 |
INTRODUCTION |
The hypothalamic decapeptide, gonadotropin-releasing hormone
(GnRH),1 controls
synthesis and secretion of pituitary gonadotropic hormones follicle-stimulating hormone and LH. Follicle-stimulating hormone and
LH are heterodimeric glycoprotein hormones essential for reproductive function in mammals (1). The GnRH receptor is coupled to a G-protein in
the Gq/11 family (2, 3). Activation of the GnRH receptor
results in elevation of intracellular calcium levels, a requirement for
gonadotropin secretion (for review, see Ref. 4). In addition, GnRH
activates PKC isozymes (5-7) and all three major subfamilies of MAPKs,
including ERK, c-Jun N-terminal kinase, and p38 MAPK (8-15). The MAPK
cascades mediate cell signaling from the GnRH receptor to the nucleus
and are critical for transcriptional activation of many GnRH-responsive
genes, including the glycoprotein hormone 
subunit gene (9, 12), the
LH
subunit gene (16), the GnRH receptor gene (17), and the MKP-2
gene (18). These MAPK-dependent transcriptional activation
events are mediated by activation of transcription factors such as
c-Fos, c-Jun (19), Elk1 (9), and Egr-1 (16).
MAPKs are activated by dual phosphorylation of the Thr and Tyr residues
in a conserved TXY motif (for review, see Refs. 20 and 21).
Dephosphorylation of either residue inactivates MAPKs. Members of a
unique family of dual specificity protein phosphatases, the MKPs,
specifically inactivate MAPKs and therefore serve as important
intracellular negative regulators of MAPK signaling cascades (for
review, see Refs. 22-25). Ten MKPs have been identified in mammalian
tissues (25, 26). Each MKP has distinct binding affinity toward
different MAPKs that defines the substrate specificity of the MKP.
Binding of a specific substrate to MKPs induces conformational changes
in the MKPs (27, 28), leading to catalytic activation of these
phosphatases (26, 29-32). In addition to the post-translational regulation of MKP catalytic activity by MAPKs, MKP expression is also
tightly controlled both temporally and spatially, suggesting that each
MKP has a distinct physiological function. Several MKPs, including
MKP-1 (33, 34), PAC-1 (35), and hVH5 (36), are induced as immediate
early genes in various cell types. The responses of other MKPs, such as
MKP-2 (37, 38) and MKP-3 (39, 40), can be either immediate or delayed,
depending on cell type and stimuli. In many cases MKP expression is
induced by MAPKs (18, 41-46), suggesting that MKPs form a negative
feedback loop to control intracellular MAPK activity.
Because the physiological functions of MKPs are largely determined by
their expression patterns, it is important to understand the mechanisms
of regulation of MKP expression. Studies of the MKP-1 gene have
identified an E-box and two cAMP response elements in the proximal
promoter region as important elements for activation of the gene
(47-49), whereas an E-box and an AP-2-like site are critical for PAC-1
activation in hematopoietic tissues (44). MKP-2 is a nuclear MKP
closely related to MKP-1 and PAC-1 (37, 38, 50). It is expressed in a
broad range of tissues and is induced by various extracellular stimuli.
GnRH stimulation of pituitary gonadotropes results in marked induction
of MKP-2 expression (9, 18). This induction is mediated through
MAPK-dependent and independent pathways (18). Activation of
both the ERK and c-Jun N-terminal kinase pathways, but not the p38 MAPK
cascade, is required for MKP-2 expression. Discrete Ca2+
signals also contribute to MKP-2 expression through modulation of
MAPK-dependent and -independent pathways. To better
understand the mechanism underlying MKP-2 induction by GnRH, we
conducted functional analysis of the 5'-flanking region of the MKP-2
gene. A DNA element, MGRE (MKP-2 GnRH
response element), was identified within the
proximal promoter region of the MKP-2 gene that mediates GnRH
responsiveness. Egr-1, a zinc finger transcription factor essential for
pituitary LH expression and normal reproductive function (51, 52),
was identified in the MGRE-binding complex. GnRH induced binding of
Egr-1 to the MGRE in an ERK-dependent manner and enhanced
transcriptional activity of Egr-1. Egr-1 protein expression closely
correlated with the expression of MKP-2 protein in T3-1 cells,
suggesting a role of Egr-1 in transcriptional regulation of the MKP-2 gene.
| |
MATERIALS AND METHODS |
Preparation of Reporter Constructs and Expression Vectors--
A
luciferase reporter construct MKP-2-Luc containing nucleotides 
1664
to +123 of MKP-2 5'-flanking region in pGL3-basic vector (Promega) was prepared as described previously (53). Successive deletions of the 5' end of the MKP-2 sequence were made by PCR. The
forward primers used in these reactions were: fw 545,
5'-TCCGGGGAATCGCATT-3'; fw 198, 5'-CCTCTAGGTCTCGGTTTT-3'; fw
169, 5'-TGGCAGACAGCACCGAGC-3'; fw 141, 5'-CTCCTCTCTTTGTGACGT-3'; fw
115, 5'-CGTGACTGGGTGCGAGGG-3'; fw 89, 5'-CTCCATTCAAGAGTCGGG-3'; and
fw +35, 5'-GAGGAGGAAACTCTGGCT-3'. The reverse primer was: rev +193,
5'-GACCGAGGAGGGGAGTATGTTT-3'. The PCR products were cloned into
pGEMTeasy vector (Promega), and their identities were verified by DNA
sequence analysis. The MKP-2 fragments were cleaved out at the
SpeI restriction site in the pGEMTeasy polylinker and the
NheI site at +123 of the MKP-2 sequence. The fragments were
then subcloned into pGL3-basic vector at the NheI
restriction site.
Oligonucleotides containing the MGRE sequence were: MGREfw,
5'-CGTGACTGGGTGCGAGGGGGCCGGCG-3', and MGRErev,
5'-CGCCGGCCCCCTCGCACCCAGTCACG-3'. The oligonucleotides were annealed,
phosphorylated at the 5' termini by polynucleotide kinase, and
subjected to blunt end ligation to generate multimers of the MGRE
element. The multimers were then ligated into a luciferase reporter
vector (PRL-pGL3) containing a prolactin minimal promoter as described
previously (54). The multimers were inserted at a SmaI
restriction site upstream of the prolactin TATAA box. The resulting
reporter constructs were sequenced to determine the number and
orientation of the MGRE elements present in the PRL-pGL3 vector.
Luciferase reporter constructs, containing 507 base pairs of
5'-flanking region of the mouse glycoprotein hormone subunit promoter (m-Luc) or the minimal thymidine kinase promoter (TK-Luc) have been described previously (55, 56). The Gal4-dependent reporter (5xGal4-E1B-Luc), containing five Gal4 DNA-binding sites cloned upstream of the E1B minimal promoter, has been reported previously (9). Expression vectors for Gal4-Elk1, Gal4-Egr-1, and NAB1
have been described previously (9, 57, 58).
PCR-based Mutagenesis--
Block substitution of the
26-nucleotide MGRE sequence in the MKP-2 promoter was prepared by PCR.
The sequences of the primers containing the mutations are indicated
below. Mutated nucleotides are underlined. Wild type MGRE sequences are
shown for comparison: MUTfwm
5'-ATGTCAGTCTAGATCTTTTTAATTATCTCCATTCAAGAGTCGGGG-3';
MGREfw, CGTGACTGGGTGCGAGGGGGCCGGCG; MUTrev,
5'-ATAATTAAAAAGATCTAGACTGACATGGAACTCGACGTCACAAAG-3'; and
MGRErev, CGCCGGCCCCCTCGCACCCAGTCACG. Two PCR reactions were carried out
using primer pairs fw 198/MUTrev and MUTfw/rev +193 and the MKP-2
5'-flanking sequence as template. The products from these two
reactions were gel-purified and combined together to be used as
template for another PCR reaction using primer pair fw 198/rev +193.
The product of this PCR reaction was gel-purified, and the nucleotide
sequence was verified by nucleotide sequence analysis. The mutant
sequence was cloned into the pGL3 basic vector as described above. The
resulting construct containing MKP-2 sequence from nucleotides 198 to
+123, with the block substitution of MGRE, is designated
MUT-198-Luc.
Cell Culture, Transient Transfection, and Luciferase
Assay--
The mouse gonadotrope cell line, T3-1 (generously
provided by Dr. Pamela Mellon, University of California, San Diego),
was cultured in Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine serum and 5% horse serum. For transient transfection studies, the cells were grown to ~50% confluence in 60-mm culture dishes. pGL3-basic vector or luciferase reporter constructs containing MKP-2 5'-flanking sequence were transfected into T3-1 cells using the calcium phosphate precipitation method. Plasmid DNA-calcium phosphate precipitate was added to the cell culture medium for 4 h. At the end of the incubation, cells were washed and placed into
fresh serum-containing medium. The cells were then stimulated with or
without 10 nM GnRHa for 4 h prior to collection for
luciferase assay. In overexpression studies using NAB1, a 4-h
incubation period was used between the end of transfection and the
initiation of agonist treatment to allow for accumulation of
overexpressed NAB1 protein in transfected cells. When fetal bovine
serum was used as an agonist, the cells were serum-starved for 4 h
following transfection and then stimulated with GnRHa or serum for
4 h. For transient transfection studies using 5xGal4-E1B-Luc
reporter, T3-1 cells were transfected with LipofectAMINE (Life
Technologies, Inc.) overnight. The cells were then washed with
serum-free medium and cultured with or without GnRHa for 8 h. For
both transfection methods, cell lysates were prepared by three
freeze-thaw cycles and clarified by centrifugation. Luciferase activity
was determined in samples containing similar amounts of total cellular
protein as described previously (9). The transfection studies were conducted in triplicate on at least three separate occasions. The data
shown are from a representative experiment and reported as the
means ± S.E. (n = 3).
Preparation of Nuclear Extracts--
T3-1 cells were
cultured in 150-mm culture dishes to ~50% confluence. Prior to
hormone stimulation, the cells were serum starved for 2 h followed
by pretreatment with or without PD98059 (50 µM) for 30 min. The cells were then treated with control solution or 10 nM GnRHa for 2 h. At the end of the hormone treatment,
nuclear extracts were collected as described previously (9). Briefly, after one wash with ice-cold HEPES-buffered saline (20 mM
HEPES, pH 7.5, 137 mM NaCl, 5 mM KCl, 1 mM Na2HPO4, and 0.1% dextrose), the cells were scraped in HEPES-buffered saline and collected by
centrifugation. The cells were placed in hypotonic buffer and lysed in
a Dounce homogenizer, and the nuclei were isolated by centrifugation
through a sucrose cushion. Nuclei were resuspended in an EMSA binding
buffer containing 10 mM Tris-HCl, pH 7.5, 50 mM
NaCl, 5% glycerol, 1 mM EDTA, 1 mM
dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, 25 mM -glycerol phosphate, 1 mM disodium pyrophosphate and 5 mM sodium
vanadate. Nuclear proteins were extracted by adding additional NaCl to
a final concentration of 450 mM and incubating at 4 °C
for 30 min with constant rocking. Nuclear debris was removed by
centrifugation at 75,000 rpm for 30 min, and protein concentration of
the samples was determined by Bradford assay. Nuclear extracts were
aliquot and stored at 80 °C until use.
EMSA--
EMSA was conducted as described previously (56).
MGREfw and MGRErev oligonucleotides were annealed and radiolabeled with polynucleotide kinase and [
-32P]ATP. T3-1 cell
nuclear extracts were mixed with 1 µg of poly(dI-dC) in EMSA binding
buffer and incubated at room temperature for 30 min. Labeled MGRE probe
(~20,000 cpm/reaction) was then added, and the binding reactions were
incubated for another 30 min at room temperature. The reactions were
resolved on 4% native polyacrylamide gels in 0.25 × TBE (22.5 mM Tris, 22.5 mM boric acid, 0.5 mM
EDTA) at 4 °C. The gels were dried, and DNA-protein binding
complexes were visualized by autoradiography.
In competition EMSA studies, unlabeled competitor oligonucleotides were
incubated with nuclear extract for 30 min before the addition of the
labeled MGRE probe. The competitors include MGRE, MUT, Sp1 and cEgr.
The sequences of MUT, Sp1 and cEgr are indicated below. The consensus
Sp1- and Egr-1-binding sites are in bold: MUT,
5'-ATGTCAGTCTAGATCTTTTTAATTAT-3' and
3'-TACAGTCAGATCTAGAAAAATTAATA-5'; Sp1,
5'-CGTGGGGGGCGGGGCCTGG-3' and
3'-GCACCCCCCGCCCCGGACC-5'; and cEgr,
5'-GGGAGTCAGTCTTGCGTGGGCGTTAGTCAGTCGGG-3' and 3'-CCCTCAGTCAGAA- CGCACCCGCAATCAGTCAGCCC-5'.
DNA Pull-down Assay--
The MGREfw oligonucleotide was
biotinylated at the 5' terminus during the synthesis reaction (Life
Technologies, Inc.). Equal amounts of the biotin-labeled MGREfw and the
unlabeled MGRErev were annealed in binding buffer (20 mM
HEPES, pH 7.9, 20 mM NaF, 1 mM EGTA, 1 mM EDTA, 0.2% Nonidet P-40, 5% glycerol, 100 mM NaCl, 1 mM dithiothreitol, 1 mM
disodium pyrophosphate and 0.5 mM phenylmethylsulfonyl fluoride). MGRE pull-down was performed as described previously (54).
Briefly, annealed biotin-MGRE oligonucleotides were bound to
streptavidin-agarose (SA) beads (Sigma) in binding buffer at 4 °C.
Approximately 5 pmol of MGRE oligonucleotides were added for each µl
of SA beads. Bound MGRE-SA beads were washed four times in the binding
buffer and resuspended to the original volume of the SA beads. MGRE
pull-down reactions were carried out in the binding buffer containing
20 µl of MGRE-SA beads and 85 µg of nuclear protein in a total
volume of 0.5 ml. In some reactions nonbiotinylated competitor
oligonucleotides were included. These included MGRE, MUT, and cEgr
oligonucleotides. The binding reactions were incubated for 4 h at
4 °C with constant rocking. At the end of the incubation, the SA
beads were pelleted by low speed centrifugation and washed six times in
the binding buffer. The binding complexes were denatured by boiling and
resolved on SDS-polyacrylamide gels. The proteins were transferred to
polyvinylidene difluoride membrane (PerkinElmer Life Sciences) and
subjected to Western blot analysis. Egr-1 and Sp1 antibodies were
purchased from Santa Cruz Biotechnology.
Preparation of Whole Cell Lysates and Western Blot
Analysis--
T3-1 cells were cultured in 60-mm dishes to ~50%
confluence. The cells were serum-starved for 4 h before GnRHa or
serum stimulation. At the end of the experiment, whole cell lysates
were collected for Western blot analysis as described previously (18).
ERK2, MKP-1, MKP-2, and Egr-1 antibodies (Santa Cruz Biotechnology), anti-active ERK antibody (Promega), and horseradish
peroxidase-conjugated secondary antibody (Bio-Rad) were used according
to the manufacturers' instruction. Immunostained signals were detected
using enhanced chemiluminescence reagents (PerkinElmer Life Sciences).
| |
RESULTS |
A 198-Base pair 5'-Flanking Sequence of the MKP-2 Gene Supports
GnRH Inducibility--
We have previously isolated the 5'-flanking
region (1664 to +123) of the rat MKP-2 gene (53). This MKP-2 sequence
supports both basal and PKC-induced expression of the luciferase
reporter gene in the rat somatolactotrope cell line, GH3. In the
present study, we first examined the expression of the same MKP-2
reporter construct (MKP-2-Luc) in the T3-1 gonadotrope cell line.
Transient transfection studies indicate that the basal expression level of MKP-2-Luc was higher than the expression level of pGL3 basic vector
or TK-Luc (Fig. 1A). GnRH
markedly induced MKP-2-Luc expression, suggesting that the MKP-2 1664
to +123 sequence can support both basal and GnRH-induced expression of
the MKP-2 gene in gonadotropes. The expression level of MKP-2-Luc was
comparable with that of the mouse glycoprotein hormone subunit
reporter (m-Luc).
View larger version (27K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of MKP-2 reporter genes in
T3-1 cells. A, basal and
GnRH-induced expression of a MKP-2 reporter gene (MKP-2-Luc) containing
the rat MKP-2 sequence from nucleotides 1664 to +123 was examined in
T3-1 cells. The cells were transiently transfected with 1 µg of
the reporter construct using the calcium phosphate precipitation
method. 3 h after transfection, the cells were washed with fresh
serum-containing medium and cultured with or without GnRHa (10 nM) for 4 h. The expression levels of MKP-2-Luc were
compared with those of the empty luciferase vector (pGL3 basic), a
mouse glycoprotein hormone subunit reporter gene (m-Luc), and a
reporter gene containing the minimal thymidine kinase promoter
(TK-Luc). The GnRHa-dependent fold induction of pGL3 basic,
MKP-2-Luc, and m-Luc is indicated by the numbers to the
left. B, reporter genes bearing 5' deletions in
the MKP-2 5'-flanking region were prepared by PCR and tested in
transient transfection studies. The lines and
numbers on the left side indicate the MKP-2
sequence contained in each reporter construct. The arrows
indicate the position of the most 5' transcription start site of the
MKP-2 gene (53). The construct containing MKP-2 sequence from
nucleotide 198 to +123 was designated MKP-2-198-Luc. All
transfection studies were conducted in triplicate on three separate
occasions with similar results. The data shown are from a
representative experiment reported as the means ± S.E.
(n = 3).
|
|
To identify regions of the MKP-2 5'-flanking sequence that
mediate GnRH responsiveness of the gene, luciferase reporter constructs bearing 5' deletions of the MKP-2 sequence were generated by PCR and
tested in transient transfection studies in T3-1 cells. Basal activity of the MKP-2 promoter progressively declined with successive 5' deletions (Fig. 1B). However, in these deletion mutants,
GnRH inducibility was not abolished until deletion to nucleotide +35 downstream of the putative transcription start site. The shortest MKP-2
fragment identified in this deletion series that retained full GnRH
responsiveness was nucleotides 198 to +123. The reporter construct
containing this fragment was designated MKP-2-198-Luc.
Regulation of MKP-2-198-Luc Expression by PKC, MAPK, and Calcium
Signals--
GnRH-induced MKP-2 expression requires activation of the
ERK cascade (18). PKC activation and VGCC-derived Ca2+
signals are essential for GnRH-induced ERK activation (13) and are
therefore also required for MKP-2 induction. In addition, thapsigargin-sensitive intracellular Ca2+ signals regulate
MKP-2 protein expression independent of MAPK activation. To understand
how these pathways regulate MKP-2 expression at the transcriptional
level, we examined their roles in GnRH-dependent MKP-2-198-Luc activation in transient transfection studies. Inhibition of PKC isozymes by staurosporine or chronic phorbol 12-myristate 13-acetate treatment blocked both basal and GnRH-induced expression of
MKP-2-198-Luc (Fig. 2). Similar results
were observed when the ERK pathway was inhibited by PD98059. In
contrast, the specific p38 inhibitor SB203580 had no effect on the fold
induction of MKP-2-198-Luc by GnRH. These studies suggest that the
PKC-ERK pathway regulates MKP-2 expression through up-regulation of
promoter activation. Blockade of extracellular Ca2+ influx
through VGCCs by nifedipine inhibited GnRH-induced MKP-2-198-Luc expression. In contrast, disruption of intracellular Ca2+
stores by thapsigargin reduced basal luciferase expression by 50% but
did not alter the fold induction by GnRH. The effect of nifedipine is
highly correlated with blockade of GnRH-induced ERK activation (13).
However, previous studies have shown that thapsigargin completely
blocked GnRH-induced MKP-2 protein accumulation (18). The data
presented here suggest that the thapsigargin-sensitive Ca2+
signal is not required for MKP-2 promoter activation but rather functions through distinct mechanisms.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 2.
Regulation of MKP-2-198-Luc expression by
PKC, MAPKs, and calcium signals. pGL3 basic vector or
MKP-2-198-Luc was transiently transfected into T3-1 cells, and the
signaling requirements for GnRH-dependent activation of
MKP-2-198-Luc were examined. Following calcium phosphate transfection,
the cells were treated with staurosporine (0.5 µM),
PD98059 (50 µM), or SB203580 (20 µM) for 30 min prior to GnRHa stimulation to inhibit GnRH-induced activation of
PKC, ERK, or p38 MAPK, respectively. In addition, some cells were
stimulated with 100 nM phorbol 12-myristate 13-acetate for
20 h before transfection to deplete
diacylglycerol-dependent PKC isoforms. In separate studies,
the effects of Ca2+ signals were examined. Nifedipine (1 µM) was added 5 min prior to GnRHa stimulation to block
calcium signals derived from L-type VGCCs. Other cells were exposed to
2 µM of thapsigargin for 30 min to deplete inositol
1,4,5-trisphosphate-sensitive intracellular Ca2+ stores
before GnRHa treatment. All transfection studies were conducted in
triplicate on three separate occasions with similar results. The data
shown are from a representative experiment reported as the means ± S.E. (n = 3).
|
|
A 26-Nucleotide Element Is Required for GnRH Responsiveness of the
MKP-2 Reporter Gene--
The studies on MKP-2-198-Luc indicate that
the 198 to +123 region of the MKP-2 gene contains an important
regulatory element(s) that mediates GnRH-dependent activation
of the gene through the PKC-ERK pathway. In an effort to identify the
DNA element(s), we prepared sequential deletions of 26-29 nucleotides
from the 5' end of the MKP-2 sequence. The sites of these deletions are indicated by the arrowheads in Fig.
3A. The reporter constructs bearing these 5' deletions were tested in transient transfection studies. Although variation in GnRH inducibility was evident with two
deletion mutants (169 and 141), the largest loss in GnRH induction
was revealed by the loss of the sequence between 115 and 89 (Fig.
3B), suggesting that this sequence is required for GnRH
responsiveness of the MKP-2 gene. The 26-nucleotide sequence was
designated MGRE. Block substitution of the MGRE sequence (shown in Fig.
3A) in the context of the 198 to +123 MKP-2 promoter (MUT-198-Luc) markedly reduced fold induction of the reporter gene by
GnRH, consistent with the effect of the deletion at 89 (MKP-2-89-Luc; Fig. 3C). These data suggest that the MGRE
is the key cis-element for GnRH responsiveness of the MKP-2
promoter. Further, the basal expression levels of both MUT-198-Luc and
MKP-2-89-Luc were comparable with that of the wild type
MKP-2-198-Luc, indicating that MGRE may not be required for basal
activity of the MKP-2 promoter.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
A 26-nucleotide DNA element within the
198-base pair MKP-2 promoter is required for GnRH responsiveness of the
MKP-2 reporter gene. A, sequence of the MKP-2
5'-flanking region in MKP-2-198-Luc. The sense strand of the DNA
sequence is shown. The arrow indicates the most 5'
transcription start site (53). Arrowheads indicate sites of
deletions shown in B. B, sequential deletions
from the 5' end of the 198-base pair MKP-2 proximal promoter region
were prepared by PCR. The resulting reporter genes were tested in
transient transfection studies using T3-1 cells. Lines
and the associated numbers on the left indicate
the MKP-2 promoter region present in each reporter construct. A
26-nucleotide element (115 to 89, designated MGRE) was critical for
GnRH responsiveness of the MKP-2 promoter. This element is in
bold type in A. One STRE-like binding site was
identified within MGRE through searching the TRANSFAC data base (76).
C, the MGRE sequence was mutated in the context of
MKP-2-198-Luc. The mutant sequence (MUT) is shown in
A. Expression of this mutant construct (MUT-198-Luc) was
examined in transient transfection studies and compared with the
expression of the wild type reporter gene (MKP-2-198-Luc) and the
deletion mutant (MKP-2-89-Luc). All transfection studies were
conducted in triplicate on three separate occasions with similar
results. The data shown are from a representative experiment reported
as the means ± S.E. (n = 3).
|
|
MGRE Is Sufficient to Mediate GnRH-induced Transcriptional
Activation of Luciferase Reporter Gene--
Our deletion and mutation
analyses indicate that MGRE is required for GnRH responsiveness of the
MKP-2 gene. To further test whether this DNA element is also sufficient
to mediate GnRH-dependent transcriptional activation, we
prepared luciferase reporter constructs containing one to three MGRE
elements upstream of the PRL TATAA box. In transient transfection
studies using T3-1 cells, a single MGRE element had only a slight
effect on both basal expression and GnRH induction of the luciferase
reporter gene (Fig. 4A). However, two tandem MGRE elements markedly increased the GnRH responsiveness of the reporter. An additional MGRE element had little
effect to further enhance GnRH fold induction of the reporter gene but
dramatically increased the luciferase expression level. This reporter
construct was designated 3xMGRE-Luc. These data indicate that the MGRE
alone is sufficient to mediate GnRH-dependent transcriptional activation of the luciferase reporter gene. However, out of the context of the native MKP-2 promoter, multiple MGRE elements
are needed to mediate optimal response to GnRH.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 4.
The MGRE element is sufficient to mediate
GnRH activation of transcription. A, luciferase
reporter genes containing one to three MGRE elements inserted upstream
of the prolactin TATAA box in PRL-pGL3 were examined in transient
transfection studies using T3-1 cells. The arrows to the
left indicate the number and orientation of the MGRE
elements in each reporter gene. The reporter gene containing three
tandem MGRE elements was designated 3xMGRE-Luc. B, signaling
requirements for GnRH-dependent activation of 3xMGRE-Luc
were examined in transient transfection studies. Pharmacological
reagents regulating PKC, MAPKs, and Ca2+ signals were
administered as described in the legend to Fig. 2. All transfection
studies were conducted in triplicate on three separate occasions with
similar results. The data shown are from a representative experiment
reported as the means ± S.E. (n = 3).
|
|
Pharmacological analysis revealed that the signaling requirements for
GnRH-dependent 3xMGRE-Luc activation closely resembled those for MKP-2-198-Luc activation (Fig. 4B). Specifically,
inhibition of the PKC pathway completely blocked GnRH-induced
activation of 3xMGRE-Luc. Inhibition of ERK activation by PD98059 also
greatly reduced GnRH responsiveness of the reporter gene. In contrast, inhibition of p38 by SB203580 had little effect on GnRH-induction of
3xMGRE-Luc. Blockade of VGCC-dependent Ca2+
signals by nifedipine blocked GnRH-dependent expression of
3xMGRE-Luc, whereas disruption of the thapsigargin-sensitive
Ca2+ signals had little effect. Together, these data
indicate that MGRE mediates GnRH-dependent transcriptional
activation through the PKC-ERK pathway in a manner entirely consistent
with the 198 MKP-2 promoter fragment.
Binding Activity Associated with MGRE Is GnRH-inducible--
To
identify the transcription factors that bind to the MGRE sequence, EMSA
were performed using T3-1 cell nuclear extract and radiolabeled
MGRE oligonucleotides. Protein concentrations of all nuclear extracts
were adjusted to 4 mg/ml. 4-7 µl of the nuclear extracts were used
in each reaction. One predominant MGRE-binding complex was detected in
the EMSA (Fig. 5). The binding intensity of this complex correlated with the amount of input T3-1 nuclear extract. Interestingly, nuclear extracts prepared from T3-1 cells that received 2 h of GnRH stimulation had markedly increased MGRE binding activity. When the cells were pretreated with PD98059 prior to
GnRH stimulation, the MGRE binding activity from their nuclear extracts
was reduced compared with the cells treated with GnRH alone. Consistent
with our functional promoter analysis, the putative MGRE binding
activity was induced by GnRH, and this induction was sensitive to ERK
inhibition by PD98059.
View larger version (76K):
[in this window]
[in a new window]
|
Fig. 5.
T3-1 cell nuclear extract
formed a GnRH-inducible binding complex with the MGRE element.
EMSA was performed using 32P-labeled MGRE oligonucleotide
as probe. Nuclear extract (NE) from unstimulated T3-1
cells, T3-1 cells treated with GnRHa for 2 h, or T3-1
cells treated with PD98059 (50 µM) and GnRHa were used in
the assay. The protein concentration of the nuclear extracts was
determined by the Bradford assay and adjusted to 4 mg/ml. Increasing
amounts of nuclear extract (4-7 µl) were used in the assay as
indicated above the gel. The arrows indicate the specific
MGRE-binding complex (upper part of the gel) and the free
MGRE probe (bottom part of the gel). The assay was repeated
three times using different preparations of nuclear extracts. All
replicates yielded similar results.
|
|
Egr-1 Is Present in the MGRE-binding Complex Following GnRH
Stimulation--
The MGRE sequence is highly GC-rich and contains a
putative STRE element (Fig. 3A) that can bind
Cys2-His2 zinc finger proteins (59). A recent
report indicates binding of Sp1, Sp3, and Egr-1 to a STRE-like element
in the PTP1B promoter (60). Based on this observation, we sought to
determine whether Egr or Sp proteins were present in the MGRE-binding
complex. First, we examined the ability of consensus Sp1 or cEgr
oligonucleotides to compete for MGRE binding activity in the
GnRH-treated T3-1 nuclear extract. As shown in Fig.
6, the unlabeled wild type MGRE
oligonucleotide competed for DNA binding, whereas the mutant MGRE
oligonucleotide (MUT) only competed with MGRE binding at 100-fold molar
excess. Interestingly, when unlabeled Sp1 oligonucleotide was used as competitor, MGRE binding activity was moderately enhanced. Unlabeled cEgr oligonucleotide competed for MGRE binding to a similar extent as
the wild type MGRE oligonucleotide. These data suggest that the
specific MGRE-binding complex from GnRH-stimulated T3-1 cells most
likely contains Egr-like proteins but not Sp1. Similar results were
obtained from competition EMSA studies using nuclear extracts from
unstimulated T3-1 cells (data not shown), suggesting that Egr-like
proteins, but not Sp1, are also involved in MGRE binding in
unstimulated T3-1 cells.
View larger version (84K):
[in this window]
[in a new window]
|
Fig. 6.
The cEgr oligonucleotide competes for MGRE
binding activity. EMSA was carried out using nuclear extract
(NE) from GnRHa-treated T3-1 cells. Unlabeled MGRE, MUT,
Sp1, and cEgr oligonucleotides were included in the reactions as
competitors for MGRE binding. The number above
each lane indicates the fold excess of the competitor
oligonucleotide. The arrows indicate the specific
MGRE-binding complex (upper part of the gel) and the free
MGRE probe (bottom part of the gel). The assay was repeated
three times using different preparations of nuclear extracts. All
replicates yielded similar results.
|
|
Egr-1 is essential for LH gene expression in gonadotropes (51, 52)
and appears to be the predominant Egr protein regulated by GnRH (61,
62). To examine whether Egr-1 is present in the MGRE-binding complex,
we performed MGRE pull-down assays followed by Western blot analysis.
Egr-1 was detected in the MGRE-binding complex from GnRH-treated
T3-1 nuclear extract (Fig.
7A). Binding of Egr-1 to the
MGRE was blocked by the presence of excess unbound MGRE or cEgr
oligonucleotides but not by excess unbound MUT oligonucleotide, suggesting that the binding between Egr-1 and MGRE was specific. Consistent with previous reports that Egr-1 protein is expressed at
very low levels in unstimulated T3-1 cells (62, 63), nondetectable levels of Egr-1 were present in the MGRE-binding complex from control
cells (Fig. 7B, left panel). 2 h of GnRH
stimulation of T3-1 cells markedly increased the amount of Egr-1
bound to MGRE in this pull-down assay, and blockade of GnRH-induced ERK
activation by PD98059 reduced the amount of MGRE-bound Egr-1 to near
nondetectable levels. Overall, these results indicate that Egr-1 binds
to MGRE and that binding of Egr-1 to the MGRE is induced by GnRH in an ERK-dependent manner. In contrast to Egr-1, no Sp1
immunoreactivity was detected in the MGRE-binding complex (Fig.
7B, right panel). The same antibody detected Sp1
immunoreactivity in T3-1 whole cell lysate (data not shown),
suggesting that the antibody was functional. These data are consistent
with previous EMSA studies (Fig. 6) and suggest that Sp1 likely does
not participate in the MGRE-binding complex within the MKP-2
promoter.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
GnRH induced Egr-1 binding to MGRE.
A, DNA pull-down assays were performed using SA-bound MGRE
as probe (SA-MGRE). Nuclear extract (NE) from
GnRHa-treated T3-1 cells was used. Unbound MGRE, MUT, and cEgr
oligonucleotides were included in the binding reactions as competitors.
The numbers in parentheses indicate the fold
excess of the unbound competitor. At the end of the pull-down assay,
Egr-1 protein in the MGRE-binding complex was detected by Western blot
analysis. Molecular mass standards (in kDa) are shown to the
left of the Western blot. B, nuclear extracts
from unstimulated T3-1 cells, T3-1 cells treated with GnRHa for
2 h, or T3-1 cells treated with PD98059 and GnRHa were used in
the MGRE pull-down assay. The MGRE-binding complex was subjected to
Western blot analysis to detect Egr-1 and Sp1 proteins. All of the MGRE
pull-down assays were repeated two times with similar results.
C, activation of a Gal4-Egr-1 fusion protein by GnRH.
Expression vectors for the Gal4 DNA binding domain (Gal4-dbd) or the
fusion proteins Gal4-Egr-1 and Gal4-Elk1 were co-transfected with the
reporter gene 5xGal4-E1B-Luc into T3-1 cells by lipofection.
Following overnight transfection, the cells were stimulated with or
without GnRHa for 8 h and then collected for luciferase assay. The
transfection studies were conducted in triplicate on four separate
occasions with similar results. The data shown are from a
representative experiment reported as the means ± S.E.
(n = 3).
|
|
GnRH Enhanced the Transcriptional Activity of Egr-1
Protein--
Egr-1 is an immediate early gene product induced by a
broad range of stimuli. Following synthesis, phosphorylation (64) or
co-repressor binding (58, 65, 66) may regulate the transcriptional activity of Egr-1. To examine the possibility that GnRH may regulate the transcriptional activity of Egr-1, we studied GnRH regulation of a
Gal4-Egr-1 fusion protein. T3-1 cells were transiently transfected with a luciferase reporter gene containing five
Gal4-binding sites together with an expression vector for the Gal4
DNA-binding domain alone (Gal4-dbd), the Gal4 DNA-binding domain
coupled to Egr-1 (Gal4-Egr-1), or the transcriptional activation domain
of Elk1 (Gal4-Elk1). GnRH markedly enhanced the ability of Gal4-Elk1 to transactivate the reporter gene (Fig. 7C), consistent with
previous observations (9). Interestingly, Gal4-Egr-1 transcriptional activity was also greatly enhanced by GnRH, and the fold activation of
Gal4-Egr-1 was comparable with that of Gal4-Elk1. These results provide
direct evidence that the activity of Egr-1 as a transcription activator
is stimulated by components of the GnRH signaling pathway. Because
GnRH-dependent activation of the MKP-2 promoter requires an
Egr-1-binding site, the enhancement of Egr-1 transcriptional activity
by GnRH likely contributes to MKP-2 gene expression.
Overexpression of NAB1 Potentiates GnRH-induced Activation of the
MKP-2 Promoter--
NAB1 and NAB2 specifically interact with Egr
proteins resulting in modified transcriptional responses of
Egr-dependent genes. In many cases, NAB overexpression
results in transcriptional repression (58, 65, 66). Further, GnRH
induces NAB1 expression in T3-1 cells (62). To examine the
possibility that NAB1 may modulate MKP-2 promoter activation by GnRH,
we overexpressed NAB1 in T3-1 cells. Interestingly, NAB1
overexpression moderately enhanced GnRH-dependent
activation of the MKP-2 promoter in a dose-dependent manner
(Fig. 8). These data suggest that NAB1
may function as a co-activator of GnRH/Egr1-dependent MKP-2
gene expression.
View larger version (20K):
[in this window]
[in a new window]
|
Fig. 8.
Overexpression of NAB1 increases GnRH-induced
activation of the MKP-2 promoter. Expression vector for NAB1 and
MKP-2-198-Luc reporter were co-transfected into T3-1 cells using
the calcium phosphate precipitation method. The total amount of DNA was
kept constant by adding appropriate amounts of a CMV control vector.
Following transfection, the cells were washed and maintained in
serum-containing medium for 4 h to allow for NAB1 protein
accumulation. The cells were then treated with or without 10 nM of GnRHa for 4 h. At the end of the treatment, the
cells were collected for luciferase assay. The transfection studies
were conducted in triplicate on two separate occasions with similar
results. The data shown are from a representative experiment reported
as the means ± S.E. (n = 3).
|
|
Expression of MKP-2 Is Correlated with Egr-1 Up-regulation in
T3-1 Cells--
Many MKP genes are activated by growth factors and
serum. Consistent with this, MKP-2 mRNA was up-regulated by serum
and epidermal growth factor in PC12 cells (37). Based on these
observations, we examined the possibility that in gonadotropes, serum
and GnRH may regulate MKP-2 expression through similar mechanisms.
First we compared the effect of serum and GnRH on MKP-2 promoter
activity in transient transfection studies using T3-1 cells (Fig.
9A). Surprisingly, serum only
modestly increased MKP-2-198-Luc expression over basal expression,
suggesting that serum is not an effective signal to activate MKP-2
promoter in T3-1 cells. Both GnRH and serum activated the ERK
pathway, as indicated by Western blot analysis of T3-1 whole cell
lysate using an anti-phospho-ERK1/2 antibody (Fig. 9B).
However, the duration of ERK activation was clearly different under the
two conditions. Prolonged ERK activation in GnRH-treated cells
correlated with Egr-1 expression and MKP-2 protein induction in these
cells. In contrast, serum stimulation resulted in transient ERK
activation and only a slight induction of Egr-1 and MKP-2 proteins.
Interestingly, serum was a potent activator of MKP-1 expression,
suggesting that serum was an effective agonist in this system and that
differential mechanisms regulate MKP-1 and MKP-2 gene activation. The
highly correlative expression of Egr-1 and MKP-2 proteins in T3-1
cells following GnRH and serum treatment suggests that optimal
transcriptional activation of the endogenous MKP-2 gene may be
dependent on Egr-1 expression.
View larger version (39K):
[in this window]
[in a new window]
|
Fig. 9.
Activation of endogenous MKP-2 expression
in T3-1 cells correlates with Egr-1
expression. A, luciferase reporter genes were
transiently transfected into T3-1 cells using the calcium phosphate
precipitation method. Following transfection, the cells were washed and
maintained in serum-free medium for 4 h. The cells were then
treated with 10 nM of GnRHa or 20% fetal bovine serum for
4 h. At the end of the treatment, the cells were collected for
luciferase assay. The transfection studies were conducted in triplicate
on three separate occasions with similar results. The data shown are
from a representative experiment reported as the means ± S.E.
(n = 3). B, T3-1 cells were
serum-starved for 4 h before hormone stimulation. The cells were
left untreated (Con) or stimulated with either 10 nM of GnRHa or 20% fetal bovine serum for the times
indicated. At the end of the treatment, whole cell lysate was
collected. Activation of ERK1/2 was detected by Western blot analysis
using an anti-phospho-ERK antibody that recognizes the dual
phosphorylated ERK1/2. Protein levels of total ERK1/2 (demonstrating
equivalent lane loading), Egr-1, MKP-1, and MKP-2 were measured using
specific antibodies.
|
|
| |
DISCUSSION |
In pituitary gonadotropes, GnRH activates all three major MAPK
cascades as well as MKP-2 and MKP-1 (current studies and Refs. 9 and
18). MKPs are dual specificity phosphatases that specifically dephosphorylate MAPKs, suggesting a role for MKPs in intracellular negative feedback regulation of GnRH-induced MAPK activity and the
subsequent MAPK-dependent gene transcription. The present study focused on transcriptional regulation of the MKP-2 gene. MKP-2
expression was robustly induced following GnRH treatment, and the
duration of MKP-2 expression was similar in clonal T3-1 cells and
rat pituitary cells in primary culture (18), indicating that the
T3-1 cell line is a suitable model for the study of MKP-2 gene
regulation by GnRH. Our promoter analysis in T3-1 cells defined a
novel cis-element (MGRE) that is both required and
sufficient to support GnRH-dependent transcriptional
activation of the MKP-2 gene. Consistent with previous observations
from our laboratory (18), pharmacological studies examining PKC and ERK
inhibition confirm the requirement for the PKC-ERK cascades in
GnRH-dependent activation of the MKP-2 promoter via the
MGRE. Our biochemical studies support the hypothesis that Egr-1 likely plays a key role in the mechanism(s) regulating transcriptional responses of the MKP-2 gene by GnRH.
The effects of GnRH on MKP-2 protein levels were mediated by
MAPK-dependent and -independent pathways that could be
differentiated by disruption of discrete Ca2+ signals
within the cell (18). In the current study, we confirmed that MKP-2
promoter activity was dependent upon a nifedipine-sensitive VGCC-derived Ca2+ signal. VGCC Ca2+ is
necessary for GnRH-induced ERK activation (13) leading to up-regulation
of the MKP-2 gene. In our previous studies (18), pretreatment with
thapsigargin depleted intracellular Ca2+ stores and
completely blocked MKP-2 protein expression independent of changes in
MAPK activity. The functional analysis of the MKP-2 promoter presented
here suggests that the effect of thapsigargin was not mediated at the
level of MKP-2 promoter activity. In addition to MKP-2, thapsigargin
also abolished GnRH-induced expression of MKP-1 and c-Fos proteins but
had little effect on c-Jun
expression.2 This suggests
that thapsigargin-sensitive Ca2+ signals regulate the
expression of these proteins in a gene-specific way. A recent report
described a Ca2+-sensitive transcription elongation block
within the first exon of the rat MKP-1 gene (67). Release of the block
by Ca2+ signals plays an important role in TRH-stimulated
MKP-1 expression in GH4C1 neuroendocrine cells. A similar
Ca2+-sensitive elongation block located in the first intron
of the c-fos gene has also been reported (68-70). It is
tempting to speculate that such a mechanism may also exist for the
MKP-2 gene and could be responsible for the observed thapsigargin
effect. Alternatively, the thapsigargin-sensitive Ca2+
signals may regulate MKP-2 mRNA or protein stability. The precise level of thapsigargin action on MKP-2 expression is not clear.
Egr-1, the prototype of the Egr family, is an immediate early gene
product induced by a broad range of stimuli (for review, see Ref. 71).
Our studies indicate that Egr-1 binds to the MKP-2 promoter at a
STRE-like sequence (MGRE), a cis-element that mediates GnRH
responsiveness of the MKP-2 promoter. Mutations within the MGRE
resulted in a marked loss in transcriptional activation by GnRH. A
recent study revealed a similar transcriptional mechanism for the
regulation of the PTP1B promoter (60). Egr-1, together with Sp1 and
Sp3, bound to a STRE-like cis-element and mediated regulation of the PTP1B promoter in response to p210
bcr-abl expression. In addition to Egr-1,
other proteins may be present in the MGRE-binding complex and may
contribute to the MGRE binding activity and basal expression of MKP-2.
For example, in other systems Sp1 can compete for Egr-1 binding in
unstimulated cells and regulate basal levels of gene expression (for
review, see Ref. 74). However, our EMSA competition studies and DNA
pull-down assays excluded this possibility. In both control and
GnRH-stimulated T3-1 cells, Sp1 protein failed to bind to MGRE,
indicating that Sp1 is not involved in MKP-2 promoter regulation at the
MGRE site. Although Egr-1 is the predominant Egr protein up-regulated
by GnRH in gonadotropes (61, 62), our studies do not discount a
potential role for other Egr proteins, including Egr-2, Egr-3, and
Egr-4, which may bind to the MGRE element.
Interestingly, knockout studies in mice revealed that Egr-1 is
essential for gonadotrope function and normal reproduction (51, 52). In
the absence of Egr-1, LH mRNA is greatly reduced, and
infertility occurs, putatively because of a loss of gonadotropic stimuli. Egr-1 binds to the proximal promoter of the LH subunit gene
and regulates GnRH-dependent LH subunit expression.
However, LH subunit gene activation also requires binding of
cell-specific transcription factors (such as steroidogenic factor 1 and
the homeobox protein Ptx1; Refs. 61-63, 72, and 73) in concert with
Egr-1, resulting in synergistic activation. It is currently not known
whether cell-specific factors contribute to MKP-2 regulation within the
gonadotrope. The possible involvement of Egr-1 in
GnRH-dependent MKP-2 expression suggests a broader role of
Egr-1 in the GnRH signaling pathway. In this case, Egr-1 may mediate
intracellular negative feedback regulation of MAPK activity through
transcriptional activation of MKP-2.
In T3-1 cells, Egr-1 basal expression is very low. GnRH strongly
induces Egr-1 expression through the PKC-ERK pathway (16, 62, 72, 73).
The induction of Egr-1/MGRE binding by GnRH may reflect changes in
total Egr-1 protein levels following GnRH treatment. In addition to the
increase in Egr-1 protein, our studies suggest that GnRH can also
enhance the transcriptional activity of Egr-1 protein. Both of these
mechanisms may contribute to MKP-2 gene activation through the
Egr-1-binding site in the proximal portion of the promoter.
Interaction between Egr-1 and NAB proteins provides yet another level
of regulation of Egr-1 activity. Because expression of NAB1 is
up-regulated by GnRH in T3-1 cells (62), NAB1 may serve as a
physiological regulator of GnRH-induced MKP-2 expression. Our
overexpression studies suggest that NAB1 may function as a co-activator
of GnRH-stimulated MKP-2 transcription. Careful examination of the
LH promoter has revealed similar effects of NAB proteins on LH
expression (75). Activation of Egr-dependent LH
transcription by NAB is strictly dependent on binding of Egr proteins
to the LH promoter and on the interaction between NAB and Egr
proteins. Based on these observations, the stimulatory effect of NAB1
on GnRH-induced MKP-2 promoter activity provides indirect evidence that
Egr proteins are likely involved in MKP-2 gene activation. In the
studies done by Milbrandt and co-workers (75), both the number and
affinity of Egr-binding sites determined whether NAB proteins
functioned as transcription co-activator or co-repressor. In gene
promoters bearing few or low affinity Egr-binding sites, NAB proteins
generally enhanced Egr-dependent transcriptional activation. The co-activator function of NAB1 on the MKP-2 promoter supports the conclusion that the single MGRE may reflect a relatively low affinity Erg-binding site. A more detailed functional analysis of
Egr-1 binding to the MGRE, as well as other potential Egr sites within
the MKP-2 promoter, is necessary to understand the molecular mechanism(s) of NAB1 action in GnRH-induced MKP-2 expression.
In summary, our studies detail a molecular mechanism leading to
GnRH-dependent transcriptional activation of the rat MKP-2 gene using a pituitary gonadotrope cell model. We provide direct evidence for a requirement for an Egr-1-binding site and the PKC-ERK signal transduction cascade in the regulation of the MKP-2 promoter by
GnRH. Consistent with previous studies, Ca2+ signals
derived from VGCCs are also required to support GnRH-induced ERK
activation and subsequent up-regulation of the MKP-2 gene. Further, our
studies on the MKP-2 promoter provide indirect evidence for a
functional role of Egr-1 in MKP-2 promoter regulation based upon NAB1
overexpression and the correlation between in vivo
expression of Egr-1 and MKP-2 proteins. These studies support the
conclusion that GnRH regulation of Egr-1 plays a principal role in
coordinating the expression of two prominent components (LH and
MKP-2) of the gene program induced by GnRH in the pituitary gonadotrope.
,
TOP
ABSTRACT
INTRODUCTION
