 |
INTRODUCTION |
Transitions in cell cycle are under the surveillance of regulatory
pathways called checkpoints. One of the checkpoints is to ensure the
integrity of the genome before entering mitosis (1-6). The mitotic
cell cycle checkpoints are conserved from yeast to mammals, and the key
target of this surveillance is the Cdc2-cyclin B complex that
phosphorylates a number of proteins involved in mitotic processes such
as proper chromosome segregation and nuclear disassembly (1, 7-10).
When DNA is damaged or DNA replication is unfinished Cdc2-cyclin B is
inactivated through inhibitory phosphorylation of Cdc2 by Wee1 and Myt1
kinases (5, 11, 12). The inhibition is reversed by Cdc25 after
completion of DNA replication or repair by removing the inhibitory phosphorylation.
One of the effector protein kinases that regulates Cdc25 is Chk1
(13-15). Chk1 was first identified in fission yeast involved in cell
cycle arrest when DNA was damaged (16). In mammalian cells a Chk1
homolog was shown to phosphorylate Cdc25A, -B, and -C (13, 17), and
this reaction promoted the binding of Cdc25 to 14-3-3 proteins (the
mammalian homolog of fission yeast Rad24 and Rad25) to prevent
activation of Cdc2. In addition to Cdc25, Wee1 and p53 have also been
found to be phosphorylated by Chk1 when checkpoint is activated
(18-20). In human cells, Chk1 is expressed from S to M phase at both
RNA and protein levels, and the proteins are localized in the nucleus
(21). When DNA is damaged by ionizing radiation, UV, or
hydroxyurea, Chk1 is found to be phosphorylated in an
ATR-dependent manner (22, 23). However, whether the kinase
activity of Chk1 is enhanced in response to DNA damage is still
controversial (21, 22, 24, 25).
Chk1 is a highly conserved gene found from yeast to
mammalian cells involved in DNA damage checkpoint. Recent studies
indicate that Chk1 is involved in both DNA damage and DNA replication
checkpoints in mammalian cells (22, 26). Chk1 protein contains a highly conserved N-terminal kinase domain linked to its less conserved C-terminal domain of unknown function through a flexible linker region
(27). Functional analysis of kinase activity suggests that the
C-terminal domain in human Chk1 may serve as a negative regulator of
kinase activity (27).
In the present report we presented evidence for the
existence of a rat liver-specific Chk1 isoform (Cil for
Chk1 isoform in liver). This
isoform was found to be transcribed using a novel promoter residing in
the intron of the Chk1 gene preceding the C-terminal domain,
and mature mRNA was formed by the joining of the new noncoding exon
within the intron to the remaining exons of Chk1 through
splicing, deleting the kinase domain of Chk1. We showed that Cil
associated with the Chk1 kinase domain using yeast two-hybrid and
pull-down assays and that it down-regulated p53-mediated gene
transcription. Furthermore, we showed that Cil was phosphorylated at a
serine residue corresponding to Ser-345 in Chk1 following UV
irradiation and that mutation of this phosphorylation site eliminated
its effect on p53 activity.
| |
EXPERIMENTAL PROCEDURES |
Oligonucleotide Primers--
The primers used were as
follows: 2-6-1, GTGTTTCGGCATAATAATCGT; 2-6-3, GAAGCAAAGCCAGAGGAGCAGAATC; 2-6-15, TTTCTTCACTGGAACCAC; 2-6-31, ATAACTCACAGGGATATTAAACCAG; Cil-2, GTAAACTTGAGAAGGAAGCA; Cil-5, TTGGGGGTTGGGATTTCAGT; Chk1 g-05, GTGTCTGCAGAAGGACCCAA; Chk1 g-06, GAGACTGCAGAAGAGAGAGTTG; Chk1 g-16,
GCAGCTGCAGTTGTCCTCTTCAACTGA; Chk1 g-19, CAGTCTGCAGTGGAGTTGC; Chk1 g-20,
TCCTTCTGCAGACACTAAAGAGTC; Chk1 g-21, AGGGCCTGCAGTCCAACCAG; Chk1 g-22,
AGAACTGCAGAGCTCGTTTGGAGAC; Chk1 g-29, GGGTAAGCTTGCGTAATCATGAGAA; Chk1
g-30, GAGAAAGCTTAAGAGAGAGTTG.
Cell Cultures and Transfection--
Rat hepatoma cell line
FAA-HTC1 (JCRB 0249) was grown in Williams' medium E supplemented with
10% fetal bovine serum and 100 µg/ml penicillin and streptomycin.
The H-4-II-E cell line obtained from Culture Collection and Research
Center (CCRC 60209) was cultured in minimum Eagle's medium
supplemented with Earle's balanced salt solution with 0.1 mM nonessential amino acids, 10% fetal bovine serum, and
10% calf serum. The MH1C1 (CCRC 60143) cell line was cultured in
Ham's F-10 medium, 15% horse serum, and 2.5% fetal bovine serum.
Hep3B cells (p53-negative human hepatoma cells) were grown in
Dulbecco's modified Eagle's medium supplemented with 10% fetal
bovine serum.
Cells were transfected using LipofectAMINETM (Invitrogen)
according to the instructions of the manufacturer. Briefly, cells were
grown to 50% confluence in 60-mm dishes. Plasmids and LipofectAMINE were separately diluted in serum-free medium to 300 µl, mixed, and
incubated at room temperature for 1 h. DNA-lipid complexes were
diluted with 2.4 ml of serum-free medium. Cells were washed twice with
phosphate-buffered saline and overlaid with the diluted DNA-lipid complexes.
Cloning of Chk1 Isoform--
We used 5'- and
3'-RACE1 (Marathon cDNA
Amplification System from CLONTECH) to clone the
Cil cDNA from rat liver following the instructions of the
manufacturer. Briefly, first-strand cDNA was synthesized using
oligo(dT) primer and Moloney murine leukemia virus reverse
transcriptase. Second-strand synthesis was performed using a mixture of
Escherichia coli DNA polymerase I, RNase H, and E. coli ligase. After the T4 DNA polymerase reaction, the double
strand cDNA was ligated to the Marathon cDNA adapter. PCR was
performed for 30 cycles with a forward primer AP1 and a reverse primer
2-6-3 for 5'-RACE. The 5'-RACE products were then cloned and sequenced.
A 5'-RACE clone with a novel DNA sequence was identified. According to
the 5'-RACE result, a specific primer for the isoform was designed for
the 3'-RACE experiment. Finally, the same cDNA clone of Cil was
also isolated from rat liver cDNA library (Stratagene, Inc.) by
screening using 32P-labeled Chk1 probe.
Plasmids and Construction of Recombinant Expressing
Clones--
The mammalian expression vector pCMVTag-2A/B/C and
p53-luciferase (p53-Luc) reporter plasmids were purchased from
Stratagene. Reporter vector pGL2-Basic and pGL2-Control were purchased
from Promega. pCMV
plasmids were purchased from
CLONTECH. p53 expression vector (pCMVTag-2C-rp53)
was constructed by inserting the rat p53 coding region in-frame into
pCMVTag-2C. Chk1 and Cil expression plasmids were constructed by
inserting PCR products of the coding region in-frame into pCMVTag2B
vector (Stratagene) and confirmed by DNA sequencing. Expression of the
corresponding proteins was confirmed by Western blot analysis using
anti-FLAG M2 antibody (Upstate Biotechnology, Inc.). The reporter
plasmids of Cil promoter were constructed by inserting
different fragments amplified from the putative promoter region and
inserted into the pGL2-Basic plasmid. The primers used for constructing
these promoter reporter plasmids were: Chk1 g-05, Chk1 g-06, Chk1 g-16,
Chk1 g-19, Chk1 g-20, Chk1 g-21, Chk1 g-22, Chk1 g-29, and Chk1
g-30.
Western Blot Analysis--
Tissues from Sprague-Dawley rats were
homogenized in lysis buffer (50 mM Tris, pH 6.8, 2% sodium
dodecyl sulfate, 0.1% bromphenol blue, 0.1 M
dithiothreitol, 10% glycerol) using a Polytron homogenizer, cleared by
centrifugation at 14,000 × g for 20 min, and stored frozen at 
70 °C. For Western blot analysis, 20 µl of protein extracts were denatured by boiling for 5 min and loaded in a 12% SDS-polyacrylamide gel in Tris-glycine buffer (25 mM Tris,
250 mM glycine, 0.1% SDS, pH 8.3). After electrophoresis
the proteins were transferred to a Hybond-C membrane (Amersham
Biosciences, Inc.). The blot was blocked with 5% nonfat milk in TBS-T
buffer (20 mM Tris, pH 7.6, 137 mM NaCl, 0.1%
Tween 20) for 1 h and incubated with primary antibody against the
C-terminal portion of Chk1 (custom-produced by Zymed
Laboratories Inc. against an oligopeptide in the C-terminal domain of Chk1) for 1 h and washed twice in TBS-T buffer. The immunoblot was then incubated with the appropriate secondary antibody conjugated to horseradish peroxidase and analyzed using the ECL detection system according to the instructions of the manufacturer (Amersham Biosciences, Inc.). For analysis of Chk1 Ser-345
phosphorylation, Western blots of proteins from cells transfected with
Chk1 and/or Cil expression plasmids with or without UV irradiation were
probed with antibody specifically against Ser-345-phosphorylated Chk1 (Cell Signaling).
Reporter Gene Assays--
Typically cells in a 60-mm culture
dish were transfected with 2 µg of reporter plasmids and 1 µg of
pCMVGal (CLONTECH) as internal standard. Cells
were harvested 48 h after transfection, washed twice in
phosphate-buffered saline, and lysed with 400 µl of reporter lysis
buffer in a luciferase assay system (Promega). Cell lysates were
collected and centrifuged briefly. For the luciferase activity assay,
cell lysates were freeze-thawed and centrifuged at 12,000 × g for 5 min, 10-µl aliquots were loaded into the AutoLumat LB953 (EG&G Berthold), and 100 µl of luciferase substrate were injected into each sample. The luminescence obtained was normalized against -galactosidase activity. To assay the transfection
efficiency, 30 µl of each supernatants were assayed for
-galactosidase activity by adding 3 µl of 100× magnesium solution
(0.1 M MgCl2, 4.5 M -mercaptoethanol), 66 µl of an o-nitrophenyl
-D-galactopyranoside solution (4 mg/ml
o-nitrophenyl -D-galactopyranoside in 0.1 M sodium phosphate, pH 7.5), and 20 µl of sodium
phosphate buffer (0.1 M, pH 7.5). The solution was
incubated at 37 °C for 30 min or until yellow color was developed.
The reaction was stopped by adding 500 µl of 1 M sodium
carbonate, and optical absorption at 420 nm was measured.
Northern Blot and RT-PCR Analysis--
A Multi-Tissue RNA blot
containing 2 µg of poly(A) mRNA from various normal rat tissues
was purchased from CLONTECH and probed with Chk1
probe according to the procedure of the manufacturer. Total RNA was
extracted from rat liver tissue and from cultured cells using the
RNeasy Total RNA kit (Qiagen). For RT-PCRs, 1 µg of total RNA was
treated with RNase-free DNase (Invitrogen) for 15 min. DNase was
inactivated by adding 1 µl of 25 mM EDTA and heated at
65 °C for 10 min. 500 ng of oligo(dT)12-18 was added,
and the first-strand cDNA was synthesized using 200 units of
SUPERSCRIPT II reverse transcriptase (Invitrogen) for 50 min at
42 °C. The reaction was terminated by heating at 70 °C for 15 min. Subsequent PCRs were carried out using primers specific to Chk1 or
Cil. A rat multiple tissue cDNA panel used as a template for PCR to
confirm tissue-specific expression of Cil was purchased from Promega.
Yeast Two-hybrid Analysis--
The Gal4-based MATCHMAKER
Two-hybrid System II (CLONTECH) was used for
two-hybrid analysis. Plasmids pAS2-1 and pACT2, encoding the Gal4
DNA-binding domain (Gal4-BD) and Gal4-activating domain (Gal4-AD),
respectively, were used to express hybrid proteins. The yeast strain
AH109 was co-transformed with pAS2-1-Chk1KD and pACT2-Cil using the
lithium acetate method (28, 29). Transformants were selected on
synthetic dropout agar plates lacking tryptophan, leucine, adenine, and
histidine. The positive yeast colony was transferred onto Whatman no. 5 paper and processed by the -galactosidase filter assay. Negative
controls were performed by co-transformation of empty vector pAS2-1
with pACT2, pAS2-1 empty vector with pACT2-Cil, pACT2 empty vector with
pAS2-1-Chk1KD, or pACT2-Cil with pVA3-1, which express fusion protein
of GAL4-DB and murine p53 (amino acids 72-390).
In Vitro Transcription-Translation and GST Pull-down
Assay--
In vitro transcription-translation was performed
using the TNT Coupled Reticulocyte Lysate System kit from Promega
according to the instructions of the manufacturer. For each reaction, 1 µg of plasmid DNA was used in a 50-µl total reaction volume. An amino acid mixture minus methionine was added to each reaction, and
reactions were performed in the presence of
[35S]methionine (Amersham Biosciences, Inc.).
For GST pull-down assays, glutathione-Sepharose beads (Amersham
Biosciences, Inc.) were prewashed in NETN (0.5% Nonidet P-40, 1 mM EDTA, 20 mM Tris, pH 8.0, 100 mM
NaCl, 10% glycerol) containing protease inhibitors (Roche Molecular
Biochemicals) and 0.5% powdered milk. Fusion proteins in the bacterial
lysate were purified with the prewashed glutathione-Sepharose beads (25 µl of beads/ml of lysate) by incubation for 1.5 h at 4 °C on
a rotary mixer. The beads were collected by centrifugation, washed four
times with NETN+P (NETN containing protease inhibitors), and
resuspended in 1 volume of NETN+P prior to use. 50 µl of beads,
containing GST fusion proteins or GST alone (negative control), were
incubated overnight at 4 °C in tubes containing 935 µl of NETN+P
and 5 µl of the in vitro-translated
35S-labeled protein. The beads were then washed four times
with NETN, resuspended in 50 µl of 1× protein loading buffer, and
boiled for 5 min followed by SDS-PAGE analysis. The gel was dried, and radiolabeled protein was detected by autoradiography.
| |
RESULTS |
Cloning of Rat Liver-specific Chk1 Isoform--
We have previously
cloned and sequenced rat Chk1 cDNA (Fig.
1). During our analysis of tissue
expression of Chk1 gene expression in rat we noticed a second RNA band
specifically observed only in the liver tissue (Fig. 2A). We
then cloned this shortened Chk1 RNA species from rat liver using 5'-
and 3'-RACE techniques based on a primer derived from the rat Chk1
sequence. DNA sequencing of the clones
obtained showed that the liver-specific Chk1 isoform, or Cil in short,
contained the exon 6 to 3'-untranslated region of rat Chk1
gene linked to a 90-bp unknown sequence at its 5'-end. Sequence
analysis of the intron between exons 5 and 6 of the Chk1 genomic sequence in rat showed that the novel 5' sequence was derived
from the internal portion of this intron. The 3' boundary of the
intron-derived sequence abuts the splicing donor consensus sequence GT,
consisting with splicing of this sequence with exon 6 (Fig.
3). To confirm the existence of this
mRNA species in rat liver we also used the Chk1 sequence to clone
the isoform cDNA from the rat liver cDNA library. Clones
obtained this way contained a sequence consistent with the RACE-derived
clones. A protein product with the molecular weight predicted from the
isoform RNA was also observed in Western blot analysis in the adult
liver tissue and to a lesser extent in the fetal liver of an 18-day embryo (Fig. 4). A Chk1-related isoform
was also observed in the kidney tissue, but its nature is still under
investigation.
View larger version (90K):
[in this window]
[in a new window]
|
Fig. 1.
DNA sequence of rat Chk1 and its
corresponding predicted protein sequence. The start codon and stop
codon are marked in boldface type.
|
|
View larger version (63K):
[in this window]
[in a new window]
|
Fig. 2.
Northern blot analysis of Chk1 expression in
different tissues. Panel A, a rat multitissue Northern blot
(CLONTECH) was hybridized with a 1.4-kb rat Chk1
probe. Panel B, the rat multitissue Northern blot was
stripped and reprobed with -actin probe. Molecular mass markers are
in units of kilobases.
|
|
View larger version (54K):
[in this window]
[in a new window]
|
Fig. 3.
Panel A, cDNA sequence of
rat Cil and its corresponding predicted protein sequence.
Panel B, schematic representation of rat
Chk1 and Cil. A 90-bp sequence at the 5'-end of
Cil is located in intron 5 and spliced to exon 6. E, exon; UTR, untranslated region.
|
|
View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4.
Chk1 and Cil protein expression in rat
tissues. Immunoblotting analysis was performed on adult rat heart,
liver, kidney, and embryonic day 18 (E18) fetal liver. The
protein blot was probed with antibody against the Chk1 C-terminal
domain. Molecular mass markers are in units of
kilodaltons.
|
|
Analysis of Tissue-specific and Development-specific Expression
of Cil--
To further confirm liver-specific expression, we examined
Cil expression in different rat tissues by RT-PCR. When both Chk1- and
Cil-specific primers were used, two RT-PCR products were observed in
the liver tissue, corresponding to the expected products of Chk1 and
Cil, respectively (Fig. 5A).
The other tissues contained only one band corresponding to that of
Chk1. This result confirmed the liver-specific expression pattern we
first observed in the Northern blot. The identity of the second band in
the RT-PCR product as Cil was confirmed by DNA sequencing. We next
examined the expression of Cil during embryo development. Total RNA was
extracted from rat livers of 18-day fetal liver, liver from days 1 and
5 postnatal liver, adult liver, and adult spleen. RT-PCR analysis
showed that Cil was expressed at a low amount in the 18-day fetal
liver, but the level of expression increased to adult level after birth
(Fig. 5B). Again no Cil isoform was observed in the spleen
sample. To examine whether the expression of this liver-specific
isoform was altered in tumor cells, we analyzed the relative mRNA
levels of Chk1 and Cil using RT-PCR in rat hepatoma cell lines. As
shown in Fig. 5C, three rat hepatoma cell lines were found
to express this isoform, but the Cil/Chk1 ratio was much lower than
that of normal adult liver, suggesting down-regulation of Cil in
tumor cells.
View larger version (63K):
[in this window]
[in a new window]
|
Fig. 5.
RT-PCR analysis of Chk1 and Cil expression in
rat tissues and cultured cells. Panel A, tissue distribution
of Cil was examined using the rat multitissue cDNA panel
(CLONTECH). Polymerase chain reaction was performed
for 30 cycles using primers specific for Chk1 (2-6-31 and 2-6-15) and
Cil (Cil-5 and 2-6-15), and nested PCR was performed for 20 cycles
using nested primers specific for Chk1 (2-6-1 and 2-6-15) and Cil
(Cil-2 and 2-6-15). Panel B, RT-PCR analysis of RNA
extracted from various rat tissues as indicated in the figure. RT-PCR
was performed using cDNA derived from 1.0 µg of total RNA, and
PCR was performed for 30 cycles using primers specific for Chk1 (2-6-1 and 2-6-15) and Cil (2-6-15 and Cil-5). Panel C, RT-PCR
analysis of Cil expression in three rat hepatoma cell lines. The
positions of Chk1 and Cil products are indicated on the
right of the panels. E18, embryonic day 18;
P1, postnatal day 1; P5, postnatal day
5.
|
|
Analysis of Promoter Activity of Sequences 5' to the First Exon of
Cil--
The sequence of Cil suggests a promoter 5' to the
first exon, somewhere in the fifth intron of the Chk1 gene.
To examine this possibility we assayed the promoter activity of DNA
sequences immediately adjacent to the 5'-end of Cil using
the luciferase reporter gene system. As shown in Fig.
6, a 300-nucleotide fragment upstream of
the first exon of Cil was found to contain promoter activity
when assayed for luciferase reporter gene expression. Deletion
analysis indicated that the promoter activity resided in the 3' half of
the 300-bp fragment. Sequence analysis of the 300-bp region revealed
three potential transcription factor-binding sites for AP-2, SP1, and
the liver-specific LF-A1 transcription factor (30-32). Deletion of the
LF-A1 binding sequence reduced the promoter activity by 30-40%.
View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
Luciferase reporter assays with
Cil promoter constructs containing various lengths of
upstream sequences. The top of the map shows intron 5 of rat Chk1. The arrow represents the first exon of Cil.
Promoterless vector pGL2-Basic served as a negative control
(bottom bar). -Fold increase of promoter activity relative
to the negative control is shown.
|
|
Phosphorylation of Cil following UV Damage--
Since
Chk1 has been shown to be activated after DNA damage by the
phosphorylation at serines 317 and 345 located in the C-terminal domain
(22), we examined whether Cil could also be phosphorylated at serine 63 (corresponding to Ser-345 of Chk1) following UV irradiation. We used
the commercial antibody that specifically recognizes the Chk1 peptide
phosphorylated at serine 345 to examine the phosphorylation status of
Cil in Cil-transfected cells before and after UV irradiation. As shown
in Fig. 7, no phosphorylation was found
in Chk1 without UV irradiation, but the phosphorylated form became
detected after UV irradiation as expected, albeit at a low level. Cil,
on the other hand, showed a low level of phosphorylation even before UV
irradiation, but the phosphorylation was enhanced after UV treatment.
These results indicate UV-induced phosphorylation of both Chk1 and Cil
at the site corresponding to Ser-345 in Chk1. When Chk1 was
co-transfected with Cil its phosphorylation was found to be enhanced
relative to the transfection of Chk1 alone. This result suggests that
Cil enhanced UV-activated phosphorylation of Chk1.
View larger version (56K):
[in this window]
[in a new window]
|
Fig. 7.
UV-induced phosphorylation of Chk1 and Cil
were caffeine-sensitive. Panel A, HTC1 cells were
transiently transfected with expression plasmids of Cil, Chk1, or both.
Caffeine (2 mM) was added 12 h after transfection. UV
(100 J/m2) treatment was performed 22 h after
transfection. Cellular lysates were prepared 24 h after
transfection and were resolved by SDS-PAGE. Phosphorylated Chk1 or Cil
was detected by Western blotting with phospho-Chk1 (Ser-345) antibody.
Panel B, as a loading control the blots were stripped and
reprobed with an actin antibody. Molecular mass markers are in units of
kilodaltons.
|
|
ATR kinase has been shown to be involved in the phosphorylation of Chk1
at Ser-345. Since ATM/ATR kinase is sensitive to the inhibition
by caffeine (33, 34), we analyzed whether the phosphorylation of Cil
after UV irradiation could be blocked by caffeine. Treatment of cells
after UV irradiation with 2 mM caffeine blocked the
phosphorylation of both Chk1 and Cil (Fig. 7), consistent with the
interpretation that both proteins were phosphorylated by ATR kinase.
Suppression of p53 Transactivation Activity by Phosphorylated
Cil--
Chen et al. (27) have shown recently that the
kinase domain fragment of Chk1 is 20 times more active in kinase
activity in vitro than the full-length Chk1. They suggested
that the C-terminal portion of Chk1 might function as a negative
regulator of Chk1 kinase activity. Since Cil contained only the
C-terminal sequences of Chk1 without the kinase domain, we suspected
that Cil might function as a competitive inhibitor of Chk1. Because
Chk1 has been shown to phosphorylate p53 and to regulate the amount of p53 in a co-transfection experiment (20), we tested whether Cil could
inhibit the transactivation activity of p53. We used the luciferase p53
transactivation assay to examine this possibility. As shown in Fig.
8, co-transfection of plasmid containing
the Chk1 gene in the p53 transactivation assay boosted the
p53 transactivation activity 50%. This result is similar to that
obtained previously (20). In contrast, Cil was found to reduce the
reporter activity by about 50%. Furthermore, the stimulation of
reporter gene activity by Chk1 was abolished by co-transfection with
Cil, suggesting that Cil was dominant over Chk1 in this activity assay.
Since Cil serine 63 (corresponding to Chk1 serine 345) was
phosphorylated even without UV treatment, we analyzed the effect of
eliminating Cil serine 63 phosphorylation in the inhibition of p53
transactivation activity. As shown in Fig. 8, mutation of Cil serine 63 to alanine resulted in the total loss of the Cil-mediated inhibition of
p53 transactivation activity. On the other hand, serine 35 (corresponding to Chk1 Ser-317, another site phosphorylated in
vivo) to alanine mutation resulted in a less inhibitory effect on
p53 transactivation activity. These results indicated that serine 63 in
Cil played an important regulatory role in the function of Cil.
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of Cil on transactivation activity of
p53. Hep3B cells were transiently co-transfected with reporter
plasmid p53-Luc and p53 expression vector pCMVTag-2C-rp53 together with
pCMVTag-2B (negative control) or with Chk1, Chk1 kinase domain,
Cil, Cil-S35A, or Cil-S63A expression vector or combinations as
indicated. After 24 h of transfection, luciferase activity was
assayed. Relative luciferase activity was expressed as the -fold
increase compared with the control experiment. The p53-free Hep3B cell
line transfected with p53-Luc alone (Minus p53) showed very
low background luciferase activity.
|
|
Evidence for the Interaction of Cil with the Kinase Domain of
Chk1--
Based on crystallographic analysis and in vitro
analysis of Chk1 kinase activity, Chen et al. (27) recently
suggested that the C-terminal domain of Chk1 could negatively interact
with the kinase domain. Because the coding sequence of Cil resides in
the C-terminal domain of Chk1, we sought to determine whether Cil could
interact with the kinase domain of Chk1. To this end, we cloned the
Chk1 kinase domain and analyzed the interaction with Cil by the yeast
two-hybrid assay. The Chk1 kinase domain indeed was found to interact
with Cil (Fig. 9), whereas no interaction was found between Chk1 and Cil (data not shown). To further demonstrate the interaction between Cil and the Chk1 kinase domain we used an
in vitro transcription-translation system and the pull-down assay to address this question. As shown in Fig. 9, the kinase domain
and Cil could be pulled down together. These results indicated that the
two molecules indeed could interact with each other. On the other hand,
no interaction was observed between Chk1 and Cil under the same
condition.
View larger version (43K):
[in this window]
[in a new window]
|
Fig. 9.
Interaction between rat Cil protein and Chk1
kinase domain. Panel A, yeast two-hybrid one-on-one analysis
of interaction between Cil and the kinase domain of Chk1. Yeasts
(AH109) were transformed with various combinations of expression
plasmids as indicated. pAS2-1 and pACT2 are empty vectors.
Transformants were initially screened by tryptophan and leucine
nutritional selection, and then positive interaction was screened by
growing yeasts on a synthetic medium plate lacking tryptophan, leucine,
adenine, and histidine. Only Cil/Chk1KD showed a positive result.
Panel B, in vitro pull-down assays using GST.
GST-Cil was incubated with the in vitro-translated Chk1
kinase domain (radiolabeled). The protein associated with the various
GST fusion proteins in the pull-down assays were resolved by SDS-PAGE,
dried, and autoradiographed. The quantity of recombinant GST fusion
proteins used for these GST pull-down assays was estimated by Coomassie
staining, and the amount of GST protein used in the experiment was 10 times more than GST-Cil (data not shown). First lane,
control experiment of binding the labeled Chk1 kinase domain to GST.
Second lane, binding experiment of the Chk1 kinase domain
with GST-Cil. KD, kinase domain. Molecular mass markers are
in units of kilodaltons.
|
|
| |
DISCUSSION |
In the present study we report the isolation of a novel isoform of
Chk1 specifically expressed in rat liver tissue. The isoform represents
the C-terminal portion of Chk1 without the kinase domain. The structure
and sequence arrangement of this isoform suggest that it was generated
by both alternate promoter usage and alternative RNA splicing. The
promoter was found within the intron preceding the C-terminal domain
exons. Alternate promoters within an intron of a gene have been
observed previously (35, 36) and are associated with tissue-specific
expression. Sequence analysis near the transcription initiation site of
Cil revealed three potential binding sites for transcription factors
AP-2, Sp1, and liver-specific LF-A1. The presence of the liver-specific
LF-A1 transcription factor-binding site supports the liver-specific
expression of Cil. Deletion of this transcription factor-binding site
reduced the promoter activity in rat HTC1 cells. Since this cell line
only expressed a low amount of Cil, we believe that this cell line is
probably not the best host for studying the regulation of the
Cil promoter. Perhaps primary hepatocytes expressing a
significant amount of Cil would serve as the appropriate host for
studying the regulation of the Cil promoter.
The Cil coding region starts at amino acid 283 of the rat Chk1 protein.
This start site is located in the flexible linker between the kinase
and the C-terminal domains (27) in the Chk1 protein. Thus Cil is
completely devoid of the kinase domain of Chk1 and contains only the
C-terminal domain. Since the C-terminal part of Chk1 has been
implicated in the negative regulation of Chk1 (27), we analyzed the
interaction of Cil and the kinase domain using the yeast two-hybrid
assay as well as an in vitro pull-down assay. These analyses
indeed showed that Cil could interact with the kinase domain. Chk1 has
been shown to enhance the p53 level when overexpressed by transient
transfection with or without treatment of ionizing radiation (20). In
our studies, overexpression of Chk1 enhanced p53 transactivation
activity, but Cil exhibited the opposite effect. These data suggested
that Cil might serve as a negative regulator in the Chk1-p53 signaling pathway.
The finding that a possible negative regulator of Chk1 kinase activity
is present only in the liver tissue is rather intriguing. Liver differs
from other tissues in having a very high proportion of polyploid cells.
Rat liver is especially rich in cells with polyploidy (37, 38) with an
estimation up to 85-90% (39-41). On the other hand, fetal and liver
tumors are composed mainly of diploid cells (37, 39, 42). Since Chk1 is
involved in cell cycle regulation, liver-specific expression of Cil may
be related to the unique hepatocyte polyploidization. This possibility remains to be verified in the future. We are constructing inducible plasmids for analyzing the effect of Cil on cell cycle and nuclear polyploidization with or without damage to DNA or stalling of DNA replication.
We have searched a human liver cDNA library for the human
counterpart of Cil with no success. Examination of the human intron sequence corresponding to the one in the rat genome containing the
Cil promoter showed no obvious sequence similarity between the two species in this part of the gene. RT-PCRs using several possible candidates from human intron sequences with patched homology with the rat sequence and the conserved C-terminal domain sequence as
primers did not reveal any Cil-like products in a human cDNA library or in mRNA extracted from human liver. Whether Cil is unique to rat or whether a different isoform in human liver exists will
be the subject of future studies.
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed: Institute of
Biochemistry, National Yang-Ming University, 155 Li-Nong St., Shih-Pai, Taipei, Taiwan, Republic of China. Tel.: 886-2-2826-7230; Fax: 886-2-2826-4843; E-mail: mth@ym.edu.tw.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
