JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M005292200 on October 24, 2000

J. Biol. Chem., Vol. 276, Issue 6, 3727-3732, February 9, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/6/3727    most recent
M005292200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maurer, U.
Right arrow Articles by Bergmann, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maurer, U.
Right arrow Articles by Bergmann, L.

The Wilms' Tumor Gene Product (WT1) Modulates the Response to 1,25-Dihydroxyvitamin D3 by Induction of the Vitamin D Receptor*

Ulrich MaurerDagger, Frederic Jehan§, Christoph Englert, Gabriele Hübinger, Eckhart Weidmann||, Hector F. DeLuca§, and Lothar Bergmann||

From the Department of Internal Medicine III, University of Ulm, 89081 Ulm, Germany, § Department of Biochemistry, College of Agricultural and Life Sciences, University of Wisconsin-Madison, Madison, WI 53706,  Forschungszentrum Karlsruhe, Institut für Genetik, 76021 Karlsruhe, Germany, and || Department of Internal Medicine III, Johann Wolfgang Goethe University, 60590 Frankfurt, Germany

Received for publication, June 19, 2000, and in revised form, October 23, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Wilms' tumor gene (wt1) encodes a transcription factor involved in urogenital development, in particular in renal differentiation, and in hematopoietic differentiation. Differentiation of a number of solid tumor and leukemic cells lines can be mediated by 1,25-dihydroxyvitamin D3. This is predominantly mediated by the nuclear receptor for 1,25-dihydroxyvitamin D3, the vitamin D receptor (VDR). In initial experiments addressing a possible link between WT1 and VDR, we observed a correlated expression of WT1 and VDR mRNA in samples from renal tissues. HT29 colon carcinoma cells, stably transfected to express WT1, exhibited elevated endogenous VDR levels compared with control cells transfected with a control construct. Elevated VDR expression was found in wt1-transfected human embryonic kidney 293 cells, as well. In transient cotransfection experiments, we observed an activation of a vdr promoter reporter by WT1 through a WT1 recognition element, indicating transcriptional regulation of the vdr gene expression by WT1. The responsive sequence element was specifically bound by wild-type, but not by mutated WT1, in electrophoretic mobility shift assays. HT29 colon carcinoma cells, which respond to 1,25-dihydroxyvitamin D3 with slow induction of growth arrest, were investigated for the influence of WT1 on 1,25-dihydroxyvitamin D3-mediated growth suppression. Although HT29 cells transfected with a control construct responded moderately to 1,25-dihydroxyvitamin D3, the response of HT29 cells expressing WT1 was strikingly enhanced. Stimulation with dihydroxyvitamin D3 caused an up to 3-fold reduction in the growth rate of different HT29 clones expressing WT1 as compared with control cells lacking WT1 expression. Thus, induction of VDR by WT1 leads to an enhanced response to 1,25-dihydroxyvitamin D3. We conclude that the vitamin D receptor gene is a target for transcriptional activation by WT1, suggesting a possible physiological role of this regulatory pathway.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In addition to its function as a regulator of calcium homeostasis, 1,25-dihydroxyvitamin D3 has been demonstrated to be a potent inducer of differentiation in leukemic cells lines and cells derived from solid tumors (reviewed in Refs. 1 and 2). Physiologically, 1,25-dihydroxyvitamin D3 directly binds to its cellular receptor, the vitamin D receptor (VDR),1 resulting in transcription factor activity of the VDR. The VDR molecule dimerizes with the retinoic X receptor and activates target genes via interaction with vitamin D response elements in vitamin D-responsive promoters (1, 2). Additionally, vitamin D response element-independent functions of 1,25-dihydroxyvitamin D3, referred to as "nongenomic signaling," have been described, as well (3).

Our own previous experiments addressing the effects of 1,25-dihydroxyvitamin D3 in leukemic cells pointed to an influence of Wilms' tumor gene (wt1) expression on the induction of differentiation by 1,25-dihydroxyvitamin D3 (4). The Wilms' tumor gene (wt1) was isolated by deletion analysis and positional cloning in Wilms' tumor and WAGR (Wilms' tumor, aniridia, urogenital malformation, mental retardation) patients, leading to its definition as a tumor suppressor gene (5). The gene product contains a C-terminal zinc finger motif and a proline-glutamine-rich domain at the N terminus, similar to the early growth response-1 transcription factor (6). WT1 is expressed as four alternative isoforms containing or lacking a 17-amino acid stretch (termed 17AA) encoded by an alternatively spliced exon 5 and an insertion of three amino acids between zinc fingers 3 and 4, encoded by alternative splice II, termed KTS (7).

Expression of WT1 has been demonstrated in the kidney, the genital ridge, fetal gonads, spleen, and mesothelium (5, 8, 9). The absence of kidneys and gonads in wt1 knockout mice indicates the crucial role of wt1 for urogenital development (9). During hematopoietic differentiation, the Wilms' tumor gene is transiently expressed, as well (10, 11). In contrast to its proposed role as a tumor suppressor, WT1 is expressed in the majority of acute leukemias (12), suggesting that the anti-oncogenic function of WT1 is dependent on the cellular context.

In initial experiments, we probed a multiple-tissue cDNA blot with probes for WT1 and VDR, observing a correlated expression pattern of VDR and WT1 mRNA. This led us investigate a possible regulation of the expression of the VDR by WT1. In this work, we demonstrate that WT1 activates the VDR promoter in vitro. We show that that engineered expression of WT1 by HT29 colon carcinoma cells, which respond moderately to 1,25-dihydroxyvitamin D3 (13), causes enhanced VDR levels and an enhanced response to 1,25-dihydroxyvitamin D3. Induction of the VDR by WT1 is confirmed in human embryonic kidney (HEK) 293 cells from renal origin, suggesting that the VDR gene represents a downstream target of WT1.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and Transfections-- HEK293 and HT29 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. For transfection, 1 × 106 cells were seeded in a 10-cm dish, and after 24 h, they were transfected with 20 µg of expression plasmid using DOTAP transfection reagent (Roche Diagnostics, Mannheim, Germany). To generate stable transfectants, cells were selected for stable vector insertion with 500 µg/ml G418 (Life Technologies, Inc.). Clones derived from single cells were generated by limiting dilution and were analyzed for WT1 protein expression by Western blotting. 1,25-Dihydroxyvitamin D3 was prepared as a 1000× stock solution (10 µM) in ethanol.

RNase Protection Assay-- Antisense probes for VDR and WT1 mRNA were generated by polymerase chain reaction amplification of the appropriate cDNA sequences (VDR 5', CCCAGCTCTCCATGC; VDR 3', TGACGCGGTACTTGTAGT; WT1 5', ACGCGCCCTACCTGCCCAG; and WT1 3', TTCTCACTGGTCTCAGATGC; MWG Biotech, Ebersberg, Germany). The VDR amplicon (224 base pairs) was cloned in antisense orientation in pCR 3.1 (Invitrogen). The wt1 amplicon was digested with BamHI, and the resulting 154-base pair fragment was cloned into pCDNA 3 (Invitrogen) after digestion with BamHI/EcoRV. GAPDH and L32 probes (Pharmingen, San Diego, CA) were included for normalization. A multiple probe for cell cycle genes including p21 was also purchased from the manufacturer. In vitro transcription and ribonuclease protection assay was performed with a kit (Pharmingen, San Diego, CA) according to the manufacturers' instructions analyzing 20 µg of total RNA isolated with Trizol reagent (Life Technologies, Inc.). Protected RNA-RNA hybrids were separated on a 6% sequencing gel and subsequently exposed to Biomax x-ray film (Eastman Kodak, Co., Rochester, NY) or to a PhosphorImager system (Molecular Dynamics).

Western Blotting-- Protein lysate was dissolved in Laemmli buffer (500 mM Tris-HCl, 100 mM dithiothreitol, 2% SDS, 0.1% bromphenol blue, 10% glycerol, pH 6.8), heated to 95 °C, and subjected to a 10% polyacrylamide gel electrophoresis. After blotting to a polyvinylidene difluoride membrane (Millipore, Bedford, MA) and blocking with skim milk (Fluka, Steinheim, Germany), the membrane was incubated with anti-WT1 C19, anti-WT1 180, or anti-VDR C-20 (all from Santa Cruz Biotechnologies) antibodies diluted 1:1000. Detection was performed by incubation with a horseradish peroxidase-conjugated anti-rabbit antibody (dilution 1: 5000), and the ECL system (both from Amersham Pharmacia Biotech). For further analysis, blots were stripped with 0.2 M glycine, pH 2.5, at 56 °C for 30 min.

Transient Transfection Experiments-- Different murine vitamin D receptor promoter fragments were subcloned in to a pGL2basic vector upstream of the firefly luciferase reporter gene as described elsewhere (14, 15). A mutant lacking the WT1 recognition element (WRE)-related sequence was generated by digestion of the 0.5-kb construct with RsrII and SmaI, followed by treatment with T4 polymerase and religation. The expression constructs used were WT1+17AA-KTS, WT1+17AA+KTS (wt1B and wt1D, kindly provided by F. J. Rauscher, III, Wistar Institute, Philadelphia, PA), and WTAR, encoding a truncated protein (16). The wt1 coding region was subcloned into pCDNA3 (Invitrogen). NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. For transfection, 0.5 × 105 cells were seeded in a 10-cm dish and were transfected with 5 µg of expression plasmid, together with 1 µg of reporter construct using DOTAP transfection reagent (Roche Diagnostics, Mannheim, Germany) after 24 h. Transfection efficiency was determined by cotransfection of 1 µg of a renilla luciferase plasmid (pRLTK; Promega, Heidelberg, Germany). After 48 h, 20 µl of lysate were transferred to a luminescent reaction, and both firefly luciferase and renilla luciferase light activity were determined according to the manufacturers' protocol (Promega, Heidelberg, Germany) with a Lumat 9510 (Berthold, Bad Weinsberg, Germany).

Electrophoretic Mobility Shift Experiments-- Electrophoretic mobility shift assay experiments were essentially done as described before (17). 20 ng of protein were incubated with 3000 cpm of radiolabeled double-stranded oligonucleotide. The oligos were as follows: hVDRWRE sense, AGGACTGGACCTGTGGGCGGGGCGGAG; hVDRWRE antisense, CTCCGCCCCGCCCACAGGTCCAGTCCT; mutated hVDRWRE sense, AGGACTGGACCTGCGTTCGGGGCGGAG; mutated hVDRWRE antisense, CTCCGCCCCGAACACAGGTCCAGTCCT; mVDRWRE sense, AGGACTGAACTTAGTGGGCGTGGTTGAG; mVDRWRE antisense, CTCAACCACGCCCACTAAGTTCAGTCCT; mutated mVDRWRE sense, AGGACTGAACTTAGTGTTCGTGGTTGAG; and mutated mVDRWRE antisense, CTCAACCACGAACACTAAGTTCAGTCCT (altered nucleotides are shown in bold and italics).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

WT1 Induces Endogenous VDR Expression in HT29 Colon Carcinoma and in Human Embryonic Kidney 293 Cells-- To investigate the effect of WT1 on the endogenous expression of VDR, HT29 cells expressing moderate endogenous levels of VDR were stably transfected with expression plasmids encoding the -17AA-KTS isoform of WT1. Expression of WT1 mRNA was detected in different selected HT29 clones by RNase protection assay and Northern blotting (data not shown), and the protein expression was detected by Western blotting. A significant induction of VDR mRNA was observed in different, independently generated HT29 cell clones expressing WT1, compared with HT29 cells transfected with the empty vector (Fig. 1A). In accordance with the induction of VDR mRNA, we observed elevated VDR protein levels in WT1-expressing HT29 cells (Fig. 1B). Detection of elevated levels of VDR in different HT29 clones expressing WT1 suggested that this was not an effect of clonal selection. In control experiments, mRNA expression of the dimerization partner of VDR, the retinoic X receptor-alpha was not elevated in clones expressing WT1 (data not shown).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1.   A, expression of WT1 and VDR mRNA by wt1-transfected HT29 clones and control cells. Probes protecting the mRNA coding for the L32 and GAPDH housekeeping gene were included. Control cells transfected with the empty vector and two clones with the highest expression of wt1 as assayed by previous analyses were tested in duplicate. Lane 1, undigested probes; lanes 2 and 3, HT29-neo; lanes 4 and 5, HT29-WT1A3; lanes 6 and 7, HT29-WT1A5. Lane 7 shows yeast tRNA put in the hybridization to control complete cleavage of the unprotected probe. Note that comparably low signal intensity of WT1 mRNA is due to the low activity of the probe in this experiment. B, protein expression of WT1 and VDR by control cells (HT29-neo) and transfectants (HT29WT1-A3 and HT29WT1-A5). WT1 protein expression was detected with the antibody wt1-180 after electrophoresis in a 10% SDS polyacrylamide gel (100 µg per lane). Induction of VDR protein in WT1-expressing HT29 cells corresponding to the induction of VDR mRNA detected with the VDR C-20 antibody after resolving 100 µg of protein per lane in a 10% SDS polyacrylamide gel. C, induction of p21 mRNA expression by WT1 in HT29 transfectants. Lane 1, undigested probes; lane 2, control hybridization with HeLa mRNA; lanes 3 and 4, HT29-neo; lanes 5 and 6, HT29-WT1A3; lanes 7 and 8, HT29-WT1A5; lane 9, yeast tRNA; lane 10, undigested probes.

To compare the extent of VDR up-regulation with a previously characterized WT1 target gene, the induction of p21 (18) was investigated in HT29 cells expressing WT1 and control cells. p21 mRNA was induced significantly, although to a somewhat lesser extent than VDR mRNA, in WT1-expressing HT29 cells (Fig. 1C).

To investigate induction of VDR by the Wilms' tumor gene product in renal cells, human embryonic kidney 293 cells were transfected with a WT1 expression construct, and induction of VDR was assayed by immunoblotting. VDR protein was strongly elevated in HEK293 cells overexpressing WT1, suggesting that WT1 up-regulates VDR expression in the context of renal cells (Fig. 2).



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 2.   Induction of VDR by WT1 in HEK293 kidney cells. Expression of WT1 protein in 293 cells transfected with a wt1 expression construct was detected by the C-19 antibody after 10% SDS polyacrylamide gel electrophoresis of 50 µg of total protein. Lane 1, control cells; lanes 2 and 3, wt1-transfected HEK293 cells. The blot was stripped, and VDR protein expression was detected by the anti-VDR C-20 antibody.

WT1 Directly Activates the VDR Promoter-- To address the question whether WT1 regulates the VDR expression at the transcriptional level, transient cotransfection experiments were performed. A 0.8-kb fragment of the mouse vdr gene promoter fused to a sequence coding for the firefly luciferase was cotransfected with -KTS and +KTS isoforms of WT1 and a mutant (WTAR) lacking the third zinc finger (16). The VDR promoter fragment was induced 4-fold by the -KTS-isoform but not by the +KTS isoform of WT1. In contrast, cotransfection of the mutant WTAR slightly repressed the VDR promoter construct (Fig. 3A). The response to WT1 appeared to be in a dose-dependent manner (Fig. 3B). To narrow the sequence element responsive for WT1, the promoter construct was shortened from distal of the transcriptional start site (see Fig. 4). A 0.5-kb promoter fragment responded, as well, to WT1. A 0.2-kb fragment, located proximal to the transcription start site, was induced to the same extent, suggesting that the WT1-responsive element was located in this fragment of the VDR promoter. This fragment contains four GC-rich clusters, with putative Sp1 binding sites (15). The most distal GC element, 5'-TGTGGGCG-3', is very similar to the sequence of the recently defined WRE high affinity binding sequence, 5'-CGTGGG(A/T)G-3' (19). A deletion construct lacking this site exhibited no response to WT1 anymore (Fig. 4). In contrast, mutation of a WT1/early growth response-1 site, which is present in the murine but not in the human VDR promoter, only slightly reduced the response to WT1 (data not shown). The WT1-responsive site is well conserved between the human and the mouse vitamin D receptor promoter. The element was then formally tested for its ability to bind the WT1 protein by electrophoretic mobility shift assays. The sequence element was specifically bound by wild-type WT1-KTS but not by the mutant WTAR. Mutation of a the binding sequence abrogated binding to WT1-KTS (Fig. 5). These observations suggest that WT1 activates the vdr gene expression at the transcriptional level through a WRE-related sequence element.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3.   A, WT1-KTS activates the VDR promoter in NIH 3T3 cells. Cotransfection of 5 µg of WT1 expression construct with 1 µg the 0.8-kb VDR promoter reporter plasmids. Luciferase activity units were normalized to 100% of the basal activity. Data are derived from five independent experiments. B, dosage-dependent activation of the vitamin D receptor promoter construct by WT1. Indicated amounts of WT1-17AA-KTS expression plasmid were mixed with pCDNA3 to a final amount of 20 µg and were cotransfected with 1 µg of 0.5-kb VDR promoter construct and 1 µg of plasmid-encoding Renilla luciferase. The level of WT1 protein reflected the level of transfected WT1 expression plasmid. This experiment was repeated with similar results.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Schematic representation of the vitamin D receptor promoter with potential transcription factor binding sites and the deduced reporter constructs with their induction by WT1.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 5.   Electrophoretic mobility shift assay demonstrating specific binding by WT1 of the element similar to WRE (19) in the context of the human (h; left) and murine (m; right) vitamin D receptor promoter. Alteration of the binding sequence (see "Experimental Procedures") abrogates binding of WT1 to this element. mut, mutant.

HT29 Cells Expressing WT1 Exhibit Increased Response to 1,25-Dihydroxyvitamin D3-- Because HT29 colon carcinoma cells have been described to be responsive to 1,25-dihydroxyvitamin D3 (13, 20), we used these cells as a model for the influence of WT1 on the response to 1,25-dihydroxyvtamin D3. Different HT29 clones expressing high levels of WT1 and HT29 control cells transfected with an empty construct were stimulated with 10 nM 1,25-dihydroxyvitamin D3 for 7 days. Consistent with previous reports (13), HT29 cells transfected with the control vector displayed low growth cessation after treatment with 1,25-dihydroxyvitamin D3. In contrast, HT29 cells expressing WT1 exhibited a marked stronger response to 1,25-dihydroxyvitamin D3; after 7 days, the cell count in WT1-expressing HT29 cells was ~30% compared with control vector-transfected HT29 cells after induction with 1,25-dihydroxyvitamin D3 (Fig. 6A). At this time, HT29 control cells showed flat morphology and tight adhesion to the surface of the culture dish, whereas WT1-expressing HT29 cells stimulated with 1,25-dihydroxyvitamin D3 grew less clustered and detached from the surface of the culture dish (Fig. 6B). The striking growth inhibition in WT1-expressing cells reflects the enhanced VDR levels in WT1-expressing HT29 clones and suggests a major change in the molecular response to 1,25-dihydroxyvitamin D3 dependent on WT1 expression.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6.   A, HT29 control cells and HT29-expressing WT1 cells were grown for 7 days in the presence of 10 nM 1,25 dihydroxyvitamin D3 or the vehicle ethanol. The cell count after 2, 4, and 7 days of treatment with 10 nM 1,25 dihydroxyvitamin D3 was assayed by counting viable cells by trypan blue exclusion. After 7 days, the cell count of wt1-expressing HT29 cells is less than 30% compared with untreated cells, whereas the growth of control cells is only slightly reduced after 7 days of culture with 10 nM 1,25 dihydroxyvitamin D3. Repeated experiments with different clones generated similar results. B, HT29 cells expressing WT1 display marked growth inhibition in the presence of 10 nM 1,25 dihydroxyvitamin D3. Cells were photographed with a camera attached to a Zeiss IM microscope.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

An influence of WT1 expression on the response to 1,25-dihydroxyvitamin D3 in hematopoietic cells was demonstrated by the inhibition of granulocytic differentiation mediated by 1,25-dihydroxyvitamin D3 because of expression of WT1 (21). In initial experiments, we analyzed the expression of WT1 and the receptor gene for 1,25-dihydroxyvitamin D3, VDR, by investigating the expression pattern of both genes using an array spotted with cDNA from different normal and tumor tissues. We detected WT1 expression predominantly in cDNA spots derived from normal adult kidney tissue. The VDR expression pattern resembled the pattern of WT1, raising the possibility of a regulatory link between WT1 and VDR expression in normal renal tissues (data not shown). Recent investigations identified Sp1 as being responsible for baseline expression of the murine vitamin D receptor (15). However, induction of the VDR by Sp1 cannot fully explain the specific pattern of VDR expression in different tissues like kidney or promyelocytes.

