HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 47, 43924-43931, November 23, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/47/43924    most recent M105999200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Steen, I. H. Articles by Birkeland, N.-K. Search for Related Content PubMed PubMed Citation Articles by Steen, I. H. Articles by Birkeland, N.-K. Social Bookmarking                      What's this?

Comparison of Isocitrate Dehydrogenase from Three Hyperthermophiles Reveals Differences in Thermostability, Cofactor Specificity, Oligomeric State, and Phylogenetic Affiliation^*

Ida Helene Steen, Dominique Madern^§, Mikael Karlström^¶, Torleiv Lien, Rudolf Ladenstein^¶, and Nils-Kåre Birkeland

From the  Department of Microbiology, University of Bergen, P. O. Box 7800, Jahnebakken 5, N-5020 Bergen, Norway, ^§ Laboratoire de Biophysique Moléculaire, Institut de Biologie Structurale, Unité Mixte de Recherche 5075, Commissariat à l'Energie Atomique-CNRS-UJF, 41 rue Jules Horowitz, 38027 Grenoble Cedex 1, France, and ^¶ Karolinska Institutet, Novum, Center for Structural Biochemistry, S-14157 Huddinge, Sweden

Received for publication, June 28, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

With the aim of gaining insight into the molecular and phylogenetic relationships of isocitrate dehydrogenase (IDH) from hyperthermophiles, we carried out a comparative study of putative IDHs identified in the genomes of the eubacterium Thermotoga maritima and the archaea Aeropyrum pernix and Pyrococcus furiosus. An optimum for activity at 90 °C or above was found for each IDH. PfIDH and ApIDH were the most thermostable with a melting temperature of 103.7 and 109.9 °C, respectively, compared with 98.3 and 98.5 °C for TmIDH and AfIDH, respectively. Analytical ultracentrifugation revealed a tetrameric oligomeric state for TmIDH and a homodimeric state for ApIDH and PfIDH. TmIDH and ApIDH were NADP-dependent (K_m(NADP) of 55.2 and 44.4 µM, respectively) whereas PfIDH was NAD-dependent (K_m(NAD) of 68.3 µM). These data document that TmIDH represents a novel tetrameric NADP-dependent form of IDH and that PfIDH is a homodimeric NAD-dependent IDH not previously found among the archaea. The homodimeric NADP-IDH present in A. pernix is the most common form of IDH known so far. The evolutionary relationships of ApIDH, PfIDH, and TmIDH with all of the available amino acid sequences of di- and multimeric IDHs are described and discussed.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isocitrate dehydrogenases (IDHs)¹ are a broadly distributed and well characterized group of enzymes that catalyze the oxidative decarboxylation of D-isocitrate to 2-oxoglutarate and CO₂ with NAD⁺ (EC 1.1.1.41) or NADP⁺ (EC 1.1.1.42) as cofactor. IDH from Escherichia coli has been studied extensively with regard to its catalytic mechanism, kinetics, and regulation, and so far the three-dimensional structure is available only for IDH from E. coli and Bacillus subtilis (1-11). Resolution of the structure of NAD-dependent homodimeric isopropylmalate dehydrogenase (IMDH) from Thermus thermophilus revealed that this enzyme, together with EcIDH, represents a unique class of metal-dependent decarboxylating dehydrogenases that lack the motif characteristic of the nucleotide-binding Rossman fold (12, 13). IDH and IMDH are specific for structurally similar substrates of the form HOOC(OH)CHCH(X), in which X represents CH₂COOH for IDH and CH(CH₃)₂ for IMDH (14, 15). However, EcIDH and T. thermophilus IMDH exhibit strong preference for their natural substrate, and the structural determinants for substrate and cofactor specificity have been identified (16-20) Recently, tartrate dehydrogenase (TDH) and homoisocitrate dehydrogenase (HDH) have been suggested as members of the metal-dependent decarboxylating dehydrogenases (21-23).

The IDHs comprise a diverse enzyme family with regard to cofactor specificity, primary structure, and oligomeric state. The archaea Archaeoglobus fulgidus, Caldococcus noboribetus, Haloferax volcanii, Sulfolobus solfataricus, and Sulfolobus acidocaldarius contain a single homodimeric IDH that is NADP-dependent or shows dual coenzyme specificity (24-27). A homodimeric NAD-IDH is present in Methylophilus methylotrophus (28). However, most bacteria contain a single homodimeric NADP-IDH, although a monomeric IDH has been identified in a few bacteria (29-38). The psychrophilic bacterium Vibrio strain ABE-1 possesses both a homodimeric and a monomeric NADP-IDH (39, 40). Eukaryotes, for example Saccharomyces cerevisiae and pig, have three different isoenzymes comprising homodimeric NADP-IDH localized in both the mitochondrion and cytosol, and hetero-oligomeric NAD-IDHs, localized in the mitochondria (29, 41). IDHs from each of the three domains of life have been cloned and sequenced, and dimeric and multimeric IDHs have been divided into three phylogenetic subfamilies (24, 42). Subfamily I includes archaeal and bacterial IDHs with preference for NADP; subfamily II contains eukaryotic NADP-IDHs and one bacterial (Sphingomonas yanoikuyae); and subfamily III comprises hetero-oligomeric NAD-IDHs and NADP-IDH from T. thermophilus (24). However, when this phylogenetic analysis was done, only the two archaeal primary sequences of IDH from A. fulgidus and C. noboribetus were available (24, 43). Recently, genomics has provided a large "pool" of putative idh genes from organisms from the three domains of life, which should allow us to reevaluate and refine our knowledge of the biochemistry and phylogeny of IDH. By characterizing putative IDH from the hyperthermophiles Aeropyrum pernix, Pyrococcus furiosus, and Thermotoga maritima with regard to thermostability, cofactor specificity, and oligomeric state, we have identified a novel tetrameric NADP-IDH in T. maritima and a homodimeric NAD-IDH in P. furiosus not previously observed in archaea. Each IDH is documented as thermostable and thermoactive. A phylogenetic analysis of all available di- and multimeric IDHs, TDHs, IMDHs, and HDHs was performed. By combining all these data, we were able to describe the subfamily I of IDHs as a procaryotic group in which the NAD and NADP usage is widespread within archaeal and bacterial enzymes. All archaeal IDHs are closely related to E. coli-like bacterial IDH. Furthermore, a more accurate description of the subfamily II confirmed that eukaryotic as well as bacterial IDHs belong to this NADP-group of enzymes.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning, Expression, and Purification-- The AfIDH has previously been expressed from a lac promoter in a pUC19-based plasmid (44). To generate a more efficient expression system, the fragment carrying the A. fulgidus idh gene was transferred to pET-11a by ligating it between the NdeI and BamHI restriction sites. The putative idh gene (BAA79665) from A. pernix was amplified from genomic DNA by polymerase chain reaction using: the primers 5'-GGGAATTCCATATGCAGGTTATGGCTTCCCCTCCTTGC-3' and 5'-GCGGGATCCCTAGCCCCTCTTCCCGGCGAGGAC-3' at 1 µM; dATP, dTTP, dCTP, and dGTP at 0.2 mM; 1× Vent polymerase buffer; and 2 units of Vent polymerase (New England Biolabs). The NdeI and BamHI restriction sites are underlined. The polymerase chain reaction product was purified using the Stratagene PCR Purification Kit, digested with NdeI and BamHI, and ligated into NdeI-BamHI-digested pET-11a plasmid vector. The putative idh gene from P. furiosus² was amplified with Platinum Taq polymerase High Fidelity (Life Technologies, Inc.) using the primers 5'-ATGAGCATTAGACTTCCACAAGAAG-3' and 5'-ATCCTTCTCTTCTAAATACATCTACTTATTCC-3' and was initially cloned into the pBAD TOPO TA vector as described in the instruction manual for the Invitrogen pBAD TOPO TA Cloning Kit. To transfer the fragment to pET-11a, a NdeI restriction site in the idh gene was disrupted by introduction of a silent mutation using the QuickChange^TM Site-Directed Mutagenesis Kit (Stratagene). The primers 5'-CAAATACTATGGAGTCCCAACTGTCTATCCGTATGCCGACAAAGTGGAC-3' and 5'-GTCCACTTTGTCGGCATACGGATAGACAGTTGGGACTCCATAGTATTTG-3' were used to introduce the mutation. The mutation site is underlined. Amplification of the mutated gene using the primers 5'-GGGAATTCCATATGAGCATTAGACTTCCACAAGAAGGA-3' and 5'-GCGGGATCCTTATTCCCCCTCAATTTCTTTTATG-3' and transfer into pET-11a were performed as described for the A. pernix. The putative idh gene, TM1148, from T. maritima was amplified and cloned into pET-11a as described for A. pernix using the primers 5'GGGAATTCCATATGGAGAAAGTCAAAGTCAAAAATCC3' and 5'GCGGGATCCCTACAGTAATTTTTCGAGATTC-TTCTTCACT3'.

E. coli strain BL21-CodonPlus(DE3)-RIL cells were transformed with the different pET-11a-IDH constructs and grown in LB broth containing ampicillin (100 µg/ml) and chloramphenicol (34 µg/ml) at 37 °C to A_600 nm = 0.7-0.8 cell density. Isopropyl--thiogalactopyranoside was added to 1.0 mM concentration to induce expression, and the incubation was continued for 3-4 h at 37 °C. Cells were harvested by centrifugation (5000 × g, 15 min) and frozen at 20 °C until used. Cells carrying pET-11a constructs of A. fulgidus, A. pernix, and P. furiosus idh, respectively, were resuspended in 20 mM sodium phosphate buffer, pH 7.0, containing 1 mM EDTA and disrupted using a French pressure cell at 55 megapascals. After removal of cell debris by centrifugation (13 000 × g, 30 min), the cell extracts were subjected to heat precipitation of host protein (80 °C, 30 min). Precipitated protein was removed by centrifugation (15000 × g, 30 min) and the heat-treated extracts were applied to a Red-Sepharose column (Millipore) equilibrated with 20 mM sodium phosphate buffer, pH 7.0, containing 1 mM EDTA. The column was washed with the sodium phosphate buffer until A₂₈₀ was zero, and protein was eluted with a NaCl gradient (0-2 M). Following elution and subsequent analysis by SDS-polyacrylamide gel electrophoresis to verify homogeneity, the fractions containing IDH activity were pooled, and NaCl was removed by filtration through a PM30 Diaflo ultrafilter using an Amicon ultrafiltration cell. Purification of TmIDH was carried out as for the other IDHs except that EDTA was substituted with 10 mM MgCl₂ in the 20 mM sodium phosphate buffer, pH 7.0, and elution from the Red-Sepharose column was performed with a NaCl gradient (0-1 M) in sodium phosphate buffer, pH 8.0. The purified IDHs were stored in 50 mM potassium phosphate, pH 7.5, containing 0.1 M NaCl.

Sedimentation Velocity-- Experiments were performed on a Beckman XLA analytical Ultracentrifuge equipped with a UV scanning system, using a 4-hole AN-60 Ti rotor with double centerpieces of 1.20-cm path length. In a typical experiment, 200 absorbance profiles for each sample were recorded at 42,000 rpm. The wavelengths were chosen according to the characteristics of the samples. The scan profiles were analyzed from eight scans recorded in the range of 130 to 175 min with TmIDH, 106 to 133 min with PfIDH, and 151 to 195 min with ApIDH using the time derivative software dcdt⁺ (45). The derivative profiles were used to calculate the experimental sedimentation coefficient, s_exp. The data were also analyzed using the Svedberg program (46). We used the program Sednterp (developed by D. B. Haynes, T. Laue, and J. Philo, found on the world wide Web at bbri.org/RASMB/rasmb.html) to calculate partial specific volume, ₂, solvent densities, , and viscosities, . The partial specific volumes values were ₂ = 0.7476 for TmIDH, 0.754 for PfIDH, and 0.7421 for ApIDH. The corrected coefficients, s_20,w, were calculated using the following equation:

(Eq. 1)

Differential Scanning Microcalorimetry-- Differential scanning calorimetry was carried out with a MicroCal calorimeter. The samples were dialyzed against the reference buffer used in the experiment (50 mM potassium phosphate buffer, pH 7.5, 0.1 M NaCl) and degassed for 10 min prior to the calorimetric analysis. A protein concentration of 1.2 mg/ml was used for the IDHs from A. pernix, P. furiosus, and A. fulgidus. The IDH from T. maritima was analyzed with a concentration of 2.5 mg/ml. The calorimetric scans were carried out between 20 and 120 °C with a scan rate of 60 °C/h. Each sample was scanned a second time after the actual calorimetric scan to estimate the reversibility of the unfolding transition.

Enzyme Assay and Determination of Kinetic Constants-- The enzyme reaction was measured photometrically (Cary 4E UV-vis spectrophotometer, Varian, Australia) at 70 °C by monitoring the formation of NAD(P)H at 340 nm (340 nm = 6.22 mM¹ cm¹). The standard reaction mixture of 1 ml contained 50 mM Tricine-KOH, pH 8.0, at assay temperature, 1 mM isocitrate, and 10 mM MgCl₂. Cofactor was added at a concentration of 1 mM NADP⁺, 0.5 mM NADP⁺, and 1 mM NAD⁺ for TmIDH, ApIDH, and PfIDH, respectively. For determination of K_m and V_max values, the isocitrate concentration was kept fixed at 1 mM while varying the cofactor concentration, and the data were analyzed by the direct linear plot of Eisenthal and Cornish-Bowden (47) using the Enzpack 3 software package (Biosoft, Cambridge, UK). Protein concentrations were measured by the method of Bradford (48).

Sequence Alignments and Construction of a Phylogenetic Tree-- Pairwise sequence comparisons were done with Bestfit as implemented in the University of Wisconsin Package, version 10 (Genetics Computer Group). For multiple sequence comparisons an initial alignment of EcIDH, ApIDH, AfIDH, PfIDH, TmIDH, and porcine IDH was constructed using ClustalW (Ref. 49; Genetics Computer Group) and then edited using GeneDoc³ according to the knowledge of the x-ray crystallographic structure of EcIDH and the alignments of eukaryotic IDHs to EcIDH presented recently (51, 52).

For construction of an alignment containing all of the other known IDH, TDH, and HDH sequences, as well as representatives of IMDH, the profile alignment option of ClustalW was used to add all of the additional sequences automatically to the alignment described above. A distance analysis using the weight option in the program Protdist (Phylip, version 3.573c) with a PAM250 substitution matrix was performed. Positions with one or more gaps in the alignment were excluded. A total of 208 amino acid positions was used. The phylogenetic tree was constructed using the neighbor-joining algorithm and displayed by the Drawtree program (Genetics Computer Group). A bootstrap analysis was performed with 100 replicates using the Seqboot program (Genetics Computer Group). The alignment is available from the authors on request. Accession numbers of the sequences used in the phylogenetic analysis are listed in Table I.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Expression and Biochemical Characterization-- The putative TmIDH, ApIDH, and PfIDH could be expressed in E. coli as active enzymes as found previously for AfIDH (44). When expressed from the T7 promoter, AfIDH was produced in 7-10 times higher amounts than when expressed from the lac promoter. Each IDH could be purified in two steps to yield more that 15 mg of pure protein/liter of culture (data not shown). TmIDH showed high preference for NADP⁺, although NAD⁺ could replace NADP⁺ at high concentrations as previously observed for AfIDH and EcIDH (Table II) (16, 24). In contrast, ApIDH was highly specific for NADP⁺ (Table II). The K_m of NADP⁺ for ApIDH and TmIDH is in the same range as reported for other bacterial and archaeal IDHs (24, 26, 29). PfIDH showed a preference for NAD⁺ and is the first archaeal IDH found to be NAD-dependent. NAD dependence is also unusual among the bacteria, with IDH from M. methylotrophus and Aquifex aeolicus being some of the exceptions (22, 28). Hence, with regard to coenzyme specificity, PfIDH is more similar to eukaryotic NAD-IDHs and NAD-dependent IMDHs than to archaeal and bacterial IDHs. The K_m for NAD⁺ of 68.3 µM (Table II) is slightly higher than those determined for M. methylotrophus (50 µM) and A. aeolicus (27.1 µM) but lower than that observed for S. cerevisiae (210 µM) (22, 28, 52, 54).

Each of the IDHs showed an optimal temperature for catalytic activity at 90 °C or above (Table II) and is similar to what has been found previously for A. fulgidus IDH (24).

Oligomeric State-- Most procaryotic IDHs have been found to be dimeric (29). Using size exclusion chromatography with a calibrated column, the PfIDH and ApIDH elution profiles were in agreement with this oligomeric state. Strikingly, the TmIDH elution profile showed two peaks, suggesting a slow equilibrium between various oligomeric states. Analytical ultracentrifugation with a set of sedimentation velocities was used to examine the respective oligomeric state of the IDHs. Two hundred boundary profiles were recorded at three different concentrations of each IDH, and the data were analyzed by the time derivative (45) and the Svedberg (46) methods.

The g(s*) profiles calculated from the first method are shown in Fig. 1. For each of the enzymes only the data recorded at a single protein concentration (~1 mg/ml) are shown. In the cases of PfIDH and ApIDH, the symmetrical peaks observed are in agreement with a single species. When the data were recorded at lower protein concentration, the peaks were always centered at the same position, indicating that PfIDH and ApIDH did not dissociate. The data were fitted with a main species and a small heterogeneity corresponding to less than 5% of the signal. With PfIDH and ApIDH, the calculated molecular mass was 70 and 77 kDa, respectively. These values are lower but similar to the values of 88 and 96 kDa expected for dimeric species (Table II). The difference is probably due to a small sample heterogeneity. Using dcdt⁺, the calculated s_20,w values in 0.1 M KCl, 50 mM Tris, pH 8, was s_20,w = 4.9 S for PfIDH and 5.4 S for ApIDH. The values were identical when calculated with the other method.

View larger version (114K): [in this window] [in a new window]   Fig. 1.   Sedimentation velocity analysis of the P. furiosus, A. pernix, and T. maritima IDHs. The top part of the figure represents the g(s*) distribution calculated for P. furiosus (panel A), A. pernix (panel B), and T. maritima (panel C). The data were fitted by a single- or two-species models using two different programs. The calculated sedimentation coefficients and molecular sizes are indicated below each panel.

In contrast to the other IDHs, the g(s*) profiles calculated for TmIDH (Panel C) showed two peaks. The data were well fitted with two oligomeric states that are in equilibrium. It is out of the scope of this study to mention how the protein concentration, salt, temperature, and pH modify this equilibrium. The calculated molecular mass was 68-200 and 85-174 kDa and in very good agreement with the expected values of 90 and 190 kDa for dimeric and tetrameric TmIDH species, respectively (Table II). The calculated s_20,w values in 0.1 M KCl, 50 mM Tris, pH 8, were s_20,w = 5.4 or 5.1 S for the dimeric TmIDH and s_20,w = 7.9 or 7.8 S for tetrameric TmIDH. Under the condition analyzed, the tetrameric TmIDH represented 68% of the sample.

Thermostability-- When analyzed by differential scanning calorimetry in 50 mM potassium phosphate buffer, pH 7.5, containing 0.1 M NaCl, the thermal unfolding of Af-, Ap-, and PfIDH was found to be an irreversible process. A reversibility of about 25-30% was found for TmIDH under the experimental conditions used. Hence, only an apparent midpoint melting temperature could be determined for the different IDHs. Not surprisingly, ApIDH and PfIDH showed the highest thermostability levels, with a melting temperature (T_m) of more than 100 °C (Fig. 2, Table I). TmIDH and AfIDH were less thermostable, with a T_m of about 98 °C (Table II).

View larger version (16K): [in this window] [in a new window]   Fig. 2.   Calorimetric melting curves of the isocitrate dehydrogenases from T. maritima (- - -), A. fulgidus (), P. furiosus (), and A. pernix ().

Phylogeny and Sequence Comparisons-- IDHs have previously been divided into three distinct phylogenetic subfamilies (24, 42) where IDH from A. fulgidus and C. noboribetus together with most of those from eubacteria comprise subfamily I, sharing at least 48% pairwise amino acid sequence identity. ApIDH and PfIDH also belong to this subfamily, sharing 48 and 50.6% identity, respectively, with the EcIDH (Fig. 3). However, TmIDH shares only 27.7% identity with EcIDH but is, in contrast, very similar to the isocitrate dehydrogenases from subfamily II, sharing 55.5% identity with NADP-IDH from S. cerevisiae. TmIDH clearly groups within subfamily II, representing the deepest branch in this subfamily. TmIDH is the first hyperthermophilic IDH in this subfamily, but inclusion of other putative IDHs from genomic sequences showed that several other bacterial IDHs, in addition to IDH from S. yanoikuyae, belong to subfamily II, constituting a separate bacterial branch (Fig. 3). TmIDH is separated from the other members of subfamily II with a high confidence value and might even represent the first member of a possible additional IDH subfamily. Inclusion of the other classes of -decarboxylating dehydrogenases, which are closely related to IDH, revealed that IMDH, TDH, and HDH form a separate clade, most closely related to IDH subfamily III. The branching pattern of IDHs from the bacteria T. thermophilus and Rickettsia prowazekii is somewhat unclear, but they show strongest affiliation with subfamily III. Interestingly, these two IDHs share a conserved C-terminal extension of about 40 amino acids not found in any of the other enzymes. The function of this extension is unknown.

View larger version (17K): [in this window] [in a new window]   Fig. 3.   Unrooted phylogenetic tree of metal-dependent decarboxylating dehydrogenases from prokaryotic and eukaryotic organisms (see Table I for a complete list of organisms included in the analysis and for sequence accession numbers). Bootstrap values obtained for 100 iterations are indicated for the major branch nodes. A, B, and E indicates Archaea, Bacteria, and Eucarya, respectively. The dashed-line ellipses indicate the eubacterial lineage in subfamily II(B) and the IMDH/HDH/TDH lineages.

As found previously for AfIDH, all amino acid residues involved in binding of isocitrate in EcIDH are conserved in Ap- and Pf IDH (Fig. 4). In the NADP-dependent EcIDH, cofactor specificity is conferred by interactions between NADP and Arg³⁹⁵, Lys³⁴⁴, Tyr³⁴⁵, Tyr³⁹¹, and Arg²⁹² (4, 42). Except for the substitution of Tyr³⁹¹ with Gln in ApIDH, these are all conserved in the archaeal NADP-dependent IDHs and are in accordance with the cofactor specificity (Fig. 4, Table II). In NAD-dependent IMDH from T. thermophilus, NAD specificity is conferred by Asp²⁷⁸, corresponding to E. coli Lys³⁴⁴, which forms a double H-bond with the 2'- and 3'-hydroxyls of the adenosine ribose of NAD (17). The preference toward NAD is also probably further enhanced by Asp²⁷⁸, repelling the negatively charged 2'-phosphate of NADP (17). Ile²⁷⁹ of T. thermophilus IMDH, corresponding to EcIDH Tyr³⁴⁵, is also rigidly conserved among NAD-dependent IDHs and IMDHs (17). In PfIDH the amino acid residues corresponding to Lys³⁴⁴ and Tyr³⁴⁵ in EcIDH are substituted with Asp and Ile, respectively (Fig. 4), confirming the role of these residues in the determination of cofactor specificity. In eukaryotic NADP-IDH, Lys³⁴⁴ and Tyr³⁴⁵ are replaced by Arg and His, respectively, and have been suggested to be involved in cofactor discrimination (22). The NADP preference determined for TmIDH agrees with the conservation of these residues (Fig. 4, Table II). Although eukaryotic and bacterial NADP-IDHs show low sequence similarity, sequence alignments have revealed a conservation of residues involved in the metal-isocitrate interaction in EcIDH (42, 52, 55), which is also true for TmIDH (Fig. 4). However, residues involved in the substrate binding site in porcine IDH have recently been evaluated by site-directed mutagenesis (51, 52). In the alignments presented by these authors, residues Arg¹¹², Ser¹¹³, and Asn¹¹⁵ of EcIDH are aligned to porcine Arg¹⁰¹, Asn¹¹¹, and Gly¹⁰⁶, respectively, as presented in Fig. 4, and not to Lys⁹⁴, Ser⁹⁵ and Asn⁹⁷ as suggested by other authors (22, 42, 51). Furthermore, residues corresponding to Arg¹²⁹ and Asp²⁸³ in EcIDH enzyme are not conserved in porcine IDH. Hence, EcIDH Ser¹¹³, Asn¹¹⁵, Arg¹²⁹, and Asp²⁸³ are not conserved in porcine IDH, and apparently neither are they in TmIDH (Fig. 4). Arg¹⁰¹ in porcine IDH, which has been suggested to be involved in catalysis, is conserved in TmIDH (Fig. 4) (51). Porcine Asp²⁷³ has been suggested to contribute to metal binding, whereas Asp²⁷⁹ as well as Asp²⁷⁵, corresponding to Asp³¹¹ and Asp³⁰⁷ in EcIDH, are critical for catalysis (Fig. 4) (52). The substitution of porcine Asp²⁷³ with a Glu in TmIDH may not be crucial because both amino acids are acidic (Fig. 4). However, structural data are needed to evaluate how conserved the EcIDH substrate-binding site is in eukaryotic and TmIDH.

View larger version (60K): [in this window] [in a new window]   Fig. 4.   Sequence alignment of IDH from A. pernix, P. furiosus, T. maritima, and porcine mitochondrial NADP-IDH with NADP-IDH from E. coli. Identical and similar residues are boxed. Residues involved in catalysis and binding of isocitrate in IDH from E. coli are shaded in green, and residues forming the NADP-binding pocket are underlined. Residues shaded in blue are involved in cofactor discrimination in bacterial and archaeal NADP-IDH, and residues shaded in yellow and pink (361) represent amino acid residues strictly conserved in NAD-IDHs and NAD-IMDHs, and eucaryotic NADP-IDHs, respectively. Red-shaded residues are known to be involved in isocitrate binding in porcine IDH. Deletions in loop regions, as compared with the structure of EcIDH, are indicated by gray shading.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Data are presented documenting that A. pernix has a homodimeric NADP-IDH, P. furiosus, a homodimeric NAD-IDH, and T. maritima a NADP-IDH, which under some conditions can exist as a homotetramer. Eukaryotic NAD-IDHs have a hetero-oligomeric structure (22, 29, 56, 57), whereas a homodimeric NAD-IDH has been found in the bacterium M. methylotrophus (28). Furthermore, IDH from A. aeolicus is NAD-dependent, and IDH from Streptococcus sp., Streptococcus salivarius, and R. prowazeki have been functionally assigned as NAD-dependent, but the oligomeric state of these IDHs is unknown (22, 28). The homodimeric NAD-IDH from P. furiosus (Table II) represents the first archaeal NAD-IDH known so far, and NAD-IDHs are thus present in each of the three domains of life. The most common form of IDH is the homodimeric NADP-IDH previously identified in organisms from the three domains of life (24, 26, 29, 41, 43). A homotetrameric IDH has not been observed before, and apparently, the homotetrameric NADP-IDH from T. maritima represents a new oligomeric state of NADP-IDH. TmIDH has a monomer size of 45.4 kDa (Table II), which corresponds to that of bacterial and eukaryotic homodimeric NADP-IDH (29, 41). In conclusion, IDHs should be considered as a family of enzymes that includes five different forms of IDH as follows: hetero-oligomeric NAD-IDHs, homodimeric NAD-IDHs, monomeric NADP-IDHs, homodimeric NADP-IDHs, and homotetrameric IDHs.

To refine the evolutionary relationships between different IDHs and to establish the phylogenetic relations of ApIDH, PfIDH, and TmIDH with different IDHs reported to date, a comparative study of dimeric and hetero-oligomeric IDHs was performed. Monomeric IDHs were excluded from the study due to lack of significant overall sequence homology with the other forms of IDH, although three short regions of homology have been identified in the monomeric IDH from Corynebacterium glutamicum (58). The phylogenetic tree presented in Fig. 3 shows that IDHs diverge in three subfamilies as observed previously (24). Inclusion of HDHs, TDHs, and IMDHs in the phylogenetic analysis indicates that these enzymes forms a fourth subfamily of -decarboxylating dehydrogenases.

Despite being NAD-dependent, PfIDH is more closely related to E. coli-like IDHs than are other NAD-IDHs and NAD-IMDH. This finding is in accordance with sequence identities of 39.7 and 39.4% with NAD-IMDH from T. thermophilus and IDH2 from S. cerevisiae, respectively, and 50.6% with EcIDH. All archaeal IDHs characterized so far are thus present in subfamily I, confirming the previously observed close relationship of archaeal IDHs and bacterial E. coli-like IDHs (24, 43). This result is further confirmed by the presence of putative IDH from Halobacterium NRC-1, Thermoplasma acidophilum, Thermoplasma volcanium, S. solfataricus, and Pyrobaculum aerophilum in subfamily I (Fig. 3). It should be noted that IDH has not been identified in Pyrococcus abyssi or Pyrococcus horikoshii and that the open reading frames annotated originally as IDH in the genomes of Methanobacterium thermoautotrophicum (GenBank^TM accession no. AAB84690) and Methanococcus jannaschii (The Institute for Genomic Research locus names MJ1596 and MJ0720) are now functionally assigned or verified as HDH or IMDH (22, 23). However, as opposed to previous notifications, subfamily I comprises IDHs showing preference for NAD in addition to NADP-IDHs (Fig. 3). Hence, it can be concluded that subfamily I includes a homogenous subfamily of prokaryotic IDHs that use either NAD or NADP as cofactor and that the IDHs for which the oligomeric states are known are all homodimeric.

The putative TmIDH showed highest sequence identity with NADP-dependent IDH from yeast and is encoded by the fraction of T. maritima genes with highest similarity to eukaryotic genes (59), and accordingly TmIDH showed phylogenetic affiliation to IDHs in subfamily II (Fig. 3). The sequence identity observed previously between members of subfamily II with members of subfamilies I and III of less that 18% (24) could raise the question of whether these subfamilies have a common ancestor. However, a sequence identity of TmIDH and EcIDH of 27.7% is higher than previously noticed between members of subfamily I and II (24), and TmIDH branches off before any of the other members of this subfamily. Hence, TmIDH is slightly more related to subfamilies I and III than the other members of subfamily II, supporting an evolutionary relationship between these subfamilies. The putative IDHs from Mesorhizobium loti, Caulobacter crescentus, Sinorhizobium meliloti, Rhodopseudomonas palustris, Rhodobacter capsulatus, Thermomonospora fusca, and Mycobacterium tuberculosis (IDH1) also group within subfamily II, with a close relationship to IDH from S. yanoikuyae (Table II, Fig. 3). These data confirm the presence of bacterial IDHs in subfamily II, and consequently this subfamily comprises eubacterial as well as eukaryotic NADP-dependent IDHs. However, within subfamily II, TmIDH does not group together with the other bacterial IDHs, and a bootstrap value of 71 indicates that TmIDH may represent a new subfamily of IDHs. Furthermore, so far only TmIDH is found to have a homotetrameric oligomeric state. Characterization with regard to oligomeric state of more IDHs belonging to subfamily II needs to be done to see whether TmIDH is unique in being homotetrameric.

With the exception of TmIDH, IDHs from hyperthermophiles are located in subfamily I, which includes IDHs from psychrophilic (Vibrio ABE-I) as well as mesophilic organisms (Fig. 3), all highly similar to EcIDH. This finding provides a basis for a comparative study of IDHs to reveal factors involved in thermostabilization of hyperthermophilic IDHs. The observed T_m value for IDH from the different hyperthermophiles matched the difference in growth optima for the organisms from which they originated (Table II). Each of the IDHs tested was substantially more thermostable than EcIDH, which is totally inactivated after a 10-min incubation at 40 °C (60). ApIDH and PfIDH are most different with regard to the number of amino acid residues, with ApIDH having protracted N and C termini compared with the other IDHs (Fig. 4). Two of three deletions in loop regions previously observed in AfIDH were also present in ApIDH and PfIDH (Fig. 4). The Deletions in loop regions constitute a property that has been observed in various other enzymes from hyperthermophiles (61). Furthermore, a reduced number of Cys residues as compared with EcIDH (1.4% Cys) has previously been observed for AfIDH (0.2% Cys) (24); this is also true for ApIDH and PfIDH, which have a Cys content of 0.5 and 0%, respectively. Hence, thermostable archaeal IDHs follow the trend observed for thermostable protein whereby Cys tend to be avoided (62). On the contrary, an increased number of Arg residues have been found in proteins from hyperthermophiles when compared with their mesophilic counterparts (62). EcIDH has 4.1% Arg residues. A slight increase in the Arg composition was found for AfIDH (4.9%) and PfIDH (5.0%), whereas ApIDH showed a significantly increased Arg composition of 7.4%. No other common difference for the thermophilic archaeal IDH could be observed when compared with EcIDH. Furthermore, neither a reduction in Cys nor an increase in Arg could be observed in TmIDH when compared with EcIDH, or the more closely related porcine and S. yanoikuyae IDH. The three-dimensional structure of the thermostable IDHs needs to be resolved to reveal whether these enzymes have a common or distinct strategy for thermostabilization.

	ACKNOWLEDGEMENT

The technical support of Marit Madsen is highly appreciated.

	FOOTNOTES

^* This work was supported by the Norwegian Research Council, the Knut and Alice Wallenberg Foundation, and the Nordic Academy for Advanced Study.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: +47-55582662; Fax: +47-55589671; E-mail: nils.birkeland@im.uib.no.

Published, JBC Papers in Press, August 31, 2001, DOI 10.1074/jbc.M105999200

³ Nicholas, K. B., and Nicholas H. B., Jr. (1997) GeneDoc: Analysis and Visualization of Genetic Variation, www.cris.com/Ketchup/genedoc.shtml.

² www.genome.utah.edu/, gene no. PF0202.

	ABBREVIATIONS

The abbreviations used are: IDH, isocitrate dehydrogenase; IMDH, isopropylmalate dehydrogenase; TDH, tartrate dehydrogenase; HDH, homoisocitrate dehydrogenase; AfIDH, Archaeoglobus fulgidus IDH; ApIDH, Aeropyrum pernix IDH; EcIDH, Escherichia coli IDH; PfIDH, Pyrococcus furiosus IDH; TmIDH, Thermotoga maritima IDH.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				T. Fuhrer and U. Sauer Different Biochemical Mechanisms Ensure Network-Wide Balancing of Reducing Equivalents in Microbial Metabolism J. Bacteriol., April 1, 2009; 191(7): 2112 - 2121. [Abstract] [Full Text] [PDF]

				A. L. Menon, F. L. Poole II, A. Cvetkovic, S. A. Trauger, E. Kalisiak, J. W. Scott, S. Shanmukh, J. Praissman, F. E. Jenney Jr., W. R. Wikoff, et al. Novel Multiprotein Complexes Identified in the Hyperthermophilic Archaeon Pyrococcus furiosus by Non-denaturing Fractionation of the Native Proteome Mol. Cell. Proteomics, April 1, 2009; 8(4): 735 - 751. [Abstract] [Full Text] [PDF]

				M. Aoshima and Y. Igarashi Nondecarboxylating and Decarboxylating Isocitrate Dehydrogenases: Oxalosuccinate Reductase as an Ancestral Form of Isocitrate Dehydrogenase J. Bacteriol., March 15, 2008; 190(6): 2050 - 2055. [Abstract] [Full Text] [PDF]

				J. Miyazaki, K. Asada, S. Fushinobu, T. Kuzuyama, and M. Nishiyama Crystal Structure of Tetrameric Homoisocitrate Dehydrogenase from an Extreme Thermophile, Thermus thermophilus: Involvement of Hydrophobic Dimer-Dimer Interaction in Extremely High Thermotolerance J. Bacteriol., October 1, 2005; 187(19): 6779 - 6788. [Abstract] [Full Text] [PDF]

				S. Watanabe, Y. Yasutake, I. Tanaka, and Y. Takada Elucidation of stability determinants of cold-adapted monomeric isocitrate dehydrogenase from a psychrophilic bacterium, Colwellia maris, by construction of chimeric enzymes Microbiology, April 1, 2005; 151(4): 1083 - 1094. [Abstract] [Full Text] [PDF]

				Y. Yasutake, S. Watanabe, M. Yao, Y. Takada, N. Fukunaga, and I. Tanaka Crystal Structure of the Monomeric Isocitrate Dehydrogenase in the Presence of NADP+: INSIGHT INTO THE COFACTOR RECOGNITION, CATALYSIS, AND EVOLUTION J. Biol. Chem., September 19, 2003; 278(38): 36897 - 36904. [Abstract] [Full Text] [PDF]

				G. J. Schut, S. D. Brehm, S. Datta, and M. W. W. Adams Whole-Genome DNA Microarray Analysis of a Hyperthermophile and an Archaeon: Pyrococcus furiosus Grown on Carbohydrates or Peptides J. Bacteriol., July 1, 2003; 185(13): 3935 - 3947. [Abstract] [Full Text] [PDF]

				J. Miyazaki, N. Kobashi, M. Nishiyama, and H. Yamane Characterization of Homoisocitrate Dehydrogenase Involved in Lysine Biosynthesis of an Extremely Thermophilic Bacterium, Thermus thermophilus HB27, and Evolutionary Implication of beta -Decarboxylating Dehydrogenase J. Biol. Chem., January 10, 2003; 278(3): 1864 - 1871. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/47/43924    most recent M105999200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Steen, I. H. Articles by Birkeland, N.-K. Search for Related Content PubMed PubMed Citation Articles by Steen, I. H. Articles by Birkeland, N.-K. Social Bookmarking                      What's this?