HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 52, 49371-49377, December 28, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/52/49371    most recent M108519200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Poplawski, A. Articles by Kelman, Z. Search for Related Content PubMed PubMed Citation Articles by Poplawski, A. Articles by Kelman, Z.

The Zinc Finger Domain of the Archaeal Minichromosome Maintenance Protein Is Required for Helicase Activity^*

Andrzej Poplawski, Beatrice Grabowski, Stephen E. Long^§, and Zvi Kelman^¶

From the  Center for Advanced Research in Biotechnology, University of Maryland Biotechnology Institute, Rockville, Maryland 20850 and the ^§ National Institute of Standards and Technology, Analytical Chemistry Division, Gaithersburg, Maryland 20899

Received for publication, September 5, 2001, and in revised form, October 16, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The minichromosome maintenance (MCM) proteins, a family of six conserved polypeptides found in all eukaryotes, are essential for DNA replication. The archaeon Methanobacterium thermoautotrophicum H contains a single homologue of MCM with biochemical properties similar to those of the eukaryotic enzyme. The amino acid sequence of the archaeal protein contains a putative zinc-binding domain of the CX₂CX_nCX₂C (C₄) type. In this study, the roles of the zinc finger domain in MCM function were examined using recombinant wild-type and mutant proteins expressed and purified from Escherichia coli. The protein with a mutation in the zinc motif forms a dodecameric complex similar to the wild-type enzyme. The mutant enzyme, however, is impaired in DNA-dependent ATPase activity and single-stranded DNA binding, and it does not possess helicase activity. These results illustrate the importance of the zinc-binding domain for archaeal MCM function and suggest a role for zinc binding in the eukaryotic MCM complex as well, since four out of the six eukaryotic MCM proteins contain a similar zinc-binding motif.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The minichromosome maintenance (MCM)¹ genes encode a family of six proteins (MCM2 to -7) first identified by their essential role in the maintenance of ARS-containing minichromosomes in Saccharomyces cerevisiae (1, 2). MCM homologues have been identified in all eukaryotes, and all are essential for DNA replication (1, 3-7). The recruitment of these proteins onto replication origins during the G₁ phase of the cell cycle is essential for the formation of a prereplicative complex and initiation of DNA synthesis (8-12). In addition to the heterohexameric structure MCM2/3/4/5/6/7, found in vivo and in vitro, several additional MCM complexes have been identified (13-16). Biochemical studies in yeast and mammals have shown that a dimeric complex of the MCM4/6/7 heterotrimer contains 3'-5' DNA helicase activity, single-stranded DNA (ssDNA) binding, and DNA-dependent ATPase activities (15, 17, 18). Both MCM2 and MCM3/5 were shown to inhibit the helicase activity of MCM4/6/7 and thus were suggested to play regulatory roles (15, 19). Both genetic and biochemical data suggest that the MCM4/6/7 complex is the eukaryotic replicative helicase and that the other MCM polypeptides may play regulatory roles (15, 16, 19).

Zinc fingers were first identified as zinc-binding domains important for protein-DNA interactions (20, 21). They contain conserved Cys and His residues, and to date more than 10 classes have been biochemically characterized, and their structures have been determined (reviewed in Refs. 22-25). Since their discovery, zinc finger domains have been implicated in diverse functions, including ssDNA and double-stranded DNA (dsDNA) binding, RNA binding, and protein-protein interactions (reviewed in Refs. 24 and 26). The primary amino acid sequences of the eukaryotic MCM2, -4, -6, and -7 proteins from all organisms contain a putative zinc finger motif of the C₄ type, either CX₂CX_nCX₂C (MCM2) or CX₂CX_nCX₄C (MCM4, -6, and -7) (Fig. 1A) (2).

The role of the zinc finger domain in MCM2 function was suggested by in vivo mutational analyses conducted in S. cerevisiae (27). In these studies, several substitutions were made in the second cysteine pair. None of the mutant proteins supported cell growth, suggesting an essential function for the putative zinc-binding domain of MCM2. However, the biochemical properties of the MCM2 zinc finger mutant were not characterized, and the roles of the zinc finger domains in MCM4, -6, or -7 have not yet been determined. Conservation of the domain from archaea to eukarya (Fig. 1) in a nonconserved region of the MCM family of proteins suggests the importance of the zinc finger domain in MCM function (2). Furthermore, mutational analyses of zinc finger domains in several viral helicases have shown these motifs to be important for helicase activity (28, 29).

Archaea, the third domain of life (30), are believed to replicate DNA in a eukaryotic-like fashion (31, 32). This conclusion is based in large part on the complete genome sequences of several members of this domain and the biochemical properties of the replication proteins that have been studied. Homologues of proteins involved in eukaryotic DNA replication have been identified within archaeal genomes, whereas bacterial DNA replication proteins have only limited sequence similarity to the eukaryotic ones. To date, at least one MCM homologue has been identified in all archaeal species studied (Fig. 1B) (32, 33). Biochemical studies with the single MCM homologue from the thermophilic archaeon Methanobacterium thermoautotrophicum H (Mth) showed that it forms a ring-shaped dodecamer with biochemical properties similar to the eukaryotic MCM4/6/7 complex, including ssDNA binding, ATPase activity stimulated by DNA, and 3' to 5' helicase activity that is dependent upon ATP hydrolysis (see Refs. 34-36; summarized in Ref. 37). Furthermore, it was recently demonstrated that MCM is associated with chromatin in Pyrococcus abyssi (38).

The archaeal domain can be divided into two main kingdoms: euryarchaeota and crenarchaeota (39). A zinc finger domain of the C₄ type has been identified in all MCM homologues from the euryarchaeota kingdom, including the Mth MCM (Fig. 1B). Only the first Cys pair is present in the two identified MCM homologues from the crenarchaeota kingdom (Fig. 1B). In order to elucidate the roles played by the zinc finger domain in mthMCM function, the motif was mutated by substituting the last Cys to Ser, resulting in a C₃S domain. In this study, the expression, purification, and biochemical properties of the mutant protein are described. It is shown that while the wild-type protein binds zinc, the mutant enzyme does not. While zinc binding is not needed for the oligomeric structure of the MCM complex, it is needed for efficient ssDNA binding, stimulation of ATPase activity by DNA, and helicase activity.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials

Labeled and unlabeled dNTPs and rNTPs were obtained from Amersham Biosciences, Inc., and AMP-PNP was from Roche Molecular Biochemicals. Single-stranded M13mp18, single-stranded X174, and double-stranded X174 DNAs were from New England Biolabs, and oligonucleotides were synthesized by the CARB DNA synthesis facility. Buffer A contained 20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 2 mM DTT, 0.5 mM EDTA, and 10% glycerol. Buffer B contained 10 mM Tris-HCl (pH 7.5), 300 mM NaCl, and 5% glycerol. Buffer C contained 20 mM Hepes-NaOH (pH 7.5), 10 mM MgCl₂, 2 mM DTT, and 100 µg/ml bovine serum albumin (BSA).

Methods

Preparation of Substrates for Helicase and Gel Mobility Shift Assays-- The oligonucleotide used in preparation of the helicase substrates was a 74-mer, 5'-(dT)₄₀CGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCC-3', referred to as M13-1T. After labeling with [-³²P]ATP and T4 polynucleotide kinase, the oligonucleotide was annealed to a single-stranded M13mp18 in a ratio of 1:2 and purified over a 1-ml Sephacryl HS-300-HR column (Sigma). Gel mobility shift assays were performed with either the M13-1T oligonucleotide; a 29-mer, Z149 (5'-AAAGCGGCCGCGCAGCCAACTCAGCTTCC-3'); a 50-mer, Hel-1 (5'-GGCCAACCGATCAAGTGCCCAGTCACGACGTTGTAAAACGAGCCCGCGCG-3'), or a 110-mer, Hel-4 (5'-CGCGCGGGCTCGTTTTACAACGTCGTGACTGGGCACTTGATCGGTTGGCC(dT)₆₀-3') labeled with [-³²P]ATP and T4 polynucleotide kinase.

Constructing the Zinc Finger Mutant of MCM-- The MCM zinc finger mutant was constructed in the pET-21 (Novagene) plasmid containing the wild-type MCM gene with a His₁₀ tag at the C terminus of the protein. Site-directed mutagenesis was performed using the QuickChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocol, with two complementary oligonucleotide primers Z207 (5'-GAGCCATCACTCTGCTCAGAGAGTGGTGGGAGATCCTTCAGGC-3') and Z208 (5'-GCCTGAAGGATCTCCCACCACTCTCTGAGCAGAGTGATGGCTC-3'). The mutated residues are underlined. The resulting construct contains a Cys to Ser substitution at residue 158 located in the second Cys pair of the zinc finger motif (Fig. 1B). Following mutagenesis, the entire gene was sequenced to ensure that no additional mutations were created.

Expression and Purification of Recombinant Proteins-- The wild-type and mutant MCM proteins were overexpressed and purified from Escherichia coli cells essentially as previously described (34) but with the following modifications. All proteins were overexpressed using the E. coli cells RIL CondoPlas (Stratagene) at either 37 °C (wild type and a protein with a mutation at the Walker-A motif (Lys  Ala)) or 24 °C (zinc finger mutant) in Luria-Bertani (LB) medium in the presence of appropriate antibiotics. Protein expression was induced and the proteins were purified to near homogeneity using Ni²⁺-chelate, Q-Sepharose, and glycerol gradient sedimentation. The glycerol gradient fractions were used in the experiments described below. Before glycerol gradient purification, the proteins were stored in buffer A at 70 °C. Protein concentrations were determined using the Bradford method (Bio-Rad) with BSA as the standard.

Glycerol Gradient Centrifugation-- A portion of the fraction purified on Q-Sepharose (300 µg) was applied to a 5-ml 20-40% glycerol gradient in buffer A, containing 200 or 500 mM NaCl. After centrifugation at 45,000 rpm (190,000 × g) for 13 h in a SW 50.1 rotor at 4 °C, fractions (300 µl) were collected from the bottom of the tube. The distribution of the mthMCM proteins was determined following 10% SDS-PAGE and staining with Coomassie Brilliant Blue (R-250).

Gel Filtration Separation-- A portion of the protein fraction purified on Q-Sepharose (100 µg in 100 µl of buffer A) was applied to a Superose-6 gel filtration column (HR10/30; Amersham Biosciences, Inc.) equilibrated with buffer A. Fractions (250 µl) were collected and analyzed for the presence of the mthMCM proteins by fractionation on a 10% SDS-PAGE and staining with Coomassie Brilliant Blue (R-250).

Analytical Measurement of Zinc-- To determine the presence or absence of zinc in the wild-type and mutant MCM proteins, a portion of the isolated proteins was dialyzed for 5 h against buffer B. The protein solutions were diluted with quartz-distilled water to reduce the level of dissolved solids and slightly acidified with nitric acid (Ultrex; J. T. Baker). Scandium was added as an internal standard at a concentration of 10 ng/g. All samples were measured using a VG PQ2 quadrupole ICP-MS system (VG Elemental) operated in a peak jumping mode. Samples were introduced into the instrument using a microconcentric nebulizer (CETAC) operated at a liquid uptake rate of 125 µl/min. Zinc measurements were made using the ⁶⁶Zn isotope with three replicate 30-s integrations at a dwell time of 10 ms. All measurements were normalized to the internal standard response. The zinc concentrations were calculated from a response curve generated from zinc calibration standard solutions.

ATPase Assay-- ATPase activity was measured in reaction mixtures (15 µl) containing 25 mM Hepes-NaOH (pH 7.5), 5 mM MgCl₂, 1 mM DTT, 100 µg/ml BSA, 1 nmol of ATP containing 2.5 µCi of [-³²P]ATP (3000 Ci/mmol; Amersham Pharmacia Biotech) in the absence of DNA or in the presence of 50 ng of single-stranded or double-stranded X174 DNA (0.15 nmol as nucleotides) and various protein concentrations. After incubation at 60 °C for 60 min, an aliquot (1 µl) was spotted onto a polyethyleneimine cellulose thin layer plate, and ATP and P_i were separated by chromatography in 1 M formic acid plus 0.5 M LiCl. The extent of ATP hydrolysis was quantitated by PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) analysis.

DNA Helicase Assay-- DNA helicase activity was measured in reaction mixtures (15 µl) containing 25 mM Hepes-NaOH (pH 7.5), 25 mM sodium acetate, 10 mM magnesium acetate, 5 mM ATP, 1 mM DTT, 100 µg/ml BSA, 5 fmol of ³²P-labeled DNA substrate (5000-6000 cpm/fmol) and wild-type or mutant proteins. After incubation at 60 °C for 1 h, the reaction was stopped by adding 5 µl of 5× loading buffer (100 mM EDTA, 0.5% SDS, 0.1% xylene cyanol, 0.1% bromophenol blue, and 50% glycerol), and aliquots were loaded onto a 12% polyacrylamide gel in 1× TBE (90 mM Tris, 90 mM boric acid, 1 mM EDTA) and electrophoresed for 3 h at 200 V at 4 °C.

Gel Mobility Shift Assay-- Complexes formed between the enzymes and ssDNA were detected by a gel mobility shift assay in reaction mixtures (15 µl) containing 25 mM Hepes-NaOH (pH 7.5), 50 mM sodium acetate, 8 mM MgCl₂, 1 mM ATP, 1 mM DTT, 100 µg/ml BSA, 20 fmol of ³²P-labeled oligonucleotide (2000-3000 cpm/fmol), and various protein concentrations. After incubation at 60 °C for 20 min, 5 µl of 5× loading buffer (0.1% xylene cyanol, 0.1% bromophenol blue, 50% glycerol) were added to stop the reaction. Aliquots of the reaction mixture were electrophoresed for 3 h at 200 V at 4 °C through a 4% polyacrylamide gel containing 6 mM magnesium acetate and 5% glycerol in 0.5 × TBE.

Nitrocellulose Filter Binding Assay-- A nitrocellulose filter binding assay was carried out by incubating varying amounts of the mthMCM wild-type or mutant proteins at 65 °C for 10 min in 25 µl of buffer C containing 50 fmol of 5' ³²P-labeled oligonucleotide (either M13-1T or Hel-4) (5000 cpm/fmol) in the presence or absence of 1 mM ATP. After incubation, the mixture was filtered through an alkaline-washed nitrocellulose filter (HA 0.45 µm; Millipore) (40), which was then washed with 20 mM Hepes-NaOH (pH 7.5). The radioactivity adsorbed to the filter was measured by liquid scintillation counting.

UV Cross-linking-- The UV-cross-linking experiments were performed using 500 ng of the wild-type enzyme as well as the Lys  Ala and zinc finger mutants essentially as previously described (41) in a reaction mixture containing 3.3 pmol of [-³²P]ATP, 20 mM Hepes-NaOH (pH 7.5), 5 mM MgCl₂, 2 mM DTT, and 250 ng BSA. The samples were incubated for 10 min at 65 °C followed by exposure to 2.5 J/cm² UV irradiation in a model 2400 Stratalinker (Stratagene) and analyzed by SDS-PAGE followed by Coomassie Blue staining and autoradiography.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The Archaeal MCM Protein Contains a Functional Zinc Finger Domain-- A zinc finger motif of the type C₄ has been identified in all archaea of the euryarchaeota kingdom for which the complete genome is known (Fig. 1B). To determine whether this domain binds zinc and to examine the role of the domain in MCM activity, one of the Cys residues in the second Cys pair was mutated to Ser, resulting in a C₃S motif. The mutant protein was expressed and purified from E. coli cells using the protocol previously described for the purification of the wild-type enzyme (34). The ability of the purified wild-type and mutant enzymes to bind zinc was determined using the ICP-MS system. While 0.6 mol of zinc were bound to 1 mol of the wild-type protein, only 0.08 mol were bound to the mutant enzyme. These results illustrate that, as predicted from the primary amino acid sequence, the archaeal MCM protein contains a functional zinc-binding domain. Submolar amounts of zinc in the wild-type proteins can be attributed to the loss of ions during the extensive purification steps.

View larger version (49K): [in this window] [in a new window]   Fig. 1.   Mth MCM protein contains a zinc finger motif of the type C4. A, an alignment of the zinc finger domain region of the six members of the MCM family (MCM2-7) from S. pombe. B, an alignment of the zinc finger domain region from several archaeal species belonging to the euryarchaeota and crenarchaeota kingdoms. The numbers to the left of the sequence represent the first residue of the zinc finger domain. Cysteine residues are shown in boldface type.

The Zinc Finger Motif Does Not Affect the Oligomeric Structure of the MCM Complex-- There are many examples in which zinc finger domains participate in protein-protein interactions (for examples, see Refs. 24 and 25). Previous studies with the wild-type mthMCM showed that the protein forms a double hexamer in solution with a native mass of about 1 MDa (Fig. 2) (34-36). Therefore, the effect of the mutation in the zinc-binding domain on the oligomeric structure of mthMCM was determined using gel filtration (Fig. 2) and glycerol gradient sedimentation (data not shown). SDS-PAGE of fractions obtained by the glycerol gradient and gel filtration (Fig. 2) yielded protein peaks at similar positions for the wild-type (Fig. 2A) and mutant proteins (Fig. 2B). The protein peaks were detected at a position (fractions 36 and 37) that is larger than thyroglobulin (660 kDa) and is similar to that previously reported for the wild-type enzyme (34-36). Thus, these results suggest that the zinc finger of the mthMCM protein is not needed to stabilize protein-protein interactions within the MCM complex. The zinc finger mutant, however, migrates at a slightly lower apparent molecular mass during gel filtration (Fig. 2) and at a slightly larger apparent molecular mass during glycerol gradient centrifugation (data not shown). This may indicate a more compact structure of the mthMCM protein in the absence of zinc.

View larger version (11K): [in this window] [in a new window]   Fig. 2.   Zinc binding is not needed for mthMCM oligomeric structure. The purified Q-Sepharose column fractions of the mthMCM wild-type (A) and zinc finger mutant (B) proteins (100 µg in 100 µl) were loaded onto a Superose-6 gel filtration column and analyzed as described under "Experimental Procedures." Aliquots (15 µl) of the fractions (indicated at the top) were subjected to 10% SDS-PAGE analysis followed by Coomassie Blue staining. The peak positions of thyroglobulin (Thy; 670 kDa), ferritin (Fer; 440 kDa), and aldolase (Ald; 150 kDa) are indicated at the top. LO indicates the sample loaded onto the column.

The Zinc Finger Motif Mutant Has an Altered ssDNA Binding Activity-- Studies performed with the mthMCM demonstrated that the protein binds ssDNA in the presence of magnesium (34, 35). Since zinc fingers have been shown to participate in protein-DNA interactions, the effect of the mutation at the zinc finger domain on ssDNA binding was determined using the gel mobility shift (Fig. 3A) and filter binding (Fig. 3B) assays. For these studies, 5'-³²P-labeled oligonucleotides were incubated with increasing amounts of wild-type and mutant forms of the mthMCM protein in the presence or absence of ATP. In the gel mobility shift assay (Fig. 3A), the wild-type enzyme (lanes 2-5), as well as the zinc finger (lanes 6-9) and Walker-A (Lys  Ala, lanes 10 and 11) mutants, all bound ssDNA. However, the two mutant proteins differ from the wild type in binding activity and pattern of interaction with ssDNA. At each concentration studied and in the presence or absence of ATP, the wild-type mthMCM showed a higher binding activity than the zinc finger mutant, with close to a 3-fold difference (compare lane 2 with lane 6, lane 3 with lane 7, lane 4 with lane 8, and lane 5 with lane 9). In the absence of ATP, the wild-type protein bound DNA about as well as the ATP-binding mutant (compare lane 5 with lane 11). The results of the complementary nitrocellulose filter binding assay (Fig. 3B) are similar. A surprising result in both assays was the improvement in DNA binding by the zinc mutant in the presence of ATP, suggesting that nucleotide binding might stabilize the mutant protein. In the gel mobility shift assay, but not the nitrocellulose filter-binding assay, the Lys  Ala mutant exhibited lower DNA binding activity in the presence of ATP. This discrepancy may be explained by the longer incubation time and harsher conditions of the gel mobility shift assay, compared with the filter binding assay, which measures weaker and more transient associations.

View larger version (26K): [in this window] [in a new window]   Fig. 3.   ssDNA binding activity of the different mthMCM proteins. A, gel mobility shift assays were performed as described under "Experimental Procedures," using 32P-labeled M13-1T oligonucleotide in the presence (lanes 1-4, 6-8, and 10) or absence (lanes 5, 9, 11, and 12) of 1 mM ATP. Lanes 2 and 6, 20 ng of enzyme; lanes 3 and 7, 60 ng of enzyme; lanes 4, 5, and 8-11, 180 ng of enzyme. The percentage of the oligonucleotide that formed a complex with MCM is indicated (%). B, nitrocellulose filter binding assays were performed as described under "Experimental Procedures" using 32P-labeled Hel-4 oligonucleotide in the presence of 10, 30, 90, and 270 ng of enzyme in the presence (filled symbols) or absence (empty symbols) of 1 mM ATP. Circles, wild-type protein; squares, Lys  Ala (K  A) mutant; triangles, zinc finger mutant.

In the presence of ATP, the wild-type protein forms two distinct shifted bands (Fig. 3A, lanes 2-4), suggesting two modes of interaction with DNA, whereas in the absence of ATP (Fig. 3A, lane 5), only a slower migrating band is observed. The zinc finger mutant, however, forms only the slower migrating band, whether ATP is present (Fig. 3A, lanes 6-8) or not (Fig. 3A, lane 9). When a nonhydrolyzable analogue of ATP, AMP-PNP, was used, only the slower migrating band could be detected with both the wild-type and the zinc mutant (data not shown), suggesting that ATP hydrolysis is needed to produce the faster migrating form of the protein-DNA complex. In support of this notion, when the wild-type protein was incubated with ssDNA in the presence of ATP but at lower temperatures (4 and 24 °C) that cannot support the ATPase and helicase activities of mthMCM (35, 36), only the slower migrating band could be detected. In addition, a mthMCM protein with a mutation at the Walker-A motif (Lys  Ala; lanes 10 and 11), which cannot bind ATP, exhibits the slower but not the faster migrating band, similar to the zinc finger mutant and the wild-type enzyme in the absence of ATP.

The Zinc Finger Motif Is Needed for DNA-dependent ATPase Activity-- As shown in Fig. 3, the mthMCM zinc mutant binds DNA in a different fashion from the wild-type enzyme. In the absence of ATP, the zinc mutant has the lowest binding activity of all of the proteins tested. However, in the presence of ATP, the DNA binding activity of the zinc mutant improves significantly, suggesting that the protein interactions with DNA may be stabilized by the nucleotide. Nevertheless, DNA binding activity by the mutant is still lower than that of the wild-type protein. This lower DNA binding activity could be attributed either to a lower affinity for ATP, an inability to bind ATP (as in the Lys  Ala mutant), or to aberrant ssDNA interactions. Thus, the ability of the mutant protein to bind ATP was tested by UV cross-linking, as was previously done with the wild-type mthMCM enzyme (41). As shown in Fig. 4A, both the wild-type (lane 2) and the zinc finger mutant (lane 3) can bind ATP, unlike the Lys  Ala mutant (lane 4). Comparing the amount of protein and labeled nucleotide in each lane (using densitometer and phosphorimager analyses, respectively) showed that similar amounts of ATP were cross-linked to the wild-type and zinc finger mutant enzymes. Thus, although UV cross-linking is not a quantitative assay, these results suggest comparable binding of ATP to both proteins.

View larger version (15K): [in this window] [in a new window]   Fig. 4.   The mthMCM zinc finger domain is needed for DNA-dependent ATPase activity. A, UV cross-linking of mthMCM proteins to ATP. 500 ng of each protein (as indicated) were cross-linked to [-32P]ATP as described under "Experimental Procedures." The proteins were separated on 10% SDS-PAGE and visualized by Coomassie Blue (upper panel) and autoradiography (lower panel). B, the ATPase activity of the wild-type and mutant mthMCM proteins was determined using 50 and 100 ng of enzyme in the absence or presence of single- or double-stranded X174 DNA as described under "Experimental Procedures." The numbers at the bottom of the autoradiogram indicate the amount of 32Pi released (quantitated by PhosphorImager analysis).

Previous studies showed that the ATPase activity of the wild-type protein is stimulated in the presence of ssDNA and, to a lesser extent, by dsDNA (34-36). Therefore, to demonstrate the importance of the zinc finger for ssDNA binding, the stimulatory effects of ssDNA and dsDNA on the ATPase activity of the protein were examined. As shown in Fig. 4B, the ATPase activity of the wild-type protein was stimulated 7-fold by X174 ssDNA (compare lanes 3 and 6 with lanes 2 and 5) and 4-fold by dsDNA (compare lanes 4 and 7 with lanes 2 and 5). The zinc finger mutant protein possesses ATPase activity in the absence of DNA (lanes 8 and 11), albeit lower than the wild-type enzyme (compare lane 8 with lane 2 and lane 11 with lane 5). The lower activity may be due to conformational changes within the mutant protein, which affect the ATPase activity. Neither ssDNA nor dsDNA, however, stimulated the ATPase activity of the mutant protein (compare lanes 9 and 10 with lane 8 and lanes 12 and 13 with lane 11). Similar results have been obtained with different protein concentrations (data not shown). Taken together, these results illustrate that the zinc finger domain is needed for stable interactions between mthMCM and ssDNA.

The Zinc Finger Domain Is Important for Helicase Activity-- The experiments described above demonstrate that the integrity of the zinc finger domain of MCM is important for efficient interaction with ssDNA and for ATPase activity. Thus, it is likely that the helicase activity of the mthMCM mutant will also be affected when the zinc binding domain is altered. The experiment described in Fig. 5 was designed to address the role of zinc binding on helicase activity. As previously reported (34-36), the wild-type protein contains a 3'-5' helicase activity (lanes 3-5) that is dependent on ATP hydrolysis (compare lanes 3-5 with lanes 6 and 11). Very limited helicase activity could be detected with the zinc finger mutant under similar conditions (compare lanes 7-9 with lanes 3-5). Thus, these results demonstrate that the zinc-binding domain of the archaeal MCM protein is needed for helicase activity.

View larger version (8K): [in this window] [in a new window]   Fig. 5.   The zinc finger domain of mthMCM is needed for helicase activity. Helicase activity assays were carried out with increasing amounts of the wild-type protein (lanes 3-6), zinc finger mutant (lanes 7-10), and Walker-A motif mutant (Lys  Ala, lanes 11 and 12) in the presence or absence of ATP, as described under "Experimental Procedures." Lane 1, boiled substrate; lane 2, no protein added; lanes 3 and 7, 50 ng of enzyme; lanes 4 and 8, 100 ng of enzyme; lanes 5, 6, and 9-12, 200 ng of enzyme. The percentage displacement of the oligonucleotide from the duplex DNA substrate is indicated (%).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In the study presented here, the roles of the zinc finger domain in the functions of the mthMCM protein were analyzed. The data illustrate that a mutation at the zinc finger, which drastically reduces zinc binding, weakens the interaction between the mthMCM protein and ssDNA, which, in turn, leads to impaired ATPase and helicase activities. The zinc finger mutant appears to retain a low level of DNA binding activity. However, ATPase activity by the zinc finger mutant is not stimulated by DNA, indicating that its interaction with DNA is different from that of the wild-type enzyme.

There are several examples in which zinc fingers are needed for protein-protein interactions (24, 26). However, oligomerization of the mthMCM does not appear to require the zinc-binding motif, since a dodecamer could be observed with the mutant protein. This is consistent with the analysis of a truncated form of the mthMCM, which demonstrated that the N-terminal 111 amino acids contain a region required for multimerization (35). The zinc finger domain is located between residues 133 and 158, which is outside of the multimerization region. It is nevertheless possible that the zinc finger participates in interactions with other proteins (e.g. the helicase loader). In vitro and in vivo interactions between archaeal MCM and Cdc6 homologues have been suggested (34, 38).

One MCM homologue has been identified in all archaea for which the complete genome is known (32, 33). To date, Methanococcus jannaschii is the only archaeon in which multiple MCM homologues (four) have been identified (42). All MCM homologues from the euryarchaeota kingdom (one out of the four in M. jannaschii) contain a C₄ type zinc finger motif (Fig. 1B). In the two identified MCM homologues from the crenarchaeota kingdom, only the first Cys pair is present (Fig. 1B), and thus the protein is not likely to bind zinc. Therefore, the MCM proteins from the crenarchaeota may have developed a different mechanism for interaction with ssDNA during translocation along the DNA, or additional proteins may be needed to associate with the MCM for helicase activity. Alternatively, it is possible that in crenarchaeota another protein, and not the MCM, functions as the replicative helicase. Future studies with MCMs from this kingdom should determine their role in DNA replication.

Previous studies have shown that the mthMCM is a dodecamer in solution (34-36). The Schizosaccharomyces pombe MCM4/6/7 complex as well as the large T-antigen, the helicase of simian virus 40, were also shown to form double hexamers. The difference, however, is that these dodecamers are efficiently formed only in the presence of DNA substrate (DNA fork structure) (43, 44). Interestingly, gel mobility shift analyses indicated that both large T-antigen and the S. pombe MCM form two types of interactions with DNA (i.e. a faster migrating band that was shown to be a hexamer and a slower migrating band that was shown to be a double hexamer) (43, 44). These observations are similar to the gel mobility shift assay presented here (Fig. 3), in which the wild-type mthMCM formed a faster and a slower migrating band in the presence of ATP. Thus, it is possible that the faster migrating band contains only one hexamer, while the slower one contains a double hexamer. It was suggested that double-hexamers unwind DNA in opposite directions (one on each strand) at the replication fork and thus initiate bidirectional DNA synthesis. However, in the absence of ATP, at lower temperatures, or with the zinc finger or ATP-binding mutants, only the slower migrating band was produced, suggesting that ATP hydrolysis may be responsible for producing a single hexamer-DNA complex, perhaps by destabilizing the double hexameric structure during translocation.

In eukaryotes, MCM2, -4, -6, and -7 contain the consensus sequence of a putative zinc-binding motif. Although the ability of these proteins to bind zinc has not yet been demonstrated, they are likely to bind the ion, since these motifs are similar to the one in the mthMCM and other zinc finger domains. The functions of the zinc fingers may differ between MCM2 and MCM4, -6, and -7. The MCM4/6/7 complex was shown to interact with ssDNA and to possess helicase activity (15, 17, 18), and thus the role of the zinc finger in the eukaryotic proteins may be similar to its role in the archaeal enzyme by participating in the interactions with ssDNA during helicase activity.

MCM2 was shown to form a complex with the other five MCM subunits, as well as with the MCM4/6/7 complex, and is believed to play a regulatory role, since the presence of MCM2 inhibits the helicase activity of the MCM4/6/7 complex in vitro (15, 19). Furthermore, the phosphorylation of MCM2 by Cdc7-Dbf4 kinase is required for the initiation of DNA synthesis (45-47), presumably by relieving the inhibition on helicase activity. It is tempting to speculate, in light of the results presented here, that the MCM2 protein interacts tightly with ssDNA at the origin via the zinc finger motif, which may tether the helicase to the DNA, preventing its translocation along the duplex. The phosphorylation of the MCM2, prior to the initiation of DNA synthesis, releases the protein from the MCM complex and/or changes its conformation such that it can no longer interact with DNA. On the other hand, MCM3 does not appear to have a zinc finger domain, and MCM5 has lost one of the cysteines needed for a functional zinc finger domain, suggesting that the regulatory role of MCM3/5 may not entail DNA binding.

The conservation of the zinc finger motif and similar biochemical properties between the archaeal and eukaryal MCM suggest that the archaeal MCM may provide a simpler model for the mechanism of the eukaryotic helicase. Studies of the interaction of the mthMCM with other proteins such as the archaeal Cdc6/Orc1 homologues and with the origin DNA may shed light on how the prereplicative complex is formed and regulated during replication in archaea and eukarya.

	ACKNOWLEDGEMENTS

We thank Drs. Jerard Hurwitz and Joon-Kyu Lee for helpful suggestions during the course of this work and Drs. Edward Egelman and Lori Kelman for comments on the manuscript. We also thank D. Shechter and Dr. J. Gautier for the MCM wild type and Lys  Ala expression vectors.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ An Invitrogen professor. To whom correspondence should be addressed: CARB/UMBI, 9600 Gudelsky Dr., Rockville, MD 20850. Tel.: 301-738-6294; Fax: 301-738-6255; E-mail: kelman@umbi.umd.edu.

Published, JBC Papers in Press, October 17, 2001, DOI 10.1074/jbc.M108519200

	ABBREVIATIONS

The abbreviations used are: MCM, minichromosome maintenance; Mth, Methanobacterium thermoautorophicum H; AMP-PNP, 5'-[,-imido]triphosphate; BSA, bovine serum albumin; DTT, dithiothreitol; dsDNA, double-stranded DNA; ssDNA, single-stranded DNA; mthMCM, Methanobacterium thermoautotrophicum.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

This article has been cited by other articles:

				W. Liu, B. Pucci, M. Rossi, F. M. Pisani, and R. Ladenstein Structural analysis of the Sulfolobus solfataricus MCM protein N-terminal domain{dagger} Nucleic Acids Res., April 16, 2008; (2008) gkn183v1. [Abstract] [Full Text] [PDF]

				N. Sakakibara, R. Kasiviswanathan, E. Melamud, M. Han, F. P. Schwarz, and Z. Kelman Coupling of DNA binding and helicase activity is mediated by a conserved loop in the MCM protein Nucleic Acids Res., March 27, 2008; 36(4): 1309 - 1320. [Abstract] [Full Text] [PDF]

				E. R. Barry, A. T. McGeoch, Z. Kelman, and S. D. Bell Archaeal MCM has separable processivity, substrate choice and helicase domains Nucleic Acids Res., February 16, 2007; 35(3): 988 - 998. [Abstract] [Full Text] [PDF]

				R. Kasiviswanathan, J.-H. Shin, and Z. Kelman DNA Binding by the Methanothermobacter thermautotrophicus Cdc6 Protein Is Inhibited by the Minichromosome Maintenance Helicase. J. Bacteriol., June 1, 2006; 188(12): 4577 - 4580. [Abstract] [Full Text] [PDF]

				R. J. Fletcher, J. Shen, Y. Gomez-Llorente, C. S. Martin, J. M. Carazo, and X. S. Chen Double Hexamer Disruption and Biochemical Activities of Methanobacterium thermoautotrophicum MCM J. Biol. Chem., December 23, 2005; 280(51): 42405 - 42410. [Abstract] [Full Text] [PDF]

				R. Kasiviswanathan, J.-H. Shin, and Z. Kelman Interactions between the archaeal Cdc6 and MCM proteins modulate their biochemical properties Nucleic Acids Res., September 8, 2005; 33(15): 4940 - 4950. [Abstract] [Full Text] [PDF]

				A. Seybert, C. C. Posthuma, L. C. van Dinten, E. J. Snijder, A. E. Gorbalenya, and J. Ziebuhr A Complex Zinc Finger Controls the Enzymatic Activities of Nidovirus Helicases J. Virol., January 15, 2005; 79(2): 696 - 704. [Abstract] [Full Text] [PDF]

				B. Pucci, M. De Felice, M. Rossi, S. Onesti, and F. M. Pisani Amino Acids of the Sulfolobus solfataricus Mini-chromosome Maintenance-like DNA Helicase Involved in DNA Binding/Remodeling J. Biol. Chem., November 19, 2004; 279(47): 49222 - 49228. [Abstract] [Full Text] [PDF]

				D. Gai, D. Li, C. V. Finkielstein, R. D. Ott, P. Taneja, E. Fanning, and X. S. Chen Insights into the Oligomeric States, Conformational Changes, and Helicase Activities of SV40 Large Tumor Antigen J. Biol. Chem., September 10, 2004; 279(37): 38952 - 38959. [Abstract] [Full Text] [PDF]

				S. A. Capaldi and J. M. Berger Biochemical characterization of Cdc6/Orc1 binding to the replication origin of the euryarchaeon Methanothermobacter thermoautotrophicus Nucleic Acids Res., September 9, 2004; 32(16): 4821 - 4832. [Abstract] [Full Text] [PDF]

				R. Kasiviswanathan, J.-H. Shin, E. Melamud, and Z. Kelman Biochemical Characterization of the Methanothermobacter thermautotrophicus Minichromosome Maintenance (MCM) Helicase N-terminal Domains J. Biol. Chem., July 2, 2004; 279(27): 28358 - 28366. [Abstract] [Full Text] [PDF]

				S. L. Forsburg Eukaryotic MCM Proteins: Beyond Replication Initiation Microbiol. Mol. Biol. Rev., March 1, 2004; 68(1): 109 - 131. [Abstract] [Full Text] [PDF]

				J.-H. Shin, Y. Jiang, B. Grabowski, J. Hurwitz, and Z. Kelman Substrate Requirements for Duplex DNA Translocation by the Eukaryal and Archaeal Minichromosome Maintenance Helicases J. Biol. Chem., December 5, 2003; 278(49): 49053 - 49062. [Abstract] [Full Text] [PDF]

				J.-H. Shin, B. Grabowski, R. Kasiviswanathan, S. D. Bell, and Z. Kelman Regulation of Minichromosome Maintenance Helicase Activity by Cdc6 J. Biol. Chem., September 26, 2003; 278(39): 38059 - 38067. [Abstract] [Full Text] [PDF]

				Z. You, Y. Ishimi, H. Masai, and F. Hanaoka Roles of Mcm7 and Mcm4 Subunits in the DNA Helicase Activity of the Mouse Mcm4/6/7 Complex J. Biol. Chem., November 1, 2002; 277(45): 42471 - 42479. [Abstract] [Full Text] [PDF]

				F. Carpentieri, M. De Felice, M. De Falco, M. Rossi, and F. M. Pisani Physical and Functional Interaction between the Mini-chromosome Maintenance-like DNA Helicase and the Single-stranded DNA Binding Protein from the Crenarchaeon Sulfolobus solfataricus J. Biol. Chem., March 29, 2002; 277(14): 12118 - 12127. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/52/49371    most recent M108519200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire