JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M109186200 on October 1, 2001

J. Biol. Chem., Vol. 276, Issue 51, 47814-47821, December 21, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/51/47814    most recent
M109186200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, S.
Right arrow Articles by Singh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, S.
Right arrow Articles by Singh, J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Chromodomain Protein Swi6-mediated Role of DNA Polymerase alpha  in Establishment of Silencing in Fission Yeast*

Shakil AhmedDagger , Sharanjot Saini, Sumit Arora, and Jagmohan Singh§

From the Institute of Microbial Technology, Sector 39A, Chandigarh - 160 036, India and the Dagger  Department of Pharmacology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854

Received for publication, September 24, 2001, and in revised form, October 1, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Although DNA replication has been thought to play an important role in the silencing of mating type loci in Saccharomyces cerevisiae, recent studies indicate that silencing can be decoupled from replication. In Schizosaccharomyces pombe, mating type silencing is brought about by the trans-acting proteins, namely Swi6, Clr1-Clr4, and Rhp6, in cooperation with the cis-acting silencers. The latter contain an autonomous replication sequence, suggesting that DNA replication may be critical for silencing in S. pombe. To investigate the connection between DNA replication and silencing in S. pombe, we analyzed several temperature-sensitive mutants of DNA polymerase alpha . We find that one such mutant, swi7H4, exhibits silencing defects at mat, centromere, and telomere loci. This effect is independent of the checkpoint and replication defects of the mutant. Interestingly, the extent of the silencing defect in the swi7H4 mutant at the silent mat2 locus is further enhanced in absence of the cis-acting, centromere-proximal silencer. The chromodomain protein Swi6, which is required for silencing and is localized to mat and other heterochromatin loci, interacts with DNA polymerase alpha  in vivo and in vitro in wild type cells. However, it does not interact with the mutant polalpha and is delocalized away from the silent mat loci in the mutant. Our results demonstrate a role of DNA polymerase alpha  in the establishment of silencing. We propose a recruitment model for the coupling of DNA replication with the establishment of silencing by the chromodomain protein Swi6, which may be applicable to higher eukaryotes.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The well studied system of mating type silencing in the budding yeast Saccharomyces cerevisiae has served as a paradigm for developmental regulation of gene regulation. Although the mating type phenotype of a homothallic strain is dictated by the MAT locus depending on whether it harbors the a- or alpha -specific alleles, two copies of the same genetic information are located at distant sites on the same chromosome, namely HML and HMR, which harbor alpha  and a alleles, respectively. However, these alleles are transcriptionally silent. The silencing is achieved by the cis-acting sequences E (essential) and I (important) that flank both HML and HMR loci (1, 2). In addition, several genes encode factors named mating type regulator/silent information regulator (MAR/SIR) that function in trans through the cis-acting sequences in keeping the HML and HMR loci silent. Extensive studies in S. cerevisiae have suggested that DNA replication is important for repression of the silent mating type loci HML and HMR (see Refs. 1 and 2 for reviews). These findings include a requirement of passage through S phase, a functional autonomous replication sequence (ARS) flanking the silent locus HMR, and a functional origin recognition complex for silencing (reviewed in Ref. 2). However, the requirement of DNA replication for silencing is obviated if the SIR1 silencing protein is recruited by alternative means, although passage through S phase is still essential (3, 4). Thus, the exact connection between DNA replication and silencing is not clear.

In the analogous system in Schizosaccharomyces pombe, the silent loci mat2P and mat3M are repressed by several trans-acting factors, namely Swi6 (5), Clr1-Clr4 (6-8), Clr6 (9), and Rhp6 (10), and cis-acting sequences, which are associated with (ARS) activity (11, 12).1 In addition, these mutations also affect silencing at centromere and telomere loci (13, 14). Among these, Swi6 contains the conserved chromodomain motif that is associated with proteins involved in the assembly of heterochromatin in a large number of species, including Drosophila, mice, and humans (15), whereas the Clr4 protein performs an evolutionarily conserved function: it methylates the histone H3 at the Lys-9 position (16, 17), an activity that is critical for silencing (17). Together these observations have suggested that DNA replication may play a role in mating type silencing in S. pombe.

To check the possible role of DNA replication in silencing, we analyzed several temperature-sensitive (ts) mutants of DNA polymerase alpha , which is required for lagging strand synthesis during DNA replication in eukaryotes (18). We find that one such ts mutant, swi7H4 (19), is defective in silencing not only at mat2 and mat3 but also at centromere and telomere loci. Biochemical data show that DNA polalpha interacts with and regulates the localization of the evolutionarily conserved chromodomain protein Swi6 to the mat loci. These results indicate a direct link between DNA replication and silencing through replication-mediated recruitment of Swi6 to heterochromatin. We believe that this mechanism of heterochromatin assembly may be conserved in all eukaryotes.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials and Reagents-- Media components were purchased from Difco (Detroit, MI) or SRL (Mumbai, India). MuLV reverse transcriptase, the expression vector pMALp2, and anti-MBP2 antibodies were purchased from New England Biolabs. Ni-NTA resin was from Qiagen. The nylon membranes for Southern and Western blotting were from Advanced Microdevices Inc, Ambala, India. [alpha -32P]dCTP was from BARC, Mumbai, India. The x-ray films were from Hindustan Photo Films. Isopropyl-1-thio-beta -D-galactopyranoside and 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside (X-gal) were from Promega (Madison, WI). Glutathione-agarose was from Sigma. Oligonucleotides were from Ransom Hill Biosciences. The enhanced chemiluminescence (ECL) kit was purchased from Amersham Pharmacia Biotech. The alkaline phosphatase and horseradish peroxidase conjugated antibodies were from Promega and Amersham Pharmacia Biotech.

Strains and Media-- Media compositions have been described (20). Strains for monitoring expression of ura4 marker at mat2, mat3, and centromere have been described earlier (6, 8, 14). For serial dilution assay, several 10-fold serial dilutions of strains grown overnight were spotted on complete and selective plates. The his3-telo strain, in which the his3 gene is inserted at the telomere, was a gift from P. E. Allshire (21). For iodine staining, the colonies were grown on PMA+ plates for 3-4 days and stained with iodine (20).

Reverse Transcriptase-PCR and Southern Blot Analysis-- The conditions for reverse transcriptase-polymerase chain reaction and Southern blotting for detecting mat2Pc and polalpha transcripts have been described (10).

Chromatin Immunoprecipitation (ChIP) Assay-- A ChIP assay to detect Swi6 localization at the mat region was carried out as described (22). The oligonucleotides used were GGGTAGGAAAAGAAGAGAGAGTAGTTGAAGG and CATACTAATAATGTAAGTAGAAGACC for mat1M (310 base pairs), GGTGCTCTTAATCTTGGATCC and ACTCGTTTCATAATGAATTGC for mat2P (215 base pairs), TGACAAAGCTTTTGTGG and TGTTAAAGCTTTTCTTCC for K region (700 base pairs), and GTCAGGATCCGCTGCTGAAAAGAAACC and ACTGGAATTCCTGAGGAGAAGAAGAATAC for H2B (395 base pairs). The PCR products were resolved by agarose gel electrophoresis and visualized by ethidium bromide staining or autoradiography.

Fluorescence Microscopy-- The localization of gfp-Swi6 was checked under Zeiss Axioplan fluorescence microscope as described (23, 24). Multiple pictures were taken along the Z axis and merged.

Plasmid Construction-- The swi6 gene (15) was amplified from genomic DNA using forward oligonucleotide 5'-ATGCGGGATCCCAAGAAAGGAGGTGTTCG and reverse oligonucleotide 5'-ATGCGATTCATTTTCACGGAACGTTAAG. The PCR product was digested with BamHI and EcoRI and cloned at the same sites in pRSETA (Invitrogen) or pGEX1 vector (Amersham Pharmacia Biotech). To express the MBP-Polalpha fusion protein, the XbaI-PstI fragment of the polalpha gene (25) was cloned into the pMALp2 vector (New England Biolabs) at the same sites. For constructing the hemagglutinin-tagged Swi6, PCR was performed using forward oligonucleotide ATGCGGCCGCTAGCCATTCTGTACACC and reverse oligonucleotide CATGCGGCCGCCTTCATTTTCACGGAACGTTAAG. The PCR product was restricted with NotI and cloned at NotI site of the vector pREP1NHA.

Antibodies and Western Blotting-- The Lacz-Polalpha fusion protein was expressed using the vector pUR292 in Escherichia coli. The protein was resolved by SDS-gel electrophoresis. The recombinant protein was stained with Coomassie Blue, gel-isolated, and injected into rabbits to obtain the antiserum. Polyclonal Swi6 antibody was a gift of R. Allshire. Immunodetection was carried using alkaline-phosphatase- (Promega) or horseradish peroxidase-conjugated secondary antibodies (ECL, Amersham Pharmacia Biotech) according to the manufacturer's instructions.

Protein Affinity Chromatography-- A crude extract (30 µg) containing MBP-Polalpha fusion protein was incubated with Ni-NTA (Qiagen, 100 µl of 2% suspension in binding buffer) to which recombinant (His)6-Swi6 had been immobilized. After collection of the unbound fraction and suitable washings with the binding buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl), the input, unbound flow through (FT), and bound (EL) fractions (residual beads) were subjected to immunoblotting. Ni-NTA beads (Qiagen) were equilibrated with binding buffer containing 50 mM NaH2PO4 (pH 8.0), 300 mM NaCl, and 10 mM imidazole. 300 µg of extract from cells expressing (His)6-Swi6 was allowed to bind the equilibrated Ni-NTA beads at 4 °C for 30-60 min. The beads were then washed with binding buffer containing 50 mM imidazole (30 min at 4 °C). After the washing step, 500 µg of the concentrated extract from cells of S. pombe (wild type and swi7H4) was added to the (His)6-swi6-conjugated Ni-NTA beads and mixed for 2 h at 4 °C. The mixture was centrifuged to obtain the supernatant (FT) fraction. After a single washing, the bound protein was eluted with 35 µl of elution buffer (binding buffer containing 250 mM imidazole). Elution was performed at 4 °C for 30 min. This represented the bound fraction (EL).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

swi7H4, a ts Mutation in DNA Polymerase alpha , Alleviates Silencing at the Mating Type Loci-- A marker gene ura4, when placed at mat2, mat3, or cen (centromere) and telomere loci, is subject to silencing. Strains harboring such a marker grow poorly on plates lacking uracil (ura-; 6, 14). However, in silencing defective mutants such as swi6 and clr1-clr4, the expression of the ura4 marker gene is enhanced, as indicated by increased growth level on ura- plates (6-8, 14). To check the requirement of DNA polalpha for silencing, several ts mutants of polalpha were generated in S. pombe, but they showed no silencing defect. However, swi7H4, an independently isolated ts mutant of polalpha with a replication checkpoint defect (19), elicited enhanced growth of strains carrying ura4 marker at mat2 and mat3 loci on ura- plates and reduced growth on FOA plates (FOA allows growth of ura- cells but not ura+ cells; Fig. 1, a and b; see also Refs. 6 and 20), indicating a derepression of the ura4 gene. A heterothallic strain in which the centromere-proximal silencer element was deleted (denoted by silencers I and II in Fig. 1a), called Msmto Delta mat2::ura4 (8), also showed a higher growth level on ura- plates and no growth on FOA plates because of the swi7H4 mutation (Fig. 1b).


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 1.   swi7H4 mutation causes derepression of the ura4 marker gene located at the silent mating type loci. a, the organization of the mating type loci in fission yeast with the conserved regions H2 and H1 at all three loci and H3 box at mat2 and mat3. The sites of insertion of the ura4 marker gene at the mat2 and mat3 loci, deletion of the centromere-proximal silencer element (silencers I and II, denoted by triangle) next to mat2, two transcripts Pc and Pi that are divergently transcribed from mat2P, and the centromere-distal silencers II and IV (11) are shown. A small deletion (Delta ) close to the H1 box of mat1 represents the Msmto deletion. b, serial dilutions of indicated strains with or without the swi7H4 mutation where mat2 (with or without a silencer deletion) or mat3 carry a linked ura4+ marker were spotted on complete, ura-, and FOA plates. The plates were incubated at 30 °C for 3-4 days and photographed.

Enhanced Silencing Defect in Silencer Deletion Background in the swi7H4 Mutant-- Heterothallic strains such as Msmto and Msmto Delta mat2::ura4 do not switch and express only the minus (M) transcripts from the mat1 locus. Expression of the silent mat2P transcripts in these strains triggers meiosis, leading to sporulation in haploid cells (the phenotype is called haploid meiosis (hm)). The spores contain a starchy compound in their cell wall, which can be stained with iodine (20). Thus, iodine staining as well as the hm phenotype indicates derepression of the silent mat2P locus in Msmto strain (8, 20). Earlier it was shown that in the Msmto background, the mutations in swi6, clr1-clr4 do not cause any increase in iodine staining although a derepression of the mat-linked ura4 gene was observed (8). However, interestingly, when these mutants were analyzed in the silencer deletion background, a high level of haploid meiosis accompanied by increased iodine staining was observed, suggesting an interplay of the silencer and these trans-acting factors (8). Therefore, we checked the effect of the swi7H4 mutation in the silencer deletion background.

The Msmto, swi7H4 strain does not give any iodine staining and no hm (0%; 0/400 cells; Fig. 2a). However, in the silencer deletion background (Msmto Delta mat2::ura4), which itself does not cause any loss of silencing, the swi7H4 mutant colonies gave dark staining with iodine (Fig. 2a) and a high level of hm (41%; 205/400 cells; Fig. 2b), suggesting a loss of silencing. To check whether this increase in iodine staining and the level of haploid meiosis was due to enhanced expression of the silent transcript mat2Pc, quantitative reverse transcriptase-PCR analysis was carried out. PCR under logarithmic conditions (10 cycles; see Ref. 10) could not detect the mat2Pc transcript (10) in Msmto (Fig. 2c, lane 1) and Msmto Delta mat2::ura4 strains (Fig. 2c, lane 2). However, the Msmto, swi7H4 mutant strain expressed detectable mat2Pc transcript (Fig. 2c, lane 3), which was elevated by ~8-fold in the silencer deletion background (Msmto Delta mat2::ura4 swi7H4; Fig. 2b, lane 4). The level of polalpha transcript was not affected (Fig. 2c, lower panel), justifying its use as a control. These results indicate that DNA polalpha is required to establish silencing at the mat2 locus, the efficiency of which is regulated by the cis-acting silencer. Because swi6 and clr1-clr4 mutants also do not give iodine staining in the Msmto background but yield dark staining in the silencer deletion background (Msmto Delta mat2::ura4; Ref. 8), our results suggest that polalpha and Swi6 (and possibly Clr1-Clr4) may act at the same step in silencing.


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 2.   Deletion of the silencer causes further abrogation of silencing in the swi7H4 mutant and genetic interaction between swi6 and polalpha . a, iodine staining phenotypes of a heterothallic Msmto strain with or without the swi7H4 mutation with silencer intact or deleted. b, increased level of haploid meiosis in the swi7H4 mutant in the silencer deletion background. Phase contrast microscopy of the strains described in panel a at a magnification of ×4,000. c, reverse transcriptase-PCR analysis of the mat2Pc transcript in the swi7H4 mutant and the effect of the silencer deletion. RNA was isolated from wild type (lane 1), silencer-deleted strain (lane 2), and swi7H4 mutant with intact silencer (lane 3) and silencer-deleted (lane 4). After cDNA synthesis, PCR was performed under logarithmic conditions (10 cycles) followed by Southern hybridization to radiolabeled mat2Pc and polalpha probes, as described Ref. 10.

Polalpha and cds1 Genes Suppress the Checkpoint Defect but Not the Silencing Defect of the swi7H4 Mutation-- All the above assays were performed at 30 °C. It is possible that the swi7H4 mutation, which is reported to exert a checkpoint defect at 36 °C (19), may have a residual growth defect at 30 °C or may have a prolonged S phase. However, we found that the swi7H4 mutant grows at a level similar to wild type strains at 30 °C. Furthermore, both the polalpha and cds1 genes, which are known to suppress the ts and checkpoint defects of the swi7H4 mutant (19), allowed growth of the swi7H4 mutant at 36 °C (Fig. 3a), confirming that both the genes suppress the growth defect of the swi7H4 mutant. Similarly, microscopic examination showed that although the mutant strain with the control vector still displayed the "cut" phenotype at 36 °C (chromosomes untimely torn; 13% of cells display cut phenotype after growth at 36 °C for 8 h), the polalpha and cds1 genes suppressed this phenotype completely with 0% of cells displaying the cut phenotype (Fig. 3b). However, most interestingly, the dark staining of the swi7H4 strain in the silencer deletion background was not suppressed by either the polalpha and cds1 genes (Fig. 3c). Therefore, the silencing defect in the swi7H4 mutant is not due to a prolonged S phase or replication checkpoint defect. On the other hand, the effect appears to be dominant, suggesting that the polalpha may participate in a silencing multimolecular complex.


View larger version (72K):
[in this window]
[in a new window]
  		Fig. 3.   polalpha and cds1 genes suppress the checkpoint defect but not the silencing defect of the swi7H4 mutant. The phenotypes of the swi7H4 mutant transformed with the control vector, polalpha , and cds1 gene are shown. a, suppression of the ts phenotype of the swi7H4 mutant by the polalpha and cds1 genes. The swi7H4 strain transformed with the control vector (pREP3), polalpha gene on a low copy vector, and cds1 gene on a high copy vector were streaked on PMA plates lacking leucine, grown at 30 and 36 °C for 4 days, and photographed. b, suppression of the cut phenotype of the swi7H4 mutant by the polalpha and cds1 genes. The strains shown in panel a were grown in liquid PMA medium lacking leucine at 30 °C. After overnight growth, they were shifted to 36 °C and then grown further for 8 h. The cells were harvested, stained with 4,6-diamidino-2-phenylindole, and photographed in a fluorescence microscope. The cells with cut phenotype in vector control are indicated by arrows. c, pola and cds1 genes fail to suppress the silencing defect of the swi7H4 mutant. The strain Msmto Delta mat2::ura4 swi7H4, which gives dark staining with iodine, was transformed with vector alone, polalpha plasmid, and cds1 gene as described in panel a. The transformants were streaked on PMA plates lacking leucine and grown for 4 days at 30 °C, after which they were stained with iodine and photographed. d, the swi6 gene requires wild type polalpha to suppress the silencing defect caused by swi6 deletion. Colonies of swi6Delta and swi6Delta , swi7H4 mutants in the silencer deletion background, were transformed with vector or swi6 gene and grown on PMA-Leu plates at 30 °C. After 3-4 days, the colonies were stained with iodine and photographed.

Because the silencing defect of the swi7H4 is dependent on the silencer, similar to Swi6 and Clr1-Clr4, we checked whether the silencing defect caused by the swi6 mutation requires DNA polalpha . Interestingly, we find that overexpression of swi6 gene could suppress the iodine staining of the swi6Delta strain in the silencer deletion background but not if the swi7H4 mutation was also present (Fig. 3d). Thus, Swi6 requires wild type polalpha to establish silencing, and the effect of the swi7H4 mutation is dominant.

swi7H4 Mutation Abrogates Silencing at Both Centromere and Telomere Loci-- Because mutations in swi6 and clr1-clr4 affect silencing at mat, centromere, and telomere loci, we also checked the effect of the swi7H4 mutation on silencing at the cen and telomere loci. The leaky expression of the ura4+ marker gene placed at three different locations within the cen1 locus (14) was enhanced by the swi7H4 mutation, as indicated by reduced growth on FOA plates (Fig. 4a). Likewise, the expression of the his3 gene placed at the telomere locus on chromosome I, which was completely lacking in the wild type strains, was derepressed in the swi7H4 mutant, as indicated by growth on His- plates (Fig. 4b). Thus, similar to the swi6 mutation (14), the swi7H4 mutation also abrogates silencing at all three heterochromatin loci in S. pombe.


View larger version (69K):
[in this window]
[in a new window]
  		Fig. 4.   swi7H4 mutation abrogates silencing at the centromere and telomere loci. a, the organization of the cen1 region of S. pombe showing the location of the ura4 marker gene inserted at the imr1L, cnt1, and otr1R regions (14). Serial dilution assay was performed for the wild type (WT) and swi7H4 mutant strains carrying the ura4 marker gene at three locations in cen1. b, the organization of the telomere region on chromosome I showing the his3 gene insertion between the telomeric repeats (telo) and the telomere-associated sequences (TAS) (21). Serial dilution assay of wild type and swi7H4 mutant in the his3-telo background was performed on complete and His- plates.

Delocalization of Swi6 from the mat Locus in the swi7H4 Mutant-- Swi6p has been mainly localized to three heterochromatin loci, namely mat, telomere, and centromere, as revealed by fluorescence in situ hybridization analysis (22), but becomes delocalized in clr4 and rik1 mutants (13). Therefore, we checked Swi6 localization in the wild type and swi7H4 mutant by expressing a plasmid containing gfp-Swi6 fusion in place of the endogenous swi6 gene (23, 24). Fluorescence microscopy showed that nearly 66% of nuclei contained three fluorescent foci in wild type cells with 26% of cells containing two foci and only 1% of cells having one foci; the remaining 7% of cells showed four foci. However, in swi7H4 mutant, the number of cells containing three foci was reduced by 50% with an increase in the number of cells with two or one foci by nearly 2 and 15-fold, respectively, as compared with the wild type cells (Fig. 5a).


View larger version (37K):
[in this window]
[in a new window]
  		Fig. 5.   Delocalization of Swi6 from mat in the swi7H4 mutant. a, cells of wild type and swi7H4 strains expressing the gfp-Swi6 plasmid in place of a swi6Delta (20) were observed by fluorescence microscopy. The number of cells with one to four fluorescent foci were counted and tabulated as percentages. b, ChIP assay to quantitate the localization of Swi6 at different sites along the mating type region. Top, the locations of the primers to amplify sequences in the mat1, mat2, and K region. Histone H2B was used as a negative control. For wild type (WT, lanes 1-3) and swi7H4, the strains carried the hemagglutinin-Swi6 plasmid in place of swi6Delta (lanes 4-6). Anti-hemagglutinin antibody was used for immunoprecipitations according to Ref. 22. All strains had the silencer deleted in panels a and b. NIP, non-immunoprecipitated; IP, immunoprecipitated; mock, only protein A-agarose beads were used.

To directly assess the localization of Swi6 to the mat loci, we carried out the ChIP assay with wild type and swi7H4 mutant strains in which the hemagglutinin-tagged swi6 gene was inserted in place of the normal swi6 gene. The results of ChIP assay confirmed the Swi6 localization at mat1, mat2, and K regions in wild type cells (Fig. 5b, lane 2) but not in the swi7H4 mutant (Fig. 5b, lane 5). Quantitative PCR showed a reduction in Swi6 localization by >10-fold in the swi7H4 mutant as compared with wild type cells, and the localization at mat1 and mat2 was 5-fold less than that at K region.3 No localization of Swi6 was detected at the control gene, histone H2B (Fig. 5b, lane 2), even by radiolabeling.3

Direct Physical Interaction between Wild Type but Not Mutant DNA polalpha and swi6 in Vivo and in Vitro-- To check whether localization of Swi6 may be because of direct physical interaction between DNA polalpha and Swi6, we checked the binding of recombinant MBP-Polalpha fusion protein to the (His)6-tagged Swi6 protein immobilized on Ni-NTA resin. Results showed that MBP-Polalpha fusion protein was specifically retained by the Ni-NTA resin to which (His)6-tagged Swi6 was immobilized (Fig. 6a, compare lane 5 with lane 6) as the MBP-Polalpha fusion protein appeared in the bound fraction (Fig. 6a, lane 5, EL) but not in the flow through fraction (Fig. 6a, lane 6, FT). MBP alone (Fig. 6a, lanes 11-13) did not bind as it appeared only in the flow through fraction (Fig. 6a, lane 11, FT), not in the bound fraction (Fig. 6a, lane 10, EL). Furthermore, MBP-Polalpha also did not bind to the Ni-NTA resin (Fig. 6a) as it appeared only in the FT fraction not in the bound (EL) fraction when the binding of the MBP-Polalpha to the Ni-NTA resin was checked (Fig. 6a, lanes 9 and 10). These results indicate that polalpha binds specifically to Swi6 in vitro.


View larger version (49K):
[in this window]
[in a new window]
  		Fig. 6.   Polalpha interacts with Swi6 both in vitro and in vivo. a, in vitro interaction. Extracts from uninduced and induced cultures of TB1 cells expressing the MBP-Polalpha fusion protein were immunoblotted with preimmune (lanes 1 and 2) or anti-Polalpha antibody (lanes 3 and 4). Binding of extracts prepared from cells expressing MBP-Polalpha (lanes 5-7) and MBP (lanes 11-13) to (His)6-Swi6 immobilized on Ni-NTA column and MBP-Polalpha fusion protein to Ni-NTA resin (lanes 8-10). The input (lanes 7, 8, and 13), FT fraction (lanes 6, 9, and 12), and bound fraction (EL, lanes 5, 10, and 11) were immunoblotted with anti-Polalpha (lanes 5-7 and lanes 8-10) or MBP antibody (lanes 11-13). b, left panel, copurification of Polalpha and Swi6 by Ni-NTA chromatography of extracts prepared from cells carrying polalpha gene disruption and harboring the plasmid pART1 containing the (His)6-tagged polalpha gene. The extract was subjected to Ni-NTA chromatography. The bound fraction was immunoblotted with anti-Polalpha and Swi6 antibodies. Right panel, binding of GST-Swi6 fusion protein to Ni-NTA beads. The input (lane 1), FT (lane 2), and bound fractions (EL, lane 3) were immunoblotted with anti-GST antibody. c, binding of wild type but not the mutant Polalpha to Swi6 in vitro. Extracts from wild type (lane 1) and swi7H4 mutant (lane 2) were incubated with Ni-NTA resin to which the extract from cells expressing (His)6-tagged swi6 gene was immobilized. FT (lanes 3 and 5) and bound fractions (EL, lanes 4 and 6) for the wild type (lanes 3 and 4) and swi7H4 mutant (lanes 5 and 6) were subjected to immunoblotting with anti-Polalpha antibody.

To check whether polalpha interacts with Swi6 in vivo, we transformed a construct carrying (His)6-tagged polalpha gene in the vector pART1 (20) into a strain carrying a disruption of the polalpha gene, as descried earlier (25). The whole cell extract prepared from these cells was fractionated by Ni-NTA chromatography to purify the (His)6-tagged polalpha protein by elution with 250 mM imidazole and immunoblotted. Interestingly, the bound fraction showed the presence of both polalpha and Swi6 as probed by the respective antibodies (Fig. 6b, left panel). To check whether the binding of Swi6 to the Ni-NTA was because of copurification of Swi6 with polalpha and not due to nonspecific retention by the Ni-NTA resin, the binding of recombinant GST-Swi6 fusion protein to the Ni-NTA column was checked. Results showed that GST-Swi6 does not bind to the Ni-NTA column by itself as it appeared in the flow through (Fig. 6b, right panel, lane 2, FT) but not in the bound (Fig. 6b, right panel, lane 3, EL) fraction. These results strongly argue that polalpha also interacts with Swi6 in vivo.

The delocalization of Swi6 in the swi7H4 mutant may be because of a lack of interaction between the swi7H4 mutant protein and Swi6, or it may be an indirect effect. To check this, we prepared extracts from the wild type and swi7H4 mutant cells and incubated them with Ni-NTA column to which (His)6-tagged Swi6 had been immobilized. After collecting, the FT and the bound (EL) fractions were eluted with 250 mM imidazole. The fractions were subjected to immunoblotting with anti-Polalpha antibody. Interestingly, we observed that although nearly 40% of the polalpha is bound to the Swi6 in the wild type extracts (Fig. 6c, lane 4, EL), no detectable band was observed in the bound fraction of the swi7H4 mutant extract (Fig. 6c, lane 6, EL) as almost all of it appeared in the flow through fraction (Fig. 6c, lane 5, FT). Thus, although the wild type polalpha interacts with Swi6, the swi7H4 mutant polalpha does not give any detectable interaction with Swi6 in vitro.

Silencing Defect Is Displayed by Other polalpha Mutants Localized in Conserved Regions of DNA Polymerase-- To find out whether mutations in certain regions of polalpha are required for silencing, we tested two other ts mutants of polalpha , namely, alpha ts11 and alpha ts13 (26) and the viable mutant of polalpha namely swi7-1 (25). Interestingly, both alpha ts11 and alpha ts13 mutants also exhibited iodine staining (Fig. 7a) and haploid meiosis in the Msmto background, indicating a silencing defect, with alpha ts11 showing a stronger effect (Fig. 7a). However, the swi7-1 mutant, which is defective in generating the double strand break at mat1 locus (23), did not show such a defect (Fig. 7a). The alpha ts11 and swi7H4 mutations map to the homology boxes II and VI, respectively, that are conserved in all DNA polymerases and are located within the nucleotide-binding domain (26), whereas alpha ts13 maps close to the domain D, which is conserved in the alpha  class of DNA polymerases (Fig. 7a; see also Ref. 26). However, the swi7-1 mutation is not located in any conserved region (Fig. 7a; see also Refs. 25 and 27). Thus, the residues involved in silencing are localized to regions that are conserved in all DNA polymerases.


View larger version (41K):
[in this window]
[in a new window]
  		Fig. 7.   A conserved region in Polalpha is involved in silencing and the replication-mediated recruitment model for silencing. a, the domain structure of DNA Polalpha , indicating the location of the mutations studied. The staining of the mutants in the Msmto background is shown except for swi7H4 (Msmto Delta mat2::ura4). Manifestation of the silencing defect (iodine staining and hm) is denoted by +, and its absence is denoted by -. b, the recruitment model for silencing. A hypothetical replication fork initiated from the centromere proximal silencer flanking the silent locus mat2P is visualized. The model proposes that DNA Polalpha is critical for recruiting Swi6 to the silent loci. Thus, Swi6 may bind progressively to the mat loci along with the lagging strand synthesis carried out by Polalpha . The same model may apply to telomere and centromere silencing with some modifications.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Passage through a distinct number of replication cycles is the hallmark of several developmental systems (reviewed in Ref. 28), indicating that replication may help in the setting up of developmentally regulated switches of expression or repression of specific loci or genes. The main objective of this study was to investigate the involvement of DNA replication in the establishment of silencing in fission yeast. Our results, obtained mostly with swi7H4, a replication checkpoint mutant of DNA polalpha , show that this mutation affects silencing at the three main heterochromatin loci in fission yeast namely, mat, cen, and telomere. At the mat loci, the silencing defect is accentuated by the deletion of the cis-acting silencer flanking the mat2 locus. Because this silencer-dependent phenotype is also exhibited by swi6 and clr1-clr4 mutants, we inferred that Polalpha and Swi6/Clr1-Clr4 may participate in the same pathway. Accordingly, we observe that Polalpha and Swi6 interact with each other both in vivo and in vitro. The localization of Swi6 to the mat loci in wild type cells is abolished in the swi7H4 mutant. These findings suggest that DNA polalpha may be directly involved in the localization of Swi6 to the heterochromatin loci. This interpretation is supported by two results. First, the mutant polalpha does not interact with Swi6 in vitro. Second, the effect of the swi7H4 mutation on silencing is not reversed by either polalpha or cds1 genes. The swi7H4 mutation is reported to be defective in the replication checkpoint. Thus, it is possible that an altered chromatin structure generated in the swi7H4 mutant, which signals the checkpoint defect, may lead to delocalization or mislocalization of the heterochromatin-associated proteins such as Swi6. However, this possibility is discounted by the fact that the mutant exhibits normal growth and no residual cut phenotype, indicative of the lack of checkpoint defect at 30 °C, the condition under which the silencing defect is observed. Furthermore, although the cut phenotype observed at 36 °C is suppressed by cds1 and polalpha genes, the silencing defect is not suppressed, indicating that the delocalization of Swi6 is not due to an altered chromatin structure generated by replication checkpoint defect. Lastly, the suppression of the silencing defect in the swi6 mutant by the swi6 gene occurs only if wild type polalpha is present; it does not occur if the swi7H4 mutation is present. Thus, the mutant polalpha exerts a dominant negative effect. These results, together with the observation that the mutations that have the strongest effect on silencing (such as alpha ts11 and swi7H4) are localized in regions that are conserved in all DNA polymerases, suggest that DNA polymerase alpha  may directly bind to Swi6 and possibly indirectly to other silencing factors such as Clr1-Clr4 and Rik1 and effect assembly of heterochromatin structure at the mat, cen, and telomere loci.

Recently, Swi6 has been shown to be present at the mat loci at a constant level throughout the cell cycle (29). An increased dosage of Swi6 was shown to shift the metastable derepressed epigenetic state, generated by the deletion of the K region spanning the mat2-3 interval, to the repressed state (29), suggesting an imprinting function of Swi6 in establishing the repressed chromatin state. However, subsequent studies have shown that the function of Clr4, which methylates the histone H3 at Lys-9 position (to which Swi6 binds specifically) must occur prior to Swi6 (16, 17). Interestingly, it was shown earlier that localization of Swi6 is disrupted in the clr4 and rik1 mutants (13). In light of the present study, where we have demonstrated that Polalpha is also required for proper localization of Swi6, the respective roles of Polalpha and Clr4 and Rik1 are not clear. They may be involved in parallel, redundant functions, or Polalpha may act in concert with Clr4/Rik1, wherein a close interaction of Polalpha with the Swi6/Clr4/Rik1 complex may bring about a concerted chain of events involving recruitment of Clr4 and Swi6 to mat, cen, and telomere loci, histone H3-Lys-9 methylation, and subsequent binding of Swi6.

Based on these results, including the involvement of silencer/ARS function in mediating the function of Swi6 and Polalpha , we propose the replication-mediated recruitment model of silencing wherein Polalpha , while initiating lagging strand DNA synthesis from the putative replication origins flanking mat2 (and presumably mat3) recruits Swi6. Among the trans-acting factors, Clr4 and Swi6 contain the chromodomain motif conserved in the heterochromatin-associated proteins (15, 30). Clr4 also contains the SET domain, which methylates the histone H3 at the lysine 9 position (16, 31). However, Swi6 binding to the methylated Lys-9 in histone H3 is required for silencing (17). Our results suggest that Polalpha may recruit Swi6 through direct interaction. After binding to the methylated Lys-9 of histone H3 in the nucleosomes (16, 17), Swi6 may form multimers (24), leading to a cooperative folding of the heterochromatin structure at the mat, telomere, and centromere regions. Because Swi6 is bound to the mat region throughout the cell cycle (29), the role of polalpha may be to recruit Swi6 to the newly replicated DNA strands. In addition, silencing is associated with the hypoacetylation of histone H4 (29). It remains to be determined whether the Lys-9 methylation in histone H3 or acetylation level of histone H4 are altered in the swi7H4 mutant. Further studies will help to decipher the order of events involved in heterochromatin assembly with respect to DNA replication.

The role of DNA replication in silencing has been actively investigated in S. cerevisiae. Recently, it was shown that in a setup where the rate-limiting silent information regulator Sir1p was recruited independently of the cis-acting silencer/ARS, silencing could be decoupled from DNA replication (3, 4), although passage through S phase was still essential. However, in normal cells, the recruitment of Sir1p is presumably through the origin recognition complex (ORC), which suggests that at least in normal cells, the assembly of the functional replication origin is critical for silencing (2). Likewise, several reports have linked replication and chromatin assembly with silencing. For example, mutations in proliferating cell nuclear antigen, replication factor-C, Polepsilon , and POLalpha are shown to affect silencing in S. cerevisiae (32-34). Proliferating cell nuclear antigen has been shown to be important for proper positioning of nucleosomes in the in vitro chromatin assembly function of CAF1 (35). Similarly, mutations in the chromatin assembly factor CAF1 affect the inheritance of the marked epigenetic states in S. cerevisiae (36).

In view of the above, our results for the first time provide evidence for a direct role of DNA replication in the assembly of the heterochromatin state. Our recent results show that the dark phenotype of the swi7H4 mutant exhibits stable inheritance during mitosis and converts to the silent state at a low rate (37, 38). In the meiotic cross as well, these alternate states behave similar to stable Mendelian genetic markers (37, 38). Thus, our studies suggest that DNA polymerase alpha  may perform an imprinting function in establishing a chromatin state that is competent to recruit the components of the heterochromatin machinery, similar to Swi6. Because Polalpha and Swi6 are important and conserved components of DNA replication and heterochromatin assembly, respectively, the Polalpha -Swi6 interaction may be highly conserved during evolution and may serve as a model for gene regulation during development in higher eukaryotes.

    ACKNOWLEDGEMENTS

We thank J. Partridge, M. Yanagida, and P. B. Singh for gift of strains, plasmids, and antibodies. The gifts of the swi7H4 strain and the cds1 plasmid by H. Okayama, the swi6 deletion strain, anti-Swi6 antibody, and gfp-Swi6 plasmid by R. Allshire, and the mutants alpha ts11 and alpha ts13 by T. Wang are specially acknowledged. Special thanks to Raj Kumar for expert technical assistance.

    FOOTNOTES

* This work was supported by the financial help of the Council of Scientific and Industrial research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed: Institute of Microbial Technology, Sector 39A, Chandigarh 160 036, India; Tel.: 0091-172-695215, Ext. 443; Fax: 0091-172-690585, 690632; E-mail: jag@imtech.res.in.

Published, JBC Papers in Press, October 1, 2001, DOI 10.1074/jbc.M109186200

1 R. N. Dubey and J. Singh, unpublished data.

3 S. Ahmed and J. Singh, unpublished results.

    ABBREVIATIONS

The abbreviations used are: MBP, maltose binding protein; PCR, polymerase chain reaction; polalpha , DNA polymerase alpha ; swi, switch; clr, cryptic loci regulator; Rhp6, rad6 homologue in S. pombe; ChIP, chromatin immunoprecipitation; cen, centromere; GST, glutathione S-transferase; ts, temperature-sensitive; Ni-NTA, nickel nitrilotriacetic acid; gfp, green fluorescent protein; FT, flow through; EL, eluate; FOA, 5-fluorooiotic acid; PMA, pombe minimal medium plus adenine; hm, haploid meiosis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Klar, A. J. S. (1992) in The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression (Jones, E. W., Pringle, J. K., and Broach, J., eds), pp. 583-656, Vol. 2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
2. Loo, S., and Rine, J. (1995) Annu. Rev. Cell Dev. Biol. 11, 519-548[CrossRef][Medline] [Order article via Infotrieve]
3. Kirchmaier, A. L., and Rine, J. (2001) Science 291, 646-650[Abstract/Free Full Text]
4. Li, Y-C., Cheng, T-H., and Gartenberg, M. R. (2001) Science 291, 650-653[Abstract/Free Full Text]
5. Lorentz, A., Heim, L., and Schmidt, H. (1992) Mol. Gen. Genet. 233, 436-442[Medline] [Order article via Infotrieve]
6. Thon, G., and Klar, A. J. S. (1993) Genetics 131, 287-296[Abstract]
7. Ekwall, K., and Ruusala, T. (1994) Genetics 136, 53-64[Abstract]
8. Thon, G., Cohen, A., and Klar, A. J. S. (1994) Genetics 138, 29-38[Abstract]
9. Grewal, S. I. S., Bonaduce, M., and Klar, A. J. S. (1998) Genetics 150, 563-576[Abstract/Free Full Text]
10. Singh, J., Goel, V., and Klar, A. J. S. (1998) Mol. Cell. Biol. 18, 5511-5522[Abstract/Free Full Text]
11. Ekwall, K., Nielsen, O., and Ruusala, T. (1991) Yeast 7, 745-755[CrossRef][Medline] [Order article via Infotrieve]
12. Olsson, T., Ekwall, K., and Ruusala, T. (1993) Nucleic Acids Res. 21, 855-861[Abstract/Free Full Text]
13. Ekwall, K., Nimmo, E. R., Javerzat, J-P., Borgstrom, B., Egel, R., Cranston, G., and Allshire, R. (1996) J. Cell Sci. 109, 2637-2648[Abstract]
14. Allshire, R. C., Nimmo, E. R., Ekwall, K., Javerzat, J-P., and Cranston, G. (1995) Genes Dev. 9, 218-233[Abstract/Free Full Text]
15. Lorentz, A., Ostermann, K., Fleck, O., and Schmidt, H. (1994) Gene (Amst.) 143, 139-143[CrossRef][Medline] [Order article via Infotrieve]
16. Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B. D., Sun, Z. W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D., and Jenuwein, T. (2000) Nature 406, 593-599[CrossRef][Medline] [Order article via Infotrieve]
17. Bannister, A. J., Zegerman, P., Partridge, J., Miska, E. A., Thomas, J. O., Allshire, R., and Kouzarides, T. (2001) Nature 410, 120-124[CrossRef][Medline] [Order article via Infotrieve]
18. Waga, S., and Stillman, B. (1998) Annu. Rev. Biochem. 67, 721-751[CrossRef][Medline] [Order article via Infotrieve]
19. Murakami, H., and Okayama, H. (1995) Nature 374, 817-819[CrossRef][Medline] [Order article via Infotrieve]
20. Moreno, S., Klar, A. J. S., and Nurse, P. (1990) Methods Enzymol. 194, 795-823
21. Nimmo, E. R., Pidoux, A. L., Perry, P. E., and Allshire, R. C. (1998) Nature 392, 825-828[CrossRef][Medline] [Order article via Infotrieve]
22. Ekwall, K., and Partridge, C. F. (1999) in Chromosome Structural Analysis: A Practical Approach (Bickmore, W., ed) , pp. 47-57, Oxford University Press
23. Pidoux, A. L., Ozawa, S., Perry, P. E., Cande, W. Z., and Allshire, R. C. (2000) J. Cell Sci. 113, 4177-4191[Abstract]
24. Wang, G., Ma, A., Chow, C. M., Horsley, D., Brown, N. R., Cowell, I. G., and Singh, P. B. (2000) Mol. Cell. Biol. 20, 6970-6983[Abstract/Free Full Text]
25. Singh, J., and Klar, A. J. S. (1993) Nature 361, 271-273[CrossRef][Medline] [Order article via Infotrieve]
26. Bhaumik, D., and Wang, T. (1998) Mol. Biol. Cell 9, 2107-2123[Abstract/Free Full Text]
27. Wang, T. S., Wong, S. W., and Korn, D. (1989) FASEB J. 3, 14-21[Abstract]
28. Wolffe, A. (1991) J. Cell Sci. 99, 201-206[Abstract/Free Full Text]
29. Nakayama, J., Klar, A. J. S., and Grewal, S. I. S. (2000) Cell 101, 307-317[CrossRef][Medline] [Order article via Infotrieve]
30. Singh, P. B. (1994) J. Cell Sci. 107, 2653-2668[Medline] [Order article via Infotrieve]
31. Ivanova, A. V., Bonaduce, M. J., Ivanov, S. V., and Klar, A. J. S. (1998) Nat. Genet. 19, 192-195[CrossRef][Medline] [Order article via Infotrieve]
32. Ehrenhofer-Murray, A. E., Kamakaka, R. T., and Rine, J. (1999) Genetics 153, 1171-1182[Abstract/Free Full Text]
33. Smith, S. S., Caputo, E., and Boeke, J. D. (1999) Mol. Cell. Biol. 19, 3184-3197[Abstract/Free Full Text]
34. Zhang, Z., Shibahara, K., and Stillman, B. (2000) Nature 408, 221-225[CrossRef][Medline] [Order article via Infotrieve]
35. Shibahara, K., and Stillman, B. (1999) Cell 96, 575-585[CrossRef][Medline] [Order article via Infotrieve]
36. Enomoto, S., and Berman, J. (1998) Genes Dev. 12, 219-232[Abstract/Free Full Text]
37. Ahmed, S. (2000) Towards Understanding the DNA Polymerase alpha -mediated Mechanism Involved in Gene Silencing and Adaptive Mutation in Schizo Saccharomyces pombePh.D. thesis , Panjab University, Chandigarh, India
38. Ahmed, S., and Singh, J. (2001) Curr. Sci. (Bangalore) 80, 1337-1343

Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Plant CellHome page
J. M. Barrero, R. Gonzalez-Bayon, J. C. del Pozo, M. R. Ponce, and J. L. Micol
INCURVATA2 Encodes the Catalytic Subunit of DNA Polymerase {alpha} and Interacts with Genes Involved in Chromatin-Mediated Cellular Memory in Arabidopsis thaliana
PLANT CELL, September 1, 2007; 19(9): 2822 - 2838.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Nakamura, A. Nabetani, T. Mizuno, F. Hanaoka, and F. Ishikawa
Alterations of DNA and Chromatin Structures at Telomeres and Genetic Instability in Mouse Cells Defective in DNA Polymerase {alpha}
Mol. Cell. Biol., December 15, 2005; 25(24): 11073 - 11088.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
D. R. Williams and J. R. McIntosh
Mcl1p Is a Polymerase {alpha} Replication Accessory Factor Important for S-Phase DNA Damage Survival
Eukaryot. Cell, January 1, 2005; 4(1): 166 - 177.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
B.-S. Lee, S. I. S. Grewal, and A. J. S. Klar
Biochemical Interactions between Proteins and mat1 cis-Acting Sequences Required for Imprinting in Fission Yeast
Mol. Cell. Biol., November 15, 2004; 24(22): 9813 - 9822.
[Abstract] [Full Text] [PDF]