JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M105962200 on October 1, 2001

J. Biol. Chem., Vol. 276, Issue 52, 49117-49124, December 28, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/52/49117    most recent
M105962200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dutoya, S.
Right arrow Articles by Bakalara, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dutoya, S.
Right arrow Articles by Bakalara, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel C-terminal Kinesin Is Essential for Maintaining Functional Acidocalcisomes in Trypanosoma brucei*

Sandrine DutoyaDagger §, Stephanie GibertDagger §, Guillaume LemercierDagger , Xavier Santarelli, Dominique BaltzDagger , Theo BaltzDagger , and Norbert BakalaraDagger ||

From the Dagger  Laboratoire de Parasitologie Moléculaire UMR CNRS 5016, Université Victor Segalen and the  Ecole Supérieure des Technologies et Biomolécules de l'Université de Bordeaux II, Bordeaux II, 33076 France

Received for publication, June 27, 2001, and in revised form, September 4, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Kinesins are cytoskeletal motor proteins that play roles in a variety of fundamental cellular processes including cell division and the anterograde transport of vesicles and organelles. We purified, cloned, and functionally characterized in Trypanosoma brucei a new member of the C-terminal kinesin family, TbKIFC1. Kinetic constants of the recombinant motor domain of TbKIFC1 were estimated at 0.56 µM for the microtubule dissociation constant (Kd) with a kcat of 0.2 s-1. Immunolocalization analysis showed an association of TbKIFC1 with punctate structures. Because they were rapidly transported to the negative pole of the microtubule after NH4Cl treatment, these structures were considered to be associated with acidic vesicles. To determine the role of the kinesin in vivo, we produced an inducible kinesin-deficient strain by double-stranded RNA interference methodology. Mutant cells were loaded with the fluorescent reagent fura2/acetoxymethylester to measure intracellular free calcium ([Ca2+]i). The resting [Ca2+]i was unchanged in mutant cells; however, alkalinization of acidic vesicles induced by NH4Cl or nigericin was not followed by release of Ca2+. These data and the relative importance of the ionomycin-releasable and the ionomycin-plus-NH4Cl-releasable Ca2+ pools suggest a lower Ca2+ content in acidocalcisomes and dysfunctional Ca2+ release.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

African trypanosomes, the causative agents of sleeping sickness in humans and nagana in cattle, are unicellular flagellated protozoa. To survive and develop in the distinctive environment of the mammalian host and the insect vector, Trypanosoma brucei must undergo morphological, biochemical, and physiological changes to adapt to the different environmental conditions. Cell viability requires mechanisms to control pH and Ca2+ homeostasis (1, 2). The level of endocytosis demonstrated by bloodstream forms (BF)1 is among the highest described so far for eukaryotic cells (3). Interestingly, this endocytic pathway is associated with an unusual cytoskeleton comprised of a precisely ordered subpellicular microtubule array that confers a high polarity to the cell, defined by a positive pole at its posterior end (4). The flagellum exits the cell from this positive pole at the flagellar pocket, a surface membrane invagination specialized for endocytosis and exocytosis (3). These features make the trypanosome an interesting model for the study of vesicular biogenesis and communication.

Kinesin proteins constitute a superfamily, the kinesin family proteins (KIFs), also known as kinesin-like proteins. Sequence differences between members of the family within the conserved motor domain of around 340 amino acids (5) are used to classify the kinesin proteins into at least 10 families (tubulin.cb.m.u-tokyo.ac.jp/KIF/). Regions outside of the motor domain are family-specific and share little, if any, sequence homology. This diversity suggests that different kinesins have distinct roles in many different cellular processes including cell division, signal transduction, and microtubule dynamics (7). They also participate in the trafficking of macromolecular complexes (8) and organelles including mitochondria (9), lysosomes (10, 11), and synaptic vesicles (12). These cargoes are moved along microtubules (13) by the action of the molecular motor domain. Kinesins are usually associated with plus-end transport, whereas minus end-directed membrane organelle transport is generally attributed to the dynein protein family (14).

Because TbKIFC1 did not belong to any of the reported kinesin families with a known cellular function, we conducted a functional study designed to reveal the role of this kinesin in T. brucei and provide insight into the mode of action of C-terminal kinesins involved in minus end transport. The results from these approaches have shown the essential role of TbKIFC1 for the biogenesis of acidocalcisomes and Ca2+ homeostasis in T. brucei.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Strains Used

T. brucei brucei monomorphic strain 427 from clone MITat 1.4 (15, 16) was used for protein purification and gene cloning. For the protein expression study procyclics derived from 427, the pleomorphic T. brucei GUTat 3.1 (17), and Trypanosoma congolense IL3000 clone 49 (provided by E. Authié) were used. The transgenic cell lines (gift from G.A.M. Cross) were created from a T. brucei 427 wild-type background (18). Procyclics were grown in SDM-79 (19) with 10% calf serum at 27 °C. For IL3000 procyclic and epimastigote forms and for the isolation of metacyclic forms from epimastigote, cultures was performed as described (20). Bloodstream slender forms were obtained from infected rats for MITat and infected mice for GUTat and T. congolense and from infected immunosuppressed mice for GUTat stumpy forms. These bloodstream forms were subsequently purified from blood cells by DEAE-cellulose chromatography (21). Bloodstream forms were also cultured in vitro in modified minimum essential medium supplemented with 10% fetal calf serum (22).

TbKIFC1 Purification

Columns and Instruments-- DEAE-Sepharose Fast flow (Amersham Pharmacia Biotech) was used for ion exchange chromatography. O-Phospho-L-tyrosine immobilized on cross-linked 4% beaded agarose from Sigma was used for affinity chromatography. The chromatographic system used throughout this study was the fast protein liquid chromatography work station from Amersham Pharmacia Biotech. All buffers contained a protease inhibitor mixture with final concentrations of 1 µM chemostatin, 1 µM leupeptin, 1 µM pepstatin, and 10 µM phenylmethylsulfonyl fluoride.

Purification Procedure-- The fraction corresponding to soluble protein obtained by hypotonic lysis (23) was equilibrated in buffer A (50 mM Tris-HCl, pH 7.0, 20 mM NaCl, 1 mM DTT, 1 mM EDTA, and protease inhibitor mixture) and loaded onto the DEAE fast flow column from Amersham Pharmacia Biotech pre-equilibrated in buffer A. The column was then washed with buffer B, and the flow-through was collected. Elution was performed by the discontinuous step gradient method. Fractions were collected at 50 and 100% buffer B (50 mM Tris-HCl, pH 7.0, 500 mM NaCl, 1 mM DTT, 1 mM EDTA, and protease inhibitor mixture).

The 50% eluted DEAE fraction was diluted and equilibrated with pre-equilibration buffer A and adsorbed onto a buffer A pre-equilibrated O-phospho-L-tyrosine-agarose affinity column. The column was washed with buffer B, and the flow-through was collected. The enzyme was eluted by a discontinuous step gradient at 50 and 100% of buffer B in a total volume of 20 ml. The flow rate was 2 ml/min for each step.

Immobilized Metal Affinity Chromatography-- NterKIFC and MDKIFC (the recombinant proteins expressed in Escherichia coli) were purified from the Amersham Pharmacia Biotech His·Bind® column, which was used according to the manufacturer's instructions (Novagen). Before performing the ATPase activity tests and the microtubule binding experiments, we desalted the MD-Kin recombinant purified protein in PEM buffer (200 mM Pipes/NaOH, pH 6.9, 2 mM EGTA, 2 mM MgSO4) on a PD10 column (Amersham Pharmacia Biotech).

Microsequencing

A purification procedure was performed starting with 1.5 × 1011 bloodstream form trypanosomes. Gel slices for sequencing were obtained from Amido Black-stained SDS-polyacrylamide gels and sent for microsequencing to Dr. Dalayer (Laboratoire de Microsequençage des Proteines, Institut Pasteur, Paris, France) (24).

Cloning by Reverse Transcriptase Polymerase Chain Reaction and Analysis of the TbKIFC1 Gene

Total cell RNA and poly(A)+ RNA were prepared and purified according to Sambrook et al. (25). cDNA was obtained by random priming with hexanucleotides and reverse transcription with the Stratagene reverse transcriptase RT II. The 90P26AS (5'-TTYTGCCANCCDATNAC-3') and 90P31AS (5'-TGYTGNGTNGCYTCYTG-3') degenerate oligonucleotides were generated by the reverse translation of sequenced peptides, P26 (VIGWQK) and P31 (QEATQQ), respectively. A portion of the spliced leader sequence common to all T. brucei mRNAs (5'-ACAGTTTCTGTACTATATTG-3') was also used as a 5' primer (MEX2). The cDNA was then used as a template for PCR amplification using the primer associations MEX2/90P26AS and MEX2/90P31AS. The amplified fragments were gel-isolated, cloned into the pT7blue T-vector (Novagen), and sequenced.

The amplified and cloned MEX2/90P26AS fragment was used as a probe to screen a T. brucei genomic DNA library (25) generated in the c2X75 cosmid vector (26) as previously described (27). BamHI/EcoRI fragments of the isolated 2.1 cosmid were subcloned into the pUC18 vector from Appligene and screened with the cDNA fragment MEX2/90P26AS. A BamHI/EcoRI fragment of 5,000 base pairs was isolated and sequenced using the AmpliTaq DNA polymerase, as described by the manufacturer (ABI PRISMTM; PerkinElmer Life Sciences).

Cloning, Expression, and Purification of the N- and C-terminal Domains of TbKIFC1 in E. coli

A 690-base pair fragment comprising the N-terminal region and a 1,550-base pair fragment containing the C terminus motor domain were generated by PCR. A 5-kilobase BamHI/EcoRI genomic fragment from AnTat 1 subcloned into pBlueScript (Stratagene) was used as a template for both PCR reactions. For the kinesin N-terminal construction (NterKIFC), the 5' primer (5'-TGCAGACATATGTCTGCGGAACAACCC) contained a 12-nucleotide linker with an NdeI restriction site to facilitate subcloning and five adjacent N-terminal residues (SAEQP). The 3' primer (5'-GCTTTCGGATCCTTAATGGTGATGGTGATGGTGGCACTTCATCTTGTGATT) included a 12-nucleotide linker with a BamHI site for cloning, a stop codon, codons for six histidine tag residues to allow binding to the His·Bind® column, and codons for six C-terminal residues (NHKMKC). The PCR product was inserted into the NdeI/BamHI sites of the pET3a plasmid (Novagen). The C-terminal region of TbKIFC1 coding for the motor domain (MDKIFC) was obtained by using the 5' primer (5'-GCTCAGGCTAGCCACCATCACCATCACCATCTGCGTAAGCAGTACTAC) and the 3' primer (5'-TGGATTCGCGGCCGCTTAGCCAAGAGATACGCCACG). The PCR-amplified DNA fragment encoded a region between the amino acids Leu475 and Pro820 of TbKIFC1. This product was cloned between the NheI/NotI sites of the pET23a plasmid (Novagen). The resulting recombinant NterKIFC and MDKIFC proteins were expressed in E. coli BL21 (DE3) from Novagen according to the manufacturer's instructions. The cells were lysed in 1× binding buffer, containing the protease inhibitor mixture, by three steps of freezing and thawing and brief sonication. The lysate was centrifuged for 30 min at 10,000 × g, and the resulting supernatant was applied to a Ni2+ His·Bind® column.

Phylogenetic Study

DNA and amino acid sequences were analyzed by the DNA STRIDER software and data base searches by the BLAST algorithm. Multiple alignment of amino acid sequences and hamming distances were determined from the CLUSTAL W version 1.6 (28) and the phylogenetic tree constructed from version 3.5c of the PHYLIP program package of J. Felsenstein (BLAST, CLUSTAL W, and PHYLIP softwares were obtained through Bisance and Infobiogen facilities). The matrix of pairwise sequence distances were calculated by Dayhoff's method using PRODIST. The phylogenetic trees were constructed from the distance matrix by the Neighbor or Fitch methods and were rooted with the ScSmy1 sequence as an out-group (23). The phylogenetic tree was drawn with TREEVIEW version 1.3 (29).

Production of a Monoclonal Antibody against TbKIFC1 and Western Blot

The NterKIFC recombinant protein was purified by immobilized metal affinity chromatography and electroeluted from a 10% SDS-PAGE gel. A mouse was injected with 20 µg of the purified recombinant protein in complete Freund's adjuvant. A further two 20-µg samples in Freund's incomplete adjuvant were injected 15 and 30 days later. After 4 weeks, a fourth aliquot of 20 µg of protein was injected, and the hybridoma technique was begun 4 days later according to Ref. 30. One hybridoma, H3, was selected by enzyme-linked immunosorbent assay screening against the recombinant NterKIFC protein. Antibodies were purified from the culture medium by a protein A affinity column according to the manufacturer's instructions (Amersham Pharmacia Biotech).

Protein Electrophoresis and Western Blotting

For Western blot analysis, proteins in sample buffer (2.2% SDS, 50 mM DTT, 90 mM Tris-HCl, pH 6.8, and 10% glycerol, mass/volume) were boiled for 5 min and subjected to 10% polyacrylamide gel electrophoresis (31). The proteins were then transferred to polyvinylidene difluoride (Immobilon P, Millipore) membranes by semi-dry blotting (32). Filters were blocked for 15 min with PBS-Tween-milk (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, 0,005% Tween 20, 5% milk), incubated overnight at 4 °C with a supernatant culture of the H3 hybridoma. A 1:1000 dilution in PBS-Tween-milk of goat anti-mouse IgG conjugated to horseradish peroxidase (Sanofi-Pasteur) was then added for 2 h. Immunoreactive bands were revealed by washing in 50 mM Tris-HCl, pH 7.5, 20 mM NaCl, and a solution containing 0.05% H2O2 and 2.8 mM 4-chloro-1-naphthol or 3,3'-diaminobenzidine for the peroxidase conjugate and according to the manufacturer's instructions for ECL revelation (Amersham Pharmacia Biotech).

Immunofluorescence Assay

Bloodstream and procyclic forms were fixed on ice for 15 min in 2% formaldehyde and permeabilized in 0.1% Triton X-100 for 10 min at room temperature. The formaldehyde was neutralized for 10 min with 0.1 M glycine at room temperature. After centrifugation and resuspension in PBS, trypanosomes were transferred to a microscope slide and treated for 30 min at room temperature with either monoclonal antibodies or polyclonal serum diluted in PBS containing 0,1% bovine serum albumin. Secondary antibodies were conjugated to fluorescein isothiocyanate (Pasteur Sanofi), Alexa fluor 568 (Molecular Probes). After washing, slides containing the treated trypanosomes were mounted with anti-fade Vectashield (Vector Laboratories). The cells were examined on a Zeiss UV microscope, and the images were analyzed by the use of a camera (Photometrics) with Metaview software and Adobe Photoshop 5.1 (Adobe Systems).

Lysosome Motility

Acidic vesicle motility was measured according to the method of Heuser (33). Cultured bloodstream forms were washed three times in Ringer's solution (155 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 2 mM NaH2PO4, 10 mM Hepes, pH 7.2, 10 mM glucose, and 0,5 mg/ml bovine serum albumin) and incubated for 30 min at 37 °C in this buffer. For the nocodazole assay, the cells were preincubated 20 min at room temperature in Ringer's solution in presence of 10 µM nocodazole. To induce retrograde transport, NH4Cl (final concentration, 30 mM) was added to the previous buffer, and the cells were incubated for 15 min. The parasites were then either formaldehyde fixed, as described for the immunofluorescence assay, or washed three times in acetate-Ringer's solution (80 mM NaCl, 70 mM sodium acetate, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 2 mM Hepes/NaOH, pH 6.9, and 10 mM glucose), incubated for 15 min, and fixed.

Determination of Protein Concentration

Protein concentrations were estimated by the method of Bradford (34) and by Coomassie Blue staining after SDS-PAGE. Bovine serum albumin was used as a standard. For microtubule binding assays, the proteins were quantified by Western blotting. Gels and membranes were then scanned to produce digital images, and protein bands were quantified using NIH image. Bovine serum albumin and MDKIFC were used as standards.

Kinesin Biochemical Characterization

Preparation of Microtubules-- Bovine tubulin was kindly provided by B. Goud (Institut Curie Paris). After parasite lysis, T. brucei tubulin was purified by chromatography on DEAE Q fast flow (Amersham Pharmacia Biotech) and two cycles of polymerization (35, 36).

Microtubule Binding Assays-- 100 µg of tubulin was polymerized in PEM buffer in the presence of glycerol 33% (v/v), 1 mM GTP, 1 mM MgCl2 for 10 min at 37 °C. Taxol was then added to a final concentration of 40 µM, and the polymerization continued for 30 min. Microtubules were centrifuged at 40,000 × g for 30 min at 22 °C. To eliminate protein aggregates, MDKIFC was centrifuged at 40,000 × g for 30 min at 4 °C. Binding assays were performed by incubating MDKIFC protein (0.1-1.7 µM) with 1 µM microtubule in PEM buffer supplemented with 1 mM GTP, 2.5 mM MgCl2, 2 mM DTT, 20 µM taxol, and 2.5 mM ATP for 15 min at room temperature. The supernatants and pellets were analyzed on SDS-PAGE and by Western blotting.

ATPase Activity Test

ATPase activity was measured as described by Mitsui et al. (37). 1 µg of MDKin protein was incubated for 5 min at 22 °C in 100 µl of PEM buffer containing 2 mM DTT, 1 mM GTP, 1 µM taxol. Then 1 mM (final concentration) of [gamma -32P]ATP (0.55 × 108 cpm/µmol) was added, and the incubation continued for 15 min at 22 °C. The reaction was stopped by the addition of 1% final SDS, 100 µl of (5 M H2SO4, 10% ammonium molybdate, 0.1 M silicotungstic acid, in a volume ratio of 2:2:1) and 1 ml of xylene/isobutanol (65:35). The reaction mixture was vortexed for 15 s and centrifuged for 5 s at 5,000 × g. Released phosphate was measured by Cerenkov counting.

Double-stranded RNA Expression and Trypanosome Transformation

The inductible T7 RNAP-based protein expression system developed by E. Wirtz was used in this study (18). The pLew 100 vector and the procyclic host cell line 29-13 coexpressing T7 RNAP and TetR were gifts from G. Cross. For double-stranded RNA expression the following construct was produced. DNA fragments corresponding to the coding regions of TbKIFC1 from nucleotides 1 to 694 and from nucleotides 1 to 645 were PCR-amplified. The 694-base pair fragment was amplified using the following set of primers: DB/KIN/01 (5'-GGCCGGAAGCTTATGTCTGCGGAACAACCC) and DB/KIN/02 (5'-GGCCGGGGATCCGCTTGAATTCGCTTTCATAGCTTCCTGA) and cloned between the BamHI/HindIII restriction sites of pLew100, giving the pLew100-SKIN construction. In a second step the 645-base pair fragment was cloned in the opposite orientation of the 694 fragment in the pLew100-SKIN construction between the EcoRI/BamHI restriction sites. This later fragment was obtained by PCR amplification using the following primers DB/KIN/03 (GGCCGGGAATTCATTCTTGCACTCCCTTGC) and DB/KIN/04 (GGCCGGGGATCCATGTCTGCGGAGCAACCC. A PCR DNA fragment containing the total TbKIFC1 coding region was also cloned into the pLew 100 vector between the HindIII/BamHI restriction sites. For stable transformation T. brucei procyclic forms (29-13 cell line) were harvested from a log phase culture (5 × 106 cells) and washed once in ZPFM (18) and resuspended to a cell density of 4 × 107 cells/ml in ZPFM. 2 × 107 cells were electroporated with 10 µg of DNA in the Eurogentech Cellject machine at 1600 V, R infinite, 40 microfarad. Parasites were then transferred to SDM-79 medium containing 10 µg/ml G418 and 5 µg/ml hygromycin and cultured overnight before the addition of phleomycin 2.5 µg/ml.

Spectrofluorometric Determinations

The [Ca2+]i and pHi were measured according to Scott et al. (38) and Fraser-L'Hostis et al. (2). Briefly, the cells were loaded with either fura2/AM or BCECF/AM (Molecular Probes) and resuspended in buffer A containing 116 mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4, 5.5 mM glucose, 50 mM Hepes, pH 7.4, and 1 mM EGTA for [Ca2+]i determination. The fura2 fluorescence response to the [Ca2+]i was calibrated from the ratio 330/380 nm fluorescence values for an emission at 510 nm. For pHi we used the wavelengths 490 and 440 nm for excitation and 535 nm for emission. The spectrofluorometer fluoromax (SPEX Instruments) and software DM 3000 (SPEX Instruments) were used for data analysis.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification, Gene Cloning, and Classification of TbKIFC1-- We previously described a two-step chromatographic process for the purification of a plasma membrane phosphatase (39) and used this procedure to purify soluble phosphatase. After hypotonic lysis, the soluble fraction was applied to a DEAE fast flow column at pH 7. VSG, the most abundant protein, was removed in the flow-through, and phosphatase activity was collected in the 250 mM NaCl eluate fraction (data not shown). Purification of the DEAE-eluted fraction proteins on an O-phospho-L-tyrosine affinity column led to the partial purification of a 91-kDa protein (Fig. 1A) that eluted at 150 mM NaCl. Although only a minority of the phosphatase activity was present in that fraction (40), the 91-kDa polypeptide was microsequenced after isolation from a 10% reducing SDS-PAGE. Three peptide sequences were obtained: 1) IISTVIGWQK; 2) ESAYYSSQLTSAIASIAAAA; and 3) NAQQVMLQAQEATQQ (Fig. 1B). Oligonucleotides based on these sequences were used to identify genomic fragments corresponding to the gene, and after screening of a T. brucei cosmid library, the complete gene sequence of the 91-kDa protein (AF319546) was obtained. The single copy gene (Southern blot; data not shown) encoded a protein of 841 amino acids. The gene was entitled TbKIFC1. Its C-terminal domain (367 amino acids) was more than 60% similar to the motor domain of kinesin (tubulin.cb.m.u-tokyo.ac.jp/KIF/). The N-terminal region did not reveal overt similarity to known kinesins or other proteins in the data base; however, analysis of its composition revealed a potential globular head domain, a coiled-coil stalk domain typical of those conserved among most kinesins and the kinesin neck consensus sequence (Fig. 1B). Molecular phylogenetic analysis, supported by high bootstrap values (Fig. 1C), showed that TbKIFC1 diverged from the four originally described C-terminal kinesin classes. Specific functions or particular cargoes have been identified for class I, II, and III C-terminal kinesins (tubulin.cb.m.u-tokyo.ac.jp/KIF/), but our phylogenetic analysis suggests a different cellular function for TbKIFC1.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Purification, structural characterization, and phylogenetic analysis of TbKIFC1. A, 10% SDS-polyacrylamide gel electrophoresis of the initial soluble fraction after hypotonic lysis (F1), the DEAE flow-through (FT), the 250 mM NaCl, DEAE eluted fractions (ELD), and the 250 mM NaCl, affinity O-phospho-L-tyrosine eluted fraction (ELA). The gel was silver-stained. B, global structure of TbKIFC1. The black, hatched, gray, and white boxes correspond to the globular head domain (GD), the stalk coiled-coil region (SR), the neck consensus sequence (N), and the motor domain respectively (MD). Amino acid sequences obtained by protein microsequencing (P26, P31, and P38) are indicated. Sequences located between the amino acids Met1 and Ser231 and between Lys474 and Pro821 represent the E. coli BL21 (DE3) expressed recombinant proteins NterKIFC and MDKIFC, respectively. These proteins were purified by immobilized metal affinity chromatography using the His·Bind® column and procedures from Novagen. A PD10 column from Amersham Pharmacia Biotech was used for buffer exchanges. The NterKIFC protein was utilized to develop a specific monoclonal antibody (H3) against TbKIFC1. C, phylogenetic analysis of kinesin superfamily proteins (tubulin.cb.m.u-tokyo.ac.jp/KIF/). The phylogenetic tree was constructed from the distance matrix by the Fitch method as described in Bringaud et al. (63) and was rooted with Scmy. Accession numbers are mentioned in the website (tubulin.cb.m.u-tokyo.ac.jp/KIF/).

Biochemical Properties of TbKIFC1-- To determine whether TbKIFC1 belongs to the motor protein family, we tested the recombinant C-terminal domain MDKIFC1 (Fig. 1B) (41) for a variety of biochemical functions. The His6-tagged recombinant protein was purified by an immobilized metal affinity chromatography procedure. The Km value for ATP was determined as 51 µM. The dissociation constant (Kd) from microtubules in the presence of ATP was calculated by incubating different concentrations of MDKIFC1 with 2 µM microtubules and quantitating the amount of microtubule-bound motor domain (Fig. 2A). The dissociation constant of MDKIFC1 from microtubules was determined to be 0.56 µM. Microtubules (2.5 µM) stimulated MDKIFC1 ATPase activity by about 8-fold to 2 pmol/s/µg of protein (Fig. 2B). The kinetic parameters, kcat, the steady state turnover number, and the K0.5MT, corresponding to the concentration of microtubules required for half-maximal stimulation of the ATPase activity, were estimated respectively at 0.1 s-1 and 0.7 µM, respectively (Fig. 2B).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   Biochemical and expression studies of TbKIFC1. A, MD-KIFC binding to microtubules. 0.1-1.7 µM MD-KIFC protein were incubated with 1 µM microtubule in the binding medium containing 2.5 mM ATP or AMP-PNP (ct) for 15 min at room temperature. The MD-KIFC-microtubules complexes were pelleted (100,000 × g for 30 min) and analyzed by Western blotting. Protein separation was performed on 12% SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and immunoblotted with anti-TbKIFC1 monoclonal antibody (H3). 3,3'-Diaminobenzidine was used to reveal the protein bands. For quantification, purified MDKIFC was used to establish a standard concentration curve with the NIH image 1.52 software. Inset, Scatchard linearization. B, tubulin activation of the ATPase activity of TbKIFC1. 1 µg of TbKIFC1 was incubated for 15 min. with 1 mM MgATP and microtubules in a concentration range of 0-2.5 µM. Inset, Hanes' linearization.

Differential Expression and Localization of TbKIFC1 Kinesin Protein-- Relative expression level quantification of TbKIFC1 between the mammalian host BF and the insect procyclic form of the parasite was estimated by immunoblotting with a specific monoclonal antibody (H3) directed against the N-terminal domain (amino acids 1-231). Expression in bloodstream forms was 1000-fold greater than in procyclics (Fig. 3A). Furthermore Fig. 3B shows that TbKIFC1 was also expressed at similar levels in the nondividing metacyclic insect form and the dividing slender trypomastigote form and that stumpies did not express the protein. The results suggested that the function of TbKIFC1 was related to the adaptation of the parasite to its mammalian host.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Protein expression. A, quantification of the level of TbKIFC1 expression between the procyclic form (pf) and the bloodstream form (bf). Soluble proteins were obtained by hypotonic lysis of 107 procyclic form and 107, 106, 105, and 104 BF. H3 was used to recognize TbKIFC1 and the chemiluminescence ECL kit to reveal the bands. B, expression level of TbKIFC1 in the different trypanosome life stages. Soluble proteins were obtained by hypotonic lysis of 107 cells of each stage. sl, slender forms; st, stumpy forms; mf, metacyclic forms. H3 was used to recognize TbKIFC1, a monoclonal anti-aldolase was used to recognize the aldolase protein, and chloronaphtol was used to reveal the bands.

The nature of the specific cargo to which TbKIFC1 associates was also investigated. Immunolocalization in slender bloodstream form trypanosomes using the monoclonal antibody H3 revealed that TbKIFC1 was confined to punctate structures. The higher density of these structures around the nucleus of the parasite (Fig. 4, a and b) suggests an association with a perinuclear acidic compartment (42). Lysosomes and acidic vesicles in general can be distinguished from other organelles by the capacity to induce their own cellular redistribution through changes in cytoplasmic pH (33). Alkaline Ringer's solution induced TbKIFC1 (Fig. 4, c and d) to accumulate at the anterior extremity of the parasite, corresponding to the negative pole of the subpellicular microtubule corset within 15 min. Subsequent acidification caused rapid redistribution of TbKIFC1 to its original site (Fig. 4, e and f). These observations indicate a retrograde movement toward the anterior extremity of the cell. Microtubule polarity of the subpellicular corset might be considered to support a retrograde transport to the anterior extremity of the parasite. To assess its role in this redistribution, parasites were treated with benzimidazole inhibitors of microtubules (5). Nocodazole (10 µM) inhibited the observed NH4Cl-induced movement, indicating that motion involved a microtubule network (data not shown).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Characteristics of TbKIFC1 localization and displacement in bloodstream forms. a, immunolocalization performed on nontreated BF using a deconvolution procedure for image analysis (24). c, immunolocalization performed after NH4Cl treatment (NH4Cl 30 mM for 15 min). e, immunolocalization performed after NH4Cl treatment and subsequent reacidification by two washes in Ringer's solution followed by 15 min of incubation in acidic Ringer's solution (70 mM sodium acetate, pH 6.9). a, c, and e, immunolocalizations of TbKIFC1 performed with the monoclonal antibody H3. b and d, diamidinophenylindole staining of a and c. f, phase contrast of e.

However, colocalization studies performed with antibodies directed against p67 (43) and the T. brucei plant vacuolar-like proton pyrophosphatase (V-H+-PPase)2 did not show an association of TbKIFC1 with either lysosomes or acidocalcisomes (data not shown). Moreover, p67 containing vesicles and acidocalcisomes did not respond to similar alkaline treatment.

Kinesin Is Required for Normal Release of Ca2+ from the Acidocalcisomes-- To estimate the potential action of TbKIFC1 in retrograde transport of acidic vesicles of the late endosomal pathway, we used RNA interference methodology to silence TbKIFC1 expression (44). Procyclic and bloodstream form kinRNAi strains modified for the expression of TbKIFC1 (18) were constructed. Because the kinesin appears to be essential to bloodstream trypanosomes, we could not perform gene silencing experiments in this life cycle stage. However, we were able to turn to procyclic forms. Although TbKIFC1 was less abundant in procyclics than in bloodstream forms, immunofluorescence studies performed on procyclics overexpressing TbKIFC1 (Fig. 5A) also indicated an association of the kinesin with punctate structures (data not shown). RNA interference led to a loss of protein (Fig. 5A) and also induced several measurable phenotypes. In trypanosomatids, acidocalcisomes are considered to be the major acidic compartment (45), and they contain a considerable fraction of the intracellular stored Ca2+ (46). As a first step toward the characterization of the effect of suppressing TbKIFC1 expression, the Ca2+ content of the acidocalcisome was analyzed. The K+/H+ exchanger, nigericin, and the weak base, NH4Cl, failed to cause Ca2+ release from acidocalcisomes in mutant cells (Fig. 5B). A second rise in [Ca2+]i that is usually observed after the subsequent addition of ionomycin did occur, but the rise in [Ca2+]i was lower for the induced kinRNA strain (Fig. 5B). The acidity of the compartment was maintained because addition of nigericin caused a significantly decreased pHi (Fig. 5C), whereas NH4Cl rapidly increased it (Fig. 5C) (38, 47). The amplitudes of the observed pH variations were the same for the noninduced, induced, and wild-type strains (data not shown). The reverse addition of NH4Cl and ionomycin confirmed the previous observations (Fig. 5B). The pHi and [Ca2+]i values were estimated at 7.2 and 90 nM, respectively. These mean pHi and [Ca2+]i levels were therefore stable and unchanged between the wild-type (38), induced, and noninduced kinRNAi strains.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Phenotype analysis of the procyclic kinRNAi+tet cell line. A, soluble proteins were obtained by hypotonic lysis of 107 parasite cells. Lane 1, noninduced Kin RNAi cell line. Lane 2, KinRNAi+tet induced with 100 ng/ml tetracycline. Lane 3, the KIN cell line in the procyclic TbKIFC1 overexpressers. Lane 4, WT is the 427 procyclic strain modified by E. Wirtz and used as a control. Kinesin was identified using the H3 antibody and the chemiluminescence ECL revelation kit. B and C, effects of nigericin and NH4Cl on Ca2+ release (B) and intracellular pH (C). The experiments were performed as described by Moreno et al. (64). The cells (0.3 mg of protein/ml) were added to the standard reaction buffer A containing either 6 µM fura2/AM and 1 mM EGTA or BCECF/AM 9 µM. 2.5 µM nigericin, 1 µM ionomycin, and 20 mM NH4Cl were added where indicated (arrow). The blue dots correspond to the noninduced kinRNAi cells and the pink dots to the induced kinRNAi cells. [Ca2+]i was determined as described by Negulescu and Machen (6) and others (64) and pHi according to Frazer-L'Hostis et al. (2).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this paper we describe the purification, cloning, biochemical, and phenotypic characterization of a C-terminal type kinesin from the parasitic protozoan Typanosoma brucei. Sequence comparison analysis showed the presence of a C-terminal motor domain containing the ATP binding motif and a microtubule-binding consensus sequence. The relationship of TbKIFC1 to the kinesin-like protein family was confirmed by the determination of several steady state kinetic parameters that were compared with three biochemically well characterized kinesin proteins Ncd (48, 49), Kar3 (50, 51), and a conventional KHC (52-54). The dissociation constant (Kd) from microtubules for TbKIFC1 in the presence of ATP was estimated at 0.56 µM, suggesting that it binds more tightly to microtubules than Ncd, Kar3, and KHC for which the Kd values were estimated at, respectively, 4.1, 1.7, and 4.2 µM at 25 mM NaCl. In the kinesin ATPase cycle, kinesin dissociation from microtubules is the slow and rate-limiting step (54). Consequently, this low rate of dissociation from microtubules would result in a low ATPase activity (48, 54). The Km values for ATP indicated that TbKIFC1 (51 µM), Ncd (190 µM), and KHC (100 µM) all bound this nucleotide with similar affinity. The concentrations of microtubules required for half-maximal stimulation were also similar at 0.7, 1, 0.7, and 0.5 µM for TbKIFC1, KHC, Ncd, and Kar3, respectively. The kcat value for TbKIFC1 was estimated at 0.2 s-1 in the presence of 2.5 µM microtubules corresponding to an increase of ATPase activity of around 8-fold. By comparison the rate constant for ADP release by Kar3, Ncd, and KHC were, respectively, 0.037, 5.4, and 20 s-1, corresponding to an ATP hydrolysis stimulation of between 6-fold for Kar3 to around 1000-fold for Ncd and KHC. According to the suggested correlation between ATPase activity and the in vitro velocity of motor proteins (50), the velocity of TbKIFC1 was inferred to be closest to the Kar3 kinesin (1-2 µM/min).

Phylogenetic analysis suggested the existence of a new subgroup within the originally described C-terminal kinesin group (Fig. 1) (5). Expression analysis revealed that TbKIFC1 expression correlated with the host adapted stages rather than with the dividing forms of the parasite (Fig. 3). Immunofluorescence localized the protein within the cytoplasm associated with punctate structures. The higher density of these structures around the nucleus and the rapid cellular redistribution of TbKIFC1 to the anterior extremity of the parasite after NH4Cl treatment (Fig. 4) indicated the association of the kinesin with acidic organelles. TbKIFC1 does not directly interact with the lysosomal or acidocalcisome compartments. These data suggest that the protein might be associated either with shuttle vesicles or macromolecular complexes moving to acidic compartments (8). However, association with different acidic vesicles cannot be ruled out, and we are currently attempting to identify the nature of the vesicles to which TbKIFC1 is associated. It has to be noted that the absence of detectable movement in procyclics even when overexpressing TbKIFC1 (Fig. 5A) indicated that this motion was under the control of other, as yet undefined, factors.

Acidocalcisomes are considered to be the major acidic compartment that accumulates Ca2+ in kinetoplastids (1). Therefore the effect of suppressing TbKIFC1 expression was analyzed for [Ca2+]i, Ca2+ release from that compartment, and pHi and pHi variations induced by nigericin and NH4Cl. One consequence of the suppression of TbKIFC1 expression was that the synergistic action of either nigericin or NH4Cl and ionomycin led to a lower [Ca2+]i corresponding to 150 ± 40 and 340 ± 30 nM for the induced and noninduced kinRNAi strain, respectively (Fig. 5B). Similar results were observed when the order of reagent addition was reversed (Fig. 5B). According to these data and the reported observation that ionomycin used alone may reflect a release of calcium from nonacidic compartments (38), we concluded that the Ca2+ storage capacity of the acidocalcisomes was significantly reduced.

It has been shown that acidity of acidocalcisomes is maintained by the combined activities of a bafilomycin A1-sensitive H+-ATPase and a V-H+-PPase (55) and is essential for Ca2+ storage and release (56). Reduced expression of these two pumps could reduce the internal pH gradient and lead to a lower calcium content. However, the pHi of mutant cells was not modified, and nigericin and NH4Cl induced the same pHi variations as in the noninduced and wild-type strains (Fig. 5C) (38). These data favor the presence of equivalent internal acidocalcisome pH gradients in mutant and wild-type strains. Calcium release has been shown to occur via a Ca2+/nH+ antiporter (46) that can be stimulated by Na+ via a Na+/H+ antiporter. Therefore an altered antiporter might abolish the release of Ca2+ mediated by alkalinization of the compartment by either nigericin or NH4Cl.

TbKIFC1 may contribute to the transport, via macromolecular complexes, of components from their site of synthesis to the acidic compartments, to give functional acidocalcisomes. The kinesin-II holoenzyme complex in Chlamydomonas was shown to transport "rafts" composed of a 16 S protein complex (57, 58). Alternatively, although acidocalcisomes were shown not to belong to the endocytic pathway in Trypanosoma cruzi (59), it was suggested that in normal Leishmania amazonensis the endosomal/lysosomal system was connected with acidocalcisomes during an autophagic process (60). The association of TbKIFC1 with vesicles involved in such a process would result in its higher expression in bloodstream forms where endocytosis is maximum. Therefore an interconnection, partially motorized by this protein, between residual bodies of the endocytic/autophagic lysosomal pathway and acidocalcisomes is proposed. Such a connecting pathway would be essential to production of functional acidocalcisomes for Ca2+ storage and release.

Nonetheless procyclic cells lacking TbKIFC1 are still viable, supporting the hypothesis that other Ca2+ transporting organelles can safeguard against limited disruption of acidocalcisomes (61, 62). For further analysis of this phenotype and the modifications linked to Ca2+ content and release, we are currently attempting to characterize acidocalcisome specific proteins such as V-H+-PPase. Although it is possible that the function of the kinesin differ in bloodstream and procyclic forms, our studies strongly suggest that experimental modifications of TbKIFC1 expression in bloodstream forms and identification of associated cellular factors will enhance our understanding of the effect of TbKIFC1 regulation on the biogenesis of acidocalcisomes.

    ACKNOWLEDGEMENTS

We acknowledge D. Russell and J. Bangs for the gift of the anti p67 monoclonal antibody, Bruno Goud for providing us in microtubules, and Jean-Baptiste Sibarata for the deconvolution. We particularly thank Jean-Nicolas Biteau, Jeanne Dachary-Prigent, Frederic Bringaud, and Emmanuel Tetaud for technical help and Charles Davis, Mike P. Barrett, Derick Robinson, and Bernard Hofflack for critical reading of the manuscript.

    FOOTNOTES

* This work was supported by the CNRS, the Conseil Régional d'Aquitaine, the Groupement De Recherche (GDR) CNRS-Parasitologie, and the Ministère de l'Education Nationale de la Recherche et de la Technologie (Action Microbiologie).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF319546.

§ These authors contributed equally to this work.

|| To whom correspondence should be addressed: Laboratoire d'Immunologie et Parasitologie Moléculaire, B.P. 12, Université Bordeaux II, 146 rue Léo-Saignat, 33076 Bordeaux Cedex, France. Tel.: 33-5-57571014; Fax: 33-5-57571015; E-mail: bakalara@hippocrate.u-bordeaux2.fr.

Published, JBC Papers in Press, October 1, 2001, DOI 10.1074/jbc.M105962200

2 G. Lemercier, S. Dutoya, T. Baltz, and N. Bakalara, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: BF, bloodstream form; PF, procyclic form; BCECF, 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceine acetoxymethyl ester; AM, acetoxymethylester; DTT, dithiothreitol; Pipes, 1,4-piperazinediethanesulfonic acid; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; AMP-PNP, 13,gamma -Imidoadenosine 5'-triphosphate; KHC, Kinesin Heavy Chain.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Docampo, R., and Moreno, S. N. (1999) Parasitol. Today 15, 443-448
2. Fraser-L'Hostis, C., Defrise-Quertain, F., Coral, D., and Deshusses, J. (1997) Biol. Chem. Hoppe-Seyler 378, 1039-1046
3. Overath, P., Stierhof, Y.-D., and Wiese, M. (1997) Trends Cell Biol. 7, 27-33
4. Gull, K. (1999) Annu. Rev. Microbiol. 53, 629-655
5. Goodson, H. V., Kang, S. J., and Endow, S. A. (1994) J. Cell Sci. 107, 1875-1884
6. Negulescu, P. A., and Machen, T. E. (1990) Methods Enzymol. 192, 38-81
7. Goldstein, L. S., and Philp, A. V. (1999) Annu. Rev. Cell Dev. Biol. 15, 141-183
8. Sheetz, M. P. (1999) Eur. J. Biochem. 262, 19-25
9. Tanaka, Y., Kanai, Y., Okada, Y., Nonaka, S., Takeda, S., Harada, A., and Hirokawa, N. (1998) Cell 93, 1147-1158
10. Hollenbeck, P. J., and Swanson, J. A. (1990) Nature 346, 864-866
11. Nakata, T., and Hirokawa, N. (1995) J. Cell Biol. 131, 1039-1053
12. Hurd, D. D., Stern, M., and Saxton, W. M. (1996) Genetics 142, 195-204
13. Hirokawa, N., Noda, Y., and Okada, Y. (1998) Curr. Opin. Cell. Biol. 10, 60-73
14. Sloboda, R. D. (1999) EMBO J. 18, 5447-5452
15. Cross, G. (1975) Parasitology 71, 393-417
16. Holder, A., and Cross, G. (1981) Mol. Biochem. Parasitol. 2, 135-150
17. Pamer, E. G., So, M., and Davis, C. E. (1989) Mol. Biochem. Parasitol. 33, 27-32
18. Wirtz, E., Hoek, M., and Cross, G. A. (1998) Nucleic Acids Res. 26, 4626-4634
19. Hamm, B., Schindler, A., and Duszenko, M. (1990) Mol. Biochem. Parasitol. 40, 13-22
20. Ross, C. A. (1987) Acta Trop. 44, 293-301
21. Lanham, S., and Godfrey, D. (1970) Exp. Parasitol. 28, 521-534
22. Baltz, T., Baltz, D., Giroud, C., and Crockett, J. (1985) EMBO J. 4, 1273-1277
23. Seyfang, A., and Duszenko, M. (1993) Eur. J. Biochem. 214, 593-597
24. Rosenfeld, J., Capdevielle, J., Guillemot, J. C., and Ferrara, P. (1992) Anal. Biochem. 203, 173-179
25. Sambrook, J., Fritsh, E., and Maniatis, T. (1989) in Molecular Cloning: A Laboratory Manual (Ford, N. , Nolan, C. , and Ferguson, M., eds), 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
26. Campbell, D. A. (1989) NAR 17, 458
27. Bates, P., and Swift, R. (1983) Gene (Amst.) 26, 137-146
28. Thompson, J., Higgins, D., and Gibson, T. (1994) Nucleic Acids Res. 22, 4673-4680
29. Page, R. (1996) Comput. Appl. Biosci. 12, 357-358
30. Fazekas de Siant Goth, S., and Heidegger, D. (1980) J. Immunol. Methods 35, 1-21
31. Laemmli, U. K. (1970) Nature 227, 680-685
32. Kyshe-Andersen, J. (1984) J Biochem. Biophys. Methods 10, 203-209
33. Heuser, J. (1989) J. Cell Biol. 108, 855-864
34. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254
35. Stieger, J., Wyler, T., and Seebeck, T. (1984) J. Biol. Chem. 259, 4596-4602
36. MacRae, T. H., and Gull, K. (1990) Biochem. J. 265, 87-93
37. Mitsui, H., Nakatani, K., Yamaguchi-Shinozaki, K., Shinozaki, K., Nishikawa, K., and Takahashi, H. (1994) Plant Mol. Biol. 25, 865-876
38. Scott, D. A., Moreno, S. N., and Docampo, R. (1995) Biochem. J. 310, 789-794
39. Bakalara, N., Santarelli, X., Davis, C., and Baltz, T. (2000) J. Biol. Chem. 275, 8863-8871
40. Bakalara, N., Seyfang, A., Davis, C., and Baltz, T. (1995) Eur. J. Biochem. 234, 871-877
41. Chandra, R., Endow, S. A., and Salmon, E. D. (1993) J. Cell Sci. 104, 899-906
42. Brickman, M. J., Cook, J. M., and Balber, A. E. (1995) J. Cell Sci. 108, 3611-3621
43. Lingnau, A., Zufferey, R., Lingnau, M., and Russell, D. G. (1999) J. Cell Sci. 112, 3061-3070
44. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Nature 391, 806-811
45. Docampo, R., Scott, D. A., Vercesi, A. E., and Moreno, S. N. (1995) Biochem. J. 310, 1005-1012
46. Vercesi, A. E., and Docampo, R. (1996) Biochem. J. 315, 265-270
47. Lu, H. G., Zhong, L., Chang, K. P., and Docampo, R. (1997) J. Biol. Chem. 272, 9464-9473
48. Moore, J. D., Song, H., and Endow, S. A. (1996) EMBO J. 15, 3306-3314
49. McDonald, H. B., Stewart, R. J., and Goldstein, L. S. (1990) Cell 63, 1159-1165
50. Endow, S. A., Kang, S. J., Satterwhite, L. L., Rose, M. D., Skeen, V. P., and Salmon, E. D. (1994) EMBO J. 13, 2708-2713
51. Song, H., and Endow, S. A. (1998) Nature 396, 587-590
52. Huang, T. G., and Hackney, D. D. (1994) J. Biol. Chem. 269, 16493-16501
53. Ma, Y. Z., and Taylor, E. W. (1995) Biochemistry 34, 13242-13251
54. Gilbert, S. P., Webb, M. R., Brune, M., and Johnson, K. A. (1995) Nature 373, 671-676
55. Rodrigues, C. O., Scott, D. A., and Docampo, R. (1999) Mol. Cell. Biol. 19, 7712-7723
56. Scott, D. A., and Docampo, R. (1998) Biochem. J. 331, 583-589
57. Piperno, G., and Mead, K. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4457-4462
58. Marszalek, J. R., and Goldstein, L. S. (2000) Biochim. Biophys. Acta 1496, 142-150
59. Docampo, R., and Moreno, S. N. (2001) Mol. Biochem. Parasitol. 114, 151-159
60. Vannier-Santos, M. A., Martiny, A., Lins, U., Urbina, J. A., Borges, V. M., and de Souza, W. (1999) Microbiology 145, 3213-3220
61. Parsons, M., and Ruben, L. (2000) Parasitol. Today 16, 56-62
62. Xiong, Z. H., Ridgley, E. L., Enis, D., Olness, F., and Ruben, L. (1997) J. Biol. Chem. 272, 31022-31028
63. Bringaud, F., Vedrenne, C., Cuvillier, A., Parzy, D., Baltz, D., Tetaud, E., Pays, E., Venegas, J., Merlin, G., and Baltz, T. (1998) Mol. Biochem. Parasitol. 94, 249-264
64. Moreno, S. N., Docampo, R., and Vercesi, A. E. (1992) J. Biol. Chem. 267, 6020-6026


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. Lemercier, B. Espiau, F. A. Ruiz, M. Vieira, S. Luo, T. Baltz, R. Docampo, and N. Bakalara
A Pyrophosphatase Regulating Polyphosphate Metabolism in Acidocalcisomes Is Essential for Trypanosoma brucei Virulence in Mice
J. Biol. Chem., January 30, 2004; 279(5): 3420 - 3425.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Lemercier, S. Dutoya, S. Luo, F. A. Ruiz, C. O. Rodrigues, T. Baltz, R. Docampo, and N. Bakalara
A Vacuolar-type H+-Pyrophosphatase Governs Maintenance of Functional Acidocalcisomes and Growth of the Insect and Mammalian Forms of Trypanosoma brucei
J. Biol. Chem., September 27, 2002; 277(40): 37369 - 37376.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
M. J. McConville, K. A. Mullin, S. C. Ilgoutz, and R. D. Teasdale
Secretory Pathway of Trypanosomatid Parasites
Microbiol. Mol. Biol. Rev., March 1, 2002; 66(1): 122 - 154.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/52/49117    most recent
M105962200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire