HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 52, 48915-48920, December 28, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/52/48915    most recent M105509200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Grimaud, R. Articles by Barras, F. Search for Related Content PubMed PubMed Citation Articles by Grimaud, R. Articles by Barras, F. Social Bookmarking                      What's this?

Repair of Oxidized Proteins

IDENTIFICATION OF A NEW METHIONINE SULFOXIDE REDUCTASE^*

Régis Grimaud^§¶, Benjamin Ezraty^§, Jennifer K. Mitchell^**, Daniel Lafitte, Claudette Briand, Peter J. Derrick^**, and Frédéric Barras^§§

From the  Laboratoire de Chimie Bactérienne, CNRS, Institute Biologie Structurale et Microbiologie, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 20, France, the ^** Chemistry Department, University of Warwick, Coventry, CV4 7AL, United Kingdom, and the  Faculté de Pharmacie, La Timone, Marseille 3005, France

Received for publication, June 14, 2001, and in revised form, September 18, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Oxidation of methionine residues to methionine sulfoxide can lead to inactivation of proteins. Methionine sulfoxide reductase (MsrA) has been known for a long time, and its repairing function well characterized. Here we identify a new methionine sulfoxide reductase, which we referred to as MsrB, the gene of which is present in genomes of eubacteria, archaebacteria, and eucaryotes. The msrA and msrB genes exhibit no sequence similarity and, in some genomes, are fused. The Escherichia coli MsrB protein (currently predicted to be encoded by an open reading frame of unknown function named yeaA) was used for genetic, enzymatic, and mass spectrometric investigations. Our in vivo study revealed that msrB is required for cadmium resistance of E. coli, a carcinogenic compound that induces oxidative stress. Our in vitro studies, showed that (i) MsrB and MsrA enzymes reduce free methionine sulfoxide with turn-over rates of 0.6 min¹ and 20 min¹, respectively, (ii) MsrA and MsrB act on oxidized calmodulin, each by repairing four to six of the eight methionine sulfoxide residues initially present, and (iii) simultaneous action of both MsrA and MsrB allowed full reduction of oxidized calmodulin. A possibility is that these two ubiquitous methionine sulfoxide reductases exhibit different substrate specificity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

All organisms living aerobically are exposed to active oxygen species (AOS)¹ produced during respiration. Most macromolecules are targeted by AOS. There is an increasing body of evidence that links oxidative stress to reduced survival rate and various pathological situations (1). Therefore, a series of protecting systems helps cells to cope with the presence of AOS. A subset of these systems, including catalase, peroxidase, superoxide dismutase, acts by reducing endogenous levels of AOS. Another second subset includes enzymes to repair AOS damage; such "repairing" enzymes can rescue oxidized lipid, DNA, or proteins.

Protein oxidation can lead to conformation changes and, in some cases, loss of function. Amino acids readily prone to AOS oxidation include cysteine, histidine, tryptophan, tyrosine, and methionine, this latter being the most sensitive (2). Methionine oxidation to methionine sulfoxide (MetSO) is reversible. Reduction of MetSO is catalyzed by methionine sulfoxide reductase (MsrA), an enzyme present in all living organisms (3, 4). MsrA has been known for a long time and has received increasing attention over the last years. Its three-dimensional structure has been described (5, 6), and the basis of its catalytic mechanism determined (7, 8). MsrA has been found to reduce both free MetSO as well as MetSO residues in proteins. A series of proteins, of considerable medical interest, has been identified as substrates of MsrA. These include calmodulin (9), HIV protease (10) or 1-proteinase-inhibitor (11). In mammals, there is evidence for a connection between MsrA and Alzheimer's disease (12) while MsrA deficiency had previously been linked to smoker's emphysema (11). In prokaryotes, mutation in msrA renders the cells sensitive to hydrogen peroxide treatment (13, 14). Conversely, in yeast, overproduction of MsrA leads to resistance to AOS (15). Furthermore, msrA mutations decrease the virulence of many human and plant pathogens (14, 16), as expected since such bacteria are submitted to high levels of AOS produced by the invaded hosts defense system.

In a few bacteria, MsrA is actually a domain of a polypeptide containing a second domain. We have analyzed the occurrence of this second domain and found it coded for in most sequenced genomes. In Escherichia coli, this gene is named yeaA. Here we report the characterization of YeaA, that we have rebaptised MsrB and find it to be a second methionine sulfoxide reductase that acts both on free MetSO and protein-contained MetSO residues.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Chemicals and Growth Conditions-- Unless noted otherwise, chemicals were purchased from Sigma. Thioredoxin reductase was a gift from Dr. C. Williams (University of Michigan, Ann Arbor, MI). Bacteria were grown on Luria-Bertani medium or M9 minimal medium.

Plasmids-- DNA manipulations were carried out using standard techniques, according to the manufacturer's instructions. Plasmid pET21MsrA was obtained by cloning the msrA gene in the pET21a vector (Novagen). Expression from this vector results in the synthesis of a protein with a His tag on the C terminus. The msrA coding region was amplified by polymerase chain reaction (PCR) using chromosomal DNA from E. coli strain MG1655 as a template and the oligonucleotides pFMsrAColi2-(GAATTCGCTAGCGAGCTCAGGAGGTTCCATATGAGTTTATTTGATAAAAAGCATCTGG) and pMsrAHis-C (GATCACTAAGCTTGGATCCTAGTGGTGGTGGTGGTGGTGGTGTGCTTCCGGC GGCAGACAGAC) as primers. The PCR product was inserted in plasmid pET21a between the EcoRI and HindIII sites. Plasmid pBAD24MsrB was obtained by cloning the msrB coding region into pBAD24 plasmid. The msrB coding region was amplified by PCR, using chromosomal DNA from E. coli strain MG1655 as a template and oligonucleotides pFMsrB1(CTGATAGAATTCCATATGGCTAATAAACCTTCGGC) and pBMsrB3 (TACTATTCTAAGCTTGGATCCTCAACCGTTGATTTCTTCGCCG) as primers. The PCR product was inserted in pBAD24 plasmid between the EcoRI and HindIII sites. All plasmid constructs were verified by DNA sequencing.

Expression and Purification of Proteins-- The C-terminal His-tagged form of MsrA was purified. E. coli strain BL21(DE3) cells containing the plasmids pET21MsrA plasmid grown at 37 °C in Luria Bertani containing 100 µg/ml ampicillin. Cells were grown until an A₆₀₀ value of 0.6, then 1 mM isopropyl-1-thio--D-galactopyranoside was added, and growth was continued for another 2 h. Cells were harvested by centrifugation and the pellet stored at 80 °C. The thawed pellet (2 g) was resuspended in 8 ml of buffer M (25 mM Hepes, pH 7.5, 10% (v/v) glycerol) containing 15 mM -mercaptoethanol and 0.3 M KCl. Resuspended cells were broken by a single pass through a chilled French pressure cell at 6 tons. The resulting crude extract was centrifuged at 30,000 × g for 30 min at 4 °C. The supernatant was loaded on a 5-ml Hi-trap column (Amersham Biosciences) charged with nickel and equilibrated with buffer M plus 0.1 M KCl. Proteins were eluted by a 13-ml gradient from 0.05 to 0.5 M imidazole, and the fractions were analyzed by SDS-polyacrylamide gel electrophoresis. The MsrA-containing fractions were pooled, brought to 0.1 M KCl, and loaded on a 0.5 × 5cm MonoQ column (Amersham Biosciences) equilibrated with buffer M plus 0.1 M KCl and 5 mM dithiothreitol. MsrA was eluted with a 7-ml gradient from 0.1 to 0.5 M KCl. Several fractions containing MsrA that were >98% pure as estimated by SDS-PAGE were aliquoted and stored at 80 °C. Typical yields were 20 mg per liter of culture. Protein concentrations were determined by the Bradford method using the Bio-Rad Protein assay kit.

MsrB protein was overproduced in DH5 cells containing the plasmid pBAD24MsrB. Cells were grown at 37 °C until an A₆₀₀ value of 0.6 in 4 liters of Luria Bertani broth containing 100 µg/ml ampicillin. Expression was induced by adding 0.2% arabinose and growth was continued for another 3 h. Cells were harvested by centrifugation, and the pellet (12 g) was resuspended in 48 ml of buffer A (50 mM Tris, pH 7.5, 10% (v/v) glycerol, 5 mM dithiothreitol). Resuspended cells were broken by a single pass through an ice-chilled French pressure cell at 5.5 tons. The crude extract was centrifuged at 30,000 × g for 30 min at 4 °C. The supernatant was precipitated with 0.1% (v/v) polyethylenimine and centrifuged at 15,000 × g at 4 °C for 20 min. The resulting supernatant was adjusted to 50 mM KCl and applied on a 30-ml Q-Sepharose (Sigma) column (column XK 16/20 Amersham Biosciences) equilibrated with buffer A plus 0.05 M KCl. A 150-ml gradient, running from 0.05 to 0.5 M KCl, was used for elution. Fractions containing MsrB were detected by immunoblot using anti-MsrB antibodies. The MsrB-containing fractions were pooled and concentrated by ultrafiltration on ultrafree biomax-5K (Millipore). Concentrated proteins were run on a gel filtration column (Superdex 75 HR 10/30 Amersham Biosciences) equilibrated with buffer M supplemented with 50 mM KCl, 5 mM dithiothreitol. MsrB protein was eluted at a molecular mass of 15,000 Da. Purity was estimated to be greater than 98% on SDS-PAGE Coomassie Blue staining. Mass spectrometry on the sample confirmed that MsrB was pure. Calibration of the gel filtration column indicated that the size of MsrB was 15,000 Da as predicted from amino acid sequence. Typical yields were 6 mg per liter of culture. Protein concentration was determined by the Bradford method using the Bio-Rad Protein assay kit. Calmodulin VU1, a recombinant calmodulin able to activate all calmodulin targets was used (17). VU1 was expressed and purified by column chromatography as previously described (18). Purity of the protein was checked by SDS-PAGE and electrospray mass spectrometry.

