![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 6, 3727-3732, February 9, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
From the Department of Internal Medicine III, University of Ulm,
89081 Ulm, Germany, § Department of Biochemistry,
College of Agricultural and Life Sciences, University of
Wisconsin-Madison, Madison, WI 53706, ¶ Forschungszentrum
Karlsruhe, Institut für Genetik, 76021 Karlsruhe, Germany, and
Department of Internal Medicine III, Johann Wolfgang Goethe
University, 60590 Frankfurt, Germany
Received for publication, June 19, 2000, and in revised form, October 23, 2000
| |
ABSTRACT |
|---|
|
|
|---|
The Wilms' tumor gene (wt1)
encodes a transcription factor involved in urogenital development, in
particular in renal differentiation, and in hematopoietic
differentiation. Differentiation of a number of solid tumor and
leukemic cells lines can be mediated by 1,25-dihydroxyvitamin D3. This is predominantly mediated by the nuclear receptor
for 1,25-dihydroxyvitamin D3, the vitamin D receptor (VDR).
In initial experiments addressing a possible link between WT1 and VDR,
we observed a correlated expression of WT1 and VDR mRNA in samples from renal tissues. HT29 colon carcinoma cells, stably transfected to
express WT1, exhibited elevated endogenous VDR levels compared with
control cells transfected with a control construct. Elevated VDR
expression was found in wt1-transfected human embryonic
kidney 293 cells, as well. In transient cotransfection experiments, we observed an activation of a vdr promoter reporter by WT1
through a WT1 recognition element, indicating transcriptional
regulation of the vdr gene expression by WT1. The
responsive sequence element was specifically bound by wild-type, but
not by mutated WT1, in electrophoretic mobility shift assays. HT29
colon carcinoma cells, which respond to 1,25-dihydroxyvitamin
D3 with slow induction of growth arrest, were investigated
for the influence of WT1 on 1,25-dihydroxyvitamin
D3-mediated growth suppression. Although HT29 cells
transfected with a control construct responded moderately to
1,25-dihydroxyvitamin D3, the response of HT29 cells
expressing WT1 was strikingly enhanced. Stimulation with
dihydroxyvitamin D3 caused an up to 3-fold reduction in the
growth rate of different HT29 clones expressing WT1 as compared with
control cells lacking WT1 expression. Thus, induction of VDR by WT1
leads to an enhanced response to 1,25-dihydroxyvitamin D3.
We conclude that the vitamin D receptor gene is a target for
transcriptional activation by WT1, suggesting a possible physiological
role of this regulatory pathway.
In addition to its function as a regulator of calcium homeostasis,
1,25-dihydroxyvitamin D3 has been demonstrated to be a potent inducer of differentiation in leukemic cells lines and cells
derived from solid tumors (reviewed in Refs. 1 and 2). Physiologically,
1,25-dihydroxyvitamin D3 directly binds to its cellular
receptor, the vitamin D receptor
(VDR),1 resulting in
transcription factor activity of the VDR. The VDR molecule dimerizes
with the retinoic X receptor and activates target genes via
interaction with vitamin D response elements in vitamin D-responsive
promoters (1, 2). Additionally, vitamin D response element-independent
functions of 1,25-dihydroxyvitamin D3, referred to as
"nongenomic signaling," have been described, as well (3).
Our own previous experiments addressing the effects of
1,25-dihydroxyvitamin D3 in leukemic cells pointed to an
influence of Wilms' tumor gene (wt1) expression on the
induction of differentiation by 1,25-dihydroxyvitamin D3
(4). The Wilms' tumor gene (wt1) was isolated by deletion
analysis and positional cloning in Wilms' tumor and WAGR
(Wilms' tumor, aniridia,
urogenital malformation, mental retardation)
patients, leading to its definition as a tumor suppressor gene (5). The
gene product contains a C-terminal zinc finger motif and a
proline-glutamine-rich domain at the N terminus, similar to the
early growth response-1 transcription factor (6). WT1 is
expressed as four alternative isoforms containing or lacking a 17-amino
acid stretch (termed 17AA) encoded by an alternatively spliced exon 5 and an insertion of three amino acids between zinc fingers 3 and 4, encoded by alternative splice II, termed KTS (7).