A number of putative WT1 target genes, with promoters being regulated in transient cotransfection experiments by WT1, could not be proved to be true targets (22). For this reason, besides investigating the regulation of a vdr promoter reporter constructs by WT1, we focused our investigations on the regulation of the endogenous vdr gene expression by transfecting two different cell lines with a wt1 expression construct and subsequent selecting for WT1 protein expression. Consistent with an induction of the vdr promoter reporter construct by the -KTS isoforms in the transient transfection assays, the endogenous VDR expression in HT29 and HEK293 cells expressing WT1 was significantly elevated.

In HT29 clones expressing WT1, the induction of VDR mRNA expression was comparable with the induction of the expression of p21 mRNA. The p21 cell cycle inhibitor gene has previously been shown to be induced by WT1 (18, 19). After generating single clones transfected with the WT1 constructs, we obtained comparably few HT29 clones stably expressing detectable WT1 protein. This suggests a selection against high levels of WT1, possibly because of induction of p21 or other growth-suppressing WT1 target genes. In addition, we observed a slight growth reduction of HT29 cells expressing WT1 compared with control cells during cell culture (Fig. 6A).

In our hands, HT29 colon carcinoma cells, but not HEK293 cells, were responsive to 1,25-dihydroxyvitamin D3. After induction with 1,25-dihydroxyvitamin D3, HT29 cells have been shown to exhibit elevated alkaline phosphatase activity as a marker of differentiation, which is accompanied by growth arrest and followed by a slow induction of apoptosis (20). In our experiments with HT29 clones expressing WT1, this response was markedly enhanced demonstrating that WT1 expression results in a different phenotype regarding the response to 1,25-dihydroxyvitamin D3.

WT1 interferes with gene expression at the transcriptional and the postranscriptional levels (23), the latter being mediated predominantly by the +KTS isoforms (24). For this reason, regulation of the VDR expression by WT1 at the transcriptional level was proved by transient cotransfection assays with different murine VDR promoter reporter constructs. This led to the identification of a sequence element in the mouse VDR promoter being responsible for induction of the VDR expression by WT1. This sequence element is well conserved in the human VDR promoter (25). It is highly similar to the WRE in the amphiregulin promoter (19). This element has recently been shown to be bound by WT1-KTS with much higher affinity than the WT1/early growth response-1 target site defined earlier (26). Consistently, WT1 recognition elements in the human and murine vitamin D receptor promoters were specifically bound by WT1 in mobility shift assays.

Our data showing that WT1 induces the cellular receptor for 1,25-dihydroxyvitamin D3 provide a new molecular mechanism by which WT1 may be involved in cellular differentiation. To date, 1,25-dihydroxyvitamin D3 is known to induce differentiation of a number of leukemic and solid tumor cell lines, but a physiological role of 1,25-dihydroxyvitamin D3 in cellular differentiation is poorly understood (1, 2). The data presented here raise the possibility that the response to 1,25-dihydroxyvitamin D3 is modulated by the Wilms' tumor gene product (WT1), which is predominantly expressed in renal and immature hematopoietic cells. In hematopoietic cells, however, we and others have found that WT1 antagonizes the induction of differentiation by 1,25-dihydroxyvitamin D3 (4, 21). The discrepancy of the data presented here could be explained by a cell type-specific suppression or activation, respectively, of the VDR gene expression by WT1. Cell type-specific regulation of bcl-2 has been shown recently (25), supporting this hypothesis. Deletions at the 11p13 locus in Wilms' tumors pointed to a tumor suppressor function of WT1. This is underscored by the findings that WT1 suppresses expression of the epidermal growth factor receptor (egfr; see Ref. 27) and the insulin-like growth factor receptor (igf-r; see Ref. 28) genes and induces the cell cycle inhibitor p21 (18) and the Rb-associated protein RbAp46 (29). Our finding of an induction of the VDR by WT1 rises the possibility that loss of WT1 may have an influence on the response to 1,25-dihydroxyvitamin D3 with possible implications for neoplasia, suggesting a novel pathway for an antioncogenic function of WT1 in at least some tumor tissues.


    ACKNOWLEDGEMENTS

We acknowledge the excellent technical assistance of Irmgard Sigg, Tanja Trosch, Gabriele Linder, and Nathalie Decker. We thank Dr. Mathias Schmid and Michael Morgan for critical reading of the manuscript and Dr. Tunca Karakas for helpful discussions. We thank Dr. Frank J. Rauscher for providing the wt1 expression constructs. 1,25-Dihydroxyvitamin D3 was kindly provided by Dr. Rita Locher, Hofmann-LaRoche, Basel, Switzerland.


    FOOTNOTES

* This work was supported by Deutsche Krebshilfe Grant 10-1290-Be 3 (to U. M. and L. B.) and Grant 10-1286-En 1 (to C. E.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Inst. for Allergy and Immunology, 10355 Science Center Dr., San Diego, CA 92121. E-mail: maureruli@gmx.de.

Published, JBC Papers in Press, October 24, 2000, DOI 10.1074/jbc.M005292200


    ABBREVIATIONS

The abbreviations used are: VDR, vitamin D receptor; HEK, human embryonic kidney; DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium salts; kb, kilobase; WRE, WT1 recognition element.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Jones, G., Strugnell, S. A., and DeLuca, H. F. (1998) Physiol. Rev. 78, 1193-1231
2. Christakos, S., Raval-Pandya, M., Wernyj, R. P., and Yang, W. (1996) Biochem. J. 316, 361-371
3. Hmama, Z., Nandan, D., Sly, L., Knutson, K. L., Herrera-Velit, P., and Reiner, N. E. (1999) J. Exp. Med. 190, 1583-1594
4. Maurer, U., Weidmann, E., Krapohl, A., Schneider, B., Karakas, T., and Bergmann, L. (1999) Proc. Am. Assoc. Cancer Res. 40, 736
5. Call, K. M., Glaser, T., Ito, C. Y., Buckler, A. J., Pelletier, J., Haber, D. A., Rose, E. A., Kral, A., Yeger, H., Lewis, W. H., Jones, C., and Housman, D. E. (1990) Cell 60, 509-520
6. Madden, S. L., Cook, D. M., Morris, J. F., Gashler, A., Sukhatme, V. P., and Rauscher, F. J. (1991) Science 253, 1550-1553
7. Haber, D. A., Sohn, R. L., Buckler, A. J., Pelletier, J., Call, K. M., and Housman, D. E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9618-9622
8. Pritchard-Jones, K., Fleming, S., Davidson, D., Bickmore, W., Porteous, D., Gosden, C., Bard, J., Buckler, A., Pelletier, J., Housman, D. E., van Heiningen, V., and Hastie, N. (1990) Nature 346, 194-197
9. Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D., and Jaenisch, R. (1993) Cell 74, 679-691
10. Maurer, U., Weidmann, E., Karakas, T., Hoelzer, D., and Bergmann, L. (1997) Blood 90, 4230-4231
11. Maurer, U., Brieger, J., Weidmann, E., Mitrou, P. S., Hoelzer, D., and Bergmann, L. (1997) Exp. Hematol. 25, 945-950
12. Bergmann, L., Miething, C., Maurer, U., Brieger, J., Karakas, T., Weidmann, E., and Hoelzer, D. (1997) Blood 90, 1217-1225
13. Shabahang, M., Buras, R. R., Davoodi, F., Schumaker, L. M., Nauta, R. J., Uskokovic, M. R., Brenner, R. V., and Evans, S. R. (1994) Cancer Res. 54, 4057-4064
14. Jehan, F., and DeLuca, H. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10138-10143
15. Jehan, F., and DeLuca, H. F. (2000) Arch. Biochem. Biophys. 377, 273-283
16. Haber, D. A., Buckler, A. J., Glaser, T., Call, K. M., Pelletier, J., Sohn, R. L., Douglass, E. C., and Housman, D. E. (1990) Cell 61, 1257-1269
17. Elser, B., Kriz, W., Bonventre, J. V., Englert, C., and Witzgall, R. (1997) J. Biol. Chem. 272, 27908-27912
18. Englert, C., Maheswaran, S., Garvin, A. J., Kreidberg, J., and Haber, D. A. (1997) Cancer Res. 57, 1429-1434
19. Lee, S. B., Huang, K., Palmer, R., Truong, V. B., Herzlinger, D., Kolquist, K. A., Wong, J., Paulding, C., Yoon, S. K., Gerald, W., Oliner, J. D., and Haber, D. A. (1999) Cell 98, 663-673
20. Diaz, G. D., Paraskeva, C., Thomas, M. G., Binderup, L., and Hague, A. (2000) Cancer Res. 60, 2304-2312
21. Svedberg, H., Chylicki, K., Baldetorp, B., Rauscher, F. J., III, and Gullberg, U. (1998) Oncogene 16, 925-932
22. Thate, C., Englert, C., and Gessler, M. (1998) Oncogene 11, 1287-1294
23. Caricasole, A., Duarte, A., Larsson, S. H., Hastie, N. D., Little, M., Holmes, G., Todorov, I., and Ward, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7562-7566
24. Larsson, S. H., Charlieu, J. P., Miyagawa, K., Engelkamp, D., Rassoulzadegan, M., Ross, A., Cuzin, F., van Heyningen, V., and Hastie, N. D. (1995) Cell 81, 391-401
25. Miyamoto, K. I., Kesterson, R. A., Yamamoto, H., Taketani, Y., Nishiwaki, E., Tatsumi, S., Inoue, Y., Morita, K., Takeda, E., and Pike, J. W. (1997) Mol. Endocrinol. 11, 1165-1179
26. Mayo, M. W., Wang, C. Y., Drouin, S. S., Madrid, L. V., Marshall, A. F., Reed, J. C., Weissman, B. E., and Baldwin, A. S. (1999) EMBO J. 18, 3990-4003
27. Englert, C., Hou, X., Maheswaran, S., Bennett, P., Ngwu, C., Re, G. G., Garvin, A. J., Rosner, M. R., and Haber, D. A. (1995) EMBO J. 14, 4662-4675
28. Werner, H., Shen-Orr, Z., Rauscher, F. J., III, Morris, J. F., Roberts, C. T., Jr., and LeRoith, D. (1995) Mol. Cell. Biol. 15, 3516-3522
29. Guan, L. S., Rauchman, M., and Wang, Z. Y. (1998) J. Biol. Chem. 273, 27047-27050


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. Seoane, I. Ben, V. Centeno, and R. Perez-Fernandez
Cellular Expression Levels of the Vitamin D Receptor Are Critical to Its Transcriptional Regulation by the Pituitary Transcription Factor Pit-1
Mol. Endocrinol., July 1, 2007; 21(7): 1513 - 1525.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Maruyama, F. Aoki, M. Toyota, Y. Sasaki, H. Akashi, H. Mita, H. Suzuki, K. Akino, M. Ohe-Toyota, Y. Maruyama, et al.
Comparative Genome Analysis Identifies the Vitamin D Receptor Gene as a Direct Target of p53-Mediated Transcriptional Activation.
Cancer Res., May 1, 2006; 66(9): 4574 - 4583.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. Wagner, K.-D. Wagner, H. Theres, C. Englert, A. Schedl, and H. Scholz
Coronary vessel development requires activation of the TrkB neurotrophin receptor by the Wilms' tumor transcription factor Wt1
Genes & Dev., November 1, 2005; 19(21): 2631 - 2642.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhang, P. Li, J. Bao, S. V. Nicosia, H. Wang, S. A. Enkemann, and W. Bai
Suppression of Death Receptor-mediated Apoptosis by 1,25-Dihydroxyvitamin D3 Revealed by Microarray Analysis
J. Biol. Chem., October 21, 2005; 280(42): 35458 - 35468.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
T. H. LEE and J. PELLETIER
Functional characterization of WT1 binding sites within the human vitamin D receptor gene promoter
Physiol Genomics, December 21, 2001; 7(2): 187 - 200.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
D. L. Lazarova, M. Bordonaro, and A. C. Sartorelli
Transcriptional Regulation of the Vitamin D3 Receptor Gene by ZEB
Cell Growth Differ., June 1, 2001; 12(6): 319 - 326.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/6/3727    most recent
M005292200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maurer, U.
Right arrow Articles by Bergmann, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maurer, U.
Right arrow Articles by Bergmann, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.