In Vitro Oxidation of Calmodulin-- Prior to oxidation, calmodulin was decalcified. One to 10 mg of lyophilized CaM was dissolved in water and precipitated with 3.3% trichloroacetic acid. The pellet was suspended in a minimal volume of Tris 1 M, pH9, water added to 1 ml of trichloroacetic acid precipitation was repeated three times, and, the last time, calmodulin-containing pellet was suspended in Hepes 50 mM, pH 7.5. Decalcified calmodulin (100 µM in Hepes 50 mM, pH 7.5) was treated with 50 mM H₂O₂ for 4 h at room temperature. H₂O₂ was removed by gel filtration through G25 Sephadex. Calmodulin was then concentrated by ultrafiltration on ultrafree biomax-5K (Millipore).

Methionine Sulfoxide Reductase Activity Assay-- Methionine sulfoxide reductase activity was assayed in 50 mM Tris buffer, pH 7.5, containing the substrate CaMox or MetSO, thioredoxin (5 µM), thioredoxin reductase (87 nM), and NADPH (that was used either at 200 or 400 µM). Reducing equivalents required for MetSO reduction were given by NADPH through the thioredoxin/thioredoxin reductase system (19). Assays were carried out at 37 °C in a final volume of 400 µl. All of the components were mixed together before adding the enzyme. The amount of NADPH oxidized was determined by measuring the absorbance at 340 nm. A unit of activity was defined as 1 nmol of NADPH oxidized per min. The rate of NADPH oxidation was linear with respect to enzyme concentration.

Mass Spectrometry Analysis-- Sample preparation was performed as follows. 30 µM CaMox was incubated at 37 °C in the presence of 1 µM of MsrA, MsrB, or both in 50 mM Tris-HCl (pH 7.5) containing thioredoxin (5 µM), thioredoxin reductase (87 nM) and NADPH (400 µM). The reaction was stopped by loading the sample onto a Sephadex G-25 column equilibrated with NH acetate (pH 6.2). The eluted protein was subsequently lyophilized. Mass spectrometry measurements were made using a Fourier Transform Ion Cyclotron Resonance Mass Spectrometer (Bruker Daltronics, Billerica, MA) equipped with a shielded 9.4T super-conducting magnet (Magnex Scientific Ltd, Abingdon, Oxon, United Kingdom) a cylindrical "infinity" ion cyclotron resonance cell with a diameter of 0.06 m and an external electrospray source (Analytica of Branford, Branford, CT) (20). Carbon dioxide heated to 200 °C was used as the drying gas in the electrospray source. The background pressure in the ion cyclotron resonance cell was typically below 2 × 10¹⁰ millibars. Calmodulin samples were prepared at a concentration of 30 µM in 50:50 water:acetonitrile 1% formic acid and injected into the mass spectrometer using a syringe pump, at a rate of 60 µl h¹.

Construction of a msrB::aphA-3 Mutant-- Plasmid pMsrB was obtained as follows. The msrB coding region was amplified from chromosomal DNA from E. coli strain MG1655 using oligonucleotides 5' coding pFMsrB2 containing an EcoRI site (5'-ACTGATCATGAATTCCAAGCTTTGTTAGTGAATAAAAGGTTG-3') and 3'-complementary pBMsrB3 containing a SphI site (5'-TAGCTCAGCATGCAACTCAGATCACAATTACGC-3'). Note that pFMsrB2 and pBMsrB3 oligonucleotides are found at 300 nt upstream and 560 nt downstream of the msrB coding region. The resulting PCR product was cloned into pUC18 plasmid, previously cut with EcoRI and SphI enzymes, yielding pMsrB01. The msrB gene was interrupted by insertion of an aphA-3 cassette (Kan^R) (21) to generate a non-polar mutation as follows. The pMsrB01 plasmid was digested with AgeI, and the extremities blunted with the Klenow fragment of DNA polymerase I. The aphA-3 cassette was obtained after SmaI digestion of pUC18K plasmid and inserted at the AgeI linearized pMsrB01 plasmid, yielding pMsrB02 plasmid. Note that the AgeI site is located at nt 210 downstream the ATG start codon. The pMsrB02 plasmid was then linearized by using SphI and EcoRI restriction enzymes and the resulting linear fragment was electroporated into E. coli KM354 (recJ) strain carrying the pTP223 plasmid (bet gam exo) (22). Kan^R clones were selected and checked for Amp^S phenotype. PCR was then used to check that recombination had taken place at the msrB locus. Last, the mutation was transferred into the E. coli MG1655 wild type strain by transduction with P1 phage, and the resulting mutant strain was called BE017.

Cadmium Sensitivity-- Cultures of E. coli were grown overnight in M9 medium. Cells were then pelleted and resuspended in fresh M9 to an A₆₀₀ of 0.01. Growth was followed by measuring the A₆₀₀. During the exponential growth phase (A₆₀₀ of 0.6), cultures were split into two subcultures, one of which received cadmium (final concentration 22 µM).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

MsrB Is Highly Conserved among Living Organisms-- In six of the available genome sequences, msrA-encoded protein is fused to an additional domain of ~150 residues in size and of unknown function. This additional domain was found to occur in all available genomic sequences, including eubacteria, animals, plants, humans, and some archea, most often as a single gene product. This domain will be referred to as MsrB. The level of conservation within the MsrB family is quite high since, for instance, human and E. coli sequences share around 25% identity.

MsrB Does Not Interact with MsrA-- The fusion between MsrA and MsrB in some genomes was recently used as a basis to predict physical interactions between the two proteins (23). We investigated this issue by using E. coli MsrB and MsrA proteins as models. Both proteins were purified (see "Experimental Procedures") mixed, and run on a gel filtration column. Despite use of various running conditions, MsrA and MsrB always eluted at their respective apparent molecular weight (data not shown). Likewise, interaction between MsrA and MsrB failed to be revealed by either cross-linking or yeast two-hybrid assays (data not shown). Taken together, these data rendered a physical interaction between MsrA and MsrB highly unlikely.

MsrB Is a Sulfoxide Reductase-- Another possibility to account for the fusion of MsrA and MsrB was that they are functionally related. Therefore, we tested whether MsrB had sulfoxide reductase activity. MetSO and dimethyl sulfoxide (Me₂SO) were used as substrates as well as methionine. The thioredoxin recycling assay, where reducing equivalents are provided by NADPH through the thioredoxin/thioredoxin reductase system, was used (19). Reductase activity was determined by following spectrophotometrically the oxidation of NADPH. NADPH oxidation was observed when MetSO (2.8 nmol NADPH oxidized/min) or Me₂SO (5.7 nmol NADPH oxidized/min) were used as substrates. In contrast, no NADPH oxidation was observed with methionine as a substrate. This indicated that MsrB has a sulfoxide reductase activity.

Comparison of MsrA and MsrB Activity on MetSO-- To compare the efficiencies of MsrA and MsrB in reducing free MetSO, we undertook steady-state kinetics analysis of these enzymes. Under our assay conditions, MsrB and MsrA exhibited Michaelis-Menten kinetics (Fig. 1). K_m values were 170 µM and 6.7 mM for MsrA and MsrB, respectively. The value found with MsrA is in good agreement with the previously published value of 120 µM (24). Turn over numbers were 20 min¹ and 0.6 min¹ for MsrA and MsrB, respectively. Catalytic efficiency (k_cat/K_m) of MsrA was found to be 1000-fold greater than that of MsrB reflecting the much lower ability of MsrB to reduce free MetSO. These results indicated that MsrB is much less efficient at reducing free MetSO than MsrA.

View larger version (17K): [in this window] [in a new window]   Fig. 1.   Characterization of MsrB and MsrA activity with MetSO as a substrate. MsrA and MsrB activities were assayed at various concentrations in MetSO. Reactions mixtures included studied enzymes, NADPH (200 µM), thioredoxin (5 µM), and thioredoxin reductase (87 nM). Curve fitting and Km calculation were done using Sigma Prism software. A, reaction carried out with MsrA (0.3 µM). The calculated turn-over number was 20 min1. B, reaction carried out with MsrB (10 µM). The calculated turn-over number was 0.6 min1.

Comparison of MsrA and MsrB Activity on Oxidized Calmodulin (CaMox)-- To know whether MsrB could act on peptide-bound MetSO, CaMox was used as a substrate since repair of CaMox by MsrA has been well documented (9). Kinetic studies showed that activities of MsrA and MsrB, using CaMox as a substrate, were similar (Fig. 2). MsrA exhibited higher initial rate of NADPH oxidation, e.g. 2 nmol of NADPH oxidized/min, than MsrB, e.g. 1.3 nmol of NADPH oxidized/min (Fig. 2). However, the total amount of NADPH oxidized by either MsrA or MsrB was identical. This analysis showed that MsrB can also act on MetSO residues within oxidized proteins.

View larger version (12K): [in this window] [in a new window]   Fig. 2.   Use of CaMox as a substrate by MsrA or MsrB. Reactions mixtures included NADPH (200 µM), thioredoxin (5 µM), thioredoxin reductase (87 nM), and CaMox (30 µM). Reactions were carried out with 1 µM MsrA (), 1 µM MsrB ().

Analysis of CaMox Repair by MsrB Using Mass Spectrometry-- The repair of CaMox by MsrB was further studied by mass spectrometry. Calmodulin was first decalcified and subsequently oxidized in vitro, and the resulting product analyzed by mass electrospray coupled to Fourier Transform ion cyclotron resonance (FTICR) (Fig. 3A). The major species (45%) was CaMox containing 8 MetSO (there are eight methionines in the CaM used). Additional abundant species containing 6 and 7 MetSO were also detected, amounting to 24 and 31%, respectively. No other species were detected indicating that only MetSO were generated. Incubation of CaMox with MsrA resulted in reduction of several, but not all of the MetSO residues (Fig. 3B) The most abundant population contained 3 MetSO (41%) though oxiforms containing 1 to 4 MetSO residues were present (Fig. 3B). Such a partial repair of CaMox by MsrA is consistent with previous work by others (9). Incubation of CaMox with MsrB led to a pattern similar to that observed with MsrA (Fig. 3C). Oxiforms containing from 1 to 4 MetSO were found, with the 3 MetSO-containing species being the most abundant (40%). It is noteworthy that the 1 MetSO-containing oxiform population accounted for 12% of the population repaired by MsrB while it was in very low abundance (4%) when MsrA was used as a reductase. Incubation of CaMox with both MsrA and MsrB yielded three populations. The first exhibited a mass that corresponded to the expected value for fully reduced CaM. This species accounted for 60% of the population. A second species, the mass of which corresponded to reduced CaM with one calcium ion bound, represented about 32% of the population. We could also observe a very low abundance species, the mass of which corresponded to that expected for a reduced calmodulin with two calcium ions bound (6%). It is likely that calcium found in these species came from trace amounts present in instruments or the preparations of MsrA, MsrB, or thioredoxin reductase.

View larger version (41K): [in this window] [in a new window]   Fig. 3.   CaMox is fully repaired by the combined action of both MsrA and MsrB. CaM was first decalcified and subsequently oxidized. FTICR spectra of CaMox (A), CaMox repaired by MsrA (B), CaMox repaired by MsrB (C), and CaMox repaired by both MsrA and MsrB (D). Spectra shown are for the 10+ charge state. Percentages indicate proportion of species seen in spectrum, based on peak intensity summed for all charge states.

Additive Effects of MsrA and MsrB-- The fact that full repair of CaMox required the presence of both MsrA and MsrB suggested that the two enzymes possess complementary properties. To investigate this issue, we submitted CaMox to sequential repair by MsrA and MsrB. CaMox was incubated with MsrB in the presence of both NADPH and the couple thioredoxin/thioredoxin reductase, and the reaction left to proceed until NADPH oxidation stopped (Fig. 4A). Arrest of the reaction could be due to limitation of either a chemical required for the reaction or substrate. Subsequent addition in the same mixture of a new batch of CaMox allowed the reaction to resume (Fig. 4A). In contrast, addition of new enzyme did not allow the reaction to resume (Fig. 4A). Taken together, these experiments indicate that the reaction had previously ceased because of substrate limitation. In a new experiment, we left the MsrB-catalyzed reaction to proceed until it reached substrate limitation and then added MsrA. We observed that NADPH oxidation resumed (Fig. 4A). The converse experiment was also performed. CaMox was first reduced by MsrA, the reaction again left to proceed until apparent completion, i.e. substrate limitation, and MsrB was subsequently added to the mixture. Again, we observed that the consumption of NADPH resumed upon addition of the second enzyme (Fig. 4B).

View larger version (23K): [in this window] [in a new window]   Fig. 4.   Sequential action of MsrA and MsrB on CaMox as a substrate. Reactions mixtures included NADPH (400 µM), thioredoxin (5 µM), thioredoxin reductase (87 nM), and CaMox (30 µM). A, reaction was carried out first with 1 µM of MsrB () until completion, at which point (indicated by an arrow), CaMox (30 µM) (), 1 µM MsrB (), or 1 µM MsrA () was added. B, reaction was carried out first with 1 µM of MsrA () until completion, at which point, CaMox (30 µM) (), 1 µM MsrA (), or 1 µM MsrB () was added.

MsrB Contributes to Resistance of E. coli Against CadmiumA strain of E. coli lacking a functional copy of msrB was constructed by reverse genetics (see "Experimental Procedures"). No defect in growth rate or colony morphology was observed when grown in LB medium. The expression of an ortholog of msrB has been reported to be induced by cadmium in Enterococcus faecalis (25). Therefore, we investigated whether msrB had any relationship with cadmium resistance in E. coli. While wild type E. coli MG1655 strain grew well in the presence of cadmium, MG1655 msrB strain stopped growing (Fig. 5). We should note that in some experiments, cadmium sensitivity was less dramatic. We have no explanation for this but suspect changes in trace elements concentration in the growth medium. In any case, throughout over 10 experiments carried out with simultaneously growing pair of isogenic wild type and mutant, this later always exhibited increased sensitivity to cadmium.

View larger version (16K): [in this window] [in a new window]   Fig. 5.   msrB is required for cadmium resistance of E. coli. A, growth of E. coli MG1655 (wild type) (), BE017 pUC18 (msrB::aphA3) (X) and BE017 pMsrB strains (). Strains were grown in M9 medium. A600 values were recorded. B, at the time indicated by an arrow, cadmium was added to the cultures at a final concentration of 22 µM. Results of a typical experiment are shown.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study, we identified a new methionine sulfoxide reductase, the structural gene of which is conserved throughout almost all free-living organisms with the exception of a few archaebacteria. The function of this enzyme is to repair proteins that have been damaged by exposure to oxidative agents.

MsrB was found to act on free MetSO and Me₂SO. This argues for MsrB being specific for the SO functional group. MsrB was also very efficient in reducing MetSO residues in peptides. To demonstrate this, we used calmodulin as a model substrate, since this later had been extensively used for probing the reductase activity of MsrA (for reviews see Refs. 4, 26). Comparison of MsrA and MsrB activities on CaMox suggested that they reduced CaMox with similar efficiencies. Electrospray mass spectrometry coupled to FTICR was then used to characterize the products of MsrA and/or MsrB acting on CaMox. It should be remarked that the analysis of such protein mixtures is quite complex since species with similar molecular masses can overlap (there is only a 6-Da differences between a double oxidation and a one Ca²⁺ adduct), generating poorly resolved peaks and inaccuracies in mass assignment. The high accuracy (less than 10 ppm) and resolution of FTICR measurements allowed us to characterize oxiforms of calmodulin recovered after treatment with either reductase. A first set of experiments, in which MsrA and MsrB were added separately to CaMox, revealed a similar pattern of products. Neither one was able to fully reduce CaMox, and, in both cases, the most populated oxiform contained 3 MetSO out of 8 initially present. Repair of CaMox by MsrA was extensively studied by Squier and collaborators (9, 26). Overall our results are consistent with those reported by these authors although some differences appeared in the population size of each oxiform. These apparent discrepancies could be accounted for by differences in samples preparation or the origin of the calmodulin used. In particular, these authors used calcium-loaded CaMox while we used decalcified calmodulin. Analysis of the effect of calcium on oxidation and subsequent MsrA/B-mediated repair is under way using calorimetric methods.

Full repair of CaMox is an as yet undocumented phenomenon. This was achieved when MsrA and MsrB were added simultaneously. To explain that MsrA was unable to fully repair CaMox, Squier and collaborators put forward the hypothesis that MsrA repairs MetSO residues that are located in hydrophobic regions of CaMox, i.e. those residues that are buried in the native structure. This led support to the model that MsrA acts upon unfolded forms (9). As a consequence, we might explain the full repair of CaMox by postulating that MsrB acts upon solvent-exposed MetSO. However, recent results revealed that MsrA exhibits diastereoselectivity and acts selectively on L-Met-S-SO in CaMox (27, 28). Hence, another possibility is that MsrB repairs selectively L-Met-R-SO. CaMox would then contain a mixture of both diastereoisomers that would require both types of methionine sulfoxide reductase to be fully reduced. The hypothesis of substrate specificity received additional experimental support by submitting CaMox to sequential action of MsrA and MsrB. Indeed, we observed that CaMox that had previously been reduced by MsrA remained a bona fide substrate for MsrB and vice versa. The simplest interpretation is that each Msr targets different MetSO diastereoisomers within CaMox. Recently, this hypothesis received additional support using purified L-Met-R-SO and L-Met-S-SO and MsrB-purified protein.²

Despite being functionally related, MsrA and MsrB appear not to share a recent origin since comparison of their amino acid sequences failed to reveal any overall similarity. Moreover, 1D NMR analysis of E. coli MsrB³ as well as CD spectra of the Mycoplasma genitalium msrB ortholog (MG448) suggested that MsrB is unstructured (29). This contrasts with MsrA that is well structured, as recently shown by the resolution of the three-dimensional structures by x-ray crystallography (5, 6). Of potential interest, however, is a motif reading CGWP(S/A)F that is present in MsrB sequences. This motif is reminiscent of the signature motif CGFWG, containing the Cys catalytic residue in MsrA (7). Ongoing studies aim at testing the role of the CGWP(S/A)F motif in MsrB activity.

Analysis of msrA and msrB genes distribution in all sequenced genomes revealed a great diversity of genetic organizations (Fig. 6). In some genomes, msrA and msrB are located in different positions (e.g. E. coli). In some genomes, they are fused such as to encode a bifunctional MsrA-MsrB polypeptide (e.g. Helicobacter pylori). In Bacillus subtilis, the intermediate situation is to be found since msrA and msrB genes lie adjacent one to the other, most probably in an operon structure. In Neisseria, they are fused with the dsbE ortholog that encodes a disulfide oxidoreductase. Intriguingly, in this later case, the three-domain protein possess a signal sequence, suggesting that it acts in an extracytoplasmic compartment. Another type of organization is found in Arabidopsis thaliana, in which there are multiple msrA and msrB, with one gene predicted to encode a polypeptide containing two MsrB domains in tandem. Another remarkable case is provided by human where MsrB was called SelX, a selenocysteine-containing protein (30). Characterization of these diverse MsrB orthologs will be of interest in revealing the biological importance of these diverse genetic arrangements. It would, for instance, be of interest to know whether increased efficiency in repair was gained by the fusion of msrA and msrB or by the tandem duplication of msrB as found in plants.

View larger version (21K): [in this window] [in a new window]   Fig. 6.   Schematic representation of msrA and msrB genetic organization in selected genomes. A, E. coli: msrA (P27110) and msrB (P39903) genes are located at 4439.80 kb and 1860.50 kb on the chromosome, respectively. B, B. subtilis: msrA (P54154) and msrB (P54155) open reading frames are separated by 131 nucleotides. C1, H. pylori: msrA and msrB are fused in this order (025011). C2, Treponema pallidum: msrB and msrA are used in this order (083641). D, Neisseria gonorrhoeae: msrA and msrB are fused to each other and to dsbE encoding disulfide oxidoreductase E (P14930). E, A. thaliana: two msrB domains are fused (Q9ZS93). Note that additional copies of msrA and msrB are to be found in other regions of the A. thaliana genome. Filled diamonds, msrA domain. Diagonal lines, msrB domain. Checkered squares, dsbE domain. Wavy lines, signal sequence.

Phenotypic analysis of an E. coli strain lacking a functional copy of msrB revealed its importance in cadmium resistance. Cadmium is a potent carcinogenic and damages cells in several ways, among which is catalysis of AOS production. Hypersensitivity of E. coli msrB to cadmium is consistent with the finding that expression of the E. faecalis msrB ortholog (and not msrA as misquoted by the authors) is induced in the presence of cadmium (25). In this context, it is important to remember that msrA mutation confers increased sensitivity to oxidative stress in both E. coli and Erwinia chrysanthemi (13, 14). These phenotypic analyses together with the biochemical features of MsrA and MsrB suggest that these methionine sulfoxide reductases have an important function in protecting cells from oxidative damages. Furthermore, a crucial role for msrB in cell physiology was recently advanced by a systematic alteration of Mycobacterium open reading frame that identified the msrB ortholog as an essential gene (31).

Although most proteins contain solvent-exposed methionine that are potential targets for oxidation, one can expect that only a subset of cell proteins will be fully inactivated by methionine oxidation. Hence, importance of the Msr repair pathway might be appreciated by identifying those proteins that contain structural and/or functionally important Met residues. Alternatively, insight might be provided by proteomic approaches aimed at describing proteins networks. A systematic search for protein/protein interactions by the yeast two-hybrid screen was recently carried out in H. pylori (32). Interestingly, the H. pylori bi-functional MsrA/MsrB protein (Fig. 6) was found to interact with ClpX, a chaperone that assists folding of abnormal proteins or associates with the ClpP protease for degradation of those misfolded proteins. Hence, a possibility is that MsrA/B repairs oxidized ClpX. Alternatively, MsrA/B and ClpX might form a complex such that a given oxidized protein might either get repaired by MsrA/B or be directed to ClpP-mediated degradation. Our ongoing studies aim at identifying in vivo substrates of MsrA and MsrB to define the repair pathway of MetSO-containing proteins.

	ACKNOWLEDGEMENTS

We are grateful to C. Williams (University of Michigan, Ann Arbor, MI) for kindly providing us with thioredoxin reductase. Thanks are due to members of the Erwinia group, to P. Gans (Institute Biologie Structurale, Grenoble, France), to P. Moreau (Laboratoire Chimie Bacterienne, Marseille, France) for fruitful discussions, to J. Sturgis (Laboratoire Ingéniérie Systems Membranaires, Marseille, France) for help in preparing the manuscript and to R. Toci (LCB) for help in Cam purification.

	FOOTNOTES

^* This work was supported by grants from the Fondation de la Recherche Médicale, the CNRS and the Université de la Méditerranée.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Both authors contributed equally to this work.

^¶ Receipient of a fellowship from the Fondation de la Recherche Médicale. Present address: Laboratoire d'Ecologie Moléculaire, IBEAS-UFR Science et Technologie, Université de Pau et des Pays de l'Adour, BP 1155 64013 Pau cedex, France.

Receipent of a fellowship from the Ministère de l'Education Nationale.

^§§ To whom correspondence should be addressed: Tel.: 33-4-91-16-45-79; Fax: 33-4-91-71-89-14; E-mail: barras@ibsm.cnrs-mrs.fr.

Published, JBC Papers in Press, October 24, 2001, DOI 10.1074/jbc.M105509200

² H. Weissbach, personal communication.

³ P. Gans, unpublished material.

	ABBREVIATIONS

The abbreviations used are: AOS, active oxygen species; MetSO, methionine sulfoxide; HIV, human immunodeficiency virus; nt, nucleotide(s); CaMox, oxidized calmodulin; FTICR, Fourier Transform ion cyclotron resonance.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				F. Cabreiro, C. R. Picot, M. Perichon, J. Castel, B. Friguet, and I. Petropoulos Overexpression of Mitochondrial Methionine Sulfoxide Reductase B2 Protects Leukemia Cells from Oxidative Stress-induced Cell Death and Protein Damage J. Biol. Chem., June 13, 2008; 283(24): 16673 - 16681. [Abstract] [Full Text] [PDF]

				C. Achilli, A. Ciana, A. Rossi, C. Balduini, and G. Minetti Neutrophil granulocytes uniquely express, among human blood cells, high levels of Methionine-sulfoxide-reductase enzymes J. Leukoc. Biol., January 1, 2008; 83(1): 181 - 189. [Abstract] [Full Text] [PDF]

				F. Neiers, S. Sonkaria, A. Olry, S. Boschi-Muller, and G. Branlant Characterization of the Amino Acids from Neisseria meningitidis Methionine Sulfoxide Reductase B Involved in the Chemical Catalysis and Substrate Specificity of the Reductase Step J. Biol. Chem., November 2, 2007; 282(44): 32397 - 32405. [Abstract] [Full Text] [PDF]

				Z. Lin, L. C. Johnson, H. Weissbach, N. Brot, M. O. Lively, and W. T. Lowther Free methionine-(R)-sulfoxide reductase from Escherichia coli reveals a new GAF domain function PNAS, June 5, 2007; 104(23): 9597 - 9602. [Abstract] [Full Text] [PDF]

				N. Rouhier, B. Kauffmann, F. Tete-Favier, P. Palladino, P. Gans, G. Branlant, J.-P. Jacquot, and S. Boschi-Muller Functional and Structural Aspects of Poplar Cytosolic and Plastidial Type A Methionine Sulfoxide Reductases J. Biol. Chem., February 2, 2007; 282(5): 3367 - 3378. [Abstract] [Full Text] [PDF]

				E. Krin, N. Chakroun, E. Turlin, A. Givaudan, F. Gaboriau, I. Bonne, J.-C. Rousselle, L. Frangeul, C. Lacroix, M.-F. Hullo, et al. Pleiotropic Role of Quorum-Sensing Autoinducer 2 in Photorhabdus luminescens. Appl. Envir. Microbiol., October 1, 2006; 72(10): 6439 - 6451. [Abstract] [Full Text] [PDF]

				P. Alamuri and R. J. Maier Methionine Sulfoxide Reductase in Helicobacter pylori: Interaction with Methionine-Rich Proteins and Stress-Induced Expression. J. Bacteriol., August 1, 2006; 188(16): 5839 - 5850. [Abstract] [Full Text] [PDF]

				D. Sagher, D. Brunell, J. F. Hejtmancik, M. Kantorow, N. Brot, and H. Weissbach Thionein can serve as a reducing agent for the methionine sulfoxide reductases PNAS, June 6, 2006; 103(23): 8656 - 8661. [Abstract] [Full Text] [PDF]

				F. CABREIRO, C. R. PICOT, B. FRIGUET, and I. PETROPOULOS Methionine Sulfoxide Reductases: Relevance to Aging and Protection against Oxidative Stress. Ann. N.Y. Acad. Sci., May 1, 2006; 1067: 37 - 44. [Abstract] [Full Text] [PDF]

				A. Olry, S. Boschi-Muller, H. Yu, D. Burnel, and G. Branlant Insights into the role of the metal binding site in methionine-R-sulfoxide reductases B Protein Sci., November 1, 2005; 14(11): 2828 - 2837. [Abstract] [Full Text] [PDF]

				E. Masse, C. K. Vanderpool, and S. Gottesman Effect of RyhB Small RNA on Global Iron Use in Escherichia coli J. Bacteriol., October 15, 2005; 187(20): 6962 - 6971. [Abstract] [Full Text] [PDF]

				P. Vattanaviboon, C. Seeanukun, W. Whangsuk, S. Utamapongchai, and S. Mongkolsuk Important Role for Methionine Sulfoxide Reductase in the Oxidative Stress Response of Xanthomonas campestris pv. phaseoli J. Bacteriol., August 15, 2005; 187(16): 5831 - 5836. [Abstract] [Full Text] [PDF]

				M. A. Marchetti, G. O. Pizarro, D. Sagher, C. DeAmicis, N. Brot, J. F. Hejtmancik, H. Weissbach, and M. Kantorow Methionine Sulfoxide Reductases B1, B2, and B3 Are Present in the Human Lens and Confer Oxidative Stress Resistance to Lens Cells Invest. Ophthalmol. Vis. Sci., June 1, 2005; 46(6): 2107 - 2112. [Abstract] [Full Text] [PDF]

				C. Vieira Dos Santos, S. Cuine, N. Rouhier, and P. Rey The Arabidopsis Plastidic Methionine Sulfoxide Reductase B Proteins. Sequence and Activity Characteristics, Comparison of the Expression with Plastidic Methionine Sulfoxide Reductase A, and Induction by Photooxidative Stress Plant Physiology, June 1, 2005; 138(2): 909 - 922. [Abstract] [Full Text] [PDF]

				J. Wu, F. Neiers, S. Boschi-Muller, and G. Branlant The N-terminal Domain of PILB from Neisseria meningitidis Is a Disulfide Reductase That Can Recycle Methionine Sulfoxide Reductases J. Biol. Chem., April 1, 2005; 280(13): 12344 - 12350. [Abstract] [Full Text] [PDF]

R. Kern, A. Malki, J. Abdallah, J.-C. Liebart, C. Dubucs, M. H. Yu, and G. Richarme Protein Isoaspartate Methyltransferase Is a Multicopy Suppressor of Protein Aggregation in Escherichia coli J. Bacteriol., February 15, 2005; 187(4): 1377 - 1383. [Abstract] [Full Text]