Expression of WT1 has been demonstrated in the kidney, the genital
ridge, fetal gonads, spleen, and mesothelium (5, 8, 9). The absence of
kidneys and gonads in wt1 knockout mice indicates the
crucial role of wt1 for urogenital development (9). During
hematopoietic differentiation, the Wilms' tumor gene is transiently
expressed, as well (10, 11). In contrast to its proposed role as a
tumor suppressor, WT1 is expressed in the majority of acute leukemias
(12), suggesting that the anti-oncogenic function of WT1 is dependent
on the cellular context.
In initial experiments, we probed a multiple-tissue cDNA blot with
probes for WT1 and VDR, observing a correlated expression pattern of
VDR and WT1 mRNA. This led us investigate a possible regulation of
the expression of the VDR by WT1. In this work, we demonstrate that WT1
activates the VDR promoter in vitro. We show that that
engineered expression of WT1 by HT29 colon carcinoma cells, which
respond moderately to 1,25-dihydroxyvitamin D3 (13), causes
enhanced VDR levels and an enhanced response to 1,25-dihydroxyvitamin D3. Induction of the VDR by WT1 is confirmed in human
embryonic kidney (HEK) 293 cells from renal origin, suggesting that
the VDR gene represents a downstream target of WT1.
Cell Culture and Transfections--
HEK293 and HT29 cells were
grown in Dulbecco's modified Eagle's medium supplemented with 10%
fetal bovine serum. For transfection, 1 × 106 cells
were seeded in a 10-cm dish, and after 24 h, they were transfected
with 20 µg of expression plasmid using DOTAP transfection reagent
(Roche Diagnostics, Mannheim, Germany). To generate stable transfectants, cells were selected for stable vector insertion with 500 µg/ml G418 (Life Technologies, Inc.). Clones derived from
single cells were generated by limiting dilution and were analyzed for
WT1 protein expression by Western blotting.
1,25-Dihydroxyvitamin D3 was prepared as a 1000×
stock solution (10 µM) in ethanol.
RNase Protection Assay--
Antisense probes for VDR and WT1
mRNA were generated by polymerase chain reaction amplification of
the appropriate cDNA sequences (VDR 5', CCCAGCTCTCCATGC; VDR 3',
TGACGCGGTACTTGTAGT; WT1 5', ACGCGCCCTACCTGCCCAG; and WT1 3',
TTCTCACTGGTCTCAGATGC; MWG Biotech, Ebersberg, Germany). The VDR
amplicon (224 base pairs) was cloned in antisense orientation in pCR
3.1 (Invitrogen). The wt1 amplicon was digested with
BamHI, and the resulting 154-base pair fragment was cloned
into pCDNA 3 (Invitrogen) after digestion with
BamHI/EcoRV. GAPDH and L32 probes (Pharmingen,
San Diego, CA) were included for normalization. A multiple probe for
cell cycle genes including p21 was also purchased from the
manufacturer. In vitro transcription and ribonuclease
protection assay was performed with a kit (Pharmingen, San Diego, CA)
according to the manufacturers' instructions analyzing 20 µg of
total RNA isolated with Trizol reagent (Life Technologies, Inc.).
Protected RNA-RNA hybrids were separated on a 6% sequencing gel and
subsequently exposed to Biomax x-ray film (Eastman Kodak, Co.,
Rochester, NY) or to a PhosphorImager system (Molecular Dynamics).
Western Blotting--
Protein lysate was dissolved in Laemmli
buffer (500 mM Tris-HCl, 100 mM dithiothreitol,
2% SDS, 0.1% bromphenol blue, 10% glycerol, pH 6.8), heated to
95 °C, and subjected to a 10% polyacrylamide gel electrophoresis.
After blotting to a polyvinylidene difluoride membrane (Millipore,
Bedford, MA) and blocking with skim milk (Fluka, Steinheim, Germany),
the membrane was incubated with anti-WT1 C19, anti-WT1 180, or anti-VDR
C-20 (all from Santa Cruz Biotechnologies) antibodies diluted 1:1000.
Detection was performed by incubation with a horseradish
peroxidase-conjugated anti-rabbit antibody (dilution 1: 5000),
and the ECL system (both from Amersham Pharmacia Biotech). For
further analysis, blots were stripped with 0.2 M glycine, pH 2.5, at 56 °C for 30 min.
