![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 52, 48915-48920, December 28, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§¶,
§
,
,
,
§§
From the
Laboratoire de Chimie Bactérienne,
CNRS, Institute Biologie Structurale et Microbiologie, 31 Chemin Joseph
Aiguier, 13402 Marseille Cedex 20, France, the ** Chemistry
Department, University of Warwick, Coventry, CV4 7AL, United Kingdom,
and the 
Faculté de Pharmacie, La
Timone, Marseille 3005, France
Received for publication, June 14, 2001, and in revised form, September 18, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Oxidation of methionine residues to methionine
sulfoxide can lead to inactivation of proteins. Methionine sulfoxide
reductase (MsrA) has been known for a long time, and its repairing
function well characterized. Here we identify a new methionine
sulfoxide reductase, which we referred to as MsrB, the gene of which is present in genomes of eubacteria, archaebacteria, and eucaryotes. The
msrA and msrB genes exhibit no sequence
similarity and, in some genomes, are fused. The Escherichia
coli MsrB protein (currently predicted to be encoded by an
open reading frame of unknown function named yeaA)
was used for genetic, enzymatic, and mass spectrometric investigations.
Our in vivo study revealed that msrB is
required for cadmium resistance of E. coli, a carcinogenic
compound that induces oxidative stress. Our in vitro
studies, showed that (i) MsrB and MsrA enzymes reduce free methionine
sulfoxide with turn-over rates of 0.6 min All organisms living aerobically are exposed to active oxygen
species (AOS)1 produced
during respiration. Most macromolecules are targeted by AOS. There is
an increasing body of evidence that links oxidative stress to reduced
survival rate and various pathological situations (1). Therefore, a
series of protecting systems helps cells to cope with the presence of
AOS. A subset of these systems, including catalase, peroxidase,
superoxide dismutase, acts by reducing endogenous levels of AOS.
Another second subset includes enzymes to repair AOS damage; such
"repairing" enzymes can rescue oxidized lipid, DNA, or proteins.
Protein oxidation can lead to conformation changes and, in some cases,
loss of function. Amino acids readily prone to AOS oxidation include
cysteine, histidine, tryptophan, tyrosine, and methionine, this latter
being the most sensitive (2). Methionine oxidation to methionine
sulfoxide (MetSO) is reversible. Reduction of MetSO is catalyzed by
methionine sulfoxide reductase (MsrA), an enzyme present in all living
organisms (3, 4). MsrA has been known for a long time and has received
increasing attention over the last years. Its three-dimensional
structure has been described (5, 6), and the basis of its catalytic
mechanism determined (7, 8). MsrA has been found to reduce both free MetSO as well as MetSO residues in proteins. A series of proteins, of
considerable medical interest, has been identified as substrates of
MsrA. These include calmodulin (9), HIV protease (10) or
In a few bacteria, MsrA is actually a domain of a polypeptide
containing a second domain. We have analyzed the occurrence of this
second domain and found it coded for in most sequenced genomes. In
Escherichia coli, this gene is named yeaA. Here
we report the characterization of YeaA, that we have rebaptised MsrB and find it to be a second methionine sulfoxide reductase that acts
both on free MetSO and protein-contained MetSO residues.
Chemicals and Growth Conditions--
Unless noted otherwise,
chemicals were purchased from Sigma. Thioredoxin reductase was a gift
from Dr. C. Williams (University of Michigan, Ann Arbor, MI). Bacteria
were grown on Luria-Bertani medium or M9 minimal medium.
Plasmids--
DNA manipulations were carried out using standard
techniques, according to the manufacturer's instructions. Plasmid
pET21MsrA was obtained by cloning the msrA gene in the
pET21a vector (Novagen). Expression from this vector results in the
synthesis of a protein with a His tag on the C terminus. The
msrA coding region was amplified by polymerase chain
reaction (PCR) using chromosomal DNA from E. coli strain
MG1655 as a template and the oligonucleotides
pFMsrAColi2-(GAATTCGCTAGCGAGCTCAGGAGGTTCCATATGAGTTTATTTGATAAAAAGCATCTGG) and pMsrAHis-C (GATCACTAAGCTTGGATCCTAGTGGTGGTGGTGGTGGTGGTGTGCTTCCGGC GGCAGACAGAC) as primers. The PCR product was inserted in plasmid pET21a between the EcoRI and HindIII sites.
Plasmid pBAD24MsrB was obtained by cloning the msrB coding
region into pBAD24 plasmid. The msrB coding region was
amplified by PCR, using chromosomal DNA from E. coli strain
MG1655 as a template and oligonucleotides pFMsrB1(CTGATAGAATTCCATATGGCTAATAAACCTTCGGC) and pBMsrB3
(TACTATTCTAAGCTTGGATCCTCAACCGTTGATTTCTTCGCCG) as primers. The PCR
product was inserted in pBAD24 plasmid between the EcoRI and
HindIII sites. All plasmid constructs were verified by DNA sequencing.
Expression and Purification of Proteins--
The C-terminal
His-tagged form of MsrA was purified. E. coli strain
BL21(DE3) cells containing the plasmids pET21MsrA plasmid grown at
37 °C in Luria Bertani containing 100 µg/ml ampicillin. Cells were
grown until an A600 value of 0.6, then 1 mM isopropyl-1-thio-
MsrB protein was overproduced in DH5 In Vitro Oxidation of Calmodulin--
Prior to oxidation,
calmodulin was decalcified. One to 10 mg of lyophilized CaM was
dissolved in water and precipitated with 3.3% trichloroacetic
acid. The pellet was suspended in a minimal volume of Tris 1 M, pH9, water added to 1 ml of trichloroacetic acid
precipitation was repeated three times, and, the last time, calmodulin-containing pellet was suspended in Hepes 50 mM,
pH 7.5. Decalcified calmodulin (100 µM in Hepes 50 mM, pH 7.5) was treated with 50 mM
H2O2 for 4 h at room temperature.
H2O2 was removed by gel filtration through G25
Sephadex. Calmodulin was then concentrated by ultrafiltration on
ultrafree biomax-5K (Millipore).
Methionine Sulfoxide Reductase Activity Assay--
Methionine
sulfoxide reductase activity was assayed in 50 mM Tris
buffer, pH 7.5, containing the substrate CaMox or MetSO, thioredoxin (5 µM), thioredoxin reductase (87 nM), and NADPH (that was used either at 200 or 400 µM). Reducing equivalents required for MetSO reduction
were given by NADPH through the thioredoxin/thioredoxin reductase
system (19). Assays were carried out at 37 °C in a final volume of
400 µl. All of the components were mixed together before adding the
enzyme. The amount of NADPH oxidized was determined by measuring the
absorbance at 340 nm. A unit of activity was defined as 1 nmol of NADPH
oxidized per min. The rate of NADPH oxidation was linear with respect
to enzyme concentration.
Mass Spectrometry Analysis--
Sample preparation was performed
as follows. 30 µM CaMox was incubated at 37 °C in the
presence of 1 µM of MsrA, MsrB, or both in 50 mM Tris-HCl (pH 7.5) containing thioredoxin (5 µM), thioredoxin reductase (87 nM) and NADPH
(400 µM). The reaction was stopped by loading the sample
onto a Sephadex G-25 column equilibrated with
NH Construction of a msrB::aphA-3 Mutant--
Plasmid
pMsrB was obtained as follows. The msrB coding region was
amplified from chromosomal DNA from E. coli strain
MG1655 using oligonucleotides 5' coding pFMsrB2 containing an
EcoRI site (5'-ACTGATCATGAATTCCAAGCTTTGTTAGTGAATAAAAGGTTG-3') and 3'-complementary pBMsrB3 containing a SphI site
(5'-TAGCTCAGCATGCAACTCAGATCACAATTACGC-3'). Note that pFMsrB2 and
pBMsrB3 oligonucleotides are found at 300 nt upstream and 560 nt
downstream of the msrB coding region. The resulting PCR
product was cloned into pUC18 plasmid, previously cut with
EcoRI and SphI enzymes, yielding pMsrB01. The
msrB gene was interrupted by insertion of an
aphA-3 cassette (KanR) (21) to generate a
non-polar mutation as follows. The pMsrB01 plasmid was digested with
AgeI, and the extremities blunted with the Klenow fragment
of DNA polymerase I. The aphA-3 cassette was obtained after
SmaI digestion of pUC18K plasmid and inserted at the
AgeI linearized pMsrB01 plasmid, yielding pMsrB02 plasmid. Note that the AgeI site is located at nt 210 downstream the
ATG start codon. The pMsrB02 plasmid was then linearized by using SphI and EcoRI restriction enzymes and the
resulting linear fragment was electroporated into E. coli
KM354 (recJ) strain carrying the pTP223 plasmid (bet
gam exo) (22). KanR clones were selected and checked
for AmpS phenotype. PCR was then used to check that
recombination had taken place at the msrB locus. Last, the
mutation was transferred into the E. coli MG1655 wild type
strain by transduction with P1 phage, and the resulting mutant strain
was called BE017.
Cadmium Sensitivity--
Cultures of E. coli were
grown overnight in M9 medium. Cells were then pelleted and resuspended
in fresh M9 to an A600 of 0.01. Growth was
followed by measuring the A600. During the
exponential growth phase (A600 of 0.6), cultures
were split into two subcultures, one of which received cadmium
(final concentration 22 µM).
MsrB Is Highly Conserved among Living Organisms--
In six of the
available genome sequences, msrA-encoded protein is fused to
an additional domain of ~150 residues in size and of unknown
function. This additional domain was found to occur in all available
genomic sequences, including eubacteria, animals, plants, humans, and
some archea, most often as a single gene product. This domain will be
referred to as MsrB. The level of conservation within the MsrB family
is quite high since, for instance, human and E. coli
sequences share around 25% identity.
MsrB Does Not Interact with MsrA--
The fusion between MsrA and
MsrB in some genomes was recently used as a basis to predict physical
interactions between the two proteins (23). We investigated this issue
by using E. coli MsrB and MsrA proteins as models. Both
proteins were purified (see "Experimental Procedures") mixed, and
run on a gel filtration column. Despite use of various running
conditions, MsrA and MsrB always eluted at their respective apparent
molecular weight (data not shown). Likewise, interaction between MsrA
and MsrB failed to be revealed by either cross-linking or yeast
two-hybrid assays (data not shown). Taken together, these data rendered
a physical interaction between MsrA and MsrB highly unlikely.
MsrB Is a Sulfoxide Reductase--
Another possibility to account
for the fusion of MsrA and MsrB was that they are functionally related.
Therefore, we tested whether MsrB had sulfoxide reductase activity.
MetSO and dimethyl sulfoxide (Me2SO) were used as
substrates as well as methionine. The thioredoxin recycling assay,
where reducing equivalents are provided by NADPH through the
thioredoxin/thioredoxin reductase system, was used (19). Reductase
activity was determined by following spectrophotometrically the
oxidation of NADPH. NADPH oxidation was observed when MetSO (2.8 nmol
NADPH oxidized/min) or Me2SO (5.7 nmol NADPH oxidized/min)
were used as substrates. In contrast, no NADPH oxidation was observed
with methionine as a substrate. This indicated that MsrB has a
sulfoxide reductase activity.
Comparison of MsrA and MsrB Activity on MetSO--
To compare the
efficiencies of MsrA and MsrB in reducing free MetSO, we undertook
steady-state kinetics analysis of these enzymes. Under our assay
conditions, MsrB and MsrA exhibited Michaelis-Menten kinetics (Fig.
1). Km values were 170 µM and 6.7 mM for MsrA and MsrB,
respectively. The value found with MsrA is in good agreement with the
previously published value of 120 µM (24). Turn over
numbers were 20 min Comparison of MsrA and MsrB Activity on Oxidized Calmodulin
(CaMox)--
To know whether MsrB could act on peptide-bound MetSO,
CaMox was used as a substrate since repair of CaMox by MsrA has been well documented (9). Kinetic studies showed that activities of MsrA and
MsrB, using CaMox as a substrate, were similar (Fig. 2). MsrA exhibited higher initial rate of
NADPH oxidation, e.g. 2 nmol of NADPH oxidized/min, than
MsrB, e.g. 1.3 nmol of NADPH oxidized/min (Fig. 2). However,
the total amount of NADPH oxidized by either MsrA or MsrB was
identical. This analysis showed that MsrB can also act on MetSO
residues within oxidized proteins.
Analysis of CaMox Repair by MsrB Using Mass Spectrometry--
The
repair of CaMox by MsrB was further studied by mass spectrometry.
Calmodulin was first decalcified and subsequently oxidized in
vitro, and the resulting product analyzed by mass electrospray coupled to Fourier Transform ion cyclotron resonance (FTICR) (Fig. 3A). The major species (45%)
was CaMox containing 8 MetSO (there are eight methionines in the CaM
used). Additional abundant species containing 6 and 7 MetSO were also
detected, amounting to 24 and 31%, respectively. No other species were
detected indicating that only MetSO were generated. Incubation of CaMox
with MsrA resulted in reduction of several, but not all of the MetSO
residues (Fig. 3B) The most abundant population contained 3 MetSO (41%) though oxiforms containing 1 to 4 MetSO residues were
present (Fig. 3B). Such a partial repair of CaMox by MsrA is
consistent with previous work by others (9). Incubation of CaMox with
MsrB led to a pattern similar to that observed with MsrA (Fig.
3C). Oxiforms containing from 1 to 4 MetSO were found, with
the 3 MetSO-containing species being the most abundant (40%). It is
noteworthy that the 1 MetSO-containing oxiform population accounted for
12% of the population repaired by MsrB while it was in very low
abundance (4%) when MsrA was used as a reductase. Incubation of CaMox
with both MsrA and MsrB yielded three populations. The first exhibited a mass that corresponded to the expected value for fully reduced CaM.
This species accounted for 60% of the population. A second species,
the mass of which corresponded to reduced CaM with one calcium ion
bound, represented about 32% of the population. We could also observe
a very low abundance species, the mass of which corresponded to that
expected for a reduced calmodulin with two calcium ions bound (6%). It
is likely that calcium found in these species came from trace amounts
present in instruments or the preparations of MsrA, MsrB, or
thioredoxin reductase.
Additive Effects of MsrA and MsrB--
The fact that full repair
of CaMox required the presence of both MsrA and MsrB suggested that the
two enzymes possess complementary properties. To investigate this
issue, we submitted CaMox to sequential repair by MsrA and MsrB. CaMox
was incubated with MsrB in the presence of both NADPH and the couple
thioredoxin/thioredoxin reductase, and the reaction left to proceed
until NADPH oxidation stopped (Fig.
4A). Arrest of the reaction
could be due to limitation of either a chemical required for the
reaction or substrate. Subsequent addition in the same mixture of a new
batch of CaMox allowed the reaction to resume (Fig. 4A). In
contrast, addition of new enzyme did not allow the reaction to resume
(Fig. 4A). Taken together, these experiments indicate that
the reaction had previously ceased because of substrate limitation. In
a new experiment, we left the MsrB-catalyzed reaction to proceed until
it reached substrate limitation and then added MsrA. We observed that
NADPH oxidation resumed (Fig. 4A). The converse experiment
was also performed. CaMox was first reduced by MsrA, the reaction again
left to proceed until apparent completion, i.e. substrate
limitation, and MsrB was subsequently added to the mixture. Again, we
observed that the consumption of NADPH resumed upon addition of the
second enzyme (Fig. 4B).
MsrB Contributes to Resistance of E. coli Against Cadmium In this study, we identified a new methionine sulfoxide reductase,
the structural gene of which is conserved throughout almost all
free-living organisms with the exception of a few archaebacteria. The
function of this enzyme is to repair proteins that have been damaged by
exposure to oxidative agents.
MsrB was found to act on free MetSO and Me2SO. This argues
for MsrB being specific for the Full repair of CaMox is an as yet undocumented phenomenon. This was
achieved when MsrA and MsrB were added simultaneously. To explain that
MsrA was unable to fully repair CaMox, Squier and collaborators put
forward the hypothesis that MsrA repairs MetSO residues that are
located in hydrophobic regions of CaMox, i.e. those residues
that are buried in the native structure. This led support to the model
that MsrA acts upon unfolded forms (9). As a consequence, we might
explain the full repair of CaMox by postulating that MsrB acts upon
solvent-exposed MetSO. However, recent results revealed that MsrA
exhibits diastereoselectivity and acts selectively on
L-Met-S-SO in CaMox (27, 28). Hence, another possibility is
that MsrB repairs selectively L-Met-R-SO. CaMox would then
contain a mixture of both diastereoisomers that would require both
types of methionine sulfoxide reductase to be fully reduced. The
hypothesis of substrate specificity received additional experimental
support by submitting CaMox to sequential action of MsrA and MsrB.
Indeed, we observed that CaMox that had previously been reduced by MsrA
remained a bona fide substrate for MsrB and vice versa. The
simplest interpretation is that each Msr targets different MetSO
diastereoisomers within CaMox. Recently, this hypothesis
received additional support using purified L-Met-R-SO and
L-Met-S-SO and MsrB-purified
protein.2
Despite being functionally related, MsrA and MsrB appear not to share a
recent origin since comparison of their amino acid sequences
failed to reveal any overall similarity. Moreover, 1D NMR analysis of
E. coli MsrB3 as
well as CD spectra of the Mycoplasma genitalium msrB
ortholog (MG448) suggested that MsrB is unstructured (29). This
contrasts with MsrA that is well structured, as recently shown by the
resolution of the three-dimensional structures by x-ray crystallography
(5, 6). Of potential interest, however, is a motif reading CGWP(S/A)F that is present in MsrB sequences. This motif is reminiscent of the
signature motif CGFWG, containing the Cys catalytic residue in MsrA
(7). Ongoing studies aim at testing the role of the CGWP(S/A)F motif in
MsrB activity.
Analysis of msrA and msrB genes distribution in
all sequenced genomes revealed a great diversity of genetic
organizations (Fig. 6). In some genomes,
msrA and msrB are located in different positions
(e.g. E. coli). In some genomes, they are fused
such as to encode a bifunctional MsrA-MsrB polypeptide (e.g.
Helicobacter pylori). In Bacillus subtilis, the
intermediate situation is to be found since msrA and
msrB genes lie adjacent one to the other, most probably in
an operon structure. In Neisseria, they are fused with the
dsbE ortholog that encodes a disulfide oxidoreductase. Intriguingly, in this later case, the three-domain protein possess a
signal sequence, suggesting that it acts in an extracytoplasmic compartment. Another type of organization is found in Arabidopsis thaliana, in which there are multiple msrA and
msrB, with one gene predicted to encode a polypeptide
containing two MsrB domains in tandem. Another remarkable case is
provided by human where MsrB was called SelX, a
selenocysteine-containing protein (30). Characterization of these
diverse MsrB orthologs will be of interest in revealing the biological
importance of these diverse genetic arrangements. It would, for
instance, be of interest to know whether increased efficiency in repair
was gained by the fusion of msrA and msrB or by
the tandem duplication of msrB as found in plants.
1 and 20 min
1, respectively, (ii) MsrA and MsrB act on oxidized
calmodulin, each by repairing four to six of the eight methionine
sulfoxide residues initially present, and (iii) simultaneous action of
both MsrA and MsrB allowed full reduction of oxidized calmodulin. A possibility is that these two ubiquitous methionine sulfoxide reductases exhibit different substrate specificity.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1-proteinase-inhibitor (11). In mammals, there is evidence for a
connection between MsrA and Alzheimer's disease (12) while MsrA
deficiency had previously been linked to smoker's emphysema (11). In
prokaryotes, mutation in msrA renders the cells sensitive to
hydrogen peroxide treatment (13, 14). Conversely, in yeast, overproduction of MsrA leads to resistance to AOS (15). Furthermore, msrA mutations decrease the virulence of many human and
plant pathogens (14, 16), as expected since such bacteria are submitted to high levels of AOS produced by the invaded hosts defense system.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-galactopyranoside was
added, and growth was continued for another 2 h. Cells were harvested by centrifugation and the pellet stored at
80 °C. The thawed pellet (2 g) was resuspended in 8 ml of buffer M (25 mM Hepes, pH 7.5, 10% (v/v) glycerol) containing 15 mM
-mercaptoethanol and 0.3 M KCl.
Resuspended cells were broken by a single pass through a chilled French
pressure cell at 6 tons. The resulting crude extract was centrifuged at
30,000 × g for 30 min at 4 °C. The supernatant was
loaded on a 5-ml Hi-trap column (Amersham Biosciences) charged
with nickel and equilibrated with buffer M plus 0.1 M KCl.
Proteins were eluted by a 13-ml gradient from 0.05 to 0.5 M
imidazole, and the fractions were analyzed by SDS-polyacrylamide gel
electrophoresis. The MsrA-containing fractions were pooled, brought to
0.1 M KCl, and loaded on a 0.5 × 5cm MonoQ column
(Amersham Biosciences) equilibrated with buffer M plus 0.1 M KCl and 5 mM dithiothreitol. MsrA was eluted
with a 7-ml gradient from 0.1 to 0.5 M KCl. Several
fractions containing MsrA that were >98% pure as estimated by
SDS-PAGE were aliquoted and stored at
80 °C. Typical yields were
20 mg per liter of culture. Protein concentrations were determined by
the Bradford method using the Bio-Rad Protein assay kit.
cells containing the plasmid
pBAD24MsrB. Cells were grown at 37 °C until an
A600 value of 0.6 in 4 liters of Luria Bertani
broth containing 100 µg/ml ampicillin. Expression was induced by
adding 0.2% arabinose and growth was continued for another 3 h.
Cells were harvested by centrifugation, and the pellet (12 g) was
resuspended in 48 ml of buffer A (50 mM Tris, pH 7.5, 10%
(v/v) glycerol, 5 mM dithiothreitol). Resuspended cells
were broken by a single pass through an ice-chilled French pressure
cell at 5.5 tons. The crude extract was centrifuged at 30,000 × g for 30 min at 4 °C. The supernatant was precipitated with 0.1% (v/v) polyethylenimine and centrifuged at 15,000 × g at 4 °C for 20 min. The resulting supernatant was
adjusted to 50 mM KCl and applied on a 30-ml Q-Sepharose
(Sigma) column (column XK 16/20 Amersham Biosciences) equilibrated with
buffer A plus 0.05 M KCl. A 150-ml gradient, running from
0.05 to 0.5 M KCl, was used for elution. Fractions
containing MsrB were detected by immunoblot using anti-MsrB antibodies.
The MsrB-containing fractions were pooled and concentrated by
ultrafiltration on ultrafree biomax-5K (Millipore). Concentrated
proteins were run on a gel filtration column (Superdex 75 HR 10/30
Amersham Biosciences) equilibrated with buffer M supplemented with 50 mM KCl, 5 mM dithiothreitol. MsrB protein was
eluted at a molecular mass of 15,000 Da. Purity was estimated to
be greater than 98% on SDS-PAGE Coomassie Blue staining. Mass
spectrometry on the sample confirmed that MsrB was pure. Calibration of
the gel filtration column indicated that the size of MsrB was 15,000 Da
as predicted from amino acid sequence. Typical yields were 6 mg per
liter of culture. Protein concentration was determined by the Bradford
method using the Bio-Rad Protein assay kit. Calmodulin VU1, a
recombinant calmodulin able to activate all calmodulin targets was used
(17). VU1 was expressed and purified by column chromatography as
previously described (18). Purity of the protein was checked by
SDS-PAGE and electrospray mass spectrometry.

10
millibars. Calmodulin samples were prepared at a concentration of 30 µM in 50:50 water:acetonitrile 1% formic acid and
injected into the mass spectrometer using a syringe pump, at a rate of 60 µl h
1.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 and 0.6 min
1 for MsrA
and MsrB, respectively. Catalytic efficiency
(kcat/Km) of MsrA was found to be
1000-fold greater than that of MsrB reflecting the much lower ability
of MsrB to reduce free MetSO. These results indicated that MsrB is much
less efficient at reducing free MetSO than MsrA.

View larger version (17K):
[in a new window]
Fig. 1.
Characterization of MsrB and MsrA activity
with MetSO as a substrate. MsrA and MsrB activities were assayed
at various concentrations in MetSO. Reactions mixtures included studied
enzymes, NADPH (200 µM), thioredoxin (5 µM), and thioredoxin reductase (87 nM). Curve
fitting and Km calculation were done using Sigma
Prism software. A, reaction carried out with MsrA (0.3 µM). The calculated turn-over number was 20 min
1. B, reaction carried out with MsrB (10 µM). The calculated turn-over number was 0.6 min
1.

View larger version (12K):
[in a new window]
Fig. 2.
Use of CaMox as a substrate by MsrA or
MsrB. Reactions mixtures included NADPH (200 µM),
thioredoxin (5 µM), thioredoxin reductase (87 nM), and CaMox (30 µM). Reactions were
carried out with 1 µM MsrA (
), 1 µM MsrB
(
).

View larger version (41K):
[in a new window]
Fig. 3.
CaMox is fully repaired by the combined
action of both MsrA and MsrB. CaM was first decalcified and
subsequently oxidized. FTICR spectra of CaMox (A), CaMox
repaired by MsrA (B), CaMox repaired by MsrB (C),
and CaMox repaired by both MsrA and MsrB (D). Spectra shown
are for the 10+ charge state. Percentages indicate proportion of
species seen in spectrum, based on peak intensity summed for all charge
states.

View larger version (23K):
[in a new window]
Fig. 4.
Sequential action of MsrA and MsrB on CaMox
as a substrate. Reactions mixtures included NADPH (400 µM), thioredoxin (5 µM), thioredoxin
reductase (87 nM), and CaMox (30 µM).
A, reaction was carried out first with 1 µM of
MsrB (
) until completion, at which point (indicated by an
arrow), CaMox (30 µM) (
), 1 µM MsrB (
), or 1 µM MsrA (
) was
added. B, reaction was carried out first with 1 µM of MsrA (
) until completion, at which point, CaMox
(30 µM) (
), 1 µM MsrA (
), or 1 µM MsrB (
) was added.
A
strain of E. coli lacking a functional copy of
msrB was constructed by reverse genetics (see
"Experimental Procedures"). No defect in growth rate or colony
morphology was observed when grown in LB medium. The expression of an
ortholog of msrB has been reported to be induced by cadmium
in Enterococcus faecalis (25). Therefore, we investigated
whether msrB had any relationship with cadmium resistance in
E. coli. While wild type E. coli MG1655 strain
grew well in the presence of cadmium, MG1655 msrB strain
stopped growing (Fig. 5). We should note
that in some experiments, cadmium sensitivity was less dramatic. We
have no explanation for this but suspect changes in trace elements
concentration in the growth medium. In any case, throughout over 10 experiments carried out with simultaneously growing pair of isogenic
wild type and mutant, this later always exhibited increased sensitivity
to cadmium.

View larger version (16K):
[in a new window]
Fig. 5.
msrB is required for
cadmium resistance of E. coli. A,
growth of E. coli MG1655 (wild type) (
), BE017 pUC18
(msrB::aphA3) (X) and BE017
pMsrB strains (
). Strains were grown in M9 medium.
A600 values were recorded. B, at the
time indicated by an arrow, cadmium was added to the
cultures at a final concentration of 22 µM. Results of a
typical experiment are shown.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
SO functional group. MsrB was also
very efficient in reducing MetSO residues in peptides. To demonstrate
this, we used calmodulin as a model substrate, since this later had
been extensively used for probing the reductase activity of MsrA (for
reviews see Refs. 4, 26). Comparison of MsrA and MsrB activities on
CaMox suggested that they reduced CaMox with similar efficiencies.
Electrospray mass spectrometry coupled to FTICR was then used to
characterize the products of MsrA and/or MsrB acting on CaMox. It
should be remarked that the analysis of such protein mixtures is quite
complex since species with similar molecular masses can overlap (there
is only a 6-Da differences between a double oxidation and a one
Ca2+ adduct), generating poorly resolved peaks and
inaccuracies in mass assignment. The high accuracy (less than 10 ppm)
and resolution of FTICR measurements allowed us to characterize
oxiforms of calmodulin recovered after treatment with either reductase.
A first set of experiments, in which MsrA and MsrB were added
separately to CaMox, revealed a similar pattern of products. Neither
one was able to fully reduce CaMox, and, in both cases, the most
populated oxiform contained 3 MetSO out of 8 initially present. Repair
of CaMox by MsrA was extensively studied by Squier and collaborators
(9, 26). Overall our results are consistent with those reported by
these authors although some differences appeared in the population size
of each oxiform. These apparent discrepancies could be accounted for by
differences in samples preparation or the origin of the calmodulin
used. In particular, these authors used calcium-loaded CaMox while we
used decalcified calmodulin. Analysis of the effect of calcium on
oxidation and subsequent MsrA/B-mediated repair is under way using
calorimetric methods.

View larger version (21K):
[in a new window]
Fig. 6.
Schematic representation
of msrA and msrB genetic organization
in selected genomes. A, E. coli:
msrA (P27110) and msrB (P39903) genes are located
at 4439.80 kb and 1860.50 kb on the chromosome, respectively.
B, B. subtilis: msrA (P54154) and
msrB (P54155) open reading frames are separated by 131 nucleotides. C1, H. pylori: msrA and
msrB are fused in this order (025011). C2,
Treponema pallidum: msrB and
msrA are used in this order (083641). D,
Neisseria gonorrhoeae: msrA and msrB
are fused to each other and to dsbE encoding disulfide
oxidoreductase E (P14930). E, A. thaliana: two
msrB domains are fused (Q9ZS93). Note that additional copies
of msrA and msrB are to be found in other regions
of the A. thaliana genome. Filled diamonds,
msrA domain. Diagonal lines, msrB
domain. Checkered squares, dsbE domain.
Wavy lines, signal sequence.
Phenotypic analysis of an E. coli strain lacking a functional copy of msrB revealed its importance in cadmium resistance. Cadmium is a potent carcinogenic and damages cells in several ways, among which is catalysis of AOS production. Hypersensitivity of E. coli msrB to cadmium is consistent with the finding that expression of the E. faecalis msrB ortholog (and not msrA as misquoted by the authors) is induced in the presence of cadmium (25). In this context, it is important to remember that msrA mutation confers increased sensitivity to oxidative stress in both E. coli and Erwinia chrysanthemi (13, 14). These phenotypic analyses together with the biochemical features of MsrA and MsrB suggest that these methionine sulfoxide reductases have an important function in protecting cells from oxidative damages. Furthermore, a crucial role for msrB in cell physiology was recently advanced by a systematic alteration of Mycobacterium open reading frame that identified the msrB ortholog as an essential gene (31).
Although most proteins contain solvent-exposed methionine that are
potential targets for oxidation, one can expect that only a subset of
cell proteins will be fully inactivated by methionine oxidation. Hence,
importance of the Msr repair pathway might be appreciated by
identifying those proteins that contain structural and/or functionally
important Met residues. Alternatively, insight might be provided by
proteomic approaches aimed at describing proteins networks. A
systematic search for protein/protein interactions by the yeast
two-hybrid screen was recently carried out in H. pylori
(32). Interestingly, the H. pylori bi-functional MsrA/MsrB protein (Fig. 6) was found to interact with ClpX, a chaperone that
assists folding of abnormal proteins or associates with the ClpP
protease for degradation of those misfolded proteins. Hence, a
possibility is that MsrA/B repairs oxidized ClpX. Alternatively, MsrA/B
and ClpX might form a complex such that a given oxidized protein might
either get repaired by MsrA/B or be directed to ClpP-mediated
degradation. Our ongoing studies aim at identifying in vivo
substrates of MsrA and MsrB to define the repair pathway of
MetSO-containing proteins.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to C. Williams (University of Michigan, Ann Arbor, MI) for kindly providing us with thioredoxin reductase. Thanks are due to members of the Erwinia group, to P. Gans (Institute Biologie Structurale, Grenoble, France), to P. Moreau (Laboratoire Chimie Bacterienne, Marseille, France) for fruitful discussions, to J. Sturgis (Laboratoire Ingéniérie Systems Membranaires, Marseille, France) for help in preparing the manuscript and to R. Toci (LCB) for help in Cam purification.
| |
FOOTNOTES |
|---|
* This work was supported by grants from the Fondation de la Recherche Médicale, the CNRS and the Université de la Méditerranée.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Both authors contributed equally to this work.
¶ Receipient of a fellowship from the Fondation de la Recherche Médicale. Present address: Laboratoire d'Ecologie Moléculaire, IBEAS-UFR Science et Technologie, Université de Pau et des Pays de l'Adour, BP 1155 64013 Pau cedex, France.
Receipent of a fellowship from the Ministère de
l'Education Nationale.
§§ To whom correspondence should be addressed: Tel.: 33-4-91-16-45-79; Fax: 33-4-91-71-89-14; E-mail: barras@ibsm.cnrs-mrs.fr.
Published, JBC Papers in Press, October 24, 2001, DOI 10.1074/jbc.M105509200
2 H. Weissbach, personal communication.
3 P. Gans, unpublished material.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: AOS, active oxygen species; MetSO, methionine sulfoxide; HIV, human immunodeficiency virus; nt, nucleotide(s); CaMox, oxidized calmodulin; FTICR, Fourier Transform ion cyclotron resonance.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Stadtman, E. R. (1992) Science 257, 1220-1224 |
| 2. | Vogt, W. (1995) Free Radic. Biol. Med. 18, 93-105 |
| 3. | Brot, N., Weissbach, L., Werth, J., and Weissbach, H. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 2155-2158 |
| 4. | Brot, N., and Weissbach, H. (2001) Biopolymers 55, 288-296 |
| 5. | Lowther, W. T., Brot, N., Weissbach, H., and Matthews, B. W. (2000) Biochemistry 39, 13307-13312 |
| 6. | Tete-Favier, F., Cobessi, D., Boschi-Muller, S., Azza, S., Branlant, G., and Aubry, A. (2000) Structure 8, 1167-1178 |
| 7. | Lowther, W. T., Brot, N., Weissbach, H., Honek, J. F., and Matthews, B. W. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6463-6468 |
| 8. | Boschi-Muller, S., Azza, S., Sanglier-Cianferani, S., Talfournier, F., Van Dorsselear, A., and Branlant, G. (2000) J. Biol. Chem. 275, 35908-35913 |
| 9. | Sun, H., Gao, J., Ferrington, D. A., Biesiada, H., Williams, T., and Squier, T. C. (1999) Biochemistry 38, 105-112 |
| 10. | Davis, D. A., Newcomb, F. M., Moskovitz, J., Wingfield, P. T., Stahl, S. J., Kaufman, J., Fales, H. M., Levine, R. L., and Yarchoan, R. (2000) Biochem. J. 346, 305-311 |
| 11. | Abrams, W. R., Weinbaum, G., Weissbach, L., Weissbach, H., and Brot, N. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 7483-7486 |
| 12. | Gabbita, S. P., Aksenov, M. Y., Lovell, M. A., and Markesbery, W. R. (1999) J. Neurochem. 73, 1660-1666 |
| 13. | Moskovitz, J., Rahman, M. A., Strassman, J., Yancey, S. O., Kushner, S. R., Brot, N., and Weissbach, H. (1995) J. Bacteriol. 177, 502-507 |
| 14. | El Hassouni, M., Chambost, J. P., Expert, D., Van Gijsegem, F., and Barras, F. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 887-892 |
| 15. | Moskovitz, J., Flescher, E., Berlett, B. S., Azare, J., Poston, J. M., and Stadman, E. R. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14071-14075 |
| 16. | Wizemann, T. M., Moskovitz, J., Pearce, B. J., Cundell, D., Arvidson, C. G., So, M., Weissbach, H., Brot, N., and Masure, H. R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7985-7990 |
| 17. | Craig, T. A., Waterson, D. M., Prendergast, F. G., Haiech, J., and Roberts, D. M. (1987) J. Biol. Chem. 262, 3278-3284 |
| 18. | Roberts, D. M., Crea, R., Malecha, M., Alvarado-Urbina, G., Chiarello, R. H., and Waterson, D. M. (1985) Biochemistry 24, 5090-5098 |
| 19. | Moskovitz, J., Weissbach, H., and Brot, N. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2095-2098 |
| 20. | Palmblad, M., H. K., Hakansson, P., Feng, X., Cooper, H. J., Giannakopulos, A. E., Green, P. S., and Derrick, P. J. (2000) Eur. J. Mass. Spectrom. 6, 267-275 |
| 21. | Menard, R., Sansonetti, P. J., and Parsot, C. (1993) J. Bacteriol. 175, 5899-5906 |
| 22. | Murphy, K. C. (1998) J. Bacteriol. 180, 2063-2071 |
| 23. | Enright, A. J., Iliopoulos, I., Kyrpides, N. C., and Ouzounis, C. A. (1999) Nature 402, 86-90 |
| 24. | Moskovitz, J., Poston, J. M., Berlett, B. S., Nosworthy, N. J., Szczepanowski, R., and Stadtman, E. R. (2000) J. Biol. Chem. 275, 14167-14172 |
| 25. | Laplace, J. M., Hartke, A., Giard, J. C., and Auffray, Y. (2000) Appl. Microbiol. Biotechnol. 53, 685-689 |
| 26. | Squier, T. C., and Bigelow, D. J. (2000) Front. Biosci. 5, 504-526 |
| 27. | Sharov, V. S., Ferrington, D. A., Squier, T. C., and Schöneich, C. (1999) FEBS Lett. 455, 247-250 |
| 28. | Sharov, V. S., and Schöneich, C. (2000) Free Radic. Biol. Med. 29, 986-994 |
| 29. | Balasubramanian, S., Schneider, T., Gerstein, M., and Regan, L. (2000) Nucleic Acids Res. 28, 3075-3082 |
| 30. | Lescure, A., Gautheret, D., Carbon, P., and Krol, A. (1999) J. Biol. Chem. 274, 38147-38154 |
| 31. | Hutchison, C. A., Peterson, S. N., Gill, S. R., Cline, R. T., White, O., Fraser, C. M., Smith, H. O., and Venter, J. C. (1999) Science 286, 2165-2169 |
| 32. | Rain, J. C., Selig, L., De Reuse, H., Battaglia, V., Reverdy, C., Simon, S., Lenzen, G., Petel, F., Wojcik, J., Schachter, V., Chemama, Y., Labigne, A., and Legrain, P. (2001) Nature 409, 211-215 |
This article has been cited by other articles:
![]() |
F. Cabreiro, C. R. Picot, M. Perichon, J. Castel, B. Friguet, and I. Petropoulos Overexpression of Mitochondrial Methionine Sulfoxide Reductase B2 Protects Leukemia Cells from Oxidative Stress-induced Cell Death and Protein Damage J. Biol. Chem., June 13, 2008; 283(24): 16673 - 16681. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Achilli, A. Ciana, A. Rossi, C. Balduini, and G. Minetti Neutrophil granulocytes uniquely express, among human blood cells, high levels of Methionine-sulfoxide-reductase enzymes J. Leukoc. Biol., January 1, 2008; 83(1): 181 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Neiers, S. Sonkaria, A. Olry, S. Boschi-Muller, and G. Branlant Characterization of the Amino Acids from Neisseria meningitidis Methionine Sulfoxide Reductase B Involved in the Chemical Catalysis and Substrate Specificity of the Reductase Step J. Biol. Chem., November 2, 2007; 282(44): 32397 - 32405. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lin, L. C. Johnson, H. Weissbach, N. Brot, M. O. Lively, and W. T. Lowther Free methionine-(R)-sulfoxide reductase from Escherichia coli reveals a new GAF domain function PNAS, June 5, 2007; 104(23): 9597 - 9602. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rouhier, B. Kauffmann, F. Tete-Favier, P. Palladino, P. Gans, G. Branlant, J.-P. Jacquot, and S. Boschi-Muller Functional and Structural Aspects of Poplar Cytosolic and Plastidial Type A Methionine Sulfoxide Reductases J. Biol. Chem., February 2, 2007; 282(5): 3367 - 3378. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Krin, N. Chakroun, E. Turlin, A. Givaudan, F. Gaboriau, I. Bonne, J.-C. Rousselle, L. Frangeul, C. Lacroix, M.-F. Hullo, et al. Pleiotropic Role of Quorum-Sensing Autoinducer 2 in Photorhabdus luminescens. Appl. Envir. Microbiol., October 1, 2006; 72(10): 6439 - 6451. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Alamuri and R. J. Maier Methionine Sulfoxide Reductase in Helicobacter pylori: Interaction with Methionine-Rich Proteins and Stress-Induced Expression. J. Bacteriol., August 1, 2006; 188(16): 5839 - 5850. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sagher, D. Brunell, J. F. Hejtmancik, M. Kantorow, N. Brot, and H. Weissbach Thionein can serve as a reducing agent for the methionine sulfoxide reductases PNAS, June 6, 2006; 103(23): 8656 - 8661. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. CABREIRO, C. R. PICOT, B. FRIGUET, and I. PETROPOULOS Methionine Sulfoxide Reductases: Relevance to Aging and Protection against Oxidative Stress. Ann. N.Y. Acad. Sci., May 1, 2006; 1067: 37 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Olry, S. Boschi-Muller, H. Yu, D. Burnel, and G. Branlant Insights into the role of the metal binding site in methionine-R-sulfoxide reductases B Protein Sci., November 1, 2005; 14(11): 2828 - 2837. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Masse, C. K. Vanderpool, and S. Gottesman Effect of RyhB Small RNA on Global Iron Use in Escherichia coli J. Bacteriol., October 15, 2005; 187(20): 6962 - 6971. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Vattanaviboon, C. Seeanukun, W. Whangsuk, S. Utamapongchai, and S. Mongkolsuk Important Role for Methionine Sulfoxide Reductase in the Oxidative Stress Response of Xanthomonas campestris pv. phaseoli J. Bacteriol., August 15, 2005; 187(16): 5831 - 5836. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Marchetti, G. O. Pizarro, D. Sagher, C. DeAmicis, N. Brot, J. F. Hejtmancik, H. Weissbach, and M. Kantorow Methionine Sulfoxide Reductases B1, B2, and B3 Are Present in the Human Lens and Confer Oxidative Stress Resistance to Lens Cells Invest. Ophthalmol. Vis. Sci., June 1, 2005; 46(6): 2107 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vieira Dos Santos, S. Cuine, N. Rouhier, and P. Rey The Arabidopsis Plastidic Methionine Sulfoxide Reductase B Proteins. Sequence and Activity Characteristics, Comparison of the Expression with Plastidic Methionine Sulfoxide Reductase A, and Induction by Photooxidative Stress Plant Physiology, June 1, 2005; 138(2): 909 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, F. Neiers, S. Boschi-Muller, and G. Branlant The N-terminal Domain of PILB from Neisseria meningitidis Is a Disulfide Reductase That Can Recycle Methionine Sulfoxide Reductases J. Biol. Chem., April 1, 2005; 280(13): 12344 - 12350. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kern, A. Malki, J. Abdallah, J.-C. Liebart, C. Dubucs, M. H. Yu, and G. Richarme Protein Isoaspartate Methyltransferase Is a Multicopy Suppressor of Protein Aggregation in Escherichia coli J. Bacteriol., February 15, 2005; 187(4): 1377 - 1383. [Abstract] [Full Text] |