HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 46, 43239-43245, November 16, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/46/43239    most recent M104202200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhou, X.-B. Articles by Korth, M. Search for Related Content PubMed PubMed Citation Articles by Zhou, X.-B. Articles by Korth, M. Social Bookmarking                      What's this?

A Molecular Switch for Specific Stimulation of the BK_Ca Channel by cGMP and cAMP Kinase^*

Xiao-Bo Zhou, Claudia Arntz^§¶, Simone Kamm^§¶, Karin Motejlek, Ulrike Sausbier^§, Ge-Xin Wang, Peter Ruth^§, and Michael Korth

From the  Abteilung Pharmakologie für Pharmazeuten, Universitätsklinikum Hamburg-Eppendorf, Martinistr. 52, D-20246 Hamburg and ^§ Institut für Pharmakologie und Toxikologie der Technischen Universität München, Biedersteinerstr. 29, D-80802 München Germany

Received for publication, May 9, 2001, and in revised form, August 2, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The cGMP and the cAMP pathways control smooth muscle tone by regulation of BK_Ca (BK) channel activity. BK channels show considerable diversity and plasticity in their regulation by cyclic nucleotide-dependent protein kinases. The underlying molecular mechanisms are unclear but may involve expression of splice variants of the BK channel  subunit. Three isoforms, BK_A, BK_B, and BK_C, which were cloned from tracheal smooth muscle, differed only in their C terminus. When expressed in HEK293 cells, cGMP kinase (cGK) but not cAMP kinase (cAK) stimulated the activity of BK_A and BK_B by shifting the voltage dependence of the channel to more negative potentials. In contrast, BK_C was exclusively stimulated by cAK. BK_C lacks a C-terminal tandem phosphorylation motif for protein kinase C (PKC) with Ser¹¹⁵¹ and Ser¹¹⁵⁴. Mutation of this motif in BK_A switched channel regulation from cGK to cAK. Furthermore, inhibition of PKC in excised patches from cells expressing BK_A abolished the stimulatory effect of cGK but allowed channel stimulation by cAK. cAK and cGK phosphorylated the channel at different sites. Thus, phosphorylation/dephosphorylation by PKC determines whether the BK channel is stimulated by cGK or cAK. The molecular mechanisms may be relevant for smooth muscle relaxation by cAMP and cGMP.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The cGMP and the cAMP pathways are major regulators of smooth muscle contractility (1). It is widely accepted that activation of large conductance Ca²⁺-activated K⁺ (BK) channels via cGMP kinase (cGK)¹ (2, 3) and cAMP kinase (cAK) (4, 5) contributes to relaxation (6). However, the responses of BK channels to hormones and drugs that activate either the cAMP or the cGMP-signaling pathway vary from tissue to tissue (7-10) and even within the same tissue (11, 12). Alternatively, spliced mRNA transcripts and reversible protein phosphorylation of the BK channel  subunit or closely associated proteins have been shown as major mechanisms for the diversity of channel regulation by protein kinases (13). Particularly, the large C-terminal domain of the BK channel  subunit has been suggested as the target for phosphorylation by several serine/threonine-directed kinases (14). The molecular requirements at the BK channel level, however, that are necessary for modulation by specific cyclic nucleotide-dependent protein kinases have not yet been resolved. Recently, phosphorylation sites for cAK (15) and cGK (16, 17) have been identified that may be important for specific BK channel activation. Since these sites are fully conserved in all mammalian alternative splice variants known so far, regulation of BK channels via both the cGK and cAK would be expected. However, in most reports on cyclic nucleotide-dependent channel stimulation, effects from either cGK (3, 16-19) or cAK (13, 15, 20, 21) have been described. In particular, it is not clear whether cGK and cAK can substitute for each other as channel regulators, whether they have additive effects, or whether specific requirements are needed that allow distinct regulation by either kinase. The elucidation of molecular mechanisms underlying BK channel regulation is even more complicated by the fact that BK channels apart from cGK and cAK are presumably modulated by additional protein kinases such as PKC (22) and Src (21). These protein kinases may interact with each other in modifying channel activity. Thus, BK channels seem to integrate the output from several signaling cascades.

With respect to channel regulation by protein kinases, it has been an important issue in recent years to identify the underlying molecular mechanisms (13, 15-19, 21, 23). In this study, we first analyzed whether distinct mRNA transcripts in tracheal smooth muscle represent the molecular basis for differential regulation of BK channel by cAK and cGK. We identified three C-terminal isoforms of the BK channel  subunit that are presumably generated by alternative splicing at cryptic intron sites within a C-terminal exon. All of the isoforms showed similar single channel conductance and Ca²⁺ sensitivity. The presence of the C-terminal tandem phosphorylation site for PKC in two isoforms allowed stimulation of channel activity by cGK, suggesting the involvement of PKC in cGK-dependent channel regulation. However, the absence of this motif in another splice variant resulted in a loss of stimulation via cGK but led to activation by cAK. The hypothesis of phosphorylation by PKC as a prerequisite for the stimulatory effect of cGK was proved by mutation of respective serines and the use of specific PKC inhibitors. The results suggest that constitutive phosphorylation by PKC at the C terminus allows conditional activation by cGK. In turn, stimulation by cAK occurs at the dephosphorylated channel and at splice variants lacking the C-terminal PKC motif. The mechanisms identified here may contribute to the relaxation induced by NO and ₂-adrenoreceptor agonists in smooth muscle.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cloning-- BK channel  subunits were cloned from a bovine tracheal smooth muscle oligo dT-primed cDNA library. About 800,000 clones of the library were screened with the EcoRV/HaeII fragment corresponding to the region between the S0 and S6 segment. The probe (nucleotides 400-989) was isolated from the human BK channel  subunit cDNA, kindly provided by Dr. L. Toro (GenBank^TM U11058) (24). Isolated full-length clones were sequenced and constructed into the expression vector pcDNA3 (Invitrogen), which directed expression of BK channel  subunits in HEK293 cells starting translation from the M1 methionine (24). The GenBank^TM accession numbers for the BK channel isoforms are AY033472 (BK_A), AY033473 (BK_B), AY033474 (BK_C).

Site-directed Mutagenesis-- Mutants were generated by extended overlap polymerase chain reaction using the primer pairs as indicated. The resulting amplicons were digested with the given restriction enzymes and cloned into pcDNA3 containing the respective isoform of the BK channel. All mutations were confirmed by sequence analysis. Primer sequences are as follows (mutated bases in bold letters): BK_A S1151A, M1/SP6, F8/M2, template BK_A, ApaI; BK_A S1154A, M3/SP6, F8/M4, template BK_A, ApaI; BK_A S1151A/S1154A, M5/SP6, F8/M6, template BK_A, ApaI; BK_A S1134A, M7/SP6, F8/M8, template BK_A, ApaI; BK_C S1134A, M7/SP6, F8/M8, template BK_C, ApaI; BK_A S1134A/S1151A/S1154A, M7/SP6, F8/M8, template BK_A S1151A/S1154A, ApaI; BK_A S922A/S1151A/S1154A, M9/R12, F6/M10, template BK_A S1151A/S1154A, AflII and SacII. Forward primers are: F6 (GAAACCATCTTAAGATCCAA); F8 (GCAGCCGTTTGCATGTGGGA); M1 (AAG GCCCGGGAGTCCCGAGACAAACAGAAGTAC); M3 (AAGTCCCGGGAGGCCCGAGACAAACAGAAGTAC); M5 (AAGGCCCGGGAGGCCCGAGACAAACAGAAGTAC); M7 (AAGAGCGCCTCCGTCCACTCCATCCCA); M9 (AGCCCGCCATCACTACTGGGGTCAACATCCCCATC). Reverse primers are: SP6 (from pcDNA3) (ATTTAGGTGACACTATAGAACTC); R12 (GATGGAGTGGACGGAGGAGCTC); M2 (GGACTCCCGGGCCTTGGGCCGGTTCTGTCGG); M4 (GGCCTCCCGGGACTTGGGCCGGTTCTGTCGG); M6 (GGCCTCCCGGGCCTTGGGCCGGTTCTGTCGG); M8 (GACGGAGGCGCTCTTCTTGCTAGAGGACTG); M10 (AGTAGTGATGGCGGGCTGGCGTAACATCCCATG).

Functional Expression in HEK293 Cells and Electrophysiological Measurements-- HEK293 cells were transfected with the channel cDNA plasmids by calcium phosphate precipitation for 18 h at 35 °C and 3% CO₂. The transfection efficiency varied between 40 and 70%. Macroscopic currents were recorded 48 h after transfection from inside-out patches excised from HEK293 cells by using a List EPC 7 amplifier connected via a 16-bit analog-to-digital interface to a Pentium IBM clone computer (25). Signals were filtered at 1 kHz by a 10-pole Bessel filter and sampled at 3 kHz. Data acquisition and analysis was performed with an ISO-3 patch-clamp program (MFK, Niedernhausen, Germany). The patch pipettes were pulled from borosilicate glass (fiber-filled) with a resistance of 3-4 megaohms and were filled with physiological saline solution containing 127 mM NaCl, 5.9 mM KCl, 2.4 mM CaCl₂, 1.2 mM MgCl₂, 11 mM glucose, and 10 mM HEPES adjusted to pH 7.4 with NaOH. The bath solution (cytosolic surface of the patch) contained 134 mM KCl, 6 mM NaCl, 1.2 mM MgCl₂, 5 mM EGTA, 11 mM glucose, 3 mM dipotassium ATP, and 10 mM HEPES (pH 7.4). Depending on the experiment, the free Ca²⁺ concentration of the bath solution was changed from 0.3-10 µM by changing the Ca²⁺ concentration in the corresponding solution. The appropriate amounts of CaCl₂ were added, and the pH was adjusted according to a computer program on the basis of the binding constants of Fabiato and checked by fura 2 fluorescence (for details see Ref. 19). Experiments with iberiotoxin (Latoxan, Rosans, France) were carried out on outside-out patches, and bath and pipette solution were opposite to those used in inside-out experiments. A multi-barreled perfusion pipette placed 200 µm away from the patch was used to switch the superfusion solution. Electrophysiological experiments were performed at 20-22 °C, the holding potential was 20 mV.

Conductance (G) values were calculated as G = I/V_m. Usually, each experiment was normalized by dividing G values by G_max, where G_max was defined as the largest G value obtained in each experiment. G/G_max voltage curves were fitted with a Boltzmann equation of the form G/G_max = (1 + exp((V_1/2  V_m)/k])¹ with the use of Origin (version 6; Microcal Software, Northampton, MA). The data are expressed as means ± S.E.

Protein Kinases and PKC Inhibitors-- Pure cGK I (26) or the catalytic subunit of cAMP kinase (19) were prepared as described. The cGK and cAK were applied to the membrane patches at a concentration of 300 nM. The cGK was consistently used in the presence of 10 µM cGMP. The PKC inhibitor peptide PKC^19-31 was from Calbiochem and was applied at a concentration of 5 µM. The non-peptide PKC inhibitor Ro31-8220 was obtained from Biomol (Hamburg, Germany) and was used at a concentration of 1 µM.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

BK Channel Isoforms Cloned from Tracheal Smooth Muscle-- The BK channels in native tracheal smooth muscle cells show diversity in modulation by cGK and cAK (4, 19, 27). To analyze whether additional yet unidentified mRNA transcripts code for BK channels that might be specifically regulated by either cGK or cAK, we cloned BK channel  subunits from smooth muscle tissue of bovine trachea. In total, nine full-length clones containing the M1 methionine (24) and poly(A)⁺ tails of different length were isolated. In general, the bovine BK channel primary structure is identical with that from human (24, 28) with the exception of repetitive amino acid sequences at the N terminus varying in length (Fig. 1A) and amino acids at positions Thr¹³⁹, Ser⁷¹⁰, Ser⁷¹¹ of the bovine sequence that are changed to Ala, Asn, Thr in the human sequence, respectively. The nine clones obtained by cloning from tracheal smooth muscle consisted of three populations differing only at their C terminus (Fig. 1). Four clones of 6.1-6.6 kb were grouped into class BK_A. The BK_A isoform has been identified in a variety of species including human (24, 28). One clone of 4.4 kb differed from the BK_A clones in amino acids 1160-1166 at the C terminus and was classified as BK_B. This clone contained a 3'-untranslated region of 0.6 kb that was different from the 3'-untranslated region of 3 kb from BK_A. The BK_B-specific C terminus was recently also identified in rat (GenBank^TM U40603) and chicken (29). Another four clones (BK_C) of 3.3 kb were lacking the last 26 amino acids at the C terminus of BK_A. The C-terminal sequence ¹¹³⁷HSIP¹¹⁴⁰, which is common to all isoforms, is followed by the sequence ¹¹⁴¹PQT¹¹⁴³ in BK_C before the stop codon and the poly(A)⁺ tail. BK_C does not contain a 3'-untranslated region, and the poly(A) tail directly follows the stop codon. Since the analysis of the genomic structure of the BK channel in rat (30) revealed a single exon encoding the C-terminal part of the BK_A isoform (amino acids 1085-1166), the BK_B and BK_C isoforms may be generated by alternative splicing at cryptic intron splice sites within this exon. In fact, inspection of the nucleotide sequence at the junction sites reveals the presence of consensus motifs of intron 5' donor splice sites (31) in BK_A, namely GT at the junction of BK_A to BK_B (site 2 in Fig. 1B) and AT at the junction of BK_A to BK_C (site 1 in Fig. 1B). The consensus motifs GT and AT are conserved at the respective splice site in mammalian BK channel nucleotide sequences (Fig. 1B). Apart from BK_B, additional C-terminal isoforms have been identified from others that probably result from splicing at site 2 including Rat1BK, Rat2BK, and MouseBK (for details see the legend of Fig. 1B). Thus, the GT and AT consensus motifs at sites 1 and 2 may serve as cryptic 5' donor splice sites within the C-terminal exon.

View larger version (38K): [in this window] [in a new window]   Fig. 1.   A, BK channel isoforms cloned from bovine tracheal smooth muscle. N-terminal alignment of the bovine (BovBK) and human (HumBK) BK channel  subunit (24) and C-terminal alignment of the three isoforms BKA, BKB, BKC identified in bovine tracheal smooth muscle are shown. The amino acid sequence of BKB and BKC different from that in BKA are underlined and given in bold letters. Amino acid numbers are given at the right margin. The phosphorylation site for cGK, Ser1134, (16, 17), and the C-terminal consensus sites Ser1151/Ser1154 for phosphorylation by PKC are indicated in bold italics. B, alignment of C-terminal nucleotide sequences of BKA, BKB, BKC (BovBK) with BK channel isoforms from different species, human BK (GenBankTM U11058), rat1 BK (GenBankTM AF135265), mouse BK (GenBankTM AF156674), and rat2 BK (GenBankTM U40603). The indicated nucleotide sequence of bovine BKA and human BK is part of a single exon encoding the C-terminal amino acids 1085-1166 (numbering of BKA) (30). Splicing within this exon at the putative cryptic intron site 1 starting with the consensus nucleotides GT or AT (underlined) may result in the BKC-specific C-terminal nucleotide sequence (indicated in bold letters). Splicing at the putative cryptic intron site 2 starting with the consensus site GT (underlined) may result in the BKB-specific C-terminal nucleotide sequence (indicated in bold letters). The BKB-specific C-terminal sequence is also found in the rat2 BK. Further isoforms with specific C termini (indicated in bold letters) such as the indicated rat1 BK and mouse BK are probably also generated by splicing at site 2. Triplets represent the reading frame. Numbers of nucleotides are given at the left and right margin of the alignments.

Basic Properties of BK_Ca Channels Expressed in HEK Cells-- Membrane currents of nontransfected native HEK293 cells were measured in inside-out patches. Depolarizing steps from a holding potential of 20 mV to positive potentials resulted in a small outward current that showed no inactivation and exhibited no Ca²⁺ sensitivity. The steady-state current at +80 mV was 27.1 ± 2.5 pA (n = 30). The amplitude of outward currents in HEK293 cells expressing BK_A was considerably larger than in native HEK cells. Mean current amplitude obtained under steady-state conditions at +80 mV in cells expressing BK_A was 1851.3 ± 176.0 pA (n = 34). Typical examples of outward currents obtained from a native and a transfected cell are shown in Fig. 2, A and B. The results demonstrate that the outward current of transfected cells was contaminated by an endogenous current component by <2%. In some inside-out patches with low channel density, single channel conductance was determined in the presence of symmetrically high potassium of 140 mM. Channel openings could be detected at membrane potentials from 60 mV to +80 mV (Fig. 2C shows an example from a cell transfected with BK_A). The current-voltage relations of the three C-terminal splice variants were linear in the voltage range between 60 and +60 mV and showed reversal potentials close to 0 mV (Fig. 2D). The mean unitary conductances were 276 ± 8.1 picosiemens (BK_A; n = 6), 260 ± 12.3 picosiemens (BK_B; n = 6), and 272 ± 16.3 picosiemens (BK_C; n = 7). To further determine the basic channel properties of the BK_Ca channel isoforms, Ca²⁺ dependence was investigated in inside-out patches. When the Ca²⁺ concentration was increased from 0.3 to 10 µM, a shift to the left of the normalized conductance-voltage relations by 100 mV was observed (Fig. 3A). In eight patches from clones BK_A and BK_B and in 10 patches from clone BK_C, the mean half-maximal activating voltage (V_1/2) was 100 ± 5, 95 ± 5, and 113 ± 9 mV in 0.3 µM Ca²⁺ and 2 ± 2.1, 0 ± 5.4, and 4 ± 8 mV in 10 µM Ca²⁺-containing solution, respectively. There was a slight increase of the slope factor between 0.3 and 1 µM Ca²⁺ in all three isoforms, but no significant change was observed between 1 µM (BK_A 16.5 ± 1.9 mV, BK_B 17.4 ± 1.8 mV, BK_C 16.2 ± 2.0 mV) and 10 µM Ca²⁺ (BK_A 18.8 ± 2.1 mV, BK_B 20.3 ± 2.4 mV, BK_C 20.6 ± 2.1 mV). By plotting V_1/2 values obtained from the curves in Fig. 3A as a function of [Ca²⁺], a linear relation was obtained with a reduction of V_1/2 by 59 ± 6.7 (BK_A), 55 ± 6.5 (BK_B), and 68 ± 8.3 mV (BK_C) per 10-fold increase of [Ca²⁺] (Fig. 3B). The difference between the V_1/2 values was not statistically significant (p > 0.1). To determine the sensitivity of the BK channel isoforms to the specific peptide blocker iberiotoxin, outside-out patches in the presence of 1 µM [Ca²⁺]_i were exposed to increasing concentrations of the toxin (Fig. 3C). Mean half-maximal inhibitory concentrations of iberiotoxin were 5.8 ± 0.7 nM (BK_A; n = 5), 5.7 ± 0.7 nM (BK_B; n = 7), and 8.3 ± 2.0 nM (BK_C; n = 7).

View larger version (29K): [in this window] [in a new window]   Fig. 2.   Characterization of BKCa channels expressed in HEK293 cells. A and B, representative currents from native- and BKA-transfected HEK cells. Currents were recorded in the inside-out mode. The membrane potential of the cells was held at 20 mV and then changed with a series of 200-ms step pulses from 80 to +80 mV with 20-mV increments at 5-s intervals. [Ca2+] in the bath solution was 1 µM. C, representative single channel recordings from an inside-out patch at membrane potentials ranging from 60 to +80 mV; c indicates the closed state of the channel. The patch was detached from a BKA-transfected HEK cell. D, current-voltage relationships obtained from inside-out patches detached from HEK cells transfected with BKA (n = 6), BKB (n = 6), and BKC (n = 7). Symbols represent mean values. Single channel currents in C and D were measured in symmetrical 140 mM KCl. [Ca2+] in the bath solution was 1 µM.

View larger version (33K): [in this window] [in a new window]   Fig. 3.   Identical Ca2+ and iberiotoxin sensitivities of BK channel isoforms expressed in HEK293 cells. A, normalized conductance-voltage relations from inside-out patches expressing BKA (n = 8), BKB (n = 8), and BKC (n = 10) isoforms. The values of membrane conductance were first normalized to the maximal value and then averaged. Each patch represents a different cell. Currents were evoked by applying a 200-ms depolarizing pulse every 5 s in 20-mV increments from a holding potential of 20 mV to ± 160 mV. After each current-voltage relation, [Ca2+] was raised stepwise from 0.3 to 10 µM. The curves represent the fits of experimental points to the Boltzmann equation. B, plot of the voltage required for half-maximal channel activation (V1/2) as a function of [Ca2+] (same data as in A). Straight lines are calculated from linear regression (r = 0.96 to 0.99). C, concentration-dependent inhibition of the BK channel current (IKCa) by iberiotoxin (IbTX) in outside-out patches. Currents were evoked by voltage steps of 200 ms from 20 to +40 mV. Means ± S.E. of five patches from BKA and of seven patches from BKB and BKC, respectively, are shown. [Ca2+] was 1 µM.

Regulation of C-terminal Splice Variants by cGK and cAK-- The activity of BK channels is modulated in native cells by cAK and cGK. To investigate whether the C-terminal splice variants expressed in HEK293 cells are also regulated by the kinases, either the catalytic subunit of cAK or cGK plus cGMP were applied to the cytosolic face of excised inside-out membrane patches (Fig. 4). In the presence of cGK (upper panels), a 26- and 31-mV shift to the left of the normalized conductance-voltage relation was observed in splice variants BK_A (V_1/2 before, 57.9 ± 5.9 mV; V_1/2 after, cGK 32.2 ± 3.5 mV; n = 7) and BK_B (V_1/2 before, 54.8 ± 6.1 mV; V_1/2 after, cGK 24.1 ± 2.8 mV; n = 8). Membrane conductance of splice variant BK_C, however, did not respond significantly to cGK, V_1/2 was 54.5 ± 5.8 mV before and 47.5 ± 5.1 mV after application of the kinase. Opposite to cGK, cAK (lower panels) had no significant influence on BK_A (V_1/2 before, 46.2 ± 5.3 mV; V_1/2 after, cAK 43.7 ± 4.8 mV; n = 8) and BK_B (V_1/2 before, 51.0 ± 5.6 mV; V_1/2 after, cAK 49.4 ± 5.1 mV; n = 8) but induced a 35-mV shift to the left of the normalized conductance-voltage relation obtained from BK_C (V_1/2 before, 62.3 ± 6.9 mV; V_1/2 after, cAK 27.8 ± 3.1 mV; n = 6). The results of Fig. 4 suggest that the C-terminal amino acids determine whether the channel is responsive to cGK or cAK.

View larger version (32K): [in this window] [in a new window]   Fig. 4.   Regulation of BK channel isoforms expressed in HEK293 cells by cGK and cAK. Normalized conductance-voltage relations from inside-out patches in the absence and presence of cGK (upper panels) and cAK (lower panels). cGK shifts the curve to the left in patches expressing BKA (n = 7) and BKB (n = 8) but not in those expressing BKC (n = 8). Cyclic AK has no effect on patches expressing BKA (n = 8) and BKB (n = 8) but induced a left-shift of the curve obtained with BKC (n = 6). Each patch represents a different cell. Currents were evoked by applying a 200-ms depolarizing pulse every 5 s in 20-mV increments from a holding potential of 20 mV to ± 120 mV. The data were fitted by a Boltzmann equation. The insets show representative BK current recordings elicited by 200 ms pulses from 20 to +40 mV. Closed symbols represent currents in the presence of either cGK or cAK; [Ca2+] in the bath solution was 1 µM. Cells from the same transfection were used for testing BK channel conductance in the absence and presence of the respective kinase as V1/2 values slightly varied between different rounds of transfection.

Effects of cGK and cAK after Mutation of the Putative PKC Sites Ser¹¹⁵¹ and Ser¹¹⁵⁴-- Inspection of the C terminus revealed the tandem motif RXKS¹¹⁵¹RXS¹¹⁵⁴RXK (32) for phosphorylation by PKC, which was present in BK_A and BK_B but not in isoform BK_C (Fig. 1A). To study the possible influence of this site on the channel regulation by cGK and cAK, a mutant BK_A was created in which Ser¹¹⁵¹ and Ser¹¹⁵⁴ were replaced by alanine (S1151A/S1154A). Inside-out patches excised from HEK293 cells expressing the double mutant construct proved insensitive to stimulation by cGK but became responsive to cAK, similar as the BK_C isoform with its truncated C terminus (Fig. 5A). V_1/2 obtained from conductance-voltage relations was 53.6 ± 6.2 mV before (control) and 49.7 ± 5.4 mV after the application of cGK (n = 8; not significant). In contrast, cAK shifted V_1/2 by 31 mV from 40.6 ± 4.3 to 9.7 ± 1.3 mV (n = 12). These results indicate that the intact putative tandem PKC motif is a prerequisite for the channel to become regulated by cGK. To evaluate whether cAK stimulated the activity of the mutant BK_A isoform by phosphorylation of Ser¹¹³⁴, the site phosphorylated by cGK (16, 17), this serine was changed to alanine. As expected, the single mutation S1134A in BK_A resulted in loss of stimulation of channel activity by cGK (Fig. 5B). The inability of cAK to activate wild-type BK_A channels was unaffected by mutation S1134A (Fig. 5B), demonstrating that the mutation of the tandem PKC site in BK_A was responsible for the specific activation by cAK. Mean V_1/2 values in Fig. 5B were 58.9 ± 6.1 mV (control) and 60 ± 6.3 mV (cGK; n = 6) and 48.9 ± 5.3 mV (control) and 51.0 ± 5.5 mV (cAK: n = 8). When the double mutation in BK_A S1151A/S1154A was combined with the mutation S1134A, a channel was created that failed to respond to cGK (not shown) but was activated by cAK, indicating that cAK phosphorylates a different site of the BK channel than cGK (Fig. 5C). Cyclic AK produced a shift to the left by 30 mV; the mean V_1/2 values were 55.8 ± 5.9 mV before and 25.4 ± 3.2 mV (n = 10) in the presence of cAK. Similarly, mutation of the cGK site S1134A in splice variant BK_C had no influence on the stimulatory action of cAK; V_1/2 was shifted to the left by 34 mV from 45.4 ± 5.2 mV (control) to 1.7 ± 2.2 mV in the presence of cAK (n = 6; data not shown). Since phosphorylation of Ser⁸⁶⁹ of the human BK channel has been suggested to account for the stimulatory effect of cAK (15); the corresponding Ser⁹²² of the bovine BK_A channel was mutated to alanine in addition to the S1151A/S1154A exchange. The cAK-mediated increase in BK channel activity was completely eliminated in patches from HEK cells expressing this S922A mutant (Fig. 5C). The mean V_1/2 values were 52.0 ± 5.4 mV before and 51.0 ± 5.5 mV (n = 13) in the presence of cAK. This finding confirms that cAK and cGK stimulate BK channel activity by phosphorylating different sites of the BK channel  subunit, i.e. Ser⁹²² and Ser¹¹³⁴, respectively.

View larger version (26K): [in this window] [in a new window]   Fig. 5.   Activation of the BKA isoform by cGK requires the putative PKC phosphorylation sites Ser1151 and Ser1154. Normalized conductance-voltage relations from inside-out patches excised from HEK293 cells expressing BKA. A, mutation of the tandem PKC site, S1151A/S1154A, switches channel activation from cGK (n = 8) to cAK (n = 12). B, mutation of the putative cGK site, S1134A, abolishes the cGK effect (n = 6), whereas cAK remains ineffective (n = 8). C, left, combined mutations S1151A/S1154A and S1134A do not affect the shift to the left of the curve by cAK (n = 10). C, right, combined mutations S1151A/S1154A and S922A prevent channel stimulation by cAK. A-C, each patch was from a different cell. Currents were evoked by applying a 200-ms depolarizing pulse every 5 s in 20-mV increments from a holding potential of 20 mV to ± 120 mV. The insets show representative BK current recordings elicited by 200-ms pulses from 20 to +40 mV. Closed symbols represent currents in the presence of cGK or cAK; [Ca2+] in the bath solution was 1 µM. ctr, control.

In summary, these results suggest that an intrinsic PKC activity of HEK293 cells phosphorylates the BK_A and BK_B isoforms and consequently allows channel stimulation by cGK. The absence of the PKC consensus motif in the BK_C isoform leads to exclusive channel stimulation by cAK. Further in depth analysis revealed that phosphorylation of both serines were involved in the activation switch, because mutation of either Ser¹¹⁵¹ or Ser¹¹⁵⁴ alone led to an intermediate phenotype with respect to channel activation by cGK and cAK (data not shown).

Inhibition of PKC Switches BK Channel Activation from cGK to cAK-- To provide additional evidence for the involvement of PKC in the regulation of the BK channel, inside-out patches expressing the BK_A isoform were superfused with the inhibitory peptide of PKC (PKC^19-31) or the PKC inhibitor Ro31-8220. To allow complete dephosphorylation of the PKC sites, inside-out patches were first superfused for 5 min with ATP-free solution to which either PKC^19-31 (Fig. 6A) or Ro31-8220 (Fig. 6B) had been added. This solution was then changed to a solution containing ATP, PKC^19-31, or Ro31-8220 and either cGK or cAK. Similarly to the results obtained with the PKC mutation S1151A/S1154A, PKC^19-31, and Ro31-8220 prevented the stimulatory action of cGK on BK_A and switched the responsiveness of the channel toward cAK. V_1/2 values obtained from conductance-voltage relations in the presence of PKC^19-31 (Fig. 6A) were not significantly changed by cGK (before, 55.0 ± 5.9 mV; after cGK, 49.3 ± 5.7 mV; n = 7), whereas a shift to the left by 28 mV was produced by cAK (before 48.8 ± 5.3 mV; after cAK 20.3 ± 2.5 mV; n = 7). Similar results were obtained with Ro31-8220 (Fig. 6B); the mean V_1/2 values before (57.4 ± 6.3 mV) and after cGK (52.5 ± 6.1 mV; n = 8) were not significantly different, whereas cAK produced a shift to the left by 31 mV (before 54.5 ± 5.7 mV; after cAK 23.0 ± 2.9 mV; n = 8). The results demonstrate that inhibition of PKC, apparently associated with the BK channel in the excised patch, switches stimulation of channel activity from cGK to cAK.

View larger version (32K): [in this window] [in a new window]   Fig. 6.   Inhibition of PKC switches stimulation of BK channel activity from cGK to cAK. Normalized conductance-voltage relations from inside-out patches excised from HEK293 cells expressing the BKA isoform. Patches were superfused with ATP-free solution plus 5 µM PKC19-31 (A) or 1 µM Ro31-8220 (B) for 5 min first (not shown) and then with a solution containing 3 mM ATP, 5 µM PKC19-31, or 1 µM Ro-31-8220 and either cGK (left panels in A (n = 7) and B (n = 8) or cAK (right panels in A (n = 7) and B (n = 8). Note that only cAK increased membrane conductance and shifted the curve significantly to the left. Every patch was obtained from a different cell. Currents were elicited by applying a 200-ms depolarizing pulse every 5 s in 20-mV increments from a holding potential of 20 mV to ± 120 mV. The insets show representative BK current recordings elicited by 200-ms pulses from 20 to +40 mV. [Ca2+] in the bath solution was 1 µM. ctr, control.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The Ca²⁺-activated K⁺ channel of the BK type is subject to regulation by both the cAMP and the cGMP signaling pathway. Its contribution to smooth muscle relaxation has recently been demonstrated by gene deletion of the Ca²⁺ sensitivity-enhancing ₁ subunit that resulted in hypertension of gene-targeted mice (33, 34). Moreover, blockade of BK channels can interfere with the relaxation-promoting effect from NO/cGMP (35, 36). Stimulation of BK channels by cyclic nucleotide-dependent protein kinases was attributed to the phosphorylation of the  subunit at sites specific for either cAK (15, 23) or cGK (16, 17). Although these reports suggested the existence of specific phosphorylation sites that are conserved in mammalian BK channels, they do not explain the diversity of channel regulation by cAK (4, 5, 37, 38) and cGK (2, 18, 19) found in native cells. Further requirements are apparently needed to allow specific channel stimulation by either of these kinases. The objective of this study was therefore to address the question of whether alternative exon splicing of the  subunit and/or additional determinants are responsible for specific enhancement of channel activity by cAK and cGK. We identified three full-length splice variants in tracheal smooth muscle differing only at their C terminus. In contrast to BK channel isoforms identified recently (39), the single channel conductance, Ca²⁺, voltage, and iberiotoxin sensitivity of the isoforms BK_A, BK_B, and BK_C, were nearly identical (Figs. 2 and 3). The unexpected finding that BK_A and BK_B were exclusively stimulated by cGK, whereas BK_C was stimulated only by cAK, prompted us to search for the determining factor. We identified a tandem PKC motif close to the C terminus that is present in BK_A and BK_B but not in BK_C. The residues Ser¹¹⁵¹ and Ser¹¹⁵⁴ of this motif have an optimal consensus sequence for PKC-dependent phosphorylation (32). Our results strongly suggest that these sites are an effective PKC substrate for the following reasons. (i) PKC inhibition by two different inhibitors switched the specificity of channel stimulation from cGK toward cAK (Fig. 6). Since PKC was inhibited in the inside-out configuration, we suppose that the PKC remains functionally associated with the channel in the detached patch, similar to that suggested recently (40). (ii) Cyclic GK fails to stimulate channel activity when PKC-dependent phosphorylation of the C terminus is prevented due to mutation of both Ser¹¹⁵¹ and Ser¹¹⁵⁴ (Fig. 5). Mutation of either Ser¹¹⁵¹ or Ser¹¹⁵⁴ alone yielded only an intermediate phenotype with respect to channel stimulation by cAK and cGK.

The channel activity in inside-out patches from HEK293 cells expressing BK_A or BK_B is per se stimulated by cGK (Fig. 4). This suggests that phosphorylation of the tandem motif by PKC occurs constitutively. A constitutive or unconditional phosphorylation possibly mediated by PKC has recently been suggested for BK channels in GH₄C₁ cells (41). Due to the phosphorylation at the tandem motif, the switch of channel regulation from cGK to cAK in the presence of PKC inhibitors may involve the activity of a phosphatase that dephosphorylates the channel at the PKC motif before the channel becomes responsive to cAK (Fig. 6). Regulation of BK channels by a closely associated phosphatase has been shown in neuronal (40) and smooth muscle cells (19, 37). The present study also clearly demonstrates that cGK and cAK phosphorylate different sites of the channel. In agreement with Alioua et al. (16) and Fukao et al. (17), Ser¹¹³⁴ was identified as target for cGK-dependent phosphorylation. In contrast to cGK, cAK does not phosphorylate Ser¹¹³⁴. Cyclic AK enhances channel activity by phosphorylating Ser⁹²², a result that confirms recent findings (13, 15). The phosphorylation of an additional cAK site introduced by a facultative STREX exon was shown to inhibit BK channel activity (13). Hence, the lack of cAK to stimulate BK_A and BK_B channels that do not contain the STREX exon could be due to an inhibitory effect mediated by phosphorylation of the tandem PKC site.

Cyclic AK was demonstrated to bind to the large C-terminal part of the BK channel from Drosophila (21) and to coimmunoprecipitate with a mouse brain BK channel expressed in HEK293 cells (13). We speculated, therefore, whether phosphorylation of the tandem PKC site is necessary for binding of cGK to the channel. Since BK_C with its truncated C terminus is unresponsive to cGK, we tested a phosphopeptide comprising the last 26 amino acids of the BK_A channel including the phosphorylated Ser¹¹⁵¹ and Ser¹¹⁵⁴ for competition with cGK. This phosphopeptide was not able to attenuate the stimulatory effect of cGK,² thus making it unlikely that cGK directly interacts with the phosphorylated C-terminal portion of the channel. Contrary to our findings with the BK_A and BK_B channel from bovine tracheal smooth muscle, a specific BK channel isoform from mouse brain is regulated by cAK when expressed in HEK293 cells (13). Comparison of the respective primary structures reveals that this BK channel from mouse brain (14) has an extended C terminus starting downstream of the PKC tandem motif, suggesting that an altered C terminus may affect phosphorylation by PKC. Preferential activation of BK channels by cAK may be achieved by specific splice variants like the BK_C isoform, lacking the C-terminal tail including the tandem motif for PKC (Fig. 7). Previous studies confirmed the presence of mRNA transcripts in the range of 4 kb in smooth muscle tissue (28). These mRNA species may represent BK channels similar to the BK_B and BK_C isoform cloned from tracheal smooth muscle in this study. Intriguingly, the BK_B and BK_C isoforms result from splicing at cryptic intron sites within the C-terminal exon. This processing of the pre-mRNA might occur in a tissue-specific manner and further adds complexity to the functional role of splice variants.

View larger version (56K): [in this window] [in a new window]   Fig. 7.   Scheme illustrating the role of BK channel isoforms in cAMP- and cGMP-mediated smooth muscle relaxation. The observation that PKC inhibits BK channels in smooth muscle (44) suggests that phosphorylation of the BK channel by PKC supports the contractile response of hormones coupling to the diacylglycerol (AC)/PKC and inositol 1,4,5-trisphosphate (IP3) pathway. In turn, phosphorylation of the tandem motif by PKC promotes the counter-regulatory effect of the NO/cGMP/cGK cascade, since phosphorylation by PKC is a prerequisite for cGK to become an effective activator of BKA and BKB channel isoforms. Dephosphorylation of the tandem PKC motif mediated by a phosphatase or expression of isoforms like BKC lacking the C-terminal tandem PKC site allow BK channel activation by cAK.

In smooth muscle, the BK channel is a multimeric macrocomplex consisting of four  and four ₁ subunits (42). The co-expression of the ₁ subunit may affect the molecular mechanisms of channel regulation identified here. However, a previous report studying channel regulation by cAK clearly demonstrated that enhancement of channel activity was not altered when the  subunit was co-expressed (15). In addition to auxiliary subunits, the interaction of protein kinases with BK channels may be influenced by the host cell. When choosing Chinese hamster ovary cells as hosts, both cAK and cGK failed to stimulate BK channels (43). In the latter report, the transfected human BK channel starts translation from methionine M₃ (24). The difference in the present study cannot be explained by the start methionine, since the human BK channel with M₃ as translational start was similarly activated by cGK when expressed in HEK293 cells as the bovine BK_A isoform with M₁ as the translational start.² This finding suggests that a specific membrane environment and/or putative scaffold and signaling proteins of host cells are needed for the functional interaction of kinases and channel isoforms. In conclusion, the results of this study establish a complex link between PKC and the ability of cGK and cAK to regulate BK channels that contain typical C termini like BK_A and BK_B. We show for the first time that phosphorylation by PKC controls the activation of the channel by cGK. This demonstration is a further step in our understanding of the diversity and complexity of BK channel regulation. The findings may be particularly significant for mechanisms of smooth muscle relaxation and may explain specific channel regulation in native cells by either cAMP or cGMP pathways.

	ACKNOWLEDGEMENTS

We thank Tina Ruttkowski for excellent technical assistance and Dr. Franz Hofmann for helpful review.

	FOOTNOTES

^* This work was supported by Deutsche Forschungsgemeinschaft.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AY033472 (BK_A), AY033473 (BK_B), and AY033474 (BK_C).

To whom correspondence should be addressed. Tel.: 49-7071-2976781; Fax: 49-7071-292476; E-mail: peter.ruth@uni-tuebingen.de.

^¶ Contributed equally.

Published, JBC Papers in Press, August 20, 2001, DOI 10.1074/jbc.M104202200

² X.-B. Zhou et al., unpublished results.

	ABBREVIATIONS

The abbreviations used are: cGK, cGMP kinase; cAK, cAMP kinase; PKC, protein kinase C; kb, kilobase.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Simon, E. O. Harrington, G. X. Liu, G. Koren, and G. Choudhary Mechanism of C-type natriuretic peptide-induced endothelial cell hyperpolarization Am J Physiol Lung Cell Mol Physiol, February 1, 2009; 296(2): L248 - L256. [Abstract] [Full Text] [PDF]

				G. Godlewski, L. Offertaler, D. Osei-Hyiaman, F. M. Mo, J. Harvey-White, J. Liu, M. I. Davis, L. Zhang, R. K. Razdan, G. Milman, et al. The Endogenous Brain Constituent N-Arachidonoyl L-Serine Is an Activator of Large Conductance Ca2+-Activated K+ Channels J. Pharmacol. Exp. Ther., January 1, 2009; 328(1): 351 - 361. [Abstract] [Full Text] [PDF]

				L. Tian, O. Jeffries, H. McClafferty, A. Molyvdas, I. C. M. Rowe, F. Saleem, L. Chen, J. Greaves, L. H. Chamberlain, H.-G. Knaus, et al. Palmitoylation gates phosphorylation-dependent regulation of BK potassium channels PNAS, December 30, 2008; 105(52): 21006 - 21011. [Abstract] [Full Text] [PDF]

				G. Estilo, W. Liu, N. Pastor-Soler, P. Mitchell, M. D. Carattino, T. R. Kleyman, and L. M. Satlin Effect of aldosterone on BK channel expression in mammalian cortical collecting duct Am J Physiol Renal Physiol, September 1, 2008; 295(3): F780 - F788. [Abstract] [Full Text] [PDF]

				X.-B. Zhou, I. Wulfsen, S. Lutz, E. Utku, U. Sausbier, P. Ruth, T. Wieland, and M. Korth M2 Muscarinic Receptors Induce Airway Smooth Muscle Activation via a Dual, G{beta}{gamma}-mediated Inhibition of Large Conductance Ca2+-activated K+ Channel Activity J. Biol. Chem., July 25, 2008; 283(30): 21036 - 21044. [Abstract] [Full Text] [PDF]

				B. F. King and A. Townsend-Nicholson Involvement of P2Y1 and P2Y11 Purinoceptors in Parasympathetic Inhibition of Colonic Smooth Muscle J. Pharmacol. Exp. Ther., March 1, 2008; 324(3): 1055 - 1063. [Abstract] [Full Text] [PDF]

				L. Tian, H. McClafferty, L. Chen, and M. J. Shipston Reversible Tyrosine Protein Phosphorylation Regulates Large Conductance Voltage- and Calcium-activated Potassium Channels via Cortactin J. Biol. Chem., February 8, 2008; 283(6): 3067 - 3076. [Abstract] [Full Text] [PDF]

				M. J. Sanderson, P. Delmotte, Y. Bai, and J. F. Perez-Zogbhi Regulation of Airway Smooth Muscle Cell Contractility by Ca2+ Signaling and Sensitivity Proceedings of the ATS, January 1, 2008; 5(1): 23 - 31. [Abstract] [Full Text] [PDF]

				S. Zhang, H. H. Patel, F. Murray, C. V. Remillard, C. Schach, P. A. Thistlethwaite, Paul. A. Insel, and J. X.-J. Yuan Pulmonary artery smooth muscle cells from normal subjects and IPAH patients show divergent cAMP-mediated effects on TRPC expression and capacitative Ca2+ entry Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1202 - L1210. [Abstract] [Full Text] [PDF]

				C. K. Isacson, Q. Lu, R. H. Karas, and D. H. Cox RACK1 is a BKCa channel binding protein Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1459 - C1466. [Abstract] [Full Text] [PDF]

				L. Magnusson, C. M. Sorensen, T. H. Braunstein, N.-H. Holstein-Rathlou, and M. Salomonsson Renovascular BKCa channels are not activated in vivo under resting conditions and during agonist stimulation Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R345 - R353. [Abstract] [Full Text] [PDF]

				M. A. Giembycz and R. Newton Beyond the dogma: novel {beta}2-adrenoceptor signalling in the airways. Eur. Respir. J., June 1, 2006; 27(6): 1286 - 1306. [Abstract] [Full Text] [PDF]

				D. F. Stowe, M. Aldakkak, A. K. S. Camara, M. L. Riess, A. Heinen, S. G. Varadarajan, and M.-T. Jiang Cardiac mitochondrial preconditioning by Big Ca2+-sensitive K+ channel opening requires superoxide radical generation Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H434 - H440. [Abstract] [Full Text] [PDF]

				R. Zhou, L. Liu, and D. Hu Involvement of BKCa {alpha} subunit tyrosine phosphorylation in vascular hyporesponsiveness of superior mesenteric artery following hemorrhagic shock in rats Cardiovasc Res, November 1, 2005; 68(2): 327 - 335. [Abstract] [Full Text] [PDF]

				L. Chen, L. Tian, S. H.-F. MacDonald, H. McClafferty, M. S. L. Hammond, J.-M. Huibant, P. Ruth, H.-G. Knaus, and M. J. Shipston Functionally Diverse Complement of Large Conductance Calcium- and Voltage-activated Potassium Channel (BK) {alpha}-Subunits Generated from a Single Site of Splicing J. Biol. Chem., September 30, 2005; 280(39): 33599 - 33609. [Abstract] [Full Text] [PDF]

				J. Yang, J. W. Clark, R. M. Bryan, and C. S. Robertson Mathematical modeling of the nitric oxide/cGMP pathway in the vascular smooth muscle cell Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H886 - H897. [Abstract] [Full Text] [PDF]

				M. Sausbier, C. Arntz, I. Bucurenciu, H. Zhao, X.-B. Zhou, U. Sausbier, S. Feil, S. Kamm, K. Essin, C. A. Sailer, et al. Elevated Blood Pressure Linked to Primary Hyperaldosteronism and Impaired Vasodilation in BK Channel-Deficient Mice Circulation, July 5, 2005; 112(1): 60 - 68. [Abstract] [Full Text] [PDF]

				A. M. Brainard, A. J. Miller, J. R. Martens, and S. K. England Maxi-K channels localize to caveolae in human myometrium: a role for an actin-channel-caveolin complex in the regulation of myometrial smooth muscle K+ current Am J Physiol Cell Physiol, July 1, 2005; 289(1): C49 - C57. [Abstract] [Full Text] [PDF]

				L. Tian, L. S. Coghill, H. McClafferty, S. H.-F. MacDonald, F. A. Antoni, P. Ruth, H.-G. Knaus, and M. J. Shipston Distinct stoichiometry of BKCa channel tetramer phosphorylation specifies channel activation and inhibition by cAMP-dependent protein kinase PNAS, August 10, 2004; 101(32): 11897 - 11902. [Abstract] [Full Text] [PDF]

				J. Snellman and S. Nawy cGMP-Dependent Kinase Regulates Response Sensitivity of the Mouse On Bipolar Cell J. Neurosci., July 21, 2004; 24(29): 6621 - 6628. [Abstract] [Full Text] [PDF]

				C. R. Wolfram Kuhlmann, C. Gast, F. Li, M. Schafer, H. Tillmanns, B. Waldecker, and J. Wiecha Cerivastatin Activates Endothelial Calcium-Activated Potassium Channels and Thereby Modulates Endothelial Nitric Oxide Production and Cell Proliferation J. Am. Soc. Nephrol., April 1, 2004; 15(4): 868 - 875. [Abstract] [Full Text] [PDF]

				H. A Widmer, I. C M Rowe, and M. J Shipston Conditional protein phosphorylation regulates BK channel activity in rat cerebellar Purkinje neurons J. Physiol., October 15, 2003; 552(2): 379 - 391. [Abstract] [Full Text] [PDF]

				F. Steffens, X.-B. Zhou, U. Sausbier, C. Sailer, K. Motejlek, P. Ruth, J. Olcese, M. Korth, and T. Wieland Melatonin Receptor Signaling in Pregnant and Nonpregnant Rat Uterine Myocytes as Probed by Large Conductance Ca2+-Activated K+ Channel Activity Mol. Endocrinol., October 1, 2003; 17(10): 2103 - 2115. [Abstract] [Full Text] [PDF]

				C. Erxleben, A. L. Everhart, C. Romeo, H. Florance, M. B. Bauer, D. A. Alcorta, S. Rossie, M. J. Shipston, and D. L. Armstrong Interacting Effects of N-terminal Variation and Strex Exon Splicing on slo Potassium Channel Regulation by Calcium, Phosphorylation, and Oxidation J. Biol. Chem., July 19, 2002; 277(30): 27045 - 27052. [Abstract] [Full Text] [PDF]

				M. Fury, S. O. Marx, and A. R. Marks Molecular BKology: The Study of Splicing and Dicing Sci. Signal., March 12, 2002; 2002(123): pe12 - pe12. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/46/43239    most recent M104202200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhou, X.-B. Articles by Korth, M. Search for Related Content PubMed PubMed Citation Articles by Zhou, X.-B. Articles by Korth, M. Social Bookmarking                      What's this?