Transient Transfection Experiments--
Different murine vitamin
D receptor promoter fragments were subcloned in to a pGL2basic vector
upstream of the firefly luciferase reporter gene as described elsewhere
(14, 15). A mutant lacking the WT1 recognition element
(WRE)-related sequence was generated by digestion of the 0.5-kb
construct with RsrII and SmaI, followed by
treatment with T4 polymerase and religation. The expression constructs
used were WT1+17AA-KTS, WT1+17AA+KTS (wt1B and wt1D, kindly
provided by F. J. Rauscher, III, Wistar Institute, Philadelphia, PA), and WTAR, encoding a truncated protein (16). The
wt1 coding region was subcloned into pCDNA3
(Invitrogen). NIH 3T3 cells were grown in Dulbecco's modified Eagle's
medium supplemented with 10% fetal bovine serum. For transfection,
0.5 × 105 cells were seeded in a 10-cm dish and were
transfected with 5 µg of expression plasmid, together with 1 µg of
reporter construct using DOTAP transfection reagent (Roche Diagnostics,
Mannheim, Germany) after 24 h. Transfection efficiency was
determined by cotransfection of 1 µg of a renilla luciferase plasmid
(pRLTK; Promega, Heidelberg, Germany). After 48 h, 20 µl of
lysate were transferred to a luminescent reaction, and both firefly
luciferase and renilla luciferase light activity were determined
according to the manufacturers' protocol (Promega, Heidelberg,
Germany) with a Lumat 9510 (Berthold, Bad Weinsberg, Germany).
Electrophoretic Mobility Shift Experiments--
Electrophoretic
mobility shift assay experiments were essentially done as described
before (17). 20 ng of protein were incubated with 3000 cpm of
radiolabeled double-stranded oligonucleotide. The oligos were as
follows: hVDRWRE sense, AGGACTGGACCTGTGGGCGGGGCGGAG; hVDRWRE
antisense, CTCCGCCCCGCCCACAGGTCCAGTCCT; mutated hVDRWRE sense, AGGACTGGACCTGCGTTCGGGGCGGAG;
mutated hVDRWRE antisense, CTCCGCCCCGAACACAGGTCCAGTCCT; mVDRWRE sense,
AGGACTGAACTTAGTGGGCGTGGTTGAG; mVDRWRE antisense,
CTCAACCACGCCCACTAAGTTCAGTCCT; mutated mVDRWRE sense,
AGGACTGAACTTAGTGTTCGTGGTTGAG; and mutated
mVDRWRE antisense, CTCAACCACGAACACTAAGTTCAGTCCT
(altered nucleotides are shown in bold and italics).
WT1 Induces Endogenous VDR Expression in HT29 Colon Carcinoma and
in Human Embryonic Kidney 293 Cells--
To investigate the effect of
WT1 on the endogenous expression of VDR, HT29 cells expressing moderate
endogenous levels of VDR were stably transfected with expression
plasmids encoding the
To compare the extent of VDR up-regulation with a previously
characterized WT1 target gene, the induction of p21 (18) was investigated in HT29 cells expressing WT1 and control cells. p21 mRNA was induced significantly, although to a somewhat lesser extent than VDR mRNA, in WT1-expressing HT29 cells (Fig.
1C).
To investigate induction of VDR by the Wilms' tumor gene product in
renal cells, human embryonic kidney 293 cells were transfected with a
WT1 expression construct, and induction of VDR was assayed by
immunoblotting. VDR protein was strongly elevated in HEK293 cells
overexpressing WT1, suggesting that WT1 up-regulates VDR expression in
the context of renal cells (Fig. 2).
WT1 Directly Activates the VDR Promoter--
To address the
question whether WT1 regulates the VDR expression at the
transcriptional level, transient cotransfection experiments were
performed. A 0.8-kb fragment of the mouse vdr gene promoter fused to a sequence coding for the firefly luciferase was cotransfected with HT29 Cells Expressing WT1 Exhibit Increased Response to
1,25-Dihydroxyvitamin D3--
Because HT29 colon carcinoma
cells have been described to be responsive to 1,25-dihydroxyvitamin
D3 (13, 20), we used these cells as a model for the
influence of WT1 on the response to 1,25-dihydroxyvtamin
D3. Different HT29 clones expressing high levels of WT1 and
HT29 control cells transfected with an empty construct were
stimulated with 10 nM 1,25-dihydroxyvitamin D3 for 7 days. Consistent with previous reports (13), HT29 cells transfected with the control vector displayed low growth cessation after treatment with 1,25-dihydroxyvitamin D3. In
contrast, HT29 cells expressing WT1 exhibited a marked stronger
response to 1,25-dihydroxyvitamin D3; after 7 days, the
cell count in WT1-expressing HT29 cells was ~30% compared with
control vector-transfected HT29 cells after induction with
1,25-dihydroxyvitamin D3 (Fig.
6A). At this time, HT29
control cells showed flat morphology and tight adhesion to the surface
of the culture dish, whereas WT1-expressing HT29 cells stimulated with
1,25-dihydroxyvitamin D3 grew less clustered and detached
from the surface of the culture dish (Fig. 6B). The striking growth inhibition in WT1-expressing cells reflects the enhanced VDR
levels in WT1-expressing HT29 clones and suggests a major change in the
molecular response to 1,25-dihydroxyvitamin D3 dependent on
WT1 expression.
An influence of WT1 expression on the response to
1,25-dihydroxyvitamin D3 in hematopoietic cells was
demonstrated by the inhibition of granulocytic differentiation mediated
by 1,25-dihydroxyvitamin D3 because of expression of WT1
(21). In initial experiments, we analyzed the expression of WT1 and the
receptor gene for 1,25-dihydroxyvitamin D3, VDR, by
investigating the expression pattern of both genes using an array
spotted with cDNA from different normal and tumor tissues. We
detected WT1 expression predominantly in cDNA spots derived from
normal adult kidney tissue. The VDR expression pattern resembled the
pattern of WT1, raising the possibility of a regulatory link between
WT1 and VDR expression in normal renal tissues (data not shown). Recent
investigations identified Sp1 as being responsible for baseline
expression of the murine vitamin D receptor (15). However, induction of
the VDR by Sp1 cannot fully explain the specific pattern of VDR
expression in different tissues like kidney or promyelocytes.
A number of putative WT1 target genes, with promoters being regulated
in transient cotransfection experiments by WT1, could not be proved to
be true targets (22). For this reason, besides investigating the
regulation of a vdr promoter reporter constructs by WT1, we
focused our investigations on the regulation of the endogenous
vdr gene expression by transfecting two different cell lines
with a wt1 expression construct and subsequent selecting for
WT1 protein expression. Consistent with an induction of the vdr promoter reporter construct by the In HT29 clones expressing WT1, the induction of VDR mRNA expression
was comparable with the induction of the expression of p21 mRNA.
The p21 cell cycle inhibitor gene has previously been shown
to be induced by WT1 (18, 19). After generating single clones
transfected with the WT1 constructs, we obtained comparably few HT29
clones stably expressing detectable WT1 protein. This suggests a
selection against high levels of WT1, possibly because of induction of
p21 or other growth-suppressing WT1 target genes. In addition, we
observed a slight growth reduction of HT29 cells expressing WT1
compared with control cells during cell culture (Fig.
6A).
In our hands, HT29 colon carcinoma cells, but not HEK293 cells, were
responsive to 1,25-dihydroxyvitamin D3. After induction with 1,25-dihydroxyvitamin D3, HT29 cells have been shown
to exhibit elevated alkaline phosphatase activity as a marker of
differentiation, which is accompanied by growth arrest and followed by
a slow induction of apoptosis (20). In our experiments with HT29 clones
expressing WT1, this response was markedly enhanced demonstrating that
WT1 expression results in a different phenotype regarding the response to 1,25-dihydroxyvitamin D3.
WT1 interferes with gene expression at the transcriptional and the
postranscriptional levels (23), the latter being mediated predominantly
by the +KTS isoforms (24). For this reason, regulation of the VDR
expression by WT1 at the transcriptional level was proved by transient
cotransfection assays with different murine VDR promoter reporter
constructs. This led to the identification of a sequence element in the
mouse VDR promoter being responsible for induction of the VDR
expression by WT1. This sequence element is well conserved in the human
VDR promoter (25). It is highly similar to the WRE in the amphiregulin
promoter (19). This element has recently been shown to be bound by
WT1-KTS with much higher affinity than the WT1/early growth response-1
target site defined earlier (26). Consistently, WT1 recognition
elements in the human and murine vitamin D receptor promoters were
specifically bound by WT1 in mobility shift assays.
Our data showing that WT1 induces the cellular receptor for
1,25-dihydroxyvitamin D3 provide a new molecular mechanism
by which WT1 may be involved in cellular differentiation. To date, 1,25-dihydroxyvitamin D3 is known to induce differentiation
of a number of leukemic and solid tumor cell lines, but a physiological role of 1,25-dihydroxyvitamin D3 in cellular
differentiation is poorly understood (1, 2). The data presented here
raise the possibility that the response to 1,25-dihydroxyvitamin
D3 is modulated by the Wilms' tumor gene product (WT1),
which is predominantly expressed in renal and immature hematopoietic
cells. In hematopoietic cells, however, we and others have found that WT1 antagonizes the induction of differentiation by
1,25-dihydroxyvitamin D3 (4, 21). The discrepancy of the
data presented here could be explained by a cell type-specific
suppression or activation, respectively, of the VDR gene expression by
WT1. Cell type-specific regulation of bcl-2 has been shown recently
(25), supporting this hypothesis. Deletions at the 11p13 locus in
Wilms' tumors pointed to a tumor suppressor function of WT1. This is
underscored by the findings that WT1 suppresses expression of the
epidermal growth factor receptor (egfr; see Ref. 27) and the
insulin-like growth factor receptor (igf-r; see Ref. 28)
genes and induces the cell cycle inhibitor p21 (18) and the
Rb-associated protein RbAp46 (29). Our finding of an induction of the
VDR by WT1 rises the possibility that loss of WT1 may have an influence
on the response to 1,25-dihydroxyvitamin D3 with possible
implications for neoplasia, suggesting a novel pathway for an
antioncogenic function of WT1 in at least some tumor tissues.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
17AA-KTS isoform of WT1. Expression of WT1
mRNA was detected in different selected HT29 clones by RNase
protection assay and Northern blotting (data not shown), and the
protein expression was detected by Western blotting. A significant
induction of VDR mRNA was observed in different, independently
generated HT29 cell clones expressing WT1, compared with HT29 cells
transfected with the empty vector (Fig.
1A). In accordance with the
induction of VDR mRNA, we observed elevated VDR protein levels in
WT1-expressing HT29 cells (Fig. 1B). Detection of elevated
levels of VDR in different HT29 clones expressing WT1 suggested that
this was not an effect of clonal selection. In control experiments,
mRNA expression of the dimerization partner of VDR, the retinoic X
receptor-
was not elevated in clones expressing WT1 (data not
shown).

View larger version (45K):
[in a new window]
Fig. 1.
A, expression of WT1 and VDR mRNA by
wt1-transfected HT29 clones and control cells. Probes
protecting the mRNA coding for the L32 and GAPDH housekeeping gene
were included. Control cells transfected with the empty vector and two
clones with the highest expression of wt1 as assayed by
previous analyses were tested in duplicate. Lane 1,
undigested probes; lanes 2 and 3, HT29-neo;
lanes 4 and 5, HT29-WT1A3; lanes 6 and
7, HT29-WT1A5. Lane 7 shows yeast tRNA put in the
hybridization to control complete cleavage of the unprotected probe. Note that comparably low signal intensity of
WT1 mRNA is due to the low activity of the probe in this
experiment. B, protein expression of WT1 and VDR by control
cells (HT29-neo) and transfectants (HT29WT1-A3
and HT29WT1-A5). WT1 protein expression was detected with
the antibody wt1-180 after electrophoresis in a 10% SDS
polyacrylamide gel (100 µg per lane). Induction of VDR
protein in WT1-expressing HT29 cells corresponding to the induction of
VDR mRNA detected with the VDR C-20 antibody after resolving 100 µg of protein per lane in a 10% SDS polyacrylamide gel.
C, induction of p21 mRNA expression by WT1 in HT29
transfectants. Lane 1, undigested probes; lane 2,
control hybridization with HeLa mRNA; lanes 3 and
4, HT29-neo; lanes 5 and 6,
HT29-WT1A3; lanes 7 and 8, HT29-WT1A5; lane
9, yeast tRNA; lane 10, undigested probes.

View larger version (62K):
[in a new window]
Fig. 2.
Induction of VDR by WT1 in HEK293 kidney
cells. Expression of WT1 protein in 293 cells transfected with a
wt1 expression construct was detected by the C-19 antibody
after 10% SDS polyacrylamide gel electrophoresis of 50 µg of total
protein. Lane 1, control cells; lanes 2 and
3, wt1-transfected HEK293 cells. The
blot was stripped, and VDR protein expression was detected
by the anti-VDR C-20 antibody.
KTS and +KTS isoforms of WT1 and a mutant (WTAR) lacking the
third zinc finger (16). The VDR promoter fragment was induced 4-fold by
the
KTS-isoform but not by the +KTS isoform of WT1. In contrast,
cotransfection of the mutant WTAR slightly repressed the VDR promoter
construct (Fig. 3A). The
response to WT1 appeared to be in a dose-dependent manner
(Fig. 3B). To narrow the sequence element responsive for
WT1, the promoter construct was shortened from distal of the
transcriptional start site (see Fig. 4).
A 0.5-kb promoter fragment responded, as well, to WT1. A 0.2-kb fragment, located proximal to the transcription start site, was induced
to the same extent, suggesting that the WT1-responsive element was
located in this fragment of the VDR promoter. This fragment contains
four GC-rich clusters, with putative Sp1 binding sites (15). The most
distal GC element, 5'-TGTGGGCG-3', is very similar to the sequence of
the recently defined WRE high affinity binding sequence,
5'-CGTGGG(A/T)G-3' (19). A deletion construct lacking this site
exhibited no response to WT1 anymore (Fig. 4). In contrast, mutation of
a WT1/early growth response-1 site, which is present in the murine but
not in the human VDR promoter, only slightly reduced the response to
WT1 (data not shown). The WT1-responsive site is well conserved between
the human and the mouse vitamin D receptor promoter. The element was
then formally tested for its ability to bind the WT1 protein by
electrophoretic mobility shift assays. The sequence element was
specifically bound by wild-type WT1-KTS but not by the mutant WTAR.
Mutation of a the binding sequence abrogated binding to WT1-KTS (Fig.
5). These observations suggest that WT1
activates the vdr gene expression at the transcriptional level through a WRE-related sequence element.

View larger version (50K):
[in a new window]
Fig. 3.
A, WT1-KTS activates the VDR promoter in
NIH 3T3 cells. Cotransfection of 5 µg of WT1 expression construct
with 1 µg the 0.8-kb VDR promoter reporter plasmids. Luciferase
activity units were normalized to 100% of the basal activity. Data are
derived from five independent experiments. B,
dosage-dependent activation of the vitamin D receptor
promoter construct by WT1. Indicated amounts of WT1-17AA-KTS
expression plasmid were mixed with pCDNA3 to a final amount of 20 µg and were cotransfected with 1 µg of 0.5-kb VDR promoter
construct and 1 µg of plasmid-encoding Renilla luciferase. The level
of WT1 protein reflected the level of transfected WT1 expression
plasmid. This experiment was repeated with similar results.

View larger version (17K):
[in a new window]
Fig. 4.
Schematic representation of the vitamin D
receptor promoter with potential transcription factor binding sites and
the deduced reporter constructs with their induction by WT1.

View larger version (64K):
[in a new window]
Fig. 5.
Electrophoretic mobility shift assay
demonstrating specific binding by WT1 of the element similar to WRE
(19) in the context of the human (h;
left) and murine (m;
right) vitamin D receptor promoter. Alteration of
the binding sequence (see "Experimental Procedures") abrogates
binding of WT1 to this element. mut, mutant.

View larger version (41K):
[in a new window]
Fig. 6.
A, HT29 control cells and
HT29-expressing WT1 cells were grown for 7 days in the presence of 10 nM 1,25 dihydroxyvitamin D3 or the vehicle
ethanol. The cell count after 2, 4, and 7 days of treatment with 10 nM 1,25 dihydroxyvitamin D3 was assayed by
counting viable cells by trypan blue exclusion. After 7 days, the cell
count of wt1-expressing HT29 cells is less than 30%
compared with untreated cells, whereas the growth of control cells is
only slightly reduced after 7 days of culture with 10 nM
1,25 dihydroxyvitamin D3. Repeated experiments with
different clones generated similar results. B, HT29 cells
expressing WT1 display marked growth inhibition in the presence of 10 nM 1,25 dihydroxyvitamin D3. Cells
were photographed with a camera attached to a Zeiss IM
microscope.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
KTS isoforms in the
transient transfection assays, the endogenous VDR expression in HT29
and HEK293 cells expressing WT1 was significantly elevated.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge the excellent technical assistance of Irmgard Sigg, Tanja Trosch, Gabriele Linder, and Nathalie Decker. We thank Dr. Mathias Schmid and Michael Morgan for critical reading of the manuscript and Dr. Tunca Karakas for helpful discussions. We thank Dr. Frank J. Rauscher for providing the wt1 expression constructs. 1,25-Dihydroxyvitamin D3 was kindly provided by Dr. Rita Locher, Hofmann-LaRoche, Basel, Switzerland.
| |
FOOTNOTES |
|---|
* This work was supported by Deutsche Krebshilfe Grant 10-1290-Be 3 (to U. M. and L. B.) and Grant 10-1286-En 1 (to C. E.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Inst. for Allergy and
Immunology, 10355 Science Center Dr., San Diego, CA 92121. E-mail:
maureruli@gmx.de.
Published, JBC Papers in Press, October 24, 2000, DOI 10.1074/jbc.M005292200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: VDR, vitamin D receptor; HEK, human embryonic kidney; DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium salts; kb, kilobase; WRE, WT1 recognition element.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Jones, G., Strugnell, S. A., and DeLuca, H. F. (1998) Physiol. Rev. 78, 1193-1231 |
| 2. | Christakos, S., Raval-Pandya, M., Wernyj, R. P., and Yang, W. (1996) Biochem. J. 316, 361-371 |
| 3. | Hmama, Z., Nandan, D., Sly, L., Knutson, K. L., Herrera-Velit, P., and Reiner, N. E. (1999) J. Exp. Med. 190, 1583-1594 |
| 4. | Maurer, U., Weidmann, E., Krapohl, A., Schneider, B., Karakas, T., and Bergmann, L. (1999) Proc. Am. Assoc. Cancer Res. 40, 736 |
| 5. | Call, K. M., Glaser, T., Ito, C. Y., Buckler, A. J., Pelletier, J., Haber, D. A., Rose, E. A., Kral, A., Yeger, H., Lewis, W. H., Jones, C., and Housman, D. E. (1990) Cell 60, 509-520 |
| 6. | Madden, S. L., Cook, D. M., Morris, J. F., Gashler, A., Sukhatme, V. P., and Rauscher, F. J. (1991) Science 253, 1550-1553 |
| 7. | Haber, D. A., Sohn, R. L., Buckler, A. J., Pelletier, J., Call, K. M., and Housman, D. E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9618-9622 |
| 8. | Pritchard-Jones, K., Fleming, S., Davidson, D., Bickmore, W., Porteous, D., Gosden, C., Bard, J., Buckler, A., Pelletier, J., Housman, D. E., van Heiningen, V., and Hastie, N. (1990) Nature 346, 194-197 |
| 9. | Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D., and Jaenisch, R. (1993) Cell 74, 679-691 |
| 10. | Maurer, U., Weidmann, E., Karakas, T., Hoelzer, D., and Bergmann, L. (1997) Blood 90, 4230-4231 |
| 11. | Maurer, U., Brieger, J., Weidmann, E., Mitrou, P. S., Hoelzer, D., and Bergmann, L. (1997) Exp. Hematol. 25, 945-950 |
| 12. | Bergmann, L., Miething, C., Maurer, U., Brieger, J., Karakas, T., Weidmann, E., and Hoelzer, D. (1997) Blood 90, 1217-1225 |
| 13. | Shabahang, M., Buras, R. R., Davoodi, F., Schumaker, L. M., Nauta, R. J., Uskokovic, M. R., Brenner, R. V., and Evans, S. R. (1994) Cancer Res. 54, 4057-4064 |
| 14. | Jehan, F., and DeLuca, H. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10138-10143 |
| 15. | Jehan, F., and DeLuca, H. F. (2000) Arch. Biochem. Biophys. 377, 273-283 |
| 16. | Haber, D. A., Buckler, A. J., Glaser, T., Call, K. M., Pelletier, J., Sohn, R. L., Douglass, E. C., and Housman, D. E. (1990) Cell 61, 1257-1269 |
| 17. | Elser, B., Kriz, W., Bonventre, J. V., Englert, C., and Witzgall, R. (1997) J. Biol. Chem. 272, 27908-27912 |
| 18. | Englert, C., Maheswaran, S., Garvin, A. J., Kreidberg, J., and Haber, D. A. (1997) Cancer Res. 57, 1429-1434 |
| 19. | Lee, S. B., Huang, K., Palmer, R., Truong, V. B., Herzlinger, D., Kolquist, K. A., Wong, J., Paulding, C., Yoon, S. K., Gerald, W., Oliner, J. D., and Haber, D. A. (1999) Cell 98, 663-673 |
| 20. | Diaz, G. D., Paraskeva, C., Thomas, M. G., Binderup, L., and Hague, A. (2000) Cancer Res. 60, 2304-2312 |
| 21. | Svedberg, H., Chylicki, K., Baldetorp, B., Rauscher, F. J., III, and Gullberg, U. (1998) Oncogene 16, 925-932 |
| 22. | Thate, C., Englert, C., and Gessler, M. (1998) Oncogene 11, 1287-1294 |
| 23. | Caricasole, A., Duarte, A., Larsson, S. H., Hastie, N. D., Little, M., Holmes, G., Todorov, I., and Ward, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7562-7566 |
| 24. | Larsson, S. H., Charlieu, J. P., Miyagawa, K., Engelkamp, D., Rassoulzadegan, M., Ross, A., Cuzin, F., van Heyningen, V., and Hastie, N. D. (1995) Cell 81, 391-401 |
| 25. | Miyamoto, K. I., Kesterson, R. A., Yamamoto, H., Taketani, Y., Nishiwaki, E., Tatsumi, S., Inoue, Y., Morita, K., Takeda, E., and Pike, J. W. (1997) Mol. Endocrinol. 11, 1165-1179 |
| 26. | Mayo, M. W., Wang, C. Y., Drouin, S. S., Madrid, L. V., Marshall, A. F., Reed, J. C., Weissman, B. E., and Baldwin, A. S. (1999) EMBO J. 18, 3990-4003 |
| 27. | Englert, C., Hou, X., Maheswaran, S., Bennett, P., Ngwu, C., Re, G. G., Garvin, A. J., Rosner, M. R., and Haber, D. A. (1995) EMBO J. 14, 4662-4675 |
| 28. | Werner, H., Shen-Orr, Z., Rauscher, F. J., III, Morris, J. F., Roberts, C. T., Jr., and LeRoith, D. (1995) Mol. Cell. Biol. 15, 3516-3522 |
| 29. | Guan, L. S., Rauchman, M., and Wang, Z. Y. (1998) J. Biol. Chem. 273, 27047-27050 |
This article has been cited by other articles:
![]() |
S. Seoane, I. Ben, V. Centeno, and R. Perez-Fernandez Cellular Expression Levels of the Vitamin D Receptor Are Critical to Its Transcriptional Regulation by the Pituitary Transcription Factor Pit-1 Mol. Endocrinol., July 1, 2007; 21(7): 1513 - 1525. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Maruyama, F. Aoki, M. Toyota, Y. Sasaki, H. Akashi, H. Mita, H. Suzuki, K. Akino, M. Ohe-Toyota, Y. Maruyama, et al. Comparative Genome Analysis Identifies the Vitamin D Receptor Gene as a Direct Target of p53-Mediated Transcriptional Activation. Cancer Res., May 1, 2006; 66(9): 4574 - 4583. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wagner, K.-D. Wagner, H. Theres, C. Englert, A. Schedl, and H. Scholz Coronary vessel development requires activation of the TrkB neurotrophin receptor by the Wilms' tumor transcription factor Wt1 Genes & Dev., November 1, 2005; 19(21): 2631 - 2642. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, P. Li, J. Bao, S. V. Nicosia, H. Wang, S. A. Enkemann, and W. Bai Suppression of Death Receptor-mediated Apoptosis by 1,25-Dihydroxyvitamin D3 Revealed by Microarray Analysis J. Biol. Chem., October 21, 2005; 280(42): 35458 - 35468. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. LEE and J. PELLETIER Functional characterization of WT1 binding sites within the human vitamin D receptor gene promoter Physiol Genomics, December 21, 2001; 7(2): 187 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Lazarova, M. Bordonaro, and A. C. Sartorelli Transcriptional Regulation of the Vitamin D3 Receptor Gene by ZEB Cell Growth Differ., June 1, 2001; 12(6): 319 - 326. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |