, compared with untreated cells. The identity of the cell line is indicated on the left, and numbers above each histogram indicate the ratio of cells in the G1/G0, S, and G2/M phases of the cell cycle (data were gated to exclude apoptotic cells for these calculations). The peak marked by an asterisk represents apoptotic cells with sub-G1 DNA content.

We also observed the appearance of a peak corresponding to a population of cells with sub-G1 DNA content (marked with an asterisk in Fig. 1). This peak, which is indicative of apoptotic cells, appeared in the tumor cell samples treated with GRO29A but was much smaller in the GRO15B-treated or untreated cells. The induction of apoptosis by GRO29A was examined further and will be described below.

In contrast to the malignant cell lines, HS27 cells, which are derived from normal skin fibroblasts, showed no major perturbations in cell cycle in response to treatment with GRO29A. The HS27 cells were also found to be considerably less sensitive to the antiproliferative effects of GRO29A than most of the tumor cell lines we have examined.2 However, it can be seen from the data (Fig. 1, untreated) that the HS27 cells have a much lower proportion in S phase (even though they are sub-confluent), compared with the tumor cell lines, and proliferate at a slower rate. To test whether the response of cells is related to the proportion of cells in S phase when GRO is added, we partially synchronized DU145 cells and added GRO29A when the cells were predominantly in S phase (after aphidicolin treatment) or G1/G0 (after serum starvation). Fig. 2A shows that the cells showed similar S phase accumulation, irrespective of the proportion of cells in S phase when GRO was added. These data suggest that the differential responsiveness of HS27 cells is not necessarily related to the lower proportion of these cells in S phase, but further studies are required to confirm the tumor selectivity of GRO29A and investigate the mechanism of selectivity.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   A, flow cytometric analysis of cell cycle parameters. DU145 cells were partially synchronized by either serum starvation or aphidicolin treatment (top panel). Cells were treated with 10 µM GRO29A at the time of release from synchronization and analyzed after 24 h (bottom panel). B, graph showing the percentage of cells accumulated in S phase for asynchronous DU145 cells treated with GRO29A or control oligonucleotide (GRO15B).

Studies of cell cycle progression following partial synchronization of tumor cells showed that even when GRO29A was added in G1/G0 (following serum synchronization) or early S phase (following aphidicolin treatment), a considerable proportion of the cells were able to progress through S phase and G2/M (data not shown). In fact, the accumulation of cells in S phase was found to be a gradual process that occurs over several cell cycles, as shown in Fig. 2B for unsynchronized DU145 cells treated with GRO29A. The gradual arrest of cells in S phase may be related to the rate of oligonucleotide uptake, which is thought to be relatively slow. We are currently investigating the relationship between GRO uptake and cell cycle arrest.

Inhibition of DNA Replication in Cells-- The S phase of the cell division cycle represents the period in which cells replicate their DNA (and thus have a DNA content intermediate between that of G0/G1 and G2/M cells). In this case, because cell proliferation is inhibited by GRO29A, it seems unlikely that the increase in the S phase fraction represents an increase in cells that are actively replicating DNA but more likely an accumulation of cells whose progress is arrested in this phase of the cell cycle.

To confirm this hypothesis, we analyzed DNA replication in cells treated with GROs. This was achieved by determining incorporation of 5-bromo-2'-deoxyuridine (BrdUrd), a nucleoside that can be incorporated into cellular DNA in place of thymidine. A BrdUrd antibody can then positively stain cells that actively synthesize DNA during the BrdUrd pulse. In this experiment, DU145 cells were incubated as described in the absence or presence of GROs for 72 h, at which time BrdUrd was added to the cell culture medium for 1 h. Cells were then fixed with methanol, and incorporation of BrdUrd was assessed by indirect immunofluorescent staining using a BrdUrd antibody. Fig. 3 shows the results of these experiments. In the untreated sample, ~40% of cells was found to be positive for BrdUrd staining. However, the cells treated with GRO29A showed an almost complete absence of staining, indicating that no de novo DNA synthesis was occurring in these cells. This effect was specific for GRO29A, because cells treated with the control oligonucleotide (GRO15B) had similar BrdUrd incorporation to untreated cells.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 3.   DNA synthesis in untreated DU145 cells and cells treated with GRO15B (control oligonucleotide) or GRO29A (active oligonucleotide). Cells were treated for 72 h and then pulsed with BrdUrd. Incorporation of BrdUrd was detected by indirect immunofluorescence using a BrdUrd monoclonal antibody.

To confirm that the effects of GRO29A on cell cycle and DNA synthesis occur in parallel, we carried out one further experiment. DU145 cells were treated in a 6-well plate, pulsed with BrdUrd for 1 h, then collected by trypsinization, and divided into 2 aliquots. One aliquot was stained with propidium iodide and analyzed by flow cytometry, and the other aliquot was used to prepare slides for staining with BrdUrd antibody. The results indicated that for the same sample of GRO29A-treated cells, there was an accumulation in S phase concurrent with an inhibition of DNA synthesis (data not shown).

The time course of inhibition of DNA replication depended on a number of factors, including the initial cell density and the number and schedule of GRO29A doses. When DU145 cells were plated at 6.25 × 103 cells per well in a 24-well plate, and treated after 17 h with 10 µM final concentration of GRO, we found no significant difference between DNA synthesis in treated and untreated cells at 3, 6, and 9 h after addition of GRO29A. However, at 12 h after treatment, only 28% of cells stained positive for BrdUrd in the GRO29A-treated sample, compared with 41 and 44%, respectively, in the untreated and GRO15B treated cells. By 24 h after addition of oligonucleotide, the GRO29A-treated cells were completely negative for BrdUrd staining.

Effect of GROs on RNA and Protein Synthesis-- Because inhibition of any one of DNA, RNA, or protein synthesis is expected to lead eventually to inhibition of the other processes, it is important to determine which of these functions is arrested first. To investigate this, we examined both RNA and protein synthesis in parallel with DNA replication, at a time point at which DNA synthesis was known to be completely inhibited. As described above, DNA replication was assessed by BrdUrd incorporation, and a similar method was used to determine RNA synthesis. This method has been described previously (35, 36) and involves detection of incorporated 5-bromouridine (BrU) by indirect immunofluorescent staining with a BrdUrd antibody (which is cross-reactive for BrU). To ensure that the BrU staining represents bona fide RNA synthesis, we carried out a preliminary experiment to assess the effects of treatment with RNase or actinomycin D, an inhibitor of RNA synthesis. Fig. 4A shows that staining in these samples was negative, indicating that this technique accurately reflects RNA synthesis.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 4.   A, DU145 cells were treated with RNase A or actinomycin D (an RNA synthesis inhibitor) and compared with untreated cells to demonstrate that the staining procedure for RNA synthesis was specific. Cells were pulsed with BrU, and incorporation of BrU was detected by indirect immunofluorescence using a cross-reactive BrdUrd monoclonal antibody. B, RNA synthesis in untreated DU145 cells and cells treated with GRO15B (control oligonucleotide) or GRO29A (active oligonucleotide). Cells were treated for 72 h and then pulsed with BrU and stained as described.

Fig. 4B shows the effects of GRO treatment on RNA synthesis in DU145 cells. After incubation for 72 h in the absence or presence of GROs, cells treated with GRO29A showed staining for BrU incorporation similar to that for untreated and control (GRO15B)-treated samples. Cells that had been treated in parallel and pulsed with BrdUrd demonstrated negative staining for DNA synthesis in the GRO29A-treated sample (shown in Fig. 3). Therefore, it appears that RNA synthesis is still occurring in GRO29A-treated cells at a time when DNA synthesis is arrested.

To determine global protein synthesis, the incorporation of [35S]methionine was examined. Cells were incubated for 72 h in the absence or presence of GROs and pulsed with [35S]methionine, and radioactivity associated with trichloroacetic acid-precipitable material was determined by scintillation counting. To normalize the data for differences in the number of cells, the total protein content for each sample was determined by the Bradford assay, and protein synthesis was expressed as counts per µg of total protein. Parallel samples were pulsed with BrdUrd in place of [35S]methionine to monitor DNA synthesis. Fig. 5 shows that there was no significant difference in the levels of global protein synthesis between untreated cells and cells treated with GRO29A or GRO15B, whereas DNA synthesis was completely inhibited by GRO29A (Fig. 3).


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 5.   Protein synthesis in untreated DU145 cells and cells treated with GRO15B (control oligonucleotide) or GRO29A (active oligonucleotide). Cells were treated for 72 h, transferred to methionine/cysteine-free medium, and then pulsed with 35S-labeled methionine. Protein synthesis was determined by scintillation counting of trichloroacetic acid-precipitable material and was normalized by determining the total protein content of the sample and expressing as counts/min per µg of total protein.

Induction of Apoptosis and Changes in Cell Morphology-- Induction of apoptosis by GRO29A was suggested by the appearance of cells with sub-G1 DNA content in the flow cytometry cell cycle analysis (Fig. 1). We confirmed this finding by carrying out terminal transferase dUTP nick-end label (TUNEL) staining of GRO-treated cells. Fig. 6A shows that there was minimal TUNEL staining in untreated DU145 cells (and in control 15B-treated samples, not shown). The sample treated with GRO29A showed a punctate pattern of positive nucleoplasmic and perinuclear staining, consistent with end labeling of fragmented DNA, an indicator of apoptosis. Although some of the treated cells had the classic features of apoptosis, at longer treatment times some cells had morphology characterized by greatly enlarged nuclei and cytoplasm. As shown in Fig. 6B, this was particularly evident in MDA-MB-231 breast cancer cells that had been treated for 5 days with GRO29A. The significance of this proportion of enlarged cells is unclear at present but is consistent with our observation that protein synthesis is ongoing, whereas DNA replication and cell division are inhibited.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 6.   A, TUNEL staining to show induction of apoptosis in DU145 prostate cancer cells by GRO29A. Cells were treated for 72 h and stained as described. Cells treated with GRO15B (not shown) had similar staining to the untreated samples. B, phase contrast micrographs of MDA-MB-231 breast cancer cells to show differences in morphology induced by treatment with an active GRO (29A) compared with the control GRO (15B).

Inhibition of DNA Replication in Vitro-- The data presented suggest that inhibition of DNA replication is a primary event associated with cell response to treatment with antiproliferative GRO. In cells, arrest of DNA synthesis can occur as a direct consequence of interference with the organization or progress of the DNA replication machinery. Alternatively, DNA replication could be arrested secondary to other effects, such as alterations in signaling pathways.

To elucidate further the mechanism of GRO29A-induced inhibition of DNA replication, we examined the effects of GROs on replication in an in vitro system (29, 30). This system utilizes HeLa cell extracts to replicate a plasmid containing the simian virus (SV40) origin of replication and requires addition of SV40 large T antigen, most probably to facilitate unwinding of the template (37, 38). By using this assay, 400 nM GRO29A was reproducibly found to inhibit DNA replication in vitro by about 90% (incorporation of dCTP was 9.1 ± 1.6% compared with control), whereas the same concentration of GRO15B had no effect (97.8 ± 7.1% dCTP incorporation compared with control). This assay was then used to examine a series of GROs with a variety of antiproliferative activities. These oligonucleotides have been described previously (9), with the exception of GRO26B, which is an active analog of GRO29A that lacks the three 5'-thymidines. Fig. 7A shows representative results from the in vitro replication assays. The relative inhibition is shown as a percentage of the control below the gel and was determined by integration of the bands representing the closed circular (form I) replication product. The ability of these same oligonucleotides to inhibit the proliferation of HeLa cells in culture is shown in Fig. 7B. Oligonucleotides 29A and 26B were found to strongly inhibit cell proliferation, 26A showed intermediate inhibitory activity, and 15A, 15B, and CRO had little or no activity. (Although we reported previously (9) some antiproliferative activity in HeLa cells for multiple doses of 15A, there was no activity when cells were treated with a single dose.) The relative activities of the six oligonucleotides in cells were almost identical to those observed in the SV40 replication assay. Therefore, we conclude that the ability of oligonucleotides to inhibit cellular proliferation is correlated with their ability to inhibit DNA replication and that this blockade of replication is due to a direct effect of GRO on the DNA replication machinery.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 7.   A, effect of various oligonucleotides on the efficiency of DNA replication in vitro. The indicated oligonucleotide was mixed with the DNA template, and buffer and cell extracts were added. The reaction was started by the addition of SV40 large T antigen and proceeded for 2 h at 37 °C. The T antigen was omitted from the negative control (far left lane). The reaction was stopped after 2 h at 37 °C. The bands indicated represent covalently closed circular (I), nicked (II), and linear (III) forms of DNA, and RI indicates replication intermediates. The density of the form I was determined with ImageQuant software, and the data were used to calculate the percentage inhibition of replication compared with the positive control (no oligonucleotide added), which is shown below each lane. B, graph indicating the relative number of viable HeLa cells (as determined by the absorbance at 570 nm following MTT assay) 96 h after treatment with a single dose (12 µM) of the oligonucleotide indicated.

Effect of GRO29A on RPA-Nucleolin Interaction and SV40 Large T Antigen Helicase Activity-- Inhibition of in vitro DNA replication by GRO29A most probably occurs because the G-rich oligonucleotide interferes with the assembly or progression of the complex that carries out the replication process. Many of the proteins that are required for efficient replication, both in the in vitro system and in cells, have now been identified (39-41). Based on the existing literature, we believe the most likely replication-associated proteins to be modulated GRO29A are replication protein A (RPA), which is known to bind to nucleolin (20), or the SV40 large T antigen, which can bind to G-quartet structures (42).

RPA is a single-stranded DNA-binding protein that plays a pivotal role in DNA replication, repair, and homologous recombination. It is possible RPA could bind directly to GRO29A, but simple single strand DNA binding would not explain the inability of other oligonucleotides (for example, 15B and CRO) to inhibit replication. There is also the possibility that GROs can modulate the interaction between RPA and nucleolin (the putative GRO-binding protein), which was recently reported by Daniely and Borowiec (20). These authors demonstrated that this interaction occurs in vitro and found that addition of exogenous nucleolin protein to the SV40 replication assay strongly reduced origin unwinding and DNA replication in this system. This was presumed to be a result of nucleolin binding to and inactivating RPA, because replication could be rescued by addition of extra RPA. It was also reported that heat shock of HeLa cells caused a redistribution of nucleolin from the nucleoli to the nucleoplasm, and the authors (20) proposed that this redistribution and the resultant binding of nucleolin to RPA was a mechanism for repression of chromosomal replication in response to cell stress. If binding of nucleolin to GRO29A caused a conformational change that enhanced the affinity of nucleolin for RPA, this would explain the inhibition of replication both in vitro and in cells. To test this hypothesis, we carried out immunoprecipitation of HeLa cell extracts with an antibody to the 14-kDa subunit of RPA in the absence or presence of various GROs. In accord with Daniely and Borowiec (20), we could detect nucleolin in the immunoprecipitated proteins by Western blotting (data not shown). However, the presence of GROs at 100-1000 nM final concentration (which was sufficient to inhibit in vitro replication) did not significantly alter the amount of nucleolin precipitated with anti-RPA antibody. Treatment of HeLa cells with GRO29A also did not cause significant redistribution of nucleolin from the nucleoli to the nucleoplasm (as assessed by immunofluorescent microscopy, data not shown). Therefore, there is no evidence to support the hypothesis that the nucleolin-RPA interaction is modulated by GRO29A.

An alternative mechanism for the inhibition of DNA replication in the SV40 system is the inhibition of large T antigen helicase activity by GRO29A. The ability of T antigen to unwind structures containing G-quartets has been documented previously (42); therefore, we postulated that the presence of an excess of G-quartet containing oligonucleotide could sequester the helicase activity and prevent template unwinding and replication. To test this hypothesis we carried out T antigen helicase assays in the presence of various oligonucleotides. Because T antigen has a single-stranded DNA binding domain, it is important to demonstrate that any inhibition by oligonucleotides is specific. Therefore, we first compared inhibition of helicase activity by an active GRO (29A) and a nonspecific oligonucleotide (NS). Fig. 8A shows that GRO29A is significantly more active than NS at inhibiting helicase activity. To compare the relative ability of the oligonucleotides used in the replication assay to inhibit helicase activity, we carried out similar experiments with 50 nM final oligonucleotide concentration (at which there was a clear difference between GRO29A and NS). Fig. 8B shows the results of these experiments. Oligonucleotides 29A, 26B, and 26A were active in inhibiting unwinding by T antigen, whereas 15A, 15B, and CRO were not. The inactivity of CRO (which is the same length as 29A) shows that inhibition of helicase activity was not simply a function of oligonucleotide length. Comparison of the data in Fig. 8B with those shown in Fig. 7 indicates a good correlation between inhibition of helicase activity, inhibition of in vitro DNA replication, and inhibition of cell growth.


View larger version (79K):
[in this window]
[in a new window]
 
Fig. 8.   A, helicase assay showing unwinding by SV40 large T antigen of a synthetic oligonucleotide substrate representing a replication fork. Lanes marked SS and DS are markers representing unwound (single strand 55A) and wound (partial duplex 55A/B) substrate in the absence of T antigen. NI is a "no incubation" control lane containing substrate and T antigen without incubation at 37 °C. In all other lanes, the helicase reaction was allowed to proceed for 15 min at 37 °C without competitor (0) or in the presence of unlabeled competitor oligonucleotides 29A or NS at the concentrations shown. B, helicase assay showing inhibition of substrate unwinding by T antigen in the presence of 50 nM concentration of competitor oligonucleotide, as indicated.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

GROs are a new type of antiproliferative oligonucleotide with considerable potential as therapeutic agents for cancer. Although the activity of GROs is known to correlate with their ability to bind to nucleolin protein, the precise mechanism by which they exert their antiproliferative effects is unknown. Because nucleolin is involved in many aspects of cell growth, proliferation, and apoptosis, knowledge of a putative target protein does not necessarily identify the processes that are affected by GROs. Further information regarding the pathways affected by GROs would facilitate the design of agents that act by a similar mechanism that may be even more active or have improved pharmacological features, compared with oligonucleotides. Therefore, in this study we proceeded to explore the mechanism of GROs by examining their effects on cellular processes.

The conclusions of our studies are that treatment of cells with antiproliferative GRO29A causes an arrest of cell cycle progression in S phase and an inhibition of DNA replication. Because DNA synthesis is affected before RNA and protein synthesis, we have concluded that this is a primary cause of proliferation inhibition. Furthermore, because GROs can also inhibit DNA replication in a cell-free assay, we infer that the action of the GROs results directly from an effect on a protein (or proteins) involved in DNA replication. To investigate the hypothesis that GRO effects are mediated by an inhibition of DNA synthesis, we have used an in vitro DNA replication assay. This assay is based on the replication of a 7.4-kilobase pair circular genome that contains an SV40 origin of replication (ori), originally described by Li and Kelly (29, 30) and modified by Roberts and Kunkel (31). The reaction is initiated by SV40 large T antigen, which is required to recognize and unwind the ori. Proteins in human cell extracts carry out all subsequent steps. Inhibition of replication by GRO29A could be mediated either by damaging the template or by modulating the activity of a protein (or proteins) that is required for replication. The former mechanism is unlikely, because the replication products of damaged templates show severe inhibition of form I DNA but relatively greater amounts of nicked and linear DNA (32, 43). The GRO29A examined in this study severely inhibited the synthesis of all forms of DNA, suggesting interference with the proper function of the complex that carries out DNA replication (known as the replisome or synthesome). Therefore, we investigated the effects of GRO29A on the replication-associated proteins most likely to be modulated. These were the SV40 large T antigen, which is known to bind to and unwind G-quartet structures (42), and RPA, which is known to bind to nucleolin (20), the putative GRO-binding protein (9). Although we could observe the interaction between nucleolin and RPA, we found that this was not significantly affected by the presence of GROs. On the other hand, the ability of T antigen to unwind a synthetic substrate representing a replication fork was strongly inhibited by GRO29A. Moreover, for a series of six oligonucleotides, the relative activity in inhibiting T antigen helicase mirrored the relative activity in inhibiting DNA replication in vitro and also in inhibiting tumor cell proliferation. Therefore, it would appear that the antiproliferative effects of GROs on cancer cells are mediated by inhibition of DNA replication, which in turn may be related to inhibition of helicase activity. Of course, SV40 T antigen is not normally present in human cells, but GRO29A could also be an inhibitor of a human replicative helicase, which will most likely share similar features with the viral T antigen. The identity of the human replicative helicase is still not certain, but a hexameric complex of proteins known as minichromosome maintenance has been reported to have helicase activity in vitro and is generally thought to be a good candidate (44, 45). The ability of this complex to bind to or unwind G-quartets has not yet been reported.

G-quartet unwinding has been described previously (46-48) for a number of helicases, but to our knowledge, this is the first report that the presence of G-quartet structures can prevent a replicative helicase unwinding its double-stranded substrate. Inhibition of helicase activity has been reported for several DNA-binding agents, including many antitumor antibiotics such as anthracyclines (49-56). In these cases, it is most likely that inhibition is caused by the formation of a strong complex between the DNA-binding ligand and the template DNA, which impede the action of the helicase (49). There is considerable evidence that inhibition of helicase activity by such compounds may play some role in their anticancer activity (57), but the effect of helicase inhibition in cancer cells has not been extensively studied.

Nucleolin has been identified by us as a GRO-binding protein (9), and by several other groups (58-61) as a G-quartet-binding protein. Although the results in this paper do not clearly define a link between the molecular effects of GROs and their binding to nucleolin, they point to an effect by inhibition of helicase activity and DNA replication. Therefore, it is interesting to note that nucleolin itself has been reported to have helicase activity and is also known as DNA helicase IV (12, 22). In addition, nucleolin has been shown to interact with at least three components of the DNA replisome complex, namely RPA (20), topoisomerase I (62), and poly(ADP-ribose) polymerase (63).

Our future studies will focus on identification of cellular helicases that may be inhibited by GRO29A, as well as clarification of the role of nucleolin in GRO activity. Such studies could lead to valuable insights into the role of nucleolin in DNA replication, as well as further elucidation of the molecular mechanisms of GRO effects.

    ACKNOWLEDGEMENT

We thank Virna Dapic for assistance with flow cytometry.

    FOOTNOTES

* This work was supported by the Department of Defense Prostate Cancer Initiative, the National Institutes of Health, and the Commonwealth of Kentucky Research Challenge Trust.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** To whom correspondence should be addressed: 204B Baxter Bldg., 570 S. Preston St., Louisville, KY 40202. Tel: 502-852-2432; Fax: 502-852-2356; E-mail: paula.bates@louisville.edu.

Published, JBC Papers in Press, September 12, 2001, DOI 10.1074/jbc.M104446200

2 P. J. Bates, S. D. Thomas, J. O. Trent, and D. M. Miller, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: GROs, G-rich oligonucleotides; BrU, 5-bromouridine; BrdUrd, 5-bromo-2'-deoxyuridine; DMEM, Dulbecco's modification of Eagle's medium; PBS, phosphate-buffered saline; FCS, fetal calf serum; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; RPA, replication protein A; TUNEL, terminal transferase dUTP nick-end label; NS, nonspecific oligonucleotide.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Gewirtz, A. M., Sokol, D. L., and Ratajczak, M. Z. (1998) Blood 92, 712-736[Free Full Text]
2. Crooke, S. T. (2000) Methods Enzymol. 313, 3-45[CrossRef][Medline] [Order article via Infotrieve]
3. Praseuth, D., Guieysse, A. L., and Helene, C. (1999) Biochim. Biophys. Acta 1489, 181-206[Medline] [Order article via Infotrieve]
4. Mann, M. J., and Dzau, V. J. (2000) J. Clin. Invest. 106, 1071-1075[Free Full Text]
5. Gold, L. (1995) J. Biol. Chem. 270, 13581-13584[Free Full Text]
6. Hermann, T., and Patel, D. J. (2000) Science 287, 820-825[Abstract/Free Full Text]
7. Burgess, T. L., Fisher, E. F., Ross, S. L., Bready, J. V., Qian, Y. X., Bayewitch, L. A., Cohen, A. M., Herrera, C. J., Hu, S. S., Kramer, T. B., Lott, F. D., Martin, F. H., Pierce, G. F., Simonet, L., and Farrell, C. L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4051-4055[Abstract/Free Full Text]
8. Benimetskaya, L., Berton, M., Kolbanovsky, A., Benimetsky, S., and Stein, C. A. (1997) Nucleic Acids Res. 25, 2648-2656[Abstract/Free Full Text]
9. Bates, P. J., Kahlon, J. B., Thomas, S. D., Trent, J. O., and Miller, D. M. (1999) J. Biol. Chem. 274, 26369-26377[Abstract/Free Full Text]
10. Derenzini, M., Sirri, V., Trere, D., and Ochs, R. L. (1995) Lab. Invest. 73, 497-502[Medline] [Order article via Infotrieve]
11. Sirri, V., Roussel, P., and Hernandez-Verdun, D. (2000) Micron 31, 121-126
12. Tuteja, R., and Tuteja, N. (1998) Crit. Rev. Mol. Biol. 33, 407-436
13. Ginisty, H., Sicard, H., Roger, B., and Bouvet, P. (1999) J. Cell Sci. 112, 761-772[Abstract]
14. Srivastava, M., and Pollard, H. B. (1999) FASEB J. 13, 1911-1922[Abstract/Free Full Text]
15. Ginisty, H., Amalric, F., and Bouvet, P. (1998) EMBO J. 17, 1476-1486[CrossRef][Medline] [Order article via Infotrieve]
16. Kibbey, M. C., Johnson, B., Petryshyn, R., Jucker, M., and Kleinman, H. K. (1995) J. Neurosci. Res. 42, 314-322[CrossRef][Medline] [Order article via Infotrieve]
17. Lee, C. H., Chang, S. C., Chen, C. J., and Chang, M. F. (1998) J. Biol. Chem. 273, 7650-7656[Abstract/Free Full Text]
18. Waggoner, S., and Sarnow, P. (1998) J. Virol. 72, 6699-6709[Abstract/Free Full Text]
19. Gotzmann, J., Eger, A., Meissner, M., Grimm, R., Gerner, C., Sauermann, G., and Foisner, R. (1997) Electrophoresis 18, 2645-2653[CrossRef][Medline] [Order article via Infotrieve]
20. Daniely, Y., and Borowiec, J. A. (2000) J. Cell Biol. 149, 799-810[Abstract/Free Full Text]
21. Léger-Silvestre, I., Gulli, M. P., Noaillac-Depeyre, J., Faubladier, M., Sicard, H., Caizergues-Ferrer, M., and Gas, N. (1997) Chromosoma 105, 542-552[Medline] [Order article via Infotrieve]
22. Tuteja, N., Huang, N. W., Skopac, D., Tuteja, R., Hrvatic, S., Zhang, J., Pongor, S., Joseph, G., Faucher, C., Almaric, F., and Falasci, A. (1995) Gene (Amst.) 160, 143-148[CrossRef][Medline] [Order article via Infotrieve]
23. Larrucea, S., Gonzalez-Rubio, C., Cambronero, R., Ballou, B., Bonay, P., Lopez-Granados, E., Bouvet, P., Fontan, M. F., and Lopez-Trascas, M. (1998) J. Biol. Chem. 273, 31718-31725[Abstract/Free Full Text]
24. Callebout, C., Blanco, J., Benkirane, N., Krust, B., Jacotot, E., Guichard, G., Seddiki, N., Svab, J., Dam, E., Muller, S., Briand, J.-P., and Hovanessian, A. G. (1998) J. Biol. Chem. 273, 21988-21997[Abstract/Free Full Text]
25. Semenkovich, C. F., Ostlund, R. E., Olson, M. O., and Wang, J. W. (1990) Biochemistry 29, 9708-9713[CrossRef][Medline] [Order article via Infotrieve]
26. Hovanessian, A. G., Puvion-Dutilleul, F., Nisole, S., Svab, J., Perret, E., Deng, J. S., and Krust, B. (2000) Exp. Cell Res. 261, 312-328[CrossRef][Medline] [Order article via Infotrieve]
27. Dumler, I., Stepanova, V., Jerke, U., Mayboroda, O. A., Vogel, F., Bouvet, P., Tkachuk, V., Haller, H., and Gulba, D. C. (1999) Curr. Biol. 9, 1468-1476[CrossRef][Medline] [Order article via Infotrieve]
28. Sorokina, E. A., and Kleinman, J. G. (1999) J. Biol. Chem. 274, 27491-27496[Abstract/Free Full Text]
29. Li, J. J., and Kelly, T. J. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 4249-4258
30. Li, J. J., and Kelly, T. J. (1985) Mol. Cell. Biol. 5, 1238-1246[Abstract/Free Full Text]
31. Roberts, J. D., and Kunkel, T. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7064-7068[Abstract/Free Full Text]
32. McGregor, W. G., Wei, D., Maher, V. M., and McCormick, J. J. (1999) Mol. Cell. Biol. 19, 147-154[Abstract/Free Full Text]
33. Morgan, D. M. (1998) Methods. Mol. Biol. 79, 179-183[Medline] [Order article via Infotrieve]
34. Veaute, X., Mari-Giglia, G., Lawrence, C. W., and Sarasin, A. (2000) Mutat. Res. 459, 19-28[Medline] [Order article via Infotrieve]
35. Haider, S. R., Juan, G., Traganos, F., and Darzynkiewicz, Z. (1997) Exp. Cell Res. 234, 498-506[CrossRef][Medline] [Order article via Infotrieve]
36. Jensen, P. O., Larsen, J., Christiansen, J., and Larsen, J. K. (1993) Cytometry 14, 455-458[CrossRef][Medline] [Order article via Infotrieve]
37. Stahl, H., Droge, P., and Knippers, R. (1986) EMBO J. 5, 1939-1944[Medline] [Order article via Infotrieve]
38. Stahl, H., Droge, P., Zentgraf, H., and Knippers, R. (1985) J. Virol. 54, 473-482[Abstract/Free Full Text]
39. Malkas, L. H. (1998) J. Cell. Biochem. 31 (suppl.), 18-29
40. Waga, S., and Stillman, B. (1994) Nature 369, 207-212[CrossRef][Medline] [Order article via Infotrieve]
41. Waga, S., Bauer, G., and Stillman, B. (1994) J. Biol. Chem. 269, 10923-10934[Abstract/Free Full Text]
42. Baran, N., Pucshansky, L., Marco, Y., Benjamin, S., and Manor, H. (1997) Nucleic Acids Res. 25, 297-303[Abstract/Free Full Text]
43. Thomas, D. C., and Kunkel, T. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7744-7748[Abstract/Free Full Text]
44. Tye, B. K. (1999) Annu. Rev. Biochem. 68, 649-686[CrossRef][Medline] [Order article via Infotrieve]
45. Labib, K., and Diffley, J. F. (2001) Curr. Opin. Genet. Dev. 11, 64-70[CrossRef][Medline] [Order article via Infotrieve]
46. Sun, H., Karow, J. K., Hickson, I. D., and Maizels, N. (1998) J. Biol. Chem. 273, 27587-27592[Abstract/Free Full Text]
47. Sun, H., Bennett, R. J., and Maizels, N. (1999) Nucleic Acids Res. 27, 1978-1984[Abstract/Free Full Text]
48. Fry, M., and Loeb, L. A. (1999) J. Biol. Chem. 274, 12797-12802[Abstract/Free Full Text]
49. Bachur, N. R., Lun, L., Sun, P. M., Trubey, C. M., Elliott, E. E., Egorin, M. J., Malkas, L., and Hickey, R. (1998) Biochem. Pharmacol. 55, 1025-1034[CrossRef][Medline] [Order article via Infotrieve]
50. Bachur, N. R., Yu, F., Johnson, R., Hickey, R., Wu, Y., and Malkas, L. (1992) Mol. Pharmacol. 41, 993-998[Abstract]
51. Tuteja, N., and Phan, T. N. (1998) Biochem. Biophys. Res. Commun. 244, 861-867[CrossRef][Medline] [Order article via Infotrieve]
52. Tuteja, N., Phan, T. N., Tuteja, R., Ochem, A., and Falaschi, A. (1997) Biochem. Biophys. Res. Commun. 236, 636-640[CrossRef][Medline] [Order article via Infotrieve]
53. George, J. W., Ghate, S., Matson, S. W., and Besterman, J. M. (1992) J. Biol. Chem. 267, 10683-10689[Abstract/Free Full Text]
54. Maine, I. P., Sun, D., Hurley, L. H., and Kodadek, T. (1992) Biochemistry 31, 3968-3975[CrossRef][Medline] [Order article via Infotrieve]
55. Chino, M., Nishikawa, K., Yamada, A., Ohsono, M., Sawa, T., Hanaoka, F., Ishizuka, M., and Takeuchi, T. (1998) J. Antibiot. (Tokyo) 51, 480-486[Medline] [Order article via Infotrieve]
56. Zhu, K., Henning, D., Iwakuma, T., Valdez, B. C., and Busch, H. (1999) Biochem. Biophys. Res. Commun. 266, 361-365[CrossRef][Medline] [Order article via Infotrieve]
57. Gewirtz, D. A. (1999) Biochem. Pharmacol. 57, 727-741[CrossRef][Medline] [Order article via Infotrieve]
58. Hanakahi, L. A., Sun, H., and Maizels, N. (1999) J. Biol. Chem. 274, 15908-15912[Abstract/Free Full Text]
59. Dempsey, L. A., Sun, H., Hanakahi, L. A., and Maizels, N. (1999) J. Biol. Chem. 274, 1066-1071[Abstract/Free Full Text]
60. Dickinson, L. A., and Kohwi-Shigematsu, T. (1995) Mol. Cell. Biol. 15, 456-465[Abstract]
61. Ishikawa, F., Matunis, M. J., Dreyfuss, G., and Cech, T. R. (1993) Mol. Cell. Biol. 13, 4301-4310[Abstract/Free Full Text]
62. Bharti, A. K., Olson, M. O., Kufe, D. W., and Rubin, E. H. (1996) J. Biol. Chem. 271, 1993-1997[Abstract/Free Full Text]
63. Borggrefe, T., Wabl, M., Akhmedov, A. T., and Jessberger, R. (1998) J. Biol. Chem. 273, 17025-17035[Abstract/Free Full Text]


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles: