HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 52, 48693-48701, December 28, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/52/48693    most recent M108282200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Caivano, M. Articles by Poli, V. Search for Related Content PubMed PubMed Citation Articles by Caivano, M. Articles by Poli, V.

The Induction of Cyclooxygenase-2 mRNA in Macrophages Is Biphasic and Requires both CCAAT Enhancer-binding protein  (C/EBP) and C/EBP Transcription Factors^*

Matilde Caivano, Barbara Gorgoni^§¶, Philip Cohen, and Valeria Poli^§

From the School of Life Sciences, ^§ Wellcome Trust Biocentre, and  Medical Research Council Protein Phosphorylation Unit, University of Dundee, Dundee DD1 5EH, Scotland

Received for publication, August 28, 2001, and in revised form, October 12, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Prostaglandins are important mediators of activated macrophage functions, and their inducible synthesis is mediated by cyclooxygenase-2 (COX-2). Here, we make use of the murine macrophage cells RAW264 as well as of immortalized macrophages derived from mice deficient for the transcription factor CCAAT enhancer-binding protein  (C/EBP) to explore the molecular mechanisms regulating COX-2 induction in activated macrophages. We demonstrate that lipopolysaccharide-mediated COX-2 mRNA induction is biphasic. The initial phase is independent of de novo protein synthesis, correlates with cAMP-response element-binding protein (CREB) activation, is inhibited by treatments that abolish CREB phosphorylation and reduce NF-B-mediated gene activation, and requires the presence of the transcription factor C/EBP. On the other hand, C/EBP appears to be essential in addition to C/EBP to effect the second phase of COX-2 gene transcription, which is important for maintaining the induced state and requires de novo protein synthesis. Indeed, both phases of COX-2 induction were defective in C/EBP/ macrophages. Moreover, the synthesis of C/EBP was increased dramatically by treatment with lipopolysaccharide and, like COX-2 induction, repressed by combined inhibition of the MAPK and of the SAPK2/p38 cascades. Taken together, these data identify CREB, NF-B, and both C/EBP and - as key factors in coordinately orchestrating transcription from the COX-2 promoter in activated macrophages.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cyclooxygenase-2 (COX-2)¹ is a key enzyme catalyzing the rate-limiting step in the inducible production of prostaglandins (PG), and its synthesis can be readily induced in many different cell types in response to a variety of stimuli (1). Although the contrasting biological properties of the different prostanoids make it difficult to define their roles in physiological processes unambiguously, PG secretion by activated macrophages clearly represents an important step in the inflammatory process (2). Indeed, COX-2, as well as COX-1, the isoform responsible for the basal steady state production of PG, represents the main target for nonsteroidal anti-inflammatory drugs, and compounds that can specifically inhibit the inducible but not the basal production of PG (i.e. COX-2 but not COX-1 activity) are being tested for the treatment of chronic inflammatory diseases such as rheumatoid arthritis or ulcerative colitis (3-5).

Many studies have therefore recently focused on the mechanisms regulating inducible COX-2 expression in monocytic cells. Three main cis-acting elements have been identified on the murine COX-2 promoter that play a role in LPS-mediated induction of COX-2 transcription in macrophages. NF-B is a transcription factor involved in LPS-mediated induction of many cytokines and inflammatory products, and inhibition of NF-B activity has been reported to impair COX-2 mRNA induction (6-11). The 138/130 C/EBP element is generally believed to play an important role in COX-2 promoter induction in macrophages as well as in other cell types, mainly through interactions with the two C/EBP family members C/EBP and - (9-16). Finally, the overlapping CRE/E-box recognition sequence located at positions 59/48 appears to be the most generally required promoter element, being essential for both basal and induced COX-2 transcription in most cellular systems analyzed (10, 12, 13, 15-21).

We and others have previously shown that stimulation of macrophages with LPS elicits the activation of the classical mitogen-activated protein kinase (MAPK) cascade and the homologous stress-activated protein kinase 2 (SAPK2)/p38 pathway (7, 22, 23). Moreover, combined suppression of these pathways utilizing the small cell-permeant inhibitors PD 98059 (24, 25) or U0126 (26), which specifically inhibit the activation of the MAPK kinase-1, together with SB 203580, a specific inhibitor of SAPK2/p38 activity (27), resulted in the coordinated inhibition of LPS-stimulated CREB/ATF1 phosphorylation and COX-2 mRNA and protein induction (28). However, the protein kinase A-mediated phosphorylation of CREB following cell treatment with forskolin did not trigger detectable COX-2 protein induction, suggesting that CREB activation, even if required, is not sufficient to activate COX-2 expression (28). Serendipitously, we have recently observed that COX-2 expression in response to LPS was profoundly impaired in macrophages derived from mice where the transcription factor C/EBP was inactivated (29). COX-2 induction could be rescued by transient or stable re-expression of C/EBP, suggesting that this factor is required for efficient COX-2 gene transcription in macrophages. Here we explore the kinetics of COX-2 mRNA induction and how it correlates with the induced activities of CREB and C/EBP factors, making use of both the murine macrophage cell line RAW264 and immortalized C/EBP/ or +/+ macrophages. We demonstrate the existence of two waves of COX-2 induction. The first does not involve de novo protein synthesis, correlates with CREB and NF-B activation, and requires preexisting C/EBP, while the second involves newly synthesized C/EBP and requires the DNA binding activity of C/EBP·C/EBP heterodimers.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Reagents and antibiotics for tissue culture were purchased from Life Technologies (Paisley, UK); SB 203580 and U0126 were from Calbiochem (Nottingham, UK); forskolin and 3-isobutyl-1-methylxanthine (IBMX) were from Sigma (Poole, UK); complete protease inhibitor mixture was from Roche Molecular Biochemicals; monoclonal mouse anti-C/EBP and polyclonal anti-C/EBP, -, -, and - antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); affinity-purified polyclonal rabbit anti-phospho-CREB and anti-CREB were from Upstate Biotechnology, Inc. (Lake Placid, NY); affinity-purified polyclonal rabbit anti-IB was from New England Biolabs (Hertfordshire, UK); enhanced chemiluminescence (ECL) reagent was from Amersham Biosciences, Inc. (Little Chalfont, UK); the RNeasy Mini Kit was from Qiagen (Crawley, West Sussex, UK); the Access reverse transcriptase (RT)-PCR system was from Promega (Southampton, UK); and Coomassie Protein Assay Reagent was from Pierce (Cheshire, UK). Murine RAW264 macrophages were obtained from the European Cell Culture Collection (Salisbury, Wiltshire, UK). Interferon- was kindly provided by Dr. G. Garotta, (Ares-Serono, Geneve, Switzerland). LPS was a generous gift from Dr. John Lee (SmithKline Beecham).

Cell Culture and Stimulation-- RAW264 macrophages were maintained at 37 °C in 5% CO₂ atmosphere in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) heat-inactivated fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin. 2 h before stimulation, the medium was removed and replaced with 2 ml of Dulbecco's modified Eagle's medium. The cells were then stimulated with 100 ng/ml LPS or 20 µM forskolin plus 10 µM IBMX for the times indicated in the figure legends. Where indicated, SB 203580 (10 µM) and/or U0126 (10 µM) were added 1 h before stimulation.

The generation of C/EBP / and +/+ immortalized macrophages is described elsewhere.² The cells were maintained at 37 °C in a 5% CO₂ atmosphere in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum containing 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin. Cells at ~70% confluence were stimulated with 100 units/ml of interferon- for 16 h and with 100 ng/ml LPS for the indicated times.

Cell Lysis-- After stimulation, the medium was aspirated, and the cells were solubilized in 0.2 ml of ice-cold lysis buffer (50 mM Tris acetate (pH 7.0), 1 mM EDTA, 1 mM EGTA, 1% (w/v) Triton X-100, 1 mM sodium orthovanadate, 10 mM sodium glycerophosphate, 50 mM NaF, 5 mM sodium pyrophosphate, 0.27 M sucrose, 1 µM microcystin-LR, 1 mM benzamidine, 0.1% (v/v) 2-mercaptoethanol, and "complete" protease inhibitor mixture (one tablet/50 ml). The samples were then snap frozen in liquid nitrogen and stored in aliquots at 80 °C until analysis. Protein concentrations were determined using the Coomassie Protein Assay Reagent.

Nuclear Extracts-- After stimulation, the cells were resuspended, washed three times in Buffer A (10 mM Hepes (pH 7.9), 1.5 mM MgCl₂, 10 mM KCl, 1 mM dithiothreitol, 0.1 mM sodium orthovanadate, 10 mM sodium glycerophosphate, 1 µM microcystin-LR, 1 mM benzamidine, 0.1% (v/v) 2-mercaptoethanol, and "complete" protease inhibitor mixture), lysed in Buffer A plus 0.1% (v/v) Nonidet P-40 for 5 min on ice, and then spun at 13,500 × g for 10 min at 4 °C. The nuclear pellet was resuspended in Buffer B (20 mM Hepes (pH 7.9), 1.5 mM MgCl₂, 420 mM NaCl, 1 mM dithiothreitol, 0.1 mM sodium orthovanadate, 10 mM sodium glycerophosphate, 1 µM microcystin-LR, 1 mM benzamidine, 0.1% (v/v) 2-mercaptoethanol and "complete" protease inhibitor mixture) rotated end over end for 15 min at 4 °C, and then sonicated in a 10 °C water bath (four 15-s pulses over 4 min). The samples were centrifuged at 13,500 × g for 15 min at 4 °C, and the supernatants were removed, snap frozen in liquid nitrogen, and stored in aliquots at 80 °C until analysis. Protein concentrations were determined using the Coomassie Protein Assay Reagent.

Immunoblotting Analysis-- Proteins were denatured in SDS, electrophoresed on a 4-12% SDS-polyacrylamide gel, and transferred to nitrocellulose membranes. Ponceau S staining was performed in order to ensure equivalent gel loading. Membranes were then incubated with the antibodies described below, which were detected using the enhanced chemiluminescence reagent (ECL). For immunoblotting of C/EBP or C/EBP, 50 µg of nuclear cell extracts were electrophoresed and immunoblotted using a monoclonal C/EBP antibody or a polyclonal C/EBP antibody, respectively. For immunoblotting of IB, 30 µg of total proteins were electrophoresed and immunoblotted using a polyclonal anti-IB antibody. For immunoblotting CREB, cell lysates (30 µg of protein) were electrophoresed and immunoblotted using, respectively, an anti-CREB antibody or an anti-phosphospecific CREB antibody recognizing CREB phosphorylated at Ser¹³³ and ATF-1 phosphorylated at Ser⁶³.

Electrophoretic Mobility Shift Assays (EMSAs)-- EMSA probes were made by annealing single-stranded oligonucleotides with 5'-GATC overhangs. 1 pmol of probe was radiolabeled by filling in with [-³²P]dATP using the Klenow enzyme. The labeled probes were purified on a Sephadex G-50 spin column. Sequences are as follows: C/EBP, 5'-GATCCTGCCGCTGCGGTTCTTGCGCAACTCACT-3'; HpxA C/EBP site, 5'-TATTTGCAGTGATGTAATCAGC-3'; NF-B, 5'-GATCGAGAGGTGAGGGGATTCCCTTAGTTAGGA-3'; CRE/E-box, 5'-GATCGTCACCACTACGTCACGTGGAGTCCGCTT-3'.

EMSAs were performed with 4 µg of nuclear extract in 20 mM Hepes (pH 7.9), 1 mM EDTA, and 2.5 mM dithiothreitol, containing 3 µg of poly(dI-dC). The complexes were separated by electrophoresis on a 6% (for C/EBP) or 5% (for NF-B and CRE/E-box) polyacrylamide-0.25× Tris borate-EDTA gel. For supershift experiments, 2 µl of polyclonal purified antibody was incubated with nuclear extracts and poly(dI-dC) for 30 min on ice prior to the probe addition. Unlabeled double-stranded oligonucleotide competitors were preincubated at a 50-fold molar excess 10 min prior to the probe addition.

RT-PCR-- Total RNA was prepared from LPS-stimulated or control RAW264 cells using the RNeasy Mini Kit according to the manufacturer's protocol. Total RNA was measured, and 50 ng was reverse transcribed using Promega avian myeloblastosis virus reverse transcriptase (5 units/ml) with the oligonucleotides GTTGGATACAGGCCAGACTTTGTTG and GAGGGTAGGCTGGCCTATAGGCT (for amplification of the "housekeeping gene," hypoxanthine guanine phosphoribosyltransferase (HPRT)), together with those for the COX-2 gene (CAGCAAATCCTTGCTGTTCC and TGGGCAAAGAATGCAAACATC) or for the C/EBP gene (CGGCACAGTCCGAGAAAAGG and TTGAAGAACTGCCGGAGGCC). Conditions for PCR amplification of the resulting first-strand DNA template were 94 °C denaturing for 30 s, 60 °C annealing for 1 min, 68 °C extension for 1 min, 30 cycles using thermostable Tfl DNA polymerase (5 units/ml), and 1 mM MgSO₄. The PCR products showed a band of 515 bp for COX-2, a band of 233 bp for C/EBP, and a band of 352 bp for HPRT.

Statistical Analysis-- Results obtained after densitometric quantifications were analyzed using the two-tailed t test. A p value of <0.05 was considered statistically significant.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

COX-2 mRNA Induction Is Biphasic-- Phosphorylation of CREB obtained by treatment of RAW264 macrophages with forskolin and IBMX did not trigger detectable accumulation of COX-2 protein after 4 h, suggesting that a distinct factor(s) induced by LPS but not by forskolin is required for COX-2 induction (28). Since, however, forskolin induces a faster and more transient phosphorylation of CREB compared with LPS stimulation, we decided to also analyze COX-2 mRNA induction at shorter time points. Indeed, forskolin was able to trigger an increase of the COX-2 mRNA (1.8-fold) already after 30 min of treatment (Fig. 1A, compare lanes 1 and 2), corresponding to maximal CREB phosphorylation (28). This induction peaked (3.3-fold) 1 h after the treatment (Fig. 1A, lane 3) and rapidly decreased, having almost returned to unstimulated levels (1.14-fold) by 2 h (Fig. 1A, lanes 4-6).

View larger version (39K): [in this window] [in a new window]   Fig. 1.   COX-2 mRNA induction in RAW264 macrophages as determined by semiquantitative RT-PCR. A, cells were left untreated or stimulated for the times indicated with 20 µM forskolin plus 10 µM IBMX, and total RNA was extracted and subjected to RT-PCR using specific primers for COX-2 and HPRT (internal control). Densitometric analysis of three independent experiments was carried out. COX-2 values were normalized against HPRT values, and statistical analysis was performed using a two-tailed t test. The differences between lanes 1 and 2 or lanes 1 and 3 were found to be statistically significant (p  0.0002). B, cells were incubated for 30 min in the presence or absence of 50 µg/ml CHX and then stimulated for 1.5 or 4 h with or without LPS (100 ng/ml) in the continuous presence or absence of the inhibitor. Total RNA was extracted and analyzed as in A. Densitometric and statistical analysis was performed as in A. The differences between lanes 1 and 2 or lanes 5 and 6 (p < 0.0005) and between lanes 6 and 8 (p < 0.0001) were statistically significant.

A number of studies have indicated that LPS-mediated COX-2 mRNA induction in macrophages does not require de novo protein synthesis (30-33), compatible with the quick activation kinetics observed. In agreement with these reports, the increase of COX-2 mRNA induced by 1.5 h of LPS treatment was not affected by pretreatment with the protein synthesis inhibitor cycloheximide (CHX) (Fig. 1B, compare lanes 2 and 4, 8.6 ± 0.33- versus 7.6 ± 0.61-fold induction), which, as already reported (33-35) caused by itself a slight (2.38 ± 0.34-fold) induction (Fig. 1B, lanes 3 and 7). Interestingly, however, CHX pretreatment did abolish COX-2 mRNA induction following a longer treatment with LPS (Fig. 1B, compare lane 6 (21.7 ± 0.64-fold induction) with lane 8 (7.95 ± 0.93-fold induction) and lane 7 (9.77 ± 1.67-fold induction after treatment with CHX alone), suggesting that de novo protein synthesis is involved in the later phases of COX-2 transcription.

Taken together, these results suggest a biphasic activation of the COX-2 gene. The first phase, corresponding to the initial activation, correlates with the kinetics of CREB phosphorylation and does not involve de novo protein synthesis, while the second phase, involved in the maintenance of the induced state, requires the action of some newly synthesized factor(s).

The LPS-mediated Induction of C/EBP, but Not of C/EBP, Is Suppressed by Treatment with U0126 plus SB 203580-- Members of the C/EBP family, and particularly C/EBP and -, may well be involved in the second phase of COX-2 transcriptional induction, since their synthesis is increased by LPS in a number of cell types (36). We have therefore analyzed their induction following LPS treatment in the presence or absence of the protein kinase inhibitors that abolish COX-2 expression. C/EBP is already present in untreated macrophages, but it is increased by 2-3-fold following LPS treatment, peaking at 4 h (not shown). We have shown previously that treatment with PD 98059 and/or SB 203580 did not affect the induction of C/EBP triggered by LPS (28). Indeed, U0126 and SB 203580, alone or in combination, were unable to modify the 3-fold LPS-induced increase of all three C/EBP isoforms, the full-length protein (FL), the liver-activating protein (LAP), and the liver-inhibitory protein (LIP) (Fig. 2A, upper panel, compare lane 1 with lanes 2-5).

View larger version (48K): [in this window] [in a new window]   Fig. 2.   Effect of different protein kinase inhibitors on the LPS-mediated induction of C/EBP and  synthesis and C/EBP DNA binding activity in RAW264 macrophages. A, cells were incubated for 1 h in the presence or absence of SB 203580 (SB) and/or U0126 (U) and then stimulated for 4 h with or without 100 ng/ml LPS in the continuous presence or absence of the inhibitors. Nuclear extracts were prepared and immunoblotted with an anti-C/EBP antibody (upper panel) that recognizes all three isoforms of the protein, full length (FL), liver-activating protein (LAP), and liver-inhibitory protein (LIP) (indicated by the arrows) or an anti-C/EBP antibody (lower panel). Equivalent gel loading was assessed by Ponceau S staining of each filter prior to immunostaining. Densitometric and statistical analysis of three independent experiments was performed. The differences between lanes 1 and 2 of the upper and lower panels (p < 0.003) and between lanes 2 and 5 of the lower panel (p = 0.001) were found to be statistically significant. B, nuclear extracts prepared as in A were analyzed by EMSA using the 198/130 C/EBP site from the murine COX-2 promoter as a probe. The arrows and numbers on the left indicate the different DNA-protein complexes detected. Densitometric and statistical analysis of complexes 1 and 2 from three independent experiments was performed. The differences between lanes 1 and 2 and lanes 3 and 4 (p = 0.04) and between lanes 3 and 4 and lanes 9 and 10 (p = 0.03) were found to be statistically significant. C, nuclear extracts were prepared and analyzed as in B. Where indicated, polyclonal antibodies directed against different C/EBP isoforms (C/EBP, -, -, or -) were also included in the incubation mix. For competition experiments, a 50-fold molar excess of one of the following unlabeled oligonucleotides was used: 138/130 COX-2 C/EBP site (self) or C/EBP site from the hemopexin promoter (HpxA). Densitometric and statistical analysis of complexes 1 and 2 from three independent experiments was performed. The differences between lanes 1 and 3 (p = 0.0005), between lanes 8 and 10 (p = 0.0001), between lanes 8 and 11 (p = 0.02), and between lanes 15 and 17 (p = 0.004) were found to be statistically significant.

The levels of C/EBP were in contrast almost undetectable in untreated RAW264 cells, but they were increased dramatically following LPS treatment (Fig. 2A, lower panel, compare lanes 1 and 2). Strikingly, the LPS-mediated induction of C/EBP was almost totally abolished by combined treatment with U0126 plus SB 203580 (Fig. 2A, lower panel, compare lanes 2 and 5) and only slightly decreased by treatment with either compound alone (lanes 3 and 4). This is in marked contrast to what was observed with C/EBP, and suggests that C/EBP may represent the factor, or one of the factors, whose synthesis is required to maintain COX-2 transcriptional induction.

Treatment with U0126 plus SB203580 Abolishes the Induction of C/EBP·C/EBP DNA Binding Activities-- Next, we analyzed by EMSA the DNA-protein interactions occurring at the level of the 138/130 C/EBP site from the murine COX-2 promoter. Four differentially migrating complexes could be detected using nuclear extracts from untreated RAW264 cells (Fig. 2B, lanes 1, 2, and 11). Complexes 1 and 2 were induced by 5-fold upon LPS treatment (Fig. 2B, compare lanes 1 and 2 with lanes 3 and 4, and compare lane 11 with lane 13). This increase was reduced by 50% by treatment with either SB 203580 or U0126 alone (Fig. 2B, lanes 5 and 6 or lanes 7 and 8, respectively) and completely abolished by a combination of the two compounds (Fig. 2B, compare lanes 3 and 4 with lanes 9 and 10, and compare lane 13 with lane 14). The inhibition of DNA binding appeared to be specific to the newly induced activities, since the inhibitors did not affect the formation of complexes using extracts from untreated cells (Fig. 2B, compare lanes 11 and 12).

All DNA-protein complexes detected at the level of the COX-2 C/EBP site could be abolished by an excess of unlabeled double-stranded oligonucleotide carrying either the same sequence (self) or the sequence of a known C/EBP binding site from the hemopexin promoter (HpxA) (Fig. 2C, lanes 6 and 7, 13 and 14, and 20 and 21), but not by an unrelated oligonucleotide (not shown). To assess if C/EBP proteins were involved in the formation of the different complexes detected and particularly of induced complexes 1 and 2, we performed supershift experiments using polyclonal antibodies against C/EBP, -, -, or - and nuclear extracts from RAW264 cells either untreated or treated with LPS (Fig. 2C). In extracts from untreated cells, all complexes could be supershifted by anti-C/EBP antibodies (Fig. 2C, lane 3) and did not contain any of the other tested C/EBP family members, as confirmed by densitometric analysis of the retarded bands (Fig. 2C, lanes 2, 4, and 5), although the same antibodies could readily supershift complexes obtained with different extracts and probes (data not shown). Upon LPS treatment, still no binding of either C/EBP or C/EBP could be detected (Fig. 2C, lanes 9 and 12), while C/EBP was involved in the formation of all four complexes, since all, including those induced by LPS, were abolished by specific antibodies raised against this protein (Fig. 2C, lane 10). C/EBP, which was absent from the complexes formed using extracts from untreated cells, was in contrast detected as part of the LPS-induced complexes 1 and 2, 40% of which could be supershifted by anti-C/EBP antibodies (Fig. 2C, lane 11). Of note, the amount of complexes supershifted could not be increased using more anti-C/EBP antibodies (data not shown). Taken together, these data suggest that complexes 1 and 2 only contain C/EBP homodimers in untreated RAW264 macrophages, while they are formed partly of C/EBP homodimers and partly of C/EBP·C/EBP heterodimers in LPS-treated cells.

We next asked whether binding of C/EBP, C/EBP, or both was affected by U0126 and SB 203580. As expected, all residual DNA-protein complexes obtained upon LPS treatment in the presence of U0126 and SB 203580 could still be supershifted by anti-C/EBP antibodies (Fig. 2C, lane 17). Interestingly, as confirmed by densitometric analysis, no supershift with anti-C/EBP antibodies could be detected anymore after treatment with the inhibitors (Fig. 2C, lane 18), suggesting that the DNA binding activity involving C/EBP·C/EBP heterodimers may represent the main target for U0126 and SB 203580 action.

DNA Binding to the CRE/E-box and NF-B Elements of the COX-2 Promoter Is Not Impaired following U0126 and SB 203580 Treatment-- To verify if the inhibition of DNA binding by treatment with U0126 and SB 203580 is specifically limited to the C/EBP proteins among the factors playing a role in COX-2 gene transcription, we have examined the pattern of DNA-protein complexes forming at the level of the two other main cis-acting elements involved in the LPS-inducible activation of the COX-2 promoter. EMSA experiments were therefore performed using the CRE/E-box element located at positions 59/48 and the 402/392 NF-B binding site as probes and nuclear extracts from RAW264 cells either untreated or treated with LPS in the presence or absence of a combination of U0126 and SB 203580 (Fig. 3).

View larger version (26K): [in this window] [in a new window]   Fig. 3.   Effect of protein kinase inhibitors on the binding to other COX-2 promoter sites and on the induction of IB. Nuclear extracts from RAW264 macrophages either untreated or treated as in Fig. 2A were analyzed by EMSA using the 59/48 CRE/E-box (A) or the 402/392 NF-B site (B) from the murine COX-2 promoter as a probe. F, free probe. Densitometric and statistical analysis of two independent experiments was performed. In B, the differences between lanes 3 and 4 or lanes 5 and 6 (p  0.001) were statistically significant. C, RAW264 macrophages were incubated for 1 h in the presence or absence of SB 203580 (SB) and/or U0126 (U) and then stimulated for 1 h with or without LPS in the continuous presence or absence of the inhibitors. Cell lysates were prepared, and 30 µg of total protein were analyzed by immunoblotting using an anti-IB antibody. Equivalent gel loading was assessed by Ponceau S staining of each filter prior to immunostaining. Densitometric and statistical analysis of four independent experiments was performed. The difference between lanes 2 and 5 (p = 0.005) was statistically significant.

As expected from knowledge that the proteins involved can bind constitutively to DNA, binding to the CRE/E-box element was already detected in extracts from untreated cells (Fig. 3A, lane 1) and increased by 1.9- or 1.3-fold, respectively, upon 1.5 or 4 h of LPS treatment (Fig. 3A, compare lanes 1, 3, and 5). Treatment with the inhibitors enhanced by 2-fold the binding prior to LPS treatment (compare lanes 1 and 2), but this phenomenon was not investigated further. In contrast, binding to the NF-B element, which was not detected in extracts from untreated cells (Fig. 3B, lanes 1 and 2) was strongly increased by treatment with LPS for 1.5 h (Fig. 3B, lane 3) and decreased by 50% after 4 h (Fig. 3B, lane 5). Importantly, binding to neither element was inhibited by U0126 and SB 203580 treatment.

Intriguingly, LPS-induced nuclear NF-B DNA binding activity was both increased and prolonged by treatment with the inhibitors as shown in Fig. 3B by comparing lane 3 with lane 4 (4- versus 8-fold induction) and lane 5 with lane 6 (2- versus 3.5-fold induction). Since increased NF-B activation may be due to impaired IB resynthesis after LPS-induced degradation, we have assessed IB levels in RAW264 cells both before and after 1 h of LPS treatment, a time when NF-B-triggered IB resynthesis should be completed (37), in the presence or absence of U0126 and/or SB 203580 (Fig. 3C). IB levels were indeed reduced about 4-fold in the presence of both inhibitors (Fig. 3C, compare lanes 2 and 5).

Neither C/EBP nor C/EBP Is Induced by Forskolin Treatment-- If C/EBP and/or C/EBP are indeed the factors whose synthesis is required to effect the second phase of COX-2 transcriptional induction, they should not be induced by forskolin treatment, since this only triggers transient COX-2 mRNA induction that is extinguished before the newly synthesized factors could start accumulating. Indeed, the levels of C/EBP as detected by Western blot were only increased slightly (2.1-fold) following forskolin treatment in comparison with the much stronger 5.5-fold induction obtained with LPS (Fig. 4A, upper panel). Even more strikingly, forskolin treatment completely failed to induce C/EBP in contrast to the dramatic 22.3-fold induction triggered by LPS treatment (Fig. 4A, lower panel). In agreement with these findings, forskolin could only trigger a weak (1.4-fold) increase of C/EBP DNA binding activity that contained C/EBP but not C/EBP as assessed by EMSA and confirmed by densitometric analysis of supershift experiments (Fig. 4, B and C).

View larger version (56K): [in this window] [in a new window]   Fig. 4.   Comparison of LPS- or forskolin-mediated induction of C/EBP and C/EBP synthesis and DNA binding activity. A, RAW264 macrophages were left untreated or stimulated for 4 h with LPS or forskolin (F) plus IBMX. Nuclear extracts were prepared and analyzed by Western blotting using anti-C/EBP or anti-C/EBP antibody. The full-length (FL) and LAP isoforms of C/EBP are indicated. Equivalent gel loading was assessed by Ponceau S staining of each filter prior to immunostaining. Densitometric and statistical analysis of three independent experiments was performed. The differences between lanes 1 and 2 of the upper panel (p = 0.005) and of the lower panel (p = 0.004), but not between lanes 1 and 3 of both panels, were found to be statistically significant. B, nuclear extracts prepared as in A were analyzed by EMSA using the 198/130 C/EBP site from the murine COX-2 promoter as a probe. Densitometric and statistical analysis of complexes 1 and 2 from three independent experiments was performed. The difference between lanes 1 and 2 and lanes 3 and 4 (p = 0.02) was statistically significant. C, nuclear extracts obtained from forskolin (F) plus IBMX treatment were analyzed as in B and, where indicated, were preincubated with polyclonal antibodies directed against different C/EBP isoforms (C/EBP, -, -, or -). The arrows and numbers on the left indicate the different DNA-protein complexes detected. Densitometric and statistical analysis of three independent experiments was performed. The difference between lanes 1 and 3 (p = 0.005) was statistically significant.

Both the Early and the Late Phase of LPS-mediated COX-2 Induction Are Defective in the Absence of C/EBP-- We have reported that COX-2 expression in macrophages is defective in the absence of C/EBP following 4 h of LPS treatment (29). To extend these data to earlier time points, we have analyzed COX-2 mRNA levels at various times after LPS treatment in C/EBP/ and +/+ macrophages. As shown in Fig. 5A, COX-2 mRNA slowly accumulated in the mutant cells, but its levels remained dramatically lower than in the wild type cells at all time points analyzed, suggesting that the basal levels of C/EBP present in untreated cells may already be required to initiate COX-2 expression in conjunction with the U0126 and SB 203580-sensitive activation of CREB, NF-B, and possibly other transcription factor(s). Importantly, in the C/EBP/ cells, LPS-induced CREB phosphorylation was normal (Fig. 5B), as was the LPS-mediated NF-B DNA binding induction (29). These data indicate that defective COX-2 expression in the C/EBP/ cells is probably a direct consequence of the absence of C/EBP and is not due to defective activation of the signaling pathways leading to CREB or NF-B activation.

View larger version (37K): [in this window] [in a new window]   Fig. 5.   COX-2 mRNA induction but not LPS-induced CREB/ATF-1 phosphorylation is defective in the absence of C/EBP. A, C/EBP +/+ and / macrophages were left untreated or stimulated for the indicated times with LPS. Total RNA was extracted at each time point, and mRNA encoding COX-2 and HPRT (internal control) was determined using RT-PCR. Densitometric and statistical analysis of two independent experiments was performed as in Fig. 1. At each time point, differences between C/EBP +/+ and / samples were statistically significant (p  0.002). B, cells were left untreated or stimulated for 30 min or 1 h with 100 ng/ml LPS, and 30 µg of total protein were immunoblotted with anti-phospho-CREB/ATF-1 antibody or CREB antibody. Equivalent gel loading was assessed by Ponceau S staining of each filter prior to immunostaining. Densitometric and statistical analysis of three independent experiments was performed, and phospho-CREB (p-CREB) values were normalized against total CREB values. The differences between lanes 1 and 2 or lanes 4 and 5 (p  0.004) were found to be statistically significant. No significant difference was detected between lanes 2 and 5 and between lanes 3 and 6.

The Induction of C/EBP mRNA Requires de Novo Protein Synthesis-- Little is known about the mechanisms regulating the LPS-mediated induction of C/EBP in RAW264 cells. Our observation that C/EBP induction, like COX-2 induction, is abolished by treatment with U0126 plus SB 203580 suggests the possibility that perhaps the same mechanisms involved in COX-2 transcriptional activation may also be responsible for the activation of the C/EBP gene. In order to test this idea, we analyzed by RT-PCR the levels of C/EBP mRNA in RAW264 macrophages after forskolin treatment or after treatment with LPS in the presence or absence of CHX (Fig. 6). C/EBP mRNA could not be induced by forskolin treatment at any of the time points analyzed (Fig. 6A), and its 3-fold induction by LPS was abolished by CHX treatment after both 1.5 and 4 h as indicated by densitometric analysis (Fig. 6B, compare lane 2 with lane 4, and compare lane 6 with lane 8). This was in marked contrast to COX-2 mRNA induction, suggesting that distinct additional factor(s) are probably required to activate the C/EBP gene.

View larger version (42K): [in this window] [in a new window]   Fig. 6.   C/EBP mRNA induction in RAW264 macrophages as determined by semiquantitative RT-PCR. A, cells were left untreated or stimulated for the times indicated with 20 µM forskolin plus 10 µM IBMX, and total RNA was extracted and subjected to RT-PCR using specific primers for C/EBP and HPRT (internal control). B, cells were incubated for 30 min in the presence or absence of 50 µg/ml CHX and then stimulated for 1.5 or 4 h with or without LPS (100 ng/ml) in the continuous presence or absence of the inhibitor. Total RNA was extracted and analyzed as in A. Densitometric and statistical analysis of three independent experiments was performed as in Fig. 1. The differences between lanes 1 and 2 or lanes 5 and 6 (p < 0.005) and between lanes 2 and 4 or lanes 6 and 8 (p < 0.001) were statistically significant.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The regulation of the COX-2 promoter in macrophages is complex and involves different promoter elements and transcription factors, but their relative roles are not completely understood. We demonstrate here that induction of the COX-2 mRNA following LPS treatment is biphasic, presumably effected by preexisting transcription factors that become post-translationally activated in the first phase while requiring the synthesis of a new factor(s) for the second phase.

The initial phase correlates with the activation of the transcription factor CREB, both upon LPS and forskolin treatment. Moreover, both CREB activation and the first phase of COX-2 induction by LPS are insensitive to inhibition of protein synthesis. Notwithstanding the strong correlations between CREB activation and COX-2 induction, recent work proposing that CREB cannot activate the COX-2 promoter in transient transfection assays imposes caution (16), and further work is needed to find out whether CREB is required to initiate COX-2 transcription and which other factors are involved.

NF-B is a good candidate to be one of these factors. Inhibition of the p38/SAPK pathway (38) and of the MAPK pathway (39), which impairs COX-2 induction, is known to cooperatively repress NF-B-dependent gene expression, and we show that in RAW264 macrophages treatment with SB 203580 plus U0126 impairs IB induction, known to be NF-B-dependent (37). Taken together, these observations suggest that in our system as well NF-B transactivating capacity may be decreased by treatment with the inhibitors. This decrease might therefore at least in part account for the inhibition of LPS-mediated COX-2 induction triggered by treatment with SB 203580 plus U0126.

Activating protein-1 factors and, in particular, c-Jun have been proposed to play an important role in COX-2 promoter activation both by co-transfection assays and by inhibition studies with a dominant negative form of c-Jun N-terminal kinase (16). Indeed, it has been proposed that it is c-Jun and not CREB that binds to the CRE in the COX-2 promoter. However, the finding that the LPS-induced COX-2 induction is suppressed by a combination of SB 203580 plus PD 98059 cannot be explained by the inhibition of c-Jun N-terminal kinase activation, because the LPS-induced phosphorylation of c-Jun is unaffected by these compounds.³ Likewise, the induction of COX-2 by forskolin cannot be explained by activation of c-Jun N-terminal kinase, since this kinase is not activated by forskolin (40). However, our results do not exclude the possibility that c-Jun N-terminal kinase and c-Jun activity may play a role in COX-2 gene transcription.

Importantly, neither CREB nor NF-B can be sufficient to both initiate and maintain COX-2 transcription that is still intensely active 3 h after LPS treatment (29), when CREB phosphorylation has long since subsided (28) and NF-B nuclear localization is already strongly decreased (37). Members of the C/EBP family of transcription factors, and in particular C/EBP and -, are good candidates to represent the transcription factors whose synthesis is required for the second, CHX-sensitive phase of COX-2 induction. Indeed, their synthesis is induced by LPS in RAW264 macrophages, although C/EBP is already present at appreciable levels in unstimulated cells. The finding that forskolin does not significantly increase either C/EBP or C/EBP levels and that treatment with U0126 plus SB 203580, which abolishes COX-2 induction, also inhibits the LPS-mediated induction of C/EBP, hence abolishing the binding of C/EBP·C/EBP heterodimers to the COX-2 promoter, are consistent with the idea that C/EBP and C/EBP are essential to mediate the second phase of LPS-mediated COX-2 induction in macrophages.

While C/EBP levels are very low in unstimulated cells, C/EBP is already present at appreciable levels before LPS treatment and appears to play an obligatory role both in the initiation and in the maintenance of COX-2 gene activation, since both phases are profoundly impaired in C/EBP-deficient macrophages. Although C/EBP transcriptional activity can be increased by phosphorylation (41, 42), no data are available describing specific phosphorylation events occurring in LPS-treated macrophages and, in preliminary experiments, we could not detect phosphorylation taking place following LPS treatment.⁴ We therefore favor the idea that C/EBP is already active in unstimulated cells but is either unable to bind to the promoter prior to CREB and/or NF-B activation or is not sufficient on its own to initiate transcription.

The model depicted in Fig. 7 describes the potential interplay of activated and inducible transcription factors taking place at the level of the COX-2 promoter in macrophages before and after LPS treatment. Although no data concerning promoter occupancy in vivo are available, at least in vitro both the CRE/E-box and the C/EBP elements can be already occupied under unstimulated conditions by preexisting members of the CREB/ATF and C/EBP families, respectively (Fig. 7A). The activation of the MAPK and SAPK pathways by LPS results, among other events, in phosphorylation of CREB and in improved NF-B activity, and the activation of the IB kinase complex by MAPK/extracellular signal-regulated kinase kinase kinase-1 leads to phosphorylation and degradation of IB and hence to the migration of NF-B to the nucleus. Both phosphorylated CREB and NF-B are known to recruit histone acetylases such as CBP/p300, which in turn contribute to making the promoter more accessible to transcription factors and help in bridging the transcription factor-CBP complexes to components of the basal transcription machinery (43, 44). These changes are likely to allow preexisting C/EBP to bind more stably to its recognition site, adjacent to the CRE. This step is required to initiate transcription (Fig. 7B), perhaps because C/EBP can also bind to CBP/p300, thus stabilizing its interaction with the promoter (45). At the same time, LPS also triggers transcriptional induction of the C/EBP and - genes through still uncharacterized mechanisms (see below). During later phases of induction, CREB phosphorylation subsides, and NF-B is sequestered back into the cytoplasm by newly synthesized IB, but at this stage, more C/EBP and newly made C/EBP are present and capable of interacting with the promoter (Fig. 7C). Either their increased abundance or, more likely, the availability of C/EBP·C/EBP heterodimers in addition to C/EBP homodimers is able to overcome the need for additional factors binding to the CRE element, perhaps even through direct or indirect interactions with the CRE site itself as proposed previously (10, 15). In addition, other transcription factors able to bind to the CRE site, such as the upstream stimulating factor-1 or -2 and members of the activating protein-1 family, may also come into play either in the initial phases or once the promoter has been activated (13, 18, 21).

View larger version (27K): [in this window] [in a new window]   Fig. 7.   Schematic model of the pathways and transcription factors involved in induction of the COX-2 promoter by LPS in macrophages. LPS, through interaction with the Toll-like receptor 4 (51), activates among others the classical MAPK pathway and the stress-activated pathway. Depicted is our model of how these two pathways sequentially activate and stimulate the different transcription factors involved in inducing the COX-2 promoter, as detailed under "Discussion." This scheme is not meant as an exhaustive description of all pathways and transcription factors involved. GTF, general transcription factors; Pol II, RNA polymerase II; I, IB kinase complex; MEKK1, MAPK/extracellular signal-regulated kinase kinase kinase 1; MKK, MAPK kinase; Tlr4, Toll-like receptor 4.

The induction of C/EBP and - appears to be regulated differentially in RAW264 macrophages. Both genes can be induced by a variety of stimuli in different cell types and particularly by proinflammatory cytokines and LPS (36). In hepatocytes, the transcription factor STAT3 is thought to be involved in activating both genes in response to interleukin-6 (46-48), and C/EBP gene transcription has been proposed to be regulated by CREB/ATF factors in hepatocytes as well as in the promonocytic cells U937 (49, 50). In RAW264 cells, C/EBP induction appears not to require CREB, since it is not affected by the treatments that abolish CREB activation (28). In contrast, CREB may well be involved in the induction of the C/EBP gene in LPS-treated cells, since the same treatments that inhibit CREB phosphorylation also abolish C/EBP induction. However, the induction of C/EBP also requires distinct as yet unidentified newly synthesized factors, since it is abolished by CHX.

Interestingly, although the relative abundance of C/EBP and - appeared to be at least equivalent after LPS induction, C/EBP binding to the COX-2 promoter was only observed as part of a heterodimer with C/EBP. This suggests that C/EBP homodimers and/or C/EBP·C/EBP heterodimers may display a higher affinity for this site. Interestingly, no binding of C/EBP to this site was detected in C/EBP/ macrophages despite appreciable levels of protein being present, supporting the idea that C/EBP may be unable to bind as a homodimer to the COX-2 C/EBP site (29). This might also explain why C/EBP cannot compensate for the absence of C/EBP in the mutant cells. Since C/EBP induction is abolished by the same treatments that inhibit CREB activation, we could not establish whether C/EBP, in conjunction with C/EBP, would be sufficient to bypass the need for CREB and/or NF-B activation. However, recent data suggest that this might be the case, since co-transfection of C/EBP, but not of C/EBP, could activate transcription of a COX-2 reporter in the absence of LPS treatment (16).

	ACKNOWLEDGEMENTS

We thank Dr. A. Soloaga and S. Stanzione for helping with some experiments and J. M. Walker for secretarial work. We are grateful to Drs. N. D. Perkins, J. Swedlow, and C. Sutherland for critically reading the manuscript.

	FOOTNOTES

^* This work was supported by the Wellcome Trust (Senior Research Fellowship to V. P.), the UK Medical Research Council (to M. C.), The Royal Society of London, and the Louis Jeantet Foundation (to P. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ Recipient of an EC Marie Curie fellowship.

To whom correspondence should be addressed: School of Life Sciences, Wellcome Trust Biocentre, University of Dundee, Dow St., Dundee DD1 5EH, Scotland. Tel.: 44-1382-345787; Fax: 44-1382-345893; E-mail: v.poli@dundee.ac.uk.

Published, JBC Papers in Press, October 19, 2001, DOI 10.1074/jbc.M108282200

² B. Gorgoni, P. Marthyn, M. Righi, and V. Poli, submitted for publication.

³ S. Morton and P. Cohen, unpublished results.

⁴ M. Caivano and P. Cohen, unpublished data.

	ABBREVIATIONS

The abbreviations used are: COX, cyclooxygenase; PG, prostaglandin(s); LPS, lipopolysaccharide; IBMX, 3-isobutyl-1-methylxanthine, CHX, cycloheximide; MAPK, mitogen-activated protein kinase; SAPK, stress-activated protein kinase; IB, inhibitor of B; CRE, cyclic AMP-response element; CREB, CRE-binding protein; CBP, CREB-binding protein; C/EBP, CCAAT enhancer-binding protein; EMSA, electrophoretic mobility shift assay; RT, reverse transcriptase; HPRT, hypoxanthine guanine phosphoribosyltransferase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

This article has been cited by other articles:

				M. Cortes-Canteli, R. Luna-Medina, M. Sanz-SanCristobal, A. Alvarez-Barrientos, A. Santos, and A. Perez-Castillo CCAAT/enhancer binding protein {beta} deficiency provides cerebral protection following excitotoxic injury J. Cell Sci., April 15, 2008; 121(8): 1224 - 1234. [Abstract] [Full Text] [PDF]