|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 276, Issue 6, 3999-4011, February 9, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, September 7, 2000, and in revised form, November 8, 2000
Voltage-gated calcium channels represent a
heterogenous family of calcium-selective channels that can be
distinguished by their molecular, electrophysiological, and
pharmacological characteristics. We report here the molecular cloning
and functional expression of three members of the low
voltage-activated calcium channel family from rat brain
( Voltage-sensitive calcium channels mediate the rapid,
voltage-dependent entry of calcium into many types of
nerve, muscle, and endocrine cells. In the nervous system, calcium
entry contributes toward the electrical properties of neurons,
modulates calcium-dependent enzymes and ion channels,
controls calcium-dependent gene transcription, and
initiates the release of neurotransmitters and neuromodulators. Electrophysiological analyses have categorized native calcium currents
into two major classes that differ in their voltage activation properties. High voltage-activated
(HVA)1 calcium channels
represent a diverse family of channels that first activate at
relatively depolarized potentials (usually > The initial evidence for the existence of LVA calcium currents was
obtained from neurons of the inferior olivary nucleus by Llinas and
Yarom (4). Subsequently, LVA currents were recorded from cells isolated
directly from the dorsal root ganglia (5-9), pituitary (10, 11), and
cardiac myocytes (12-16). T-type channels are of interest, since they
are responsible for rebound burst firing in central neurons and are
implicated in normal brain functions such as slow wave sleep and in
diseased states such as epilepsy (3, 17). They are also thought to play
a role in hormone secretion (18, 19) and smooth muscle excitability
(20). The biophysical characterization of T-type channels has been
complicated by the presence of multiple types of calcium currents in
neurons and other cells as well as a lack of specific pharmacological tools. In addition, there is considerable heterogeneity in the reported
activation, inactivation, permeation, and pharmacology of neuronal
T-type currents. T-type calcium channels represent the most recent
calcium channel family to be described at the molecular level (21-25),
although there remains little known concerning their biochemical composition.
In the present paper, the molecular and electrophysiological
characteristics of three members of the rat brain T-type calcium channel family ( Molecular Cloning of Rat Brain T-type Channels--
To
identify novel calcium channel subtypes, oligonucleotides were
designed based on structurally conserved elements found in all
cloned mammalian HVA calcium channels (rat brain
The 567-bp human polymerase chain reaction (PCR) fragment was labeled
by random priming and used to screen 750,000 plaque-forming units of a rat brain cDNA library enriched for cDNAs
greater than 4 kb (26). After four rounds of screening, 28 positives
were isolated, and their ends were sequenced. Of these, 19 encoded for
Isolation of Deduction of Intron-Exon Boundaries--
To confirm that the
RNA Isolation and Northern Blot--
Total cellular RNA was
isolated from adult rat tissues; Northern blot analysis was performed
with RNA size markers (Life Technologies), total RNA (30 µg/lane)
from spinal cord, pons/medulla, cerebellum, striatum,
hypothalamus/thalamus, hippocampus, cortex, olfactory bulb, and whole
brain; and separated through a 1.1% agarose gel containing 1.1 M formaldehyde and then transferred to Hybond-N nylon
membrane by capillary blot. Hybridization was performed independently
for each Reverse Transcription and Polymerase Chain Reaction--
To
detect low levels of T-type channel expression, RT-PCR analysis of
T-type channel expression within different brain regions was performed.
The reaction consisted of 1 µg of RNA, 1× RT buffer, 10 mM dNTPs, 5 units of RT (Life Technologies), and 10 pmol of the Transient Transfection and Electrophysiology--
Human
embryonic kidney cells (HEK293; tsa-201) were grown in standard
Dulbecco's modified Eagle's medium, supplemented with 10% fetal
bovine serum and 50 units/ml penicillin streptomycin to 80%
confluence. Cells were maintained at 37 °C in a humidified atmosphere of 95% O2 and 5% CO2, and every
2-3 days they were enzymatically dissociated with trypsin-EDTA and
plated on 35-mm Petri dishes 12 h prior to transfection. A
standard calcium phosphate procedure was used to transiently transfect
cells. Rat
Functional expression in transfected cells was evaluated 24-48 h after
transfection using the whole-cell patch clamp technique (28). The
external recording solution contained (unless otherwise noted) 2 mM CaCl2, 1 mM MgCl2,
10 mM HEPES, 40 mM TEA-Cl, 92 mM CsCl, 10 mM glucose, pH 7.2. The internal pipette solution
contained 105 mM CsCl, 25 mM TEA-Cl, 1 mM CaCl2, 11 mM EGTA, 10 mM HEPES, pH 7.2. Whole-cell currents were recorded using
an Axopatch 200B or 200A amplifier (Axon Instruments, Foster City CA),
controlled and monitored with a PC running pCLAMP software version 6.03 (Axon Instruments). Patch pipettes (Sutter borosilicate glass
BF150-86-10) were pulled using a Sutter P-87 puller and fire-polished
using a Narishige microforge, and they showed a resistance of 2.5-4 megaohms when filled with internal solution. Series resistance had
typical values of 7-10 megaohms and was electronically compensated by
at least 60%. Whole-cell currents never exceeded 2 nA, limiting errors
in voltage to a few mV. Only cells exhibiting adequate voltage control
(judged by smoothly rising current-voltage (I-V) relationship and monoexponential decay of capacitive currents) were
included in the analysis. The bath was connected to ground via a 3 M KCl agar bridge. Gigaohm seals were formed directly in
the external control solution, and all recordings were performed at
room temperature (20-24 °C). Data were low pass-filtered at 2 kHz
using the built-in Bessel filter of the amplifier, and in most cases,
subtraction of capacitance and leakage current was carried out on-line
using the P/4 protocol. Recordings were analyzed using Clampfit 6.03 (Axon Instruments), and figures and fittings utilized the software
program Microcal Origin (version 3.78).
Data Analysis and Modeling--
Calcium current activation
curves were constructed by converting the peak current values from the
I-V relationships to conductance using the equation
gCa = Ipeak/(Vc
The electrophysiological properties of the Screening of an expressed sequence tag data bank with the C. elegans C54D2.5 open reading frame described several unidentified human expressed sequence tag sequences (H55225, H55617, H55223, and
H55544), which were then used to design synthetic oligonucleotides and
amplify a 567-bp While the Sequence analysis of additional
Molecular and Functional Characterization of a Family of Rat
Brain T-type Calcium Channels*
§,§,,,
,
Biotechnology Laboratory, University of
British Columbia, Vancouver, British Columbia V6T 1Z3, Canada,
¶ NeuroMed Technologies Inc., Vancouver, British Columbia V6T 1Z4,
Canada, the Department of Molecular Biology and Biochemistry,
Simon Fraser University, Burnaby, British Columbia V5A 1S6, Canada, and
** University-College of the Fraser Valley,
Abbotsford, British Columbia V2S 7M8, Canada
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1G, 1H, and 1I).
Northern blot and reverse transcriptase-polymerase chain reaction
analyses show 1G, 1H, and
1I to be expressed throughout the newborn and juvenile
rat brain. In contrast, while 1G and 1H
mRNA are expressed in all regions in adult rat brain,
1I mRNA expression is restricted to the striatum.
Expression of 1G, 1H, and
1I subunits in HEK293 cells resulted in calcium currents
with typical T-type channel characteristics: low voltage activation,
negative steady-state inactivation, strongly
voltage-dependent activation and inactivation, and slow
deactivation. In addition, the direct electrophysiological comparison
of 1G, 1H, and 1I under
identical recording conditions also identified unique characteristics
including activation and inactivation kinetics and permeability to
divalent cations. Simulation of 1G, 1H,
and 1I T-type channels in a thalamic neuron model cell
produced unique firing patterns (burst versus tonic)
typical of different brain nuclei and suggests that the three channel types make distinct contributions to neuronal physiology.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
40 mV) and that
display distinct pharmacological characteristics (L-type, N-type,
P/Q-type, and R-type; Refs. 1 and 2). In contrast to activation
for HVA calcium channels, low voltage-activated (LVA or T-type) calcium
channels first activate with relatively small depolarizations (between
80 and 60 mV) and have a poorly defined pharmacology. In addition
to their distinct low voltage dependence of activation, T-type calcium
channels also exhibit unique voltage-dependent kinetics,
small single channel conductance, rapid inactivation, slow
deactivation, and a relatively higher permeability to Ca2+
compared with Ba2+ (3).
1G, 1H, and
1I) are reported. This is the first report defining the
molecular and biophysical properties of three distinct T-type calcium
channels isolated from the same tissue and species.
Electrophysiological recordings describe 1G,
1H, and 1I currents with many
distinguishing characteristics typical of T-type currents present in
native cells, although they each also possess distinct kinetics,
inactivation profiles, and divalent ion permeabilities. We also find
evidence for the generation of multiple 1I variants by
alternative splicing and for the unique developmental and spatial
expression of 1G, 1H, and
1I T-type calcium channels in the rat CNS.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1A,
GTCAAAACTCAGGCCTTCTA and AACGTGTTCTTGGCTATCGCGGTG; rat brain
1B, GTGAAAGCACAGAGCTTCTACTGG and
AACGTTTTCTTGGCCATTGCTGTG; rat brain 1C,
GTTAAATCCAACGTCTTCTACTGG and AATGTGTTCTTGGCCATTGCGGTG; rat brain
1D, GTGAAGTCTGTCACGTTTTACTGG and
AAGCTCTTCTTGGCCATTGCTGTA; rat brain 1E,
GTCAAGTCGGCAAGTGTTCTTA and AATGTATTCTTGGCTATCGC). The
oligonucleotide sequences were subsequently utilized to "screen"
the entire Caenorhabditis elegans genome data base (ACeDB)
and resulted in the identification of five potential
voltage-dependent ion channels in C. elegans
(cosmids and reading frames: C11D2.6, C27F2.3, C54D2.5, C48A7.1, and
T02C5.5). Three of the C. elegans genes (C54D2.5, C48A7.1,
and T02C5.5) were determined to represent homologues of rat and human
calcium channels expressed in nerve, muscle, and cardiovascular
tissues, while the other two genes (C11D2.6 and C27F2.3) represent
novel four domain-type ion channels. The T02C5.5 open reading frame encodes the unc-2 gene, which is a calcium channel
1 subunit homologous to the mammalian 1A,
1B, and 1E subtypes, while C48A7.1
encodes egl-19, a nematode calcium channel 1
subunit homologous to the mammalian 1C,
1D, 1F, and 1S L-type
channels. Mammalian homologues of the C. elegans C54D2.5
reading frame were identified by "screening" the
GenBankTM expressed sequence tag data bank with C54D2.5.
Four of the resulting human expressed sequence tags (H55225, H55617,
H55223, and H55544) were judged to encode novel calcium channel-like proteins. Utilizing these sequences, synthetic oligonucleotide primers
were generated and used to amplify human brain total RNA and identified
a 567-bp fragment corresponding to a portion of human brain
1I.
1G, four for 1H, and five for the
1I subunit. The full-length rat brain 1G,
1H, and 1I clones were assembled in
pBluescript SK from overlapping cDNAs. Both strands of the
full-length clones were sequenced using a modified dideoxynucleotide
protocol and Sequenase version 2.1 (U.S. Biochemical Corp.) and then
subcloned into the vertebrate expression vector pCDNA-3 (Invitrogen).
1I Splice Variants--
Isoforms of
the 1I subunit were identified by DNA sequence analysis
of multiple rat brain 1I cDNA clones. To confirm
that the clones represented bona fide expressed transcripts,
reverse transcriptase and PCR (RT-PCR) was performed with total rat
brain RNA. The reactions consisted of 1 µg of RNA, 1× RT buffer, 10 mM dNTPs, 5 units of RT (Life Technologies, Inc.), and 10 pmol of the 3'-oligonucleotide at 42 °C for 90 min. The 50-µl PCR
was composed of 1 µl of rat brain cDNA/RNA, 1× PCR buffer, 1.25 mM dNTPs, 2 units of Taq polymerase, and
20 pmol of each oligonucleotide (variant 1, 5'-ACTCTGGAAGGCTGGGTGGAG-3'
and 5'-GAGAACGAGGCACAAGTTGATC-3'; variant 2, 5'-ATGGGTACTGCCCCCCGCCTCTCA-3' and 5'-CAAGGATCGCTGATCATAGCTC-3'; and
variant 3, 5'-ATCCGTATCATGCGTGTTCTGCG-3' and
5-CCACTGGCAGAGCTGTACACTG-3'). The reactions were preheated for 15 min at 95 °C followed by 35 cycles of 30 s at 95 °C, 20 s at 55 °C, and 1 min at 72 °C. The fidelity of all three
variants and the wild type 1I cDNA was confirmed by
sequencing of both strands.
1I isoforms represented alternatively spliced variants
of the 1I gene, PCR was used to amplify portions of rat
genomic DNA flanking the regions of interest. Oligonucleotides on
either side of the putative introns were synthesized for use in the PCR
to determine splice variants (as above). The 50-µl PCR was composed
of 1 ng of rat genomic DNA, 1× PCR buffer, 1.25 mM dNTPs,
2 units of Taq polymerase, and 20 pmol of each
oligonucleotide. The reactions were placed into a preheated PCR block
for 15 min at 95 °C followed by 35 cycles (30 s at 95 °C, 20 s at 55 °C, 1 min at 72 °C). The PCR products were separated by
electrophoresis through a 1.5% agarose gel, blotted to a nylon
membrane, and then probed with a 
-32P-radiolabeled
intron-specific oligonucleotide probe to identify the genomic band of
interest. Fragments hybridizing to the probes were cut out and cloned
into pGem-T Easy (Promega), and their DNA sequence was determined.
1 subunit, and the radiolabeled probe was
allowed to decay between probe hybridization. Northern blot hybridization conditions utilized 5× SSPE, 0.3% SDS, 10 µg/µl tRNA, 30 µg/µl salmon sperm blocking DNA, and a random-primed cDNA probe that corresponds to nucleotides 2523-3397 of the
1I clone, 3568-4426 of the 1G clone, or
3391-4231 of the 1H cDNA clone.
1G oligonucleotide (5'-CAGGAGACGAAACCTTGA-3')
1H oligonucleotide (5'-GGAGACGCGTAGCCTGTT-3'), or
1I oligonucleotide (5'-CAGGATCCGGAACTTGTT-3') at
42 °C for 90 min. From this reaction, 5 µl was removed and added
to a 50-µl PCR composed of 1× PCR buffer, 1.25 mM dNTPs, 2 units of Taq, 20 pmol of the 3'-oligonucleotide, and 20 pmol of the 5'-oligonucleotide
(1G-5'-TCAGAGCCTGATTTCTTT-3',
1H-5'-GACGAGGATAAGACGTCT-3', or
1I-5'-GATGAGGACCAGAGCTCA-3'). The reactions were placed
into a preheated PCR block for 35 cycles (1 min at 95 °C, 45 s
at 55 °C, 45 s at 72 °C). The PCR products were separated by
electrophoresis through a 1.5% agarose gel, blotted to a nylon
membrane, and then probed with a -32P-radiolabeled
oligonucleotide probe specific for each of the three channels. As a
positive control, 1 µg of RNA from each brain region was amplified by
35 cycles (1 min at 95 °C, 30 s at 55 °C, 30 s at
72 °C) with -tubulin oligonucleotides
(5'-CAGGTGTCCACGGCTGTGGTG-3' and 5'-AGGGCTCCATCGAAACGCAG-3').
1G (3 µg), rat 1H (3 µg),
and rat 1I (3 µg) calcium channel subunits were
cotransfected with CD8 (2 µg) marker plasmid, and 15 µg pBluescript SK carrier DNA for a total of 20 µg of cDNA. Transiently
transfected cells were selected for expression of CD8 by adherence of
Dynabeads as described previously (27).
ECa), where Ipeak is the peak calcium current, Vc the command pulse
potential, and ECa the apparent calcium reversal
potential obtained by linear extrapolation of the current values in the
ascending portion of the I-V curve. Conductance values were
then normalized and fitted to standard Boltzman relations:
g/gmax = (1 + (exp(V V0.5a)/ka)) 1, where g is the peak conductance,
gmax is the maximal peak calcium conductance,
V0.5a is the midpoint of the activation curve, and ka is the activation slope factor.
Steady-state inactivation curves were obtained by evoking calcium
currents with a test depolarization to 30 mV applied at the end of
15-s prepulses from 120 to 50 mV. The steady-state inactivation
curves were constructed by plotting the normalized current during the test pulse as a function of the conditioning potential. The data were
fitted with a Boltzman equation:
I/Imax = (1 + exp((V V0.5i/ki)) 1, where I is the peak current, Imax
is the peak current when the conditioning pulse was 120 mV,
V and V0.5i are the conditioning potential and the half-inactivation potential,
respectively, and ki is the inactivation slope factor.
1G,
1H, and 1I channels were modeled using
modified Hodgkin-Huxley equations for T-type calcium channels produced
by Huguenard and McCormick (29). The values for
voltage-dependent activation and inactivation, as well as
the time constants for activation, inactivation, and deactivation were
obtained from whole-cell recordings of 1G, 1H, or 1I using 2 mM calcium
as the charge carrier. These values were substituted for the data
obtained from recordings of T-type calcium currents of juvenile rat
thalamic relay neurons (29). Simulated current clamp recordings of
thalamic relay neurons were generated using the C-Clamp software
program based on the major currents of these cells (30) and
substitution of 1G, 1H, or 1I for the native T-type currents.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1I subunit fragment from human brain
total RNA (see Ref. 21 for an alternative strategy). Utilizing the
human 567-bp fragment as a probe, full-length rat brain cDNAs
homologous to C54D2.5 were isolated from a rat brain cDNA library
and shown by sequence analysis to encode three different members of the
T-type calcium channel family (1G, 1H,
and 1I) (Fig. 1). Similar
to HVA calcium channels and sodium channels, all three putative rat
brain T-type channel subunits possess four structural domains linked by
intracellular loops, a conserved pore region (P-loop), and voltage
sensors (S4 segments) in each of the four domains. In contrast to the
HVA calcium channel subunits, which all possess a conserved glutamate
within their P-loops, the T-type channels have aspartate residues
substituted in domain III and IV P-loops. Additional differences from
HVA channels include no apparent 
-subunit binding site in the domain
I-II linker (31) and no EF hand region (32) or calmodulin binding site
(33, 34) in the carboxyl tail.
View larger version (171K):
[in a new window]
Fig. 1.
Primary structure of the rat brain
1G,
1H, and
1I T-type calcium channels.
Transmembrane regions (S1-S6) and pore regions (P-loop) are
boxed, while dashes represent gaps introduced to
align the three full-length cDNA sequences.
1G and 1H subunits encode
proteins of 2254 and 2359 amino acids (aa), respectively, the
1I subunit encodes for a significantly shorter protein
of 1826 aa, which is mostly due to a shorter domain I-II linker (199 aa
for 1I versus 345 and 368 aa for
1G and 1H, respectively) and a shorter
carboxyl tail region (77 aa for 1I versus 433 and 493 aa for 1G and 1H, respectively). The overall conservation of aa sequence is highest between the 1G and 1H subunits (56% identity), with
the 1I protein having 53% identity to 1H
and 49% identity to IG. Most of the sequence conservation is found in the membrane-spanning regions with
substantially less identity in the carboxyl tail and putative intra-
and extracellular loops.
1I cDNAs showed that
at least four 1I variants are expressed in rat brain.
Compared with the "wild type" 1I-a isoform, the
predicted primary sequence of the 1I-b variant is
missing three residues (FIY) in domain I S6, the 1I-c
variant has a six-aa deletion in the domain II-III linker, and the
1I-d variant contains a 13-aa insertion in the putative
cytoplasmic linker between domain IV S4 and S5 (Fig. 2A). Since variations in
cDNA sequence may be due to RT artifacts, it is important to
confirm that putative variants are in fact encoded in the genome. Along
this line, rat genomic DNA was examined in the regions flanking the
putative splice junctions of the 1I variants. Fig.
2B shows that the 1I-b, 1I-c,
and 1I-d variants all result from the apparent use of
alternative 5' splice junction sites. In the case of
1I-d, the alternative 5' junction matches the 5' GT
splice consensus site, while in 1I-b and
1I-c the 5' sites are nontypical TT and GA intronic
junctions. RT-PCR of adult rat brain RNA confirmed that all four
1I variants are expressed in the rat CNS (data not
shown).
View larger version (30K):
[in a new window]
Fig. 2.
Alternatively spliced isoforms of the
1I T-type channel. A,
schematic structure of the T-type 1 subunit and primary
structure comparing differences between wild type 1I-a
subunit and three other 1I variants isolated by cDNA
cloning from rat brain. B, comparison of cDNA and rat
genomic DNA sequence of the 1I-a, 1I-b,
1I-c, and 1I-d isoforms.
Regional expression of the 1G, 1H, and
1I subunits was carried out by Northern blot using the
unique domain II-III linkers of each channel as a probe and total RNA
isolated from different brain regions of adult rats. The
1G probe (Fig.
3A) hybridized to a single
band at ~ 10 kb in all brain regions, while the
1H probe hybridized (Fig. 3B) to a single
band at ~8.5 kb in all brain regions. In contrast, the
1I probe hybridized to an ~11-kb mRNA found only
in the adult striatum (Fig. 3C). No 1I
mRNA signal was detected in total RNA isolated from the different
brain regions upon exposure of the autoradiogram for a further 7 days
at 80 °C with intensifying screens.
|
The selective expression of 1I mRNA in the adult
striatum is in contrast to the widespread distribution of
1I expression previously reported (23). In an attempt to
detect lesser amounts of mRNA than that possible with Northern
blots, RT-PCR was performed on the same brain RNA samples. Fig.
4A shows that the RT-PCR
results confirm the Northern blot results, with 1I
mRNA being detected specifically in the adult striatum and
1G and 1H expressed ubiquitously throughout the adult rat brain. Fig. 4B shows RT-PCR to
compare 1I transcripts using total RNA isolated from
6-week-old and adult rat brain. Within the juvenile rat brain
1I is expressed in all brain regions, while again
1I is selectively expressed in the striatum in adult
brain. Taken together, these results suggest the differential
expression of 1I calcium channels during CNS development.
|
Functional Characteristics of 1G, 1H,
and 1I Calcium Currents--
Transient expression in
HEK cells showed that consistent with low voltage-activated channels
the mean current-voltage relationships of the 1I,
1G, and 1H channels all activate at
negative potentials (Fig. 5a).
All recordings were carried out using 2 mM calcium as a
charge carrier and resulted from the expression of individual 1 subunits alone. Currents were evoked from a holding
potential of 110 mV to voltages from 90 to 0 mV for
1H and 1I and from 80 to 0 mV for
1G. Typically, the threshold for current activation under these ionic conditions was between 80 and 60 mV with peak amplitudes occurring between 45 and 35 mV. Fig. 5, b-d,
illustrates representative current traces of the three T-type calcium
channels obtained during 150-ms test pulses from 90 to 0 mV. All of
the channels show substantial inactivation during the test pulse, although 1I shows much slower activation and
inactivation kinetics than 1G and 1H.
Upon coexpression with the 1b and 2
subunits associated with the HVA calcium channels, we did not observe
any functional effects on current-voltage relations, steady-state inactivation, or channel kinetics (data not shown).
|
Kinetics of Activation and Inactivation--
To further examine
the voltage dependence of the kinetic parameters, records from each
channel subtype were obtained at different potentials, and both the
activation time constant (
act) and the inactivation time
constant (inact) were measured. To quantify macroscopic
activation and inactivation rates, we fitted single-exponential functions to the activating and inactivating segments of individual test currents. Superimposing current traces revealed distinct activation and inactivation kinetics of the three channel types (Fig.
6a). The 1I
T-type calcium channel activated and inactivated more slowly than the
other two channels, while 1G possessed the fastest
activation and inactivation kinetics.
|
Typical of native T-type calcium currents (3), each of the cloned rat
brain channels showed marked voltage-dependent kinetics as
both act and inact decreased markedly at
more positive potentials (Fig. 6, b-g). The
act for 1G decayed 76.1% from 45 to
10 mV (n = 13), while in the same range of voltage
for 1H and 1I the decreases in
act were 77.6% (n = 9) and 52.0%
(n = 4), respectively. The decrease in
inac for 1G was 51.7% (n = 4) and 31% for 1I (n = 5) in the
range of 55 to 25 mV. The 1H channel had a larger decrease of 59% from 50 to 25 mV (n = 9). Both
act and inac decayed monotonically with
voltage toward a voltage-independent minimum. This suggests that
voltage-independent transitions must exist in the pathway from the
closed to the open state and from the activated to the inactivated
states in these calcium channels (35, 36). It is possible that the
inactivation process is voltage-independent and kinetically coupled to
the activation process as has been suggested by Serrano et
al. (37).
Voltage Dependence of Activation and Steady-state
Inactivation--
A more detailed analysis of the
voltage-dependent parameters revealed distinct differences
between the three rat brain T-type calcium channels. Activation curves
for each channel are plotted in Fig. 5a and show that
1I activation occurs between 80 and 40 mV, with a
V0.5a of 60.7 mV and
ka = 8.39 (n = 6); 1G
between 70 and 30 mV with V0.5a = 51.73 and ka = 6.53 (n = 5); and
1H between 55 and 25 mV with
V0.5a = 43.15 and
ka = 5.34 (n = 9).
As shown in Fig. 7b,
inactivation occurs in the range of 105 to 75 mV, 100 to 70 mV,
and 80 to 65 mV for 1I, 1G, and 1H, respectively. The
V0.5i and ki values
were 93.2 mV and 4.7 (n = 6), 85.4 mV and 5.4 (n = 5), and 73.9 mV and 2.76 (n = 4)
for 1I, 1G, and 1H,
respectively. The activation and steady-state inactivation curves are
similar to those of the native T-type calcium currents present in a
variety of excitable and nonexcitable cells (3, 5-20).
|
To examine window currents, the activation and inactivation curves were plotted for each channel (Fig. 7, c-e). The results suggest that although channel open probability is likely to be low, incomplete inactivation and the high driving force for calcium may permit a significant and continuous influx of calcium into the cells within the voltage range of the window current. It is also noticeable that the window currents occur at a negative range of voltages for the three T-type calcium channels close to the value of the resting potential of many cell types.
Deactivation Kinetics--
One distinguishing feature of native
T-type channels is their slow rate of deactivation after removal of
membrane depolarization. The time constant of the decay is ~10 times
slower for LVA channels (2-12 ms) (3, 10) than for HVA channels
(<300 µs) (38, 39). The rate of deactivation, which reflects the
rate of channel closing, was measured as the rate of decay of the tail
currents at different repolarizing potentials. Tail currents of
1I, 1G, and 1H were fitted
with single exponentials, whose time constants of decay
(deac) decreased at more negative repolarization
potentials (Fig. 8a). At 120
mV, the values for deac were 1.63 ± 0.1 (n = 3), 1.15 ± 0.073 (n = 6),
and 0.61 ± 0.82 (n = 4) for 1G,
1I, and 1H, respectively. Fig. 8,
b-d, shows the tail currents obtained during different
repolarizing pulses from 120 to 40 mV applied after a test pulse of
40 mV for 1G and 1I and 30 mV for
1H. The kinetics of the tail currents for all three
T-type channels were faster at more negative repolarizing potentials,
indicating a strong voltage dependence of the deactivation process. The
slow rate of deactivation would allow a significant calcium influx after short action potentials (40), enabling neurons to control their
excitability by regulating the activation of
calcium-dependent potassium channels responsible for the
after potentials hyperpolarizing.
|
Barium Versus Calcium Permeability--
Typically, native T-type
calcium channels have been characterized by their distinct permeability
to divalent ions. In most instances, T-type channels are either equally
permeable or more permeable to calcium than barium, usually indicated
by a smaller whole-cell current when barium is used a charge carrier
(8, 41-43). In HEK cells transfected with 1G (Fig.
9), substitution of 2 mM
calcium with 2 mM barium resulted in a significant decrease in the current amplitude and a small shift of the I-V curve
in the hyperpolarized direction (V0.5 = 45 mV
in 2 mM Ba, V0.5 = 52.4 in 2 mM calcium, n = 3). Cells transfected with
1I showed equivalent amplitude currents when 2 mM calcium was replaced by 2 mM barium, without
a significant shift in the I-V curve (n = 8). Most interestingly, rat 1H had significantly larger
currents in 2 mM barium than in 2 mM calcium
(n = 7). At all potentials explored, there were no
major changes in the kinetics of 1G, 1H,
and 1I currents using the different charge carriers
(data not shown).
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
This study is the first both to describe the molecular cloning and
functional expression of three T-type calcium channel 1 subunits (1G, 1H and 1I)
from the same species and tissue and to compare their biophysical
properties in 2 mM calcium saline. We find significant
molecular and functional differences between the channel types that may
help both in understanding the diversity of native T-type channels and
in elucidating their physiological roles. The major novel insights
include 1) that at least four alternatively spliced variants of the
1I T-type calcium channel are expressed in the CNS, 2)
that, compared with the 1G and 1H T-type
channels, 1I exhibits a distinct developmental and
spatial expression profile, 3) that in identical external 2 mM calcium saline the 1G and
1I T-type channels exhibit voltage-dependent properties that are significantly different from those previously reported, and 4) that modeling of the 1G,
1H, and 1I channels in thalamic relay
neurons indicates that the three T-type channels probably contribute to
distinct oscillatory and bursting behaviors.
Northern blot and RT-PCR experiments examining juvenile brain regions
showed that the 1G, 1H, and
1I T-type calcium channels were expressed ubiquitously
in the spinal cord, cerebellum, pons/medulla, striatum,
hypothalamus/thalamus, hippocampus, cortex, and olfactory bulb (Figs. 3
and 4B). It has been suggested that T-type calcium channels
have a role in tissue development, and reports for vascular smooth
muscle suggest that T-type channels are expressed only during the
G1-S phase of the cell cycle (for a review, see Ref. 3).
The widespread expression of the three different T-type channels in the
juvenile rat brain suggests possible roles in cell division,
growth, and proliferation of the nervous system.
In the adult nervous system, while 1G and
1H were expressed in all brain regions examined,
1I transcripts were selectively expressed in the
striatum. Our results for 1G and 1H are
essentially in agreement with those reported by Talley et
al. (23), who showed high to moderate 1G and
1H expression in the olfactory bulb, hippocampus,
striatum, cortex, thalamus and hypothalamus, and, to a lesser extent,
in the sensory ganglia. However, in contrast to our studies, Talley
et al. (23) reported the widespread expression of the
1I T-type channel in many adult rat brain regions.
Furthermore, while Perez-Reyes et al. (21) reported that
1G hybridizes to two mRNAs of ~8.5 and 9.7 kb in
rat brain, we find that 1G only hybridizes to a single
~10-kb mRNA. Interestingly, the 8.5-kb 1G mRNA
reported previously (21) is similar in size to that for
1H and suggests the possibility of probe cross-reaction. Previous electrophysiological studies have shown that a small percentage of adult rat neostriatal neurons have measurable LVA calcium
currents (44, 45). It is likely that 1I constitutes at
least some of the native LVA current in these striatal neurons and that
this channel may be involved in the burst firing typical of type I
globus pallidus neurons (Ref. 46; also see Fig.
10).
|
In comparing the primary structure of the rat brain 1G,
1H, and 1I T-type calcium channels, a
prominent difference is the shorter length of the 1I
calcium channel. As shown in Fig. 1, the shorter 1I
predicted protein is mainly the result of shorter domain I-II linker
and carboxyl tail regions. When aligned with the domain I-II linkers of
1G and 1H, the shorter length is the
result of 1I possessing several large gaps, most
noticeably a gap that omits a histidine repeat found in the
1G and 1H. Another feature of the
1I subunit is the short 77-amino acid carboxyl tail,
which is due to a stop codon (TAA) at positions 5458-5460 of the
1I cDNA sequence and which is likely to be the result of alternative splicing (47). The sequence of the rat 1I carboxyl tail reported here is similar to that
reported by Lee et al. (24) and distinct from the human
1I subunit reported by Monteil et al.
(48).
We find that at least four 1I T-type variants are
expressed in the rat CNS. Transient expression of the
1I-c and 1I-d variants in HEK cells shows
that they result in functional T-type channels (data not shown),
although a detailed analysis of their biophysical properties remains to
be undertaken. Taken together, the data suggest that multiple
variants of T-type channels are expressed in the CNS. Since single aa
substitutions can have dramatic effects on channel properties, it is
likely that sequence differences between 1G,
1H, and 1I channels themselves, as well
as between isoforms resulting from alternative splicing, probably
account for many of the biophysical differences reported for native
T-type calcium channels.
Expression of 1G, 1H, and
1I subunits in HEK tsa201 cells produced calcium
currents with many characteristics of native T-type channels, although
significant differences exist between the three subtypes. For example,
1I channels activate and inactivate at the most negative
potentials, while the 1H subtype displays the most
positive activation and inactivation voltage range. These results
differ from those reported by Klockner et al. (49), who
showed similar inactivation values for 1G,
1H, and 1I channels. The discrepancy
between their and our findings may be explained by the use of different
expression systems (transient transfection versus stable
cell lines), different solution composition, or primary sequence
differences arising from different species (human 1H was
used in the Klockner et al. study and rat 1H
in the present study). Our results also differ from those of Monteil
et al. (48), who showed that the human 1I
activated and inactivated at more positive potentials compared with the
human 1G.
In addition to voltage-dependent differences, channel
kinetics were also distinct for each of the three rat brain T-type
calcium channels; 1G activated and inactivated with the
fastest kinetics, while 1I exhibited the slowest
kinetics. Most native T-type calcium channels exhibit inactivation time
courses with h values in the range of the
1G and 1H inactivation time constants.
However, some native T-type channels with kinetics similar to
1I have been described in thalamus and hippocampus (3).
It has been suggested that 1I might correspond to the
slow T-type channel present in juvenile thalamic reticular neurons (24,
57), although our results indicate significant differences between
1I and the native thalamic slow T-type channel. For
example, 1I exhibits slower inactivation kinetics
(h = 112.8 ms at 20 mV compared with ~80 ms for the
native T-type slow current), more negative activation and inactivation
characteristics, and importantly, also possesses a different divalent
ion permeability profile than the slow T-type current in thalamic
reticular neurons (Ref. 24; see Fig. 9).
Human neuronal 1G and 1I T-type channels
have recently been characterized (48, 50). Comparison of the human and
rat 1G properties shows that they share some
similarities, including activation threshold and inactivation and
deactivation kinetics, although they significantly differ in their
steady-state inactivation profiles (V0.5 = 86
mV for rat versus 75 mV for human). Comparison of the rat
and human 1I channels shows that the human
1I activates and inactivates at more positive potentials
(V0.5 activation = 40.6 mV for human
1I versus 60.7 mV for rat
1I). Additionally, the steady-state inactivation profile
of the rat 1I is significantly more negative
(V0.5 = 93.2 mV) compared with that for the
human 1I (V0.5 = 68.9).
T-type channels typically deactivate ~10 times slower than HVA
calcium channels, including R-type channels (51). In agreement, the
three rat brain T-type channels were found to deactivate slowly with
deac values of 1.63, 1.1, and 0.61 ms for
1G, 1I, and 1H,
respectively. This observation is in agreement with the results reported for 1G and 1I by Klockner
et al. (49). However, in contrast to the human
1H T-type channel, we found that the rat 1H deactivated faster than the other two rat brain
T-type channels. Moreover, we observed only a fast component of the
tail current and not the slow component reported by Williams et
al. (25) for 1H from the human medullary thyroid
carcinoma cell line.
All three rat brain T-type channels display a steady-state inward window current over a negative range of potentials that is close to the resting potentials of many cell types. A continuous influx of calcium at resting potentials through T-type channels may play a significant role in cellular physiology and has been implicated in mediating cell growth and proliferation in response to growth factors in cardiac cells (52), in the secretion of aldosterone in adrenal granulosa cells (18), and in maturation and differentiation of spermatogenic cells (53). Additionally, an increase in the window current of T-type calcium channels has been implicated in the pathophysiology of genetic cardiomyopathy in hamsters (54), in cytokine-induced pancreatic beta cell death (55), and in motor neuronal toxicity in spinobulbar muscular atrophy (56).
Generally T-type calcium channels display divalent ion permeation
characteristics such that peak currents are either similar or smaller
upon replacement of calcium with barium (3, 8, 41-43). In agreement,
in this study we showed that both 1G and 1I peak whole-cell currents were smaller or similar when
barium replaced calcium as the charge carrier. In contrast,
1H displayed larger whole-cell currents in barium than
in calcium. Our findings for 1H differ from those of
Williams et al. (25), who showed that human
1H from a medullary thyroid carcinoma cell line
possesses larger currents when calcium is used as the charge carrier.
Examination of the residues implicated in selectivity (the aspartates
and glutamates in the P-loops) did not suggest any obvious differences in human and rat 1H subunits that could explain their
distinct permeabilities. The only noticeable change between the human
1H and rat 1H P-loops is a serine to
threonine substitution at the beginning of the P-loop of domain IV.
Although similar efficiency of calcium and barium as current carriers
is generally characteristic of the T-type calcium channels, there are
examples of T-type currents in native cells that are more permeable to
barium than to calcium. One example is the T-type current present in
rat thalamic reticular neurons (57). It has been recently reported by
Serrano et al. (58) that conductance differences between
calcium and barium through 1G channels are due to
distinct effects of magnesium on calcium and barium currents. These
authors showed a voltage-dependent block with 1 mM magnesium preferentially affected inward current carried
by barium. However, in the present study 1H, barium and
calcium currents were recorded both in the presence and absence of
external magnesium, and whole-cell peak barium currents were still
larger than calcium currents (data not shown).
In thalamic neurons, the generation of bursting activity appears to be
a major function of the T-type channels, although this type of
electrical behavior differs greatly between neurons in different
thalamic nuclei (3). For example, thalamic reticular neurons display
longer lasting bursting behavior as compared with thalamic relay
neurons (29, 57). To correlate the properties of the three rat brain
T-type calcium channels described in this study with native thalamic
T-type currents, we substituted the electrophysiological properties of
1G, 1H, and 1I for the
properties of the native T-type current in a simulated model of a
juvenile thalamic relay neuron (29, 30).
As shown in Fig. 10, the model thalamic relay neurons have a distinct
rebound spiking profile, which consists of a high frequency burst
followed by lower frequency oscillatory spikes. Substitution of
1G for the native channel in the model causes the
oscillatory firing pattern to decrease in frequency, and the high
frequency bursts are eliminated. An electrophysiological comparison of
1G with the native T-type channel in thalamic relay
neurons (29) indicates many similarities but enough differences to
alter the role in modifying electrical behavior. Interestingly,
1I-substituted model neurons showed distinct high
frequency burst firing typical of many types of thalamic neurons
including juvenile thalamic reticular neurons (3). Also of interest,
the rat 1H T-type channel only produced a single rebound
spike in this model thalamic cell. Taken together, these studies
suggest that the three classes of rat brain T-type channels are likely
to make distinct contributions to cellular electrical properties and
intracellular calcium levels and that they play unique roles in
neuronal physiology and development.
| |
FOOTNOTES |
|---|
* This work was supported by a grant from the Canadian Institutes for Health Research (CIHR) (to T. P. S.); fellowship support from the Human Frontiers Research Program (to C. M. S), from the CIHR (to J. E. M.), and from the Natural Sciences and Engineering Research Council of Canada and Killam Foundation (to K. S. C. H.); and a CIHR Senior Scientist Award (to T. P. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF290212 (1G), AF290213 (1H),
and AF290214 (1I).
§ These authors contributed equally to this work.
To whom correspondence should be addressed: Biotechnology
Laboratory, Rm. 237-6174 University Blvd., University of British Columbia, Vancouver, British Columbia V6T 1Z3, Canada. Tel.:
604-822-6968; Fax: 604-822-6470; E-mail: snutch@zoology.ubc.ca.
Published, JBC Papers in Press, November 9, 2000, DOI 10.1074/jbc.M008215200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HVA, high voltage-activated; aa, amino acid(s); bp, base pair; kb, kilobase(s); HEK, human embryonic kidney; LVA, low voltage-activated; PCR, polymerase chain reaction; RT, reverse transcription; TEA, tetraethylammonium; CNS, central nervous system.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Catterall, W. A. (1995) Annu. Rev. Biochem. 64, 493-531 |
| 2. | Stea, A., Soong, T. W., and Snutch, T. P. (1995) in Handbook of Receptors and Channels: Ligand- and Voltage-gated Ion Channels (North, R. A., ed) , pp. 113-151, CRC Press, Inc., Boca Raton, FL |
| 3. | Huguenard, J. R. (1996) Annu. Rev. Physiol. 58, 329-348 |
| 4. | Llinas, R., and Yarom, Y. (1981) J. Physiol. (Lond.) 315, 549-567 |
| 5. | Carbone, E., and Lux, H. D. (1984) Biophys. J. 46, 413-418 |
| 6. | Carbone, E., and Lux, H. D. (1984) Nature 310, 501-502 |
| 7. | Bossu, J.-L., Feltz, A., and Thomann, J. M. (1985) Pfluegers Arch. 403, 360-368 |
| 8. | Fedulova, S. A., Kostyuk, P. G., and Veselovsky, N. S. (1985) J. Physiol. (Lond.) 359, 431-446 |
| 9. | Nowycky, M. C., Fox, A. P., and Tsien, R. W. (1985) Nature 316, 440-443 |
| 10. | Matteson, D. R, and Armstrong, C. M. (1986) J. Gen. Physiol. 8, 161-182 |
| 11. | Mason, W. T., and Sikdar, S. K. (1989) J. Physiol. (Lond.) 415, 367-391 |
| 12. | Bean, B. P. (1985) J. Gen. Physiol. 86, 1-30 |
| 13. | Nilius, B., Hess, P., Lansman, J. B., and Tsien, R. W. (1985) Nature 316, 443-446 |
| 14. | Hagiwara, N., Irisawa, H., and Kameyama, M. (1988) J. Physiol. (Lond.) 395, 233-253 |
| 15. | Nuss, H. B., and Houser, S. R. (1993) Circ. Res. 73, 777-782 |
| 16. | Zhou, Z., and Lipsius. (1994) J. Mol. Cell. Cardiol. 26, 1211-1219 |
| 17. | McCleskey, E. W., and Schroeder, J. E. (1991) Curr. Top. Membr. 39, 295-326 |
| 18. | Cohen, C. J., McCarthy, R. T., Barrett, P. Q., and Rasmussen, H. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2412-2416 |
| 19. | Enyeart, J. J., Mlinar, B., and Enyeart, J. A. (1993) Mol. Endocrinol. 7, 1031-1040 |
| 20. | Akaike, N., Kostyuk, P. G., and Osipchuk, Y. V. (1989) J. Physiol. (Lond.) 412, 181-195 |
| 21. | Perez-Reyes, E., Cribbs, L. L., Daud, A., Lacerda, A. E., Barclay, J., Williamson, M. P., Fox, M., Rees, M., and Lee, J. H. (1998) Nature 391, 896-900 |
| 22. | Cribbs, L. L., Lee, J. H., Yang, J., Satin, J., Zhang, Y., Daud, A., Barclay, J., Williamson, M. P., Fox, M., Rees, M., and Perez-Reyes, E. (1998) Circ. Res. 83, 103-109 |
| 23. | Talley, E. M., Cribbs, L. L., Lee, J. H., Daud, A., Perez-Reyes, E., and Bayliss, D. A. (1999) J. Neurosci. 19, 1895-1911 |
| 24. | Lee, J. H., Daud, A. N, Cribbs, L. L, Lacerda, A. E, Pereverzev, A., Klockner, U., Schneider, T., and Perez-Reyes, E. (1999) J. Neurosci. 19, 1912-1921 |
| 25. | Williams, M. E., Washburn, M. S., Hans, M., Urrutia, A., Brust, P. F., Prodanovich, P, Harpold, M. M., and Stauderman, K. A. (1999) J. Neurochem. 72, 791-798 |
| 26. | Snutch, T. P., Leonard, J. P., Gilbert, M. M., Lester, H. A., and Davidson, N. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 3391-3395 |
| 27. | Sutton, K. G., McRory, J. E., Guthrie, H., Murphy, T. H., and Snutch, T. P. (1999) Nature 401, 800-804 |
| 28. | Hamill, O. P., Marty, A., Neher, E., Sakmann, B., and Sigworth, F. J. (1981) Pfluegers Arch. 391, 85-100 |
| 29. | Huguenard, J. R., and McCormick, D. A. (1992) J. Neurophysiol. 68, 1373-1383 |
| 30. | McCormick, D. A., and Huguenard, J. R. (1992) J. Neurophysiol. 68, 1384-1400 |
| 31. | Pragnell, M., De Waard, M., Mori, Y., Tanabe, T., Snutch, T. P., and Campbell, K. P. (1994) Nature 368, 67-70 |
| 32. | Babitch, J. (1990) Nature 346, 321-322 |
| 33. | Lee, A., Wong, S. T., Gallagher, D., Li, B., Storm, D. R., Scheuer, T., and Catterall, W. A. (1999) Nature 399, 155-159 |
| 34. | Peterson, B. T., DeMaria, C. D., Adelman, J. P., and Yue, D. T. (1999) Neuron 22, 549-558 |
| 35. | Chen, C., and Hess, P. (1990) J. Gen. Physiol. 96, 603-630 |
| 36. | Mlinar, B., Biagi, B. A., and Enyeart, J. J. (1993) J. Gen Physiol. 102, 217-237 |
| 37. | Serrano, J. R., Perez-Reyes, E., and Jones, S. W. (1999) J. Gen Physiol. 114, 185-201 |
| 38. | Swandulla, D., and Armstrong, C. M. (1988) J. Gen. Physiol. 92, 197-218 |
| 39. | Williams, M. E., Marubio, L. M., Deal, C. R., Hans, M., Brust, P. F., Philipson, L. H., Miller, R. J., Johnson, E. C., Harpold, M. M., and Ellis, S. B. (1994) J. Biol. Chem. 269, 22347-22357 |
| 40. | McCobb, D. P., and Beam, K. G. (1991) Neuron 7, 119-127 |
| 41. | Carbone, E., and Lux, H. D. (1987) J. Physiol. (Lond.) 386, 547-570 |
| 42. | Carbone, E., and Lux, H. D. (1987) J. Physiol. (Lond.) 386, 571-601 |
| 43. | Fox, A. P., Nowycky, M. C., and Tsien, R. W. (1987) J. Physiol. (Lond.) 394, 149-172 |
| 44. | Hoehn, K., Watson, T. W., and MacVicar, B. A. (1993) J. Neurosci. 13, 1244-1257 |
| 45. | Bargas, J., Howe, A., Eberwine, J., Cao, Y., and Surmeier, D. J. (1994) J. Neurosci. 14, 6667-6686 |
| 46. | Nambu, A., and Llinas, R. (1994) J. Neurophysiol. 72, 1127-1139 |
| 47. | Mittman, S., Guo, J., Emerick, M. C., and Agnew, W. S. (1999) Neurosci. Lett. 16, 121-124 |
| 48. | Monteil, A., Chemin, J., Leuranguer, V., Altier, C., Mennessier, G., Bourinet, E., Lory, P., and Nargeot, J. (2000) J. Biol. Chem. 275, 16530-16535 |
| 49. | Klockner, U., Lee, J. H., Cribbs, L. L, Daud, A., Hescheler, J., Pereverzev, A., Perez-Reyes, E., and Schneider, T. (1999) Eur. J. Neurosci. 11, 4171-4178 |
| 50. | Monteil, A., Chemin, J., Bourinet, E., Mennessier, G., Lory, P., and Nargeot, J. (2000) J. Biol. Chem. 275, 6090-6100 |
| 51. | Randall, A. D., and Tsien, R. W. (1997) Neuropharmacology 36, 879-893 |
| 52. | Xu, X., and Best, P. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 87, 4655-4659 |
| 53. | Santi, C. M., Darszon, A., and Hernández-Cruz, A. (1996) Am. J. Physiol. 27, C1583-C1593 |
| 54. | Bkaily, G., Sculptoreanu, A., Jacques, D., and Jasmin, G. (1997) Mol. Cell. Biochem. 176, 199-204 |
| 55. | Wang, L., Bhattacharjee, A., Zuo, Z., Hu, F. Q., Honkanen, R. E., Berggren, P. O., and Li, M. (1999) Endocrinology 140, 1200-1204 |
| 56. | Sculptoreanu, A., Abramovici, H., Abdullah, A. R., Bibikova, A., Panet- Raymond, V., Frankel, D., Schipper, H. M., Pinsky, L., and Trifiro, M. A. (2000) Mol. Cell. Biochem. 203, 23-31 |
| 57. | Huguenard, J. R., and Prince, D. A. (1992) J. Neurosci. 12, 3804-3838 |
| 58. | Serrano, J. R., Perez-Reyes, E., and Jones, S. W. (2000) Biophys. J. 78, 445A |
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. L. Levitsky and J. López-Barneo Developmental change of T-type Ca2+ channel expression and its role in rat chromaffin cell responsiveness to acute hypoxia J. Physiol., May 1, 2009; 587(9): 1917 - 1929. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. L. Ernst, Y. Zhang, J. W. Yoo, S. J. Ernst, and J. L. Noebels Genetic Enhancement of Thalamocortical Network Activity by Elevating {alpha}1G-Mediated Low-Voltage-Activated Calcium Current Induces Pure Absence Epilepsy J. Neurosci., February 11, 2009; 29(6): 1615 - 1625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Pugh and I. M. Raman Mechanisms of Potentiation of Mossy Fiber EPSCs in the Cerebellar Nuclei by Coincident Synaptic Excitation and Inhibition J. Neurosci., October 15, 2008; 28(42): 10549 - 10560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Z. Wetmore, E. A. Mukamel, and M. J. Schnitzer Lock-and-Key Mechanisms of Cerebellar Memory Recall Based on Rebound Currents J Neurophysiol, October 1, 2008; 100(4): 2328 - 2347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Tao, M. E. Hildebrand, P. Liao, M. C. Liang, G. Tan, S. Li, T. P. Snutch, and T. W. Soong Activation of Corticotropin-Releasing Factor Receptor 1 Selectively Inhibits CaV3.2 T-Type Calcium Channels Mol. Pharmacol., June 1, 2008; 73(6): 1596 - 1609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Carabelli, A. Marcantoni, V. Comunanza, A. de Luca, J. Diaz, R. Borges, and E. Carbone Chronic hypoxia up-regulates {alpha}1H T-type channels and low-threshold catecholamine secretion in rat chromaffin cells J. Physiol., October 1, 2007; 584(1): 149 - 165. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Hildebrand, L. S. David, J. Hamid, K. Mulatz, E. Garcia, G. W. Zamponi, and T. P. Snutch Selective Inhibition of Cav3.3 T-type Calcium Channels by G{alpha}q/11-coupled Muscarinic Acetylcholine Receptors J. Biol. Chem., July 20, 2007; 282(29): 21043 - 21055. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Jagodic, S. Pathirathna, M. T. Nelson, S. Mancuso, P. M. Joksovic, E. R. Rosenberg, D. A. Bayliss, V. Jevtovic-Todorovic, and S. M. Todorovic Cell-Specific Alterations of T-Type Calcium Current in Painful Diabetic Neuropathy Enhance Excitability of Sensory Neurons J. Neurosci., March 21, 2007; 27(12): 3305 - 3316. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. W. Tedford and G. W. Zamponi Direct G Protein Modulation of Cav2 Calcium Channels Pharmacol. Rev., December 1, 2006; 58(4): 837 - 862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Qiu, M. A. Bosch, K. Jamali, C. Xue, M. J. Kelly, and O. K. Ronnekleiv Estrogen Upregulates T-Type Calcium Channels in the Hypothalamus and Pituitary J. Neurosci., October 25, 2006; 26(43): 11072 - 11082. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Khosravani and G. W. Zamponi Voltage-gated calcium channels and idiopathic generalized epilepsies. Physiol Rev, July 1, 2006; 86(3): 941 - 966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhong, J. R. Liu, J. W. Kyle, D. A. Hanck, and W. S. Agnew A profile of alternative RNA splicing and transcript variation of CACNA1H, a human T-channel gene candidate for idiopathic generalized epilepsies Hum. Mol. Genet., May 1, 2006; 15(9): 1497 - 1512. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Molineux, J. E. McRory, B. E. McKay, J. Hamid, W. H. Mehaffey, R. Rehak, T. P. Snutch, G. W. Zamponi, and R. W. Turner Specific T-type calcium channel isoforms are associated with distinct burst phenotypes in deep cerebellar nuclear neurons PNAS, April 4, 2006; 103(14): 5555 - 5560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Molineux, F. R. Fernandez, W. H. Mehaffey, and R. W. Turner A-Type and T-Type Currents Interact to Produce a Novel Spike Latency-Voltage Relationship in Cerebellar Stellate Cells J. Neurosci., November 23, 2005; 25(47): 10863 - 10873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Wolf, J. T. Moyer, M. T. Lazarewicz, D. Contreras, M. Benoit-Marand, P. O'Donnell, and L. H. Finkel NMDA/AMPA Ratio Impacts State Transitions and Entrainment to Oscillations in a Computational Model of the Nucleus Accumbens Medium Spiny Projection Neuron J. Neurosci., October 5, 2005; 25(40): 9080 - 9095. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. B. Vieira, C. Kushmerick, M. E. Hildebrand, E. Garcia, A. Stea, M. N. Cordeiro, M. Richardson, M. V. Gomez, and T. P. Snutch Inhibition of High Voltage-Activated Calcium Channels by Spider Toxin PnTx3-6 J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 1370 - 1377. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Autret, I. Mechaly, F. Scamps, J. Valmier, P. Lory, and G. Desmadryl The involvement of Cav3.2/{alpha}1H T-type calcium channels in excitability of mouse embryonic primary vestibular neurones J. Physiol., August 15, 2005; 567(1): 67 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Steger, B. B. Shtonda, C. Thacker, T. P. Snutch, and L. Avery The C. elegans T-type calcium channel CCA-1 boosts neuromuscular transmission J. Exp. Biol., June 1, 2005; 208(11): 2191 - 2203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Vitko, Y. Chen, J. M. Arias, Y. Shen, X.-R. Wu, and E. Perez-Reyes Functional Characterization and Neuronal Modeling of the Effects of Childhood Absence Epilepsy Variants of CACNA1H, a T-Type Calcium Channel J. Neurosci., May 11, 2005; 25(19): 4844 - 4855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-T. Hu, S. Basu, and F. J. White Repeated Cocaine Administration Suppresses HVA-Ca2+ Potentials and Enhances Activity of K+ Channels in Rat Nucleus Accumbens Neurons J Neurophysiol, September 1, 2004; 92(3): 1597 - 1607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Dubel, C. Altier, S. Chaumont, P. Lory, E. Bourinet, and J. Nargeot Plasma Membrane Expression of T-type Calcium Channel {alpha}1 Subunits Is Modulated by High Voltage-activated Auxiliary Subunits J. Biol. Chem., July 9, 2004; 279(28): 29263 - 29269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Li, L. Stevens, N. Klugbauer, and D. Wray Roles of Molecular Regions in Determining Differences between Voltage Dependence of Activation of CaV3.1 and CaV1.2 Calcium Channels J. Biol. Chem., June 25, 2004; 279(26): 26858 - 26867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Niwa, K. Yasui, T. Opthof, H. Takemura, A. Shimizu, M. Horiba, J.-K. Lee, H. Honjo, K. Kamiya, and I. Kodama Cav3.2 subunit underlies the functional T-type Ca2+ channel in murine hearts during the embryonic period Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2257 - H2263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-Y. Park, H.-W. Kang, S.-W. Jeong, and J.-H. Lee Multiple Structural Elements Contribute to the Slow Kinetics of the Cav3.3 T-type Channel J. Biol. Chem., May 21, 2004; 279(21): 21707 - 21713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Bradley, U. A. Anderson, S. M. Woolsey, K. D. Thornbury, N. G. McHale, and M. A. Hollywood Characterization of T-type calcium current and its contribution to electrical activity in rabbit urethra Am J Physiol Cell Physiol, May 1, 2004; 286(5): C1078 - C1088. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Khosravani, C. Altier, B. Simms, K. S. Hamming, T. P. Snutch, J. Mezeyova, J. E. McRory, and G. W. Zamponi Gating Effects of Mutations in the Cav3.2 T-type Calcium Channel Associated with Childhood Absence Epilepsy J. Biol. Chem., March 12, 2004; 279(11): 9681 - 9684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Hildebrand, J. E. McRory, T. P. Snutch, and A. Stea Mammalian Voltage-Gated Calcium Channels Are Potently Blocked by the Pyrethroid Insecticide Allethrin J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 805 - 813. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Ruscheweyh, H. Ikeda, B. Heinke, and J. Sandkuhler Distinctive membrane and discharge properties of rat spinal lamina I projection neurones in vitro J. Physiol., March 1, 2004; 555(2): 527 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Stotz, S. E. Jarvis, and G. W. Zamponi Functional roles of cytoplasmic loops and pore lining transmembrane helices in the voltage-dependent inactivation of HVA calcium channels J. Physiol., January 15, 2004; 554(2): 263 - 273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shan, M. L. Messi, Z. Zheng, Z.-M. Wang, and O. Delbono Preservation of motor neuron Ca2+ channel sensitivity to insulin-like growth factor-1 in brain motor cortex from senescent rat J. Physiol., November 15, 2003; 553(1): 49 - 63. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O A Sergeeva, A N Chepkova, N Doreulee, K S Eriksson, W Poelchen, I Monnighoff, B Heller-Stilb, U Warskulat, D Haussinger, and H L Haas Taurine-Induced Long-Lasting Enhancement of Synaptic Transmission in Mice: Role of Transporters J. Physiol., August 1, 2003; 550(3): 911 - 919. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-H. Liu, S. Konig, M. Michel, S. Arnaudeau, J. Fischer-Lougheed, C. R. Bader, and L. Bernheim Acceleration of human myoblast fusion by depolarization: graded Ca2+ signals involved Development, August 1, 2003; 130(15): 3437 - 3446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Del Toro, K. L. Levitsky, J. Lopez-Barneo, and M. D. Chiara Induction of T-type Calcium Channel Gene Expression by Chronic Hypoxia J. Biol. Chem., June 13, 2003; 278(25): 22316 - 22324. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Barreiro, C. R. W. Guimaraes, and R. B. de Alencastro Potential of mean force calculations on an L-type calcium channel model Protein Eng. Des. Sel., March 1, 2003; 16(3): 209 - 215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Perez-Reyes Molecular Physiology of Low-Voltage-Activated T-type Calcium Channels Physiol Rev, January 1, 2003; 83(1): 117 - 161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chemin, J. Nargeot, and P. Lory Neuronal T-type alpha 1H Calcium Channels Induce Neuritogenesis and Expression of High-Voltage-Activated Calcium Channels in the NG108-15 Cell Line J. Neurosci., August 15, 2002; 22(16): 6856 - 6862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hirooka, G. E. Bertolesi, M. E. M. Kelly, E. M. Denovan-Wright, X. Sun, J. Hamid, G. W. Zamponi, A. E. Juhasz, L. W. Haynes, and S. Barnes T-Type Calcium Channel alpha 1G and alpha 1H Subunits in Human Retinoblastoma Cells and Their Loss After Differentiation J Neurophysiol, July 1, 2002; 88(1): 196 - 205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-H. Lee, E.-G. Kim, B.-G. Park, K.-H. Kim, S.-K. Cha, I. D. Kong, J.-W. Lee, and S.-W. Jeong Identification of T-Type alpha 1H Ca2+ Channels (Cav3.2) in Major Pelvic Ganglion Neurons J Neurophysiol, June 1, 2002; 87(6): 2844 - 2850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-F. Zhang, D. C. Cooper, and F. J. White Repeated Cocaine Treatment Decreases Whole-Cell Calcium Current in Rat Nucleus Accumbens Neurons J. Pharmacol. Exp. Ther., June 1, 2002; 301(3): 1119 - 1125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wolfart and J. Roeper Selective Coupling of T-Type Calcium Channels to SK Potassium Channels Prevents Intrinsic Bursting in Dopaminergic Midbrain Neurons J. Neurosci., May 1, 2002; 22(9): 3404 - 3413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chemin, A. Monteil, E. Perez-Reyes, E. Bourinet, J. Nargeot, and P. Lory