HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 47, 43842-43849, November 23, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/47/43842    most recent M101516200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Degousee, N. Articles by Rubin, B. B. Search for Related Content PubMed PubMed Citation Articles by Degousee, N. Articles by Rubin, B. B. Social Bookmarking                      What's this?

p38 MAPK Regulates Group IIa Phospholipase A₂ Expression in Interleukin-1-stimulated Rat Neonatal Cardiomyocytes^*

Norbert Degousee, Eva Stefanski, Thomas F. Lindsay, David A. Ford^§, Rohan Shahani, Catherine A. Andrews^¶, Donna J. Thuerauf^¶, Christopher C. Glembotski^¶, Timo J. Nevalainen, Jay Tischfield^**, and Barry B. Rubin

From the  Division of Vascular Surgery, Max Bell Research Center 1-917, Toronto General Hospital, Toronto, Ontario M5G-2C4, Canada, the ^§ Department of Biochemistry and Molecular Biology, St. Louis University Health Sciences Center, St. Louis, Missouri 63104, ^¶ San Diego State University Heart Institute and the Department of Biology, San Diego State University, San Diego, California 92182, the  Department of Pathology, University of Turku, Turku 20520, Finland, and the ^** Department of Genetics, Rutgers, State University of New Jersey, Piscataway, New Jersey 08854-8082

Received for publication, February 19, 2001, and in revised form, September 20, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Group IIa phospholipase A₂ (GIIa PLA₂) is released by some cells in response to interleukin-1. The purpose of this study was to determine whether interleukin-1 would stimulate the synthesis and release of GIIa PLA₂ from cardiomyocytes, and to define the role of p38 MAPK and cytosolic PLA₂ in the regulation of this process. Whereas GIIa PLA₂ mRNA was not identified in untreated cells, exposure to interleukin-1 resulted in the sustained expression of GIIa PLA₂ mRNA. Interleukin-1 also stimulated a progressive increase in cellular and extracellular GIIa PLA₂ protein levels and increased extracellular PLA₂ activity 70-fold. In addition, interleukin-1 stimulated the p38 MAPK-dependent activation of the downstream MAPK-activated protein kinase, MAPKAP-K2. Treatment with the p38 MAPK inhibitor, SB202190, decreased interleukin-1 stimulated MAPKAP-K2 activity, GIIa PLA₂ mRNA expression, GIIa PLA₂ protein synthesis, and the release of extracellular PLA₂ activity. Infection with an adenovirus encoding a constitutively active form of MKK6, MKK6(Glu), which selectively phosphorylates p38 MAPK, induced cellular GIIa PLA₂ protein synthesis and the release of GIIa PLA₂ and increased extracellular PLA₂ activity 3-fold. In contrast, infection with an adenovirus encoding a phosphorylation-resistant MKK6, MKK6(A), did not result in GIIa PLA₂ protein synthesis or release by unstimulated cardiomyocytes. In addition, infection with an adenovirus encoding MKK6(A) abrogated GIIa PLA₂ protein synthesis and release by interleukin-1-stimulated cells. These results provide direct evidence that p38 MAPK activation was necessary for interleukin-1-induced synthesis and release of GIIa PLA₂ by cardiomyocytes.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Interleukin-1 (IL-1)¹ has been implicated in the pathophysiology of a variety of myocardial disease states, including cardiac hypertrophy, congestive heart failure, and ischemia-reperfusion injury (1-3). IL-1 is thought to participate in the genesis of these cardiac pathologies through the induction of specific genes, such as inducible nitric-oxide synthase, cyclooxygenase-2, matrix metalloproteinase, vascular endothelial growth factor, and B-crystallin (4-6). As the range of genes that are induced by cardiomyocytes following exposure to IL-1 have not been fully defined, the precise mechanisms that lead to the phenotypic changes that follow exposure to IL-1 remain incompletely understood.

The effects of IL-1 in cardiomyocytes are mediated, in part, by stimulation of mitogen-activated protein kinase (MAPK) enzymes. The MAPK enzymes include p38 MAPK, p42/44 MAPK, and JNK. Molecular cloning studies have led to the identification of four distinct p38 MAPK isoforms as follows: p38, p382, p38, and p38 (7). The MAPK enzymes exert distinct biological functions, as p38 MAPK promoted apoptosis, whereas p382 MAPK promoted myocardial hypertrophy and cell survival (8, 9). p38 MAPK activity is increased by phosphorylation on a Thr-Gly-Tyr motif by MAPK kinases, including MKK3 and MKK6 (10, 11). MKK6 forms a functional complex with p38 MAPK that is dependent on both the presence of a docking site in the N terminus of the MAPK kinase and the selective recognition of an activation (T-loop) of the individual p38 MAPK isoforms (7), and leads to the phosphorylation and activation of p38 MAPK. MKK6 activity is regulated by phosphorylation on Ser-207 and Thr-211. Mutation of Ser-207 and Thr-211 to Glu had the same effect as phosphorylation of these amino acids and resulted in a constitutively active form of the enzyme, MKK6(Glu) (11). Among the different MAPK enzymes, MKK6(Glu) only activated p38 MAPK in cardiac myocytes (9, 12). In addition, MKK6(Glu) phosphorylated p38 MAPK but not JNK1 or ERK2 in vitro and MKK6(Glu) did not activate a phosphorylation-defective (Thr-180 to Ala and Tyr-182 to Phe) p38 MAPK (11). Therefore, MKK6(Glu) is a potent and selective activator of p38 MAPK that can be used to study the physiologic effects of myocardial p38 MAPK activation in vitro (7, 9, 13).

MAPK enzymes have been implicated in the regulation of phospholipase A₂ (PLA₂) expression (14). PLA₂ enzymes catalyze the hydrolysis of phospholipids, with the subsequent release of fatty acids, such as arachidonic acid, from the sn-2 position (15). Arachidonic acid is the biochemical precursor of the leukotrienes, thromboxanes, and prostaglandins, biologically active metabolites that may modulate the myocardial response to cytokine exposure (16-18). The PLA₂ enzymes have been classified into groups (G) according to their cellular location, dependence on Ca²⁺ for catalytic activity, and primary structure (15, 19). Thus, cardiac myocytes are known to express cytosolic Ca²⁺-dependent PLA₂ (cPLA₂, GIV) (14, 20) and cytosolic Ca²⁺-independent PLA₂ (iPLA₂, GVI) enzymes (21, 22). Studies have shown that the p38 MAPK-activated protein kinases MNK1, MSK1, and PRAK1 and the 42-kDa MAPK (ERK2) are able to phosphorylate cPLA₂ in vitro (23-25). In addition to cPLA₂ and iPLA₂, a family of 10 extracellular or secreted PLA₂ (sPLA₂) enzymes has also been described in mammals that include GIb, IIa, IIc, IId, IIe, IIf, III, V, X, and XII PLA₂ (19, 26). Whereas some of these sPLA₂ enzymes are located in granules and are secreted into the extracellular environment (27), others have been identified in the Golgi apparatus, nuclear envelope, plasma membrane, and cytosol (28, 29). The identity of the sPLA₂ enzyme(s) that are expressed and released by cardiomyocytes following exposure to IL-1 have not been defined.

GIIa PLA₂ is a highly basic protein that is secreted from a number of cells during inflammation and may play a central role in the liberation of arachidonic acid from phospholipids (30). In some cell types, cPLA₂ activity was required for the expression of GIIa PLA₂ (31, 32). In cardiac myocytes, exposure to IL-1 led to p38 MAPK activation (33, 34), and in smooth muscle cells IL-1 led to GIIa PLA₂ expression (35). In this study, we show that IL-1 induced GIIa PLA₂ gene expression by cardiomyocytes and that p38 MAPK activation was necessary for IL-1-induced synthesis and release of GIIa PLA₂ by these cells. In contrast, cPLA₂ activity was not required for IL-1-induced GIIa PLA₂ synthesis by cardiomyocytes.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- The MEK-1 inhibitor PD98059, the p38 MAPK inhibitor SB202190, and the inactive control SB202474 were obtained from Calbiochem. Antiserum specific for cPLA₂ was purchased from Santa Cruz Biotechnology, Santa Cruz, CA. The anti-MAPKAP-K2 was from Upstate Biotechnology, Inc., Lake Placid, NY. Recombinant human IL-1 was from PeproTech Inc., Rocky Hill, NJ. The cDNAs for rat GIIa PLA₂ and cPLA₂ were provided by Dr. Brian Kennedy, Merck Sharp and Dohme. Mouse GAPDH cDNA was obtained from Ambion, Austin, TX. Arachidonyltrifluoromethyl ketone (AACOCF₃) and (E)-6-(bromomethylene)-3-(1-napthalenyl)-2H-tetrahydopyran-2-one (HELSS) were from Cayman Chemical, Ann Arbor, MI. Polyclonal antiserum against recombinant rat GIIa PLA₂ was raised in rabbits, and recombinant rat GIIa PLA₂, which contains 6 His residues at the C terminus of the protein and migrates at an apparent mass of ~18 kDa on SDS-PAGE, was synthesized as described (36). Recombinant iPLA₂ was kindly provided by Dr. Simon Jones (Genetics Institute, Cambridge, MA). LY311727 was kindly provided by Dr. Ed Mihelich, Lilly. All other reagents were analytical or tissue culture grade and were obtained from Sigma.

Cell Culture and Experimental Protocol-- Rat neonatal cardiomyocytes were isolated from the hearts of 1-2-day-old Sprague-Dawley rats as described previously (12). Briefly, hearts were isolated, washed, and cut into 1-2-mm pieces and sequentially digested with 0.15% trypsin in calcium and bicarbonate-free Hanks' in 12-16 consecutive digestions for 5 min at room temperature. The dissociated cells were pooled, washed, and suspended in Dulbecco's modified Eagle's medium and Ham's F-12 medium, 1:1, supplemented with 10% fetal bovine serum (FBS), and plated for 60 min to remove contaminating fibroblasts. After collecting unattached cells, cardiomyocytes were seeded on 60- or 100-mm dishes at a density of 0.9 × 10⁵ cells/cm² in Dulbecco's modified Eagle's medium:F-12 medium supplemented with 10% FBS and 0.1 mM bromodeoxyuridine and cultured in a humidified atmosphere of 5% CO₂ and 95% air for 24 h. Cells were then washed and incubated in serum-free medium supplemented with 1 µg/ml insulin, 5 µg/ml transferrin, 1 nM LiCl, 1 nM SeO₂, 25 µg/ml vitamin C, 100 units/ml penicillin, and 100 units/ml streptomycin (medium A). After 24 h (which corresponds to time = 0 in the experimental protocol), cells were washed, resuspended in medium A, and treated with inhibitors or adenoviral vectors, as indicated in the figure legends. When chemicals were dissolved in Me₂SO or ethanol, the identical concentrations of these solvents were added to controls. Where indicated, cells were pretreated with inhibitors for 1 h before addition of Me₂SO or IL-1, at 10 ng/ml, for up to 72 h. All experiments were done in triplicate and repeated 2-6 times. In all studies, cytotoxicity was assessed by monitoring the extracellular release of lactate dehydrogenase and creatine kinase. Studies in which the release of lactate dehydrogenase or creatine kinase exceeded >5% of total cellular activity were excluded from further analysis.

MAPKAP-K2 Kinase Assays-- Following exposure to vehicle or SB202190 (10 µM) for 30 min, cells were treated with 10 ng/ml IL-1 for up to 60 min. Cells that were exposed to osmotic stress by incubation with 400 mM sorbitol for 10 min were used as positive controls. Cultures were extracted in 400 µl of MAPKAP-K2 assay buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 5 mM sodium pyrophosphate, 10 mM sodium glycerophosphate, 50 mM NaF, 0.5 mM sodium o-vanadate, 0.1% 2-mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, and 1 µg/ml leupeptin). Following removal of debris by centrifugation, MAPKAP-K2 was immunoprecipitated using 1.5 µg of anti-MAPKAP-K2 and submitted to a kinase assay using [-³²P]ATP and hsp27 as the substrates, as described by the manufacturer's protocol. Labeled hsp27 was then resolved by 12% SDS-PAGE, and the gel was then submitted to PhosphorImager analyses, as described (6).

Plasmids-- pcDNA3 FLAG-MKK6(Glu), obtained from R. J. Davis (University of Massachusetts, Worcester, MA), codes for activated human MKK6 (11). The cDNA clone, pcDNA3 HA-MKK6b(A), a mutant form of MKK6 containing Ala substitutions at Ser-207 and Thr-211 (37), was originally obtained from J. Han (Scripps Institute, La Jolla, CA). Sr3 HA-p38-2, which codes for wild type human p38-2 MAPK, was obtained from B. Stein (38) (Signal Pharmaceuticals, Inc., San Diego, CA). p38-2 MAPK is distinct from p38, p38 ,and p38 but is identical to human p38₂ MAPK (39).

Adenoviruses-- The preparation of recombinant adenoviruses encoding MKK6(Glu) and p38-2 MAPK, and infection of cardiomyocytes, was carried out exactly as described previously (13). A recombinant adenovirus encoding MKK6b(A) was constructed as follows. A polymerase chain reaction product was created from the cDNA clone, pcDNA3 HA-MKK6b(A), with the following primers: ggcggcggccgccaactagaaggcacagtcgagg (pcDNA3 rev NotI) and ggcggaattcatgtctcagtcgaaaggcaagaag (MKK6b Met EcoRI), which introduced EcoRI and NotI restriction sites. The polymerase chain reaction product was then cloned into pGEX-6P-1, cut from the pGEX construct with BamHI and NotI, and subcloned into the BglII and NotI sites of the pAdTrack-CMV shuttle vector. The shuttle vector was recombined with pAdEasy-1 to form the viral construct, MKK6(A), as described by He et al. (40). Viral titers were determined by observing GFP fluorescence of primary neonatal cardiac myocytes, and the minimum quantity of viral stock that afforded 100% transfection efficiency was selected for the experiments in this study.

Phospholipase A₂ Assay-- Extracellular PLA₂ activity was determined by measuring the amounts of free [1-¹⁴C]oleic acid released from [1-¹⁴C]oleic acid-labeled Escherichia coli, according to the protocol developed by Elsbach and Weiss (41). The reaction was carried out in a total volume of 1.5 ml of 0.1 M Tris buffer, pH 7.5, containing 7 mM CaCl₂, 10 mg fatty acid-free bovine serum albumin, and 2.8 × 10⁸ radiolabeled E. coli (corresponding to 5.6 nmol of phospholipid). After a 30-min incubation at 37 °C, the reaction was terminated by filtration through a 0.45-µm Millipore filter, and the released [1-¹⁴C]oleic acid bound to the bovine serum albumin carrier was estimated by liquid scintillation counting, as described (42). All assays were performed in the excess of substrate and corrected for non-enzymatic hydrolysis. 1 unit of PLA₂ activity was defined as the amount of enzyme that hydrolyzed 56 pmol of phospholipid substrate in 30 min at 37 °C, which corresponds to 1% of the total E. coli substrate.

RNA Isolation and Northern Blot Analysis-- Total cellular RNA was extracted from rat cardiomyocytes using the RNeasy system (Qiagen, Mississauga, Ontario, Canada). Extracted RNA (15 µg) was run on 1% formaldehyde-agarose gels and transferred to a nylon membrane (GeneScreen Plus, PerkinElmer Life Sciences) by capillary blotting. cDNA probes used for hybridization were labeled with [³²P]dCTP using a random primer labeling kit (Amersham Pharmacia Biotech). After baking at 80 °C, the blot was subjected to hybridization, followed by two 30-min washes with 1× SSC containing 0.5% SDS at 65 °C and three 30-min washes with 0.1× SSC containing 0.1% SDS at 65 °C. Washed membranes were exposed to x-ray film (Kodak X-Omat) with one intensifying screen at 70 °C for periods ranging from 5 h to 3 days. Films were densitometrically scanned and analyzed using an Imaging densitometer (model GS-690) and the Molecular Analyst program (Bio-Rad).

Production of an Anti-iPLA₂ Antiserum-- The peptide EEFLKREFGEHTK, which corresponds to amino acids 507-519 of the 85-kDa iPLA₂ cloned from Chinese hamster ovary cells (43), was polymerized onto a polylysine tree and injected into a rabbit with Freund's complete adjuvant. The serum was collected and affinity-purified with the polylysine tree-linked multiple antigenic peptide, which was fixed to an Immunosorb column, according to the manufacturer's instructions (Pierce).

Preparation of Total Cell Lysates-- In selected studies, plates were washed with phosphate-buffered saline, and the cells were incubated in ice-cold lysis buffer (50 mM HEPES, pH 7.5, 100 mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 25 mM sodium fluoride, 0.5 mM phenylphosphate, 5 mM glycerophosphate, 2 mM EDTA, 2 mM EGTA, 10 µg/ml aprotinin, and 10 µg/ml leupeptin) for 30 min, followed by passage through a 21-gauge syringe needle. Cellular lysates were centrifuged at 150,000 × g for 20 min at 4 °C, and the supernatants were stored at 20 °C for subsequent immunoblotting studies.

Western Blot Analysis-- Cell lysates and cytosolic or microsomal fractions were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using 9, 13, or 16.5% gels at a constant 100 V. Proteins were transferred to a nitrocellulose membrane in 25 mM Tris-HCl, 192 mM glycine, 20% methanol, pH 8.3, at 2 mA/cm, followed by overnight blocking in 5% milk and 1% goat serum. The blots were then incubated with primary antibody (see figure legends for specific antibodies) for 2 h at room temperature, washed, and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h. Detection of immunoreactive bands was carried out using enhanced chemiluminescence.

Statistical Analysis-- All results are expressed as the mean ± S.D. of triplicate determinations. Comparisons between groups were made by repeated measures analysis of variance, followed by post-hoc analysis with paired t tests. When multiple comparisons between groups were made, a Bonferroni correction was applied. A p value <0.01 was considered to be significant.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

IL-1 Stimulates GIIa PLA₂ mRNA Expression and GIIa PLA₂ Synthesis and Release by Rat Neonatal Cardiomyocytes-- No GIIa PLA₂ mRNA was detected in cardiomyocytes following incubation in culture medium with 10% FBS for 24 h and incubation in medium A (without FBS) for a further 24 h (Fig. 1A, time = 0) by northern blot analysis. After an additional 72 h in culture, untreated cardiomyocytes still failed to express GIIa PLA₂ mRNA (Fig. 1A). In contrast, treatment with IL-1 resulted in the sustained expression of GIIa PLA₂ mRNA. These results are consistent with the notion that IL-1 induced GIIa PLA₂ mRNA transcription in cardiomyocytes.

View larger version (32K): [in this window] [in a new window]   Fig. 1.   Time course of GIIa PLA2 mRNA expression. Bromodeoxyuridine-treated, serum-starved cells were incubated in the presence (+) or absence () of 10 ng/ml IL-1 for up to 72 h. Following washing and total RNA extraction, GIIa PLA2 and GAPDH mRNA expression were assessed by northern blot analysis, as described under "Experimental Procedures." Autoradiograms are representative of three independent studies.

To determine whether IL-1 induced GIIa PLA₂ protein synthesis and release by cardiomyocytes, cells were treated with IL-1, and cellular lysates and the extracellular fluid were evaluated by western blot analysis. The anti-GIIa PLA₂ antibody used in these studies identified recombinant rat GIIa PLA₂ but failed to identify recombinant rat GV PLA₂ (Fig. 2A), a closely related protein that is also expressed in cardiomyocytes.² GIIa PLA₂ was not identified in the cellular lysates (Fig. 2B) or extracellular fluid (Fig. 3A) of untreated cells. In contrast, treatment with IL-1 induced a progressive increase in GIIa PLA₂ protein levels in the cellular lysates (Fig. 2B) and extracellular fluid (Fig. 3A) of cardiomyocytes. Treatment with IL-1 also stimulated a progressive increase in PLA₂ activity in the extracellular fluid of cardiomyocytes compared with controls (Fig. 3B). Co-incubation of the extracellular fluid from IL-1-stimulated cardiomyocytes with LY311-727 (1 µM), a substituted indole that constrains the activity of GIIa, GV, and GX PLA₂ (44, 45) but has no effect on cPLA₂ or iPLA₂ activity, significantly decreased extracellular PLA₂ activity (3510 ± 620 units/ml, controls versus 62 ± 7 units/ml, LY311-727, p < 0.0001, paired t test, data not shown). Taken together, these data are consistent with the notion that IL-1 stimulated the synthesis and release of catalytically active GIIa PLA₂ from cardiomyocytes.

View larger version (31K): [in this window] [in a new window]   Fig. 2.   IL-1 stimulates GIIa PLA2 protein synthesis in cardiomyocytes. A, antibody specificity. Recombinant rat GIIa PLA2 and the supernatant of HEK-293 cells that had been stably transfected with rat GV PLA2 were resolved by SDS-PAGE, transferred to nitrocellulose, and probed with an anti-GIIa PLA2 or an anti-GV PLA2 antiserum. B, expression of GIIa PLA2 following incubation in the presence (+) or absence () of 10 ng/ml IL-1. At the indicated times, cells were lysed in disruption buffer and evaluated by western blotting, as described under "Experimental Procedures." Recombinant GIIa PLA2, which has 6 addition His residues at the C terminus of the protein and is known to migrate at an apparent mass of ~18 kDa (36), was run as a electrophoresis control. Representative results from three independent experiments are shown.

View larger version (30K): [in this window] [in a new window]   Fig. 3.   Time course of the release of GIIa PLA2 and PLA2 activity by cardiomyocytes. Cells were incubated in the presence (+) or absence () of 10 ng/ml IL-1 for up to 72 h. A, the presence of GIIa PLA2 in the supernatant was assessed by western blotting. B, PLA2 activity in the supernatant of control (open bars) or IL-1-treated cells (filled bars) was assessed by monitoring the release of [1-14C]oleic acid from [1-14C]oleic acid-labeled E. coli, as described under "Experimental Procedures." Repeated measures-ANOVA, p = 0.00003; *, p < 0.001 versus control. Representative results from three independent experiments done in triplicate are shown.

IL-1 Stimulates cPLA₂ mRNA and Protein Synthesis by Cardiomyocytes-- cPLA₂ is required for cytokine-induced transcription of sPLA₂ gene products in some cells (31, 47). Therefore, we evaluated the effect of IL-1 on cPLA₂ mRNA and protein synthesis in cardiomyocytes. Unstimulated cardiomyocytes expressed low levels of cPLA₂ mRNA (Fig. 4A). Following treatment with IL-1 for 72 h, a 6-fold increase in cPLA₂ mRNA to GAPDH mRNA was observed (Fig. 4A). Treatment with IL-1 also resulted in an increase in cPLA₂ protein levels in cardiomyocytes (Fig. 4B). Therefore, IL-1 stimulated both cPLA₂ and GIIa PLA₂ synthesis in cardiomyocytes.

View larger version (53K): [in this window] [in a new window]   Fig. 4.   IL-1 stimulates cPLA2 mRNA expression and cPLA2 protein synthesis by cardiomyocytes. Cells were incubated in the presence (+) or absence () of 10 ng/ml IL-1 for up to 72 h. A, following washing and total RNA extraction, cPLA2 mRNA expression was assessed by northern blot analysis. B, cells were lysed with disruption buffer, resolved by SDS-PAGE, transferred to nitrocellulose, and probed with an anti-cPLA2 antibody. A representative autoradiogram and western blot from three independent experiments are shown.

cPLA₂ and iPLA₂ Do Not Regulate the Expression of GIIa PLA₂ or the Release of PLA₂ Activity by IL-1-treated Cardiomyocytes-- To study the potential role of cPLA₂ in IL-1-stimulated GIIa PLA₂ mRNA and protein synthesis, cells were treated with AACOCF₃, a reversible inhibitor of both cPLA₂ and iPLA₂ (48, 49). Treatment with 5 µM AACOCF₃ had no effect on GIIa PLA₂ mRNA expression by control or IL-1-stimulated cells (Fig. 5A). Similarly, treatment with 0.1 or 1 µM AACOCF₃ had no effect on cellular GIIa PLA₂ protein levels in the absence IL-1, whereas 5 µM AACOCF₃ caused an increase in cellular GIIa PLA₂ levels (Fig. 5B). Treatment with increasing concentrations of AACOCF₃ also had no effect on the IL-1-stimulated increase in cellular GIIa PLA₂ protein levels (Fig. 5B), extracellular GIIa PLA₂ protein levels (Fig. 5C), or extracellular PLA₂ activity (Fig. 5D). In addition, treatment with IL-1 had no effect on cellular levels of iPLA₂, as measured by western blot analysis, and inhibition of cellular iPLA₂ activity with 10 µM HELSS (50) had no effect on GIIa PLA₂ release by IL-1 stimulated cells (data not shown). These results do not support a role for either cPLA₂ or iPLA₂ in the regulation of IL-1-stimulated GIIa PLA₂ synthesis and release by cardiomyocytes.

View larger version (27K): [in this window] [in a new window]   Fig. 5.   Effect of inhibition of cPLA2 activity on IL-1-stimulated GIIa PLA2 mRNA expression, cellular GIIa PLA2 protein synthesis, and the release of GIIa PLA2. A, cells were pretreated with 0.1% Me2SO () or 5 µM AACOCF3 (+) for 30 min at 37 °C. Following exposure to vehicle () or IL-1 (+) for 72 h, GIIa PLA2 and GAPDH mRNA expression were evaluated by northern blot analysis. B and C, cells were pretreated with the indicated concentrations of AACOCF3 for 30 min at 37 °C, incubated with vehicle () or IL-1 (+) for 72 h, and disrupted in lysis buffer. The cell lysate (B) and the extracellular fluid (C) were then evaluated by western blotting with an anti-GIIa PLA2 antiserum. D, PLA2 activity in the extracellular fluid of control (open bars) or IL-1 treated cells (filled bars) was measured as described under "Experimental Procedures." Representative results from three independent experiments done in triplicate are shown.

IL-1 Stimulates MAPKAP-K2 Activity in Cardiomyocytes-- p38 MAPK has been implicated in the regulation of IL-1-induced gene expression (51, 52). Therefore, we evaluated the effect of IL-1 on p38 MAPK activity. p38 MAPK phosphorylates and activates the downstream MAPK-activated protein kinase, MAPKAP-K2 (6). Therefore, MAPKAP-K2 activity was used as an index of p38 MAPK activity. Treatment with IL-1 for 15 min induced a 4-fold rise in MAPKAP-K2 activity (Fig. 6, A and B). After 60 min, MAPKAP-K2 activity had returned to base-line levels. The increase in MAPKAP-K2 activity induced by IL-1 was attenuated by treatment with SB202190 (10 µM), an inhibitor of p38 MAPK. In addition, the increase in MAPKAP-K2 activity that was observed when cardiomyocytes were subjected to osmotic stress by co-incubation with 400 mM sorbitol was also inhibited by SB202190. These results are consistent with the notion that IL-1 induced a rapid, transient increase in p38 MAPK activity in cardiomyocytes and that this increase in p38 MAPK activity was inhibited by co-incubation with SB202190.

View larger version (27K): [in this window] [in a new window]   Fig. 6.   Effect of IL-1 on cellular MAPKAP-K2 activity and inhibition of p38 MAPK-dependent MAPKAP-K2 activation by SB202190. A, cardiomyocytes were incubated in the presence (+) or absence () of 10 µM SB202190 for 30 min at 37 °C and then treated with either 10 ng/ml IL-1 for 0-60 min or 400 mM sorbitol for 10 min. Following cells lysis in MAPKAP-K2 assay buffer and immunoprecipitation, MAPKAP-K2 activity was evaluated with a kinase assay using [-32P]ATP and hsp27 as the substrates, followed by SDS-PAGE and PhosphorImager analysis, as described under "Experimental Procedures." B, densitometric analysis of the image presented in A. Representative results from two independent experiments are shown.

Inhibition of p38 MAPK Activity Attenuates GIIa PLA₂ mRNA and Protein Synthesis and the Release of Secretory PLA₂ Activity from Cardiomyocytes-- Treatment with SB202190 significantly decreased IL-1-stimulated cardiomyocyte GIIa PLA₂ mRNA expression (Fig. 7A), cellular GIIa PLA₂ protein synthesis (Fig. 7B), and extracellular GIIa PLA₂ release (Fig. 7C). Similarly, treatment of cardiomyocytes with SB202190 resulted in a dose-dependent decrease in IL-1-stimulated extracellular PLA₂ activity (Fig. 7D). In contrast, treatment with PD098059, which inhibits MEK1-mediated phosphorylation and activation of p42/44 MAPK (53, 54), or the inactive control, SB202747, had no effect on cardiomyocyte GIIa PLA₂ mRNA expression, cellular GIIa PLA₂ protein synthesis, extracellular GIIa PLA₂ release, or extracellular PLA₂ activity (Fig. 7, A-D). Taken together, these results are consistent with the notion that p38 MAPK kinase played a role in the regulation of the synthesis and release of GIIa PLA₂ by IL-1-stimulated cardiomyocytes.

View larger version (35K): [in this window] [in a new window]   Fig. 7.   Effect of inhibition of p38 MAPK or p42/44 MAPK activity on GIIa PLA2 mRNA expression, cellular GIIa PLA2 protein synthesis, and the release of GIIa PLA2 by IL-1-treated cells. Cardiomyocytes were pretreated with Me2SO (0.1%), 10 µM PD098059, 10 µM SB202190, or 10 µM SB202747 for 30 min at 37 °C, washed, and incubated in the presence (+) or absence () of 10 ng/ml IL-1 for 72 h. A, GIIa PLA2 mRNA expression was evaluated by northern blot analysis. B and C, cell lysates (B) and the extracellular fluid (C) were evaluated by western blotting with an anti-GIIa PLA2 antiserum. D, cells were treated with 0.1% Me2SO (open bars), 0.1 µM (stippled bars), 1 µM (hatched bars), or 10 µM (filled bars) PD098059, SB202190, or SB202747, as indicated, for 30 min at 37 °C, washed, and treated with 10 ng/ml IL-1 for 72 h. PLA2 activity in the supernatant was assessed by monitoring the release of [1-14C]oleic acid from [1-14C]oleic acid-labeled E. coli, as described under "Experimental Procedures." Repeated measures-ANOVA, p = 3.6 × 107; *, p < 0.01 versus control. All results are representative of three or more independent experiments.

Activation of p38 MAPK by MKK6 Stimulates GIIa PLA₂ Protein Synthesis and the Release of PLA₂ Activity by Cardiomyocytes-- p38 MAPK is phosphorylated and activated by MKK6 (11). To study further the role of p38 MAPK activation in the regulation of GIIa PLA₂ expression, cells were infected with a recombinant adenovirus encoding a constitutively active MKK6, MKK6(Glu). In previous studies, it has been shown that adenoviral mediated gene transfer achieved a transfection efficiency of 100% in neonatal rat cardiac myocytes (7) and that infection with an adenovirus encoding MKK6(Glu) resulted in a 6-fold increase in p38 MAPK phosphorylation and an 8-fold increase in MAPKAP-K2 activity in these cells (6). To control for the current studies, cells were infected with a recombinant adenovirus encoding MKK6(A), in which Ser-207 and Thr-211 were mutated to Ala. The result of infecting cells with a recombinant adenovirus encoding wild type human p38-2 MAPK was also evaluated. Infection with a recombinant adenovirus encoding MKK6(Glu) resulted in an increase in cellular GIIa PLA₂ synthesis (Fig. 8A) and extracellular GIIa PLA₂ release (Fig. 8B) in comparison with cells infected with the adenovirus encoding p38-2 MAPK or the empty vector. In contrast, infection with the adenovirus encoding MKK6(A) abrogated cellular GIIa PLA₂ synthesis and the release of extracellular GIIa PLA₂ (Fig. 8, A and B). Infection with the adenovirus encoding MKK6(Glu) also resulted in a 3-fold increase in extracellular PLA₂ activity in comparison with cells infected with the adenovirus encoding p38-2 MAPK or the empty vector (Fig. 9C), and this extracellular PLA₂ activity was inhibited >98% by 1 µM LY311-727 (data not shown). In contrast to these results, infection with the adenovirus encoding MKK6(A) decreased extracellular PLA₂ activity by 96% in comparison with cells infected with MKK6(Glu) (Fig. 8C). Taken together, these data provide direct evidence that activation of p38 MAPK by MKK6(Glu) was sufficient to induce GIIa PLA₂ synthesis and release by cardiomyocytes.

View larger version (25K): [in this window] [in a new window]   Fig. 8.   Effect of infection with adenoviruses encoding MKK6(Glu), MKK6(A), or p38-2 MAPK on cellular GIIa PLA2 protein synthesis and the release of GIIa PLA2 and PLA2 activity by cardiomyocytes. Cardiomyocytes were infected with a control adenovirus (encoding GFP alone) or adenoviruses encoding GFP and MKK6(Glu), MKK6(A), or p38-2 MAPK in medium with 10% serum for 4 h, washed, and incubated for 18 h. Cells were then washed and placed in serum-free medium. Following 72 h in culture, cell lysates (A) and extracellular fluid (B) were analyzed by western blotting for GIIa PLA2. C, PLA2 activity in the extracellular fluid was measured as described under "Experimental Procedures." Repeated measures-ANOVA, p = 1.5 × 109; *, p = 0.006 GFP versus MKK6(Glu); **, p = 0.002 GFP versus MKK6(A). Representative results from two independent experiments done in triplicate are shown.

View larger version (27K): [in this window] [in a new window]   Fig. 9.   Effect of infection with adenoviruses encoding MKK6(Glu), MKK6(A), or p38-2 MAPK on IL-1-induced cellular GIIa PLA2 protein synthesis and the release of GIIa PLA2 and PLA2 activity by cardiomyocytes. Cardiomyocytes were infected with a control adenovirus (encoding GFP alone) or adenoviruses encoding GFP and MKK6(Glu), MKK6(A), or p38-2 MAPK, exactly as described in Fig. 8. Cells were then washed twice in phosphate-buffered saline, resuspended in fresh culture medium, and incubated in the presence (+) or absence () of 10 ng/ml IL-1 for 72 h. Cell lysates (A) and extracellular fluid (B) were analyzed by western blotting for GIIa PLA2. C, PLA2 activity in the extracellular fluid was measured as described under "Experimental Procedures." Repeated measures-ANOVA, p = 3.1 × 108; *, p = 0.001 control versus IL-1; **, p = 0.0004 GFP versus MKK6(A). Representative results from two independent experiments done in triplicate are shown.

IL-1-stimulated GIIa PLA₂ Protein Synthesis and the Release of PLA₂ Activity Are Abrogated by Infection with an Adenovirus Encoding MKK6(A)-- To evaluate the role of p38 MAPK in IL-1-stimulated GIIa PLA₂ expression, cells were infected with a control adenovirus (GFP), or with adenoviruses encoding MKK6(Glu), MKK6(A), or p38-2 MAPK, cultured for 72 h, and then treated with Me₂SO or IL-1 for an additional 72 h. In cells infected with the control adenovirus or with adenoviruses encoding MKK6(Glu) or p38-2 MAPK and then treated with IL-1, cellular GIIa PLA₂ levels, extracellular GIIa PLA₂ release, and extracellular PLA₂ activity were similar (Fig. 9, A-C). In contrast, infection with the adenovirus encoding MKK6(A) abrogated the IL-1-induced increases in cellular GIIa PLA₂ levels, extracellular GIIa PLA₂ release, and extracellular PLA₂ activity. These results provide direct evidence that activation of p38 MAPK by MKK6 was necessary for IL-1-stimulated GIIa PLA₂ expression and release by rat neonatal cardiomyocytes.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

To date, 10 distinct sPLA₂ enzymes have been described in mammalian cells, including GIb, GIIa, GIIc, GIId, GIIe, GIIf, GIII, GV, GX, and GXII PLA₂ (19, 26). Of these enzymes, GIIa, GIId, GIIe, GV, and GXII PLA₂ mRNA have been identified by Northern blot or reverse transcriptase-polymerase chain reaction analysis in murine cardiomyocytes (26, 36, 55). GIIa PLA₂ can supply arachidonic acid to cyclooxygenase-2 for IL-1-induced prostaglandin E₂ biosynthesis (56), and increased levels of IL-1 have been identified in multiple cardiac pathologies (1). Therefore, IL-1-induced GIIa PLA₂ synthesis and release may play a role in the evolution of these myocardial pathologies (57). Whereas GIIa PLA₂ has been the most extensively studied of the PLA₂ enzymes, the factors that regulate the expression of GIIa PLA₂ in cardiac myocytes have not been defined. Therefore, we studied the effect of IL-1 on GIIa PLA₂ expression and release by cardiomyocytes, and we evaluated the role of p38 MAPK and cPLA₂ in this process.

Effect of IL-1 on Cardiomyocyte GIIa PLA₂ mRNA Expression-- Exposure to IL-1 resulted in the sustained expression of cardiomyocyte GIIa PLA₂ mRNA. In contrast, no GIIa PLA₂ mRNA was identified in unstimulated cells. IL-1 may have increased GIIa PLA₂ mRNA levels by increasing mRNA transcription, as reported previously in mesangial cells and rabbit chondrocytes (58, 59). In addition, IL-1 may have also increased GIIa PLA₂ mRNA levels through post-translational mechanisms involving cytoplasmic targets that lead to stabilization of GIIa PLA₂ mRNA, as described for vascular endothelial growth factor (5).

cPLA₂ and iPLA₂ Do Not Regulate GIIa PLA₂ Gene Expression in IL-1-stimulated Rat Neonatal Cardiomyocytes-- cPLA₂, a constitutively expressed enzyme that participates in eicosanoid metabolism (14), has been implicated in the regulation of IL-1-stimulated GIIa PLA₂ gene expression in rat vascular smooth muscle cells (35) and rat fibroblasts (31) by virtue of the ability of AACOCF₃ to inhibit this process (48). Therefore, we explored the role of cPLA₂ in the induction of GIIa PLA₂ expression in IL-1-stimulated cardiomyocytes. Whereas treatment with IL-1 increased cPLA₂ mRNA and protein levels in cardiomyocytes, preincubation with AACOCF₃ had no effect on IL-1-stimulated GIIa PLA₂ mRNA expression or GIIa PLA₂ protein synthesis by these cells. The role of cPLA₂ in GIIa PLA₂ mRNA expression was also explored by treating cells with the MEK-1 inhibitor, PD098059, as MEK-1 has been shown to phosphorylate and activate p42/p44 MAPK, which subsequently phosphorylates and activates cPLA₂ (14, 23). Pretreatment with PD098059, which attenuated IL-1-induced GIIa PLA₂ mRNA expression in rat vascular smooth muscle cells (35), had no effect on GIIa PLA₂ mRNA expression, GIIa PLA₂ protein levels, or the release of GIIa PLA₂ by IL-1-stimulated cells. Therefore, two independent lines of evidence indicated that the MEK1-p42/44 MAPK-cPLA₂ pathway did not regulate GIIa PLA₂ mRNA expression in IL-1-stimulated rat cardiomyocytes. The observation that cPLA₂ regulated IL-1-stimulated GIIa PLA₂ mRNA expression in rat vascular smooth muscle cells and fibroblasts (31, 35), but did not regulate GIIa PLA₂ mRNA expression in IL-1-stimulated cardiomyocytes, indicates that the regulation of GIIa PLA₂ transcription is cell-specific.

iPLA₂ is constitutively expressed by many cell types and has been implicated in phospholipid remodeling (19, 60). iPLA₂ may also function in myocardial signal transduction cascades, as exposure to IL-1 transiently increased membrane-associated iPLA₂ activity (61), iPLA₂ was shown to mediate the selective hydrolysis of plasmalogen phospholipids in hypoxic ventricular myocytes (62), and inhibition of iPLA₂ activity with HELSS attenuated nitrite production, inducible nitric-oxide synthase expression, arachidonic acid release, and prostaglandin E₂ synthesis by IL-1-stimulated cells (61, 63). As cPLA₂ did not appear to participate in the regulation of GIIa PLA₂ expression, we evaluated the possibility that iPLA₂ was involved in this process. Treatment with IL-1 for 72 h had no effect on iPLA₂ protein levels, and treatment with HELSS failed to attenuate the extracellular release of PLA₂ activity in response to IL-1. Isenovic and LaPointe (63) found that exposure to IL-1 for 24 h decreased iPLA₂ protein levels in cardiomyocytes. Taken together, these results do not support a role for cPLA₂ or iPLA₂ in the regulation of GIIa PLA₂ expression by IL-1-stimulated cells.

p38 MAPK Partially Regulates GIIa PLA₂ Gene Expression in Cardiomyocytes-- Four independent lines of evidence supported a role for p38 MAPK in GIIa PLA₂ gene expression by cardiomyocytes. First, IL-1 stimulated an increase in p38 MAPK activity that preceded the increase in GIIa PLA₂ protein synthesis. The duration of p38 MAPK activation observed in this study (15 min, cf. Fig. 6), as judged by the activation of MAPKAP-K2, was transient. Similarly, Clerk et al. (33) showed that treating rat neonatal cardiomyocytes with IL-1 induced an increase in p38 MAPK phosphorylation that was maximal within 5-15 min and had largely declined within 45 min. In contrast, Tanaka et al. (5) showed that treating rat neonatal cardiomyocytes with IL-1 stimulated an increase in p38 MAPK phosphorylation that persisted for 4 h. Whereas the reasons for the apparent differences in the duration of IL-1-stimulated MAPKAP-K2 activation and p38 MAPK phosphorylation in these studies are unknown, these independent experimental approaches both demonstrated that the IL-1-stimulated increase in p38 MAPK activity preceded GIIa PLA₂ protein synthesis by IL-1-treated cardiomyocytes. Second, the IL-1-stimulated increases in MAPKAP-K2 activity, GIIa PLA₂ mRNA expression, and GIIa PLA₂ protein synthesis and release were attenuated by pretreating cardiomyocytes with SB202190, a pyridinyl imidazole that selectively constrains the activity of p38 and p38 MAPK but does not affect p42/44 MAPK or JNK activity (53, 54). Third, infection with an adenovirus encoding the constitutively active form of MKK6, MKK6(Glu), the direct upstream activator of p38 MAPK, was sufficient to induce GIIa PLA₂ protein synthesis and release by cardiomyocytes in the absence of IL-1. The amount of PLA₂ released by cells treated with IL-1 was ~3-fold higher than the amount of PLA₂ released by cells infected with the adenovirus encoding MKK6(Glu). This finding indicated that IL-1 may have activated multiple myocardial signaling cascades, including p38 MAPK, that modulated GIIa PLA₂ expression. Alternatively, exposure to IL-1 may have resulted in more intense p38 MAPK activation than infection with the adenovirus encoding MKK6(Glu). Fourth, infection with the adenovirus encoding the phosphorylation-resistant kinase MKK6(A) abrogated cellular GIIa PLA₂ protein synthesis and extracellular GIIa PLA₂ release by cardiomyocytes that were subsequently stimulated with IL-1. Therefore, MKK6(A) functioned as a dominant negative MKK6 mutant for IL-1-induced GIIa PLA₂ expression by cardiomyocytes. Taken together, these results provide direct evidence for the involvement of p38 MAPK activation in the regulation of GIIa PLA₂ expression by cardiomyocytes.

The mechanisms by which p38 MAPK regulated GIIa PLA₂ gene expression are not known but are likely to have involved modification of the activation state of transcription factors that are known to regulate the activity of the rat GIIa PLA₂ promoter, including nuclear factor B (NF-B) (64, 65), the CAAT-enhancer binding protein (C/EBP) factors and the peroxisome proliferator-activated receptor  (PPAR) (35, 66). NF-B is retained in the cytoplasm by virtue of its association with the inhibitor of B (IB). Transfection of cardiomyocytes with MKK6(Glu) or p38-2 MAPK increased IKK kinase activity and luciferase expression by an NF-B-dependent luciferase reporter plasmid (13). The observations that 1) IKK-mediated phosphorylation of IB led to the ubiquination and degradation of IB (13), 2) MKK6(Glu) activated transcription mediated by NF-B (65), and 3) IL-1 increased the binding of NF-B to a specific site on the rat GIIa PLA₂ promoter (35) are consistent with the notion that IL-1-stimulated p38 MAPK activation resulted in NF-B translocation to the nucleus and activation of the GIIa PLA₂ promoter in rat cardiomyocytes.

The C/EBP family is composed of four activating members, including C/EBP, C/EBP, C/EBP, and C/EBP, and a putative inhibitory member, C/EBP (CHOP) (67). The C/EBP and C/EBP genes are induced in inflammatory reactions, participate in the acute phase response (68, 69), and are absolutely required for IL-1-induced transcription of the GIIa PLA₂ gene in rabbit chondrocytes (70). Whereas C/EBP and C/EBP mediated the induction of GIIa PLA₂ transcription by cAMP-elevating agents in rat vascular smooth muscle cells, C/EBP factors did not appear to mediate the stimulation of the rat GIIa PLA₂ promoter by IL-1 (71).

PPAR, PPAR, and PPAR are members of the nuclear receptor superfamily of transcription factors that bind to DNA as heterodimers with retinoid X receptor and participate in the regulation of genes that are involved in lipid metabolism (66). Treatment with PPAR ligands, including 15-deoxy-^12,14-dehydroprostaglandin-J₂ carbaprostacyclin and 9-hydroxyoctadecanoic acid, induced GIIa PLA₂ gene expression in vascular smooth muscle cells, and IL-1 and the PPAR ligands both stimulated the activity of a reporter gene that contained a PPAR-binding site in its promoter (35). Furthermore, inhibitors of NF-B and PPAR binding to their promoter both blocked IL-1-induced GIIa PLA₂ gene activation (35). These result indicated that PPAR was necessary for the regulation of GIIa PLA₂ gene transcription by NF-B in response to IL-1 (66). Our demonstration that cPLA₂ and iPLA₂ did not participate in IL-1-stimulated GIIa PLA₂ gene expression indicates that a PLA₂ distinct from these enzymes, or another metabolic pathway (72), may supply arachidonic acid or its metabolites to PPARs in cardiomyocytes. The roles of NF-B, C/EBP factors, and the PPAR pathway in IL-1-stimulated GIIa PLA₂ gene expression in rat neonatal cardiomyocytes are currently being explored.

Multiple sPLA₂ Enzymes May Be Released by IL-1-stimulated Cardiomyocytes-- Pretreatment with SB202190 abrogated the release of GIIa PLA₂ from IL-1-stimulated cardiomyocytes but only decreased extracellular PLA₂ activity by 67%. In contrast, treatment with LY311-727 decreased extracellular PLA₂ activity by >98%, thereby demonstrating that this extracellular PLA₂ activity was attributable to a secretory PLA₂ (73). As LY311-727 constrains the activity of multiple sPLA₂ enzymes, including GIIa, GV, and GX PLA₂ (44, 73, 74), these results indicate that a secretory PLA₂ distinct from GIIa PLA₂ may have also been released by IL-1-stimulated cardiomyocytes. As mRNA coding for multiple sPLA₂ enzymes have been identified in cardiomyocytes (26, 36, 55), it is possible that one or more of these enzymes, in addition to GIIa PLA₂, was synthesized and released by IL-1-stimulated cells. In addition, it is also possible that cardiomyocytes release enzymes with phospholipase A₁ and lysophospholipase activity in response to IL-1.

In summary, we have documented the expression of GIIa PLA₂ by IL-1-stimulated rat neonatal cardiomyocytes. The expression of GIIa PLA₂ in IL-1-stimulated cardiomyocytes was found to be partially regulated by the MKK6-p38 MAPK signaling pathway and did not require activation of the MEK1-p42/44 MAPK-cPLA₂ signaling cascade. The induction of GIIa PLA₂ synthesis and release by p38 MAPK indicates that GIIa PLA₂ may play a role in the pathophysiology of myocardial hypertrophy, apoptosis, and ischemia-reperfusion injury, as these processes are all associated with p38 MAPK activation (9, 46, 75).

	ACKNOWLEDGEMENT

We thank Dr. Jonathan Arm, Harvard University, for the careful review of this manuscript.

	FOOTNOTES

^* This work was supported in part by Heart and Stroke Foundation of Canada Grant NA-4151 (to B. B. R.), the Research Fund of Turku University Hospital (to T. J. N.), and National Institutes of Health Grants HL 42665 (to D. A. F.), HL-25037, HL-63975 (to C. C. G.), and DK38185 (to J. T.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Recipient of the Wylie Scholar Award in Academic Vascular Surgery from the Pacific Vascular Research Foundation, San Francisco, CA and a Fellowship from the Bickel Foundation, Toronto, Ontario, Canada. To whom correspondence should be addressed: Division of Vascular Surgery, 200 Elizabeth St., EC5-302a, Toronto General Hospital, Toronto, Ontario M5G-2C4, Canada. Tel.: 416-340-3645; Fax: 416-340-5029; E-mail: barry.rubin@uhn.on.ca.

Published, JBC Papers in Press, September 24, 2001, DOI 10.1074/jbc.M101516200

² N. Degousee and B. Rubin, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: IL-1, interleukin-1; PLA₂, phospholipase A₂; sPLA₂, secretory phospholipase A₂; cPLA₂, Ca²⁺-dependent cytosolic phospholipase A₂; iPLA₂, Ca²⁺-independent cytosolic phospholipase A₂; MAPK, mitogen-activated protein kinase; MKK6, MAPK kinase 6, ERK, extracellular signal-regulated kinase; JNK, N-terminal c-Jun kinase; AACOCF₃, arachidonyltrifluoromethyl ketone; HELSS, (E)-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one; FBS, fetal bovine serum; ANOVA, analysis of variance; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HA, hemagglutinin; PAGE, polyacrylamide gel electrophoresis; PPAR, peroxisome proliferator-activated receptor; C/EBP, CAAT enhancer-binding protein; GFP, green fluorescent protein.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. P. Levick, D. C. Loch, S. M. Taylor, and J. S. Janicki Arachidonic Acid Metabolism as a Potential Mediator of Cardiac Fibrosis Associated with Inflammation J. Immunol., January 15, 2007; 178(2): 641 - 646. [Abstract] [Full Text] [PDF]

				N. Degousee, D. Angoulvant, S. Fazel, E. Stefanski, S. Saha, K. Iliescu, T. F. Lindsay, J. E. Fish, P. A. Marsden, R.-K. Li, et al. c-Jun N-terminal Kinase-mediated Stabilization of Microsomal Prostaglandin E2 Synthase-1 mRNA Regulates Delayed Microsomal Prostaglandin E2 Synthase-1 Expression and Prostaglandin E2 Biosynthesis by Cardiomyocytes J. Biol. Chem., June 16, 2006; 281(24): 16443 - 16452. [Abstract] [Full Text] [PDF]

				S. Levick, D. Loch, B. Rolfe, R. C. Reid, D. P. Fairlie, S. M. Taylor, and L. Brown Antifibrotic Activity of an Inhibitor of Group IIA Secretory Phospholipase A2 in Young Spontaneously Hypertensive Rats. J. Immunol., June 1, 2006; 176(11): 7000 - 7007. [Abstract] [Full Text] [PDF]

				C. S. Beckett, K. Pennington, and J. McHowat Activation of MAPKs in thrombin-stimulated ventricular myocytes is dependent on Ca2+-independent PLA2 Am J Physiol Cell Physiol, May 1, 2006; 290(5): C1350 - C1354. [Abstract] [Full Text] [PDF]

				X. Wang, M. A. Khaleque, M. J. Zhao, R. Zhong, M. Gaestel, and S. K. Calderwood Phosphorylation of HSF1 by MAPK-Activated Protein Kinase 2 on Serine 121, Inhibits Transcriptional Activity and Promotes HSP90 Binding J. Biol. Chem., January 13, 2006; 281(2): 782 - 791. [Abstract] [Full Text] [PDF]

				N. Degousee, J. Martindale, E. Stefanski, M. Cieslak, T. F. Lindsay, J. E. Fish, P. A. Marsden, D. J. Thuerauf, C. C. Glembotski, and B. B. Rubin MAP Kinase Kinase 6-p38 MAP Kinase Signaling Cascade Regulates Cyclooxygenase-2 Expression in Cardiac Myocytes In Vitro and In Vivo Circ. Res., April 18, 2003; 92(7): 757 - 764. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/47/43842    most recent M101516200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Degousee, N. Articles by Rubin, B. B. Search for Related Content PubMed PubMed Citation Articles by Degousee, N. Articles by Rubin, B. B. Social Bookmarking                      What's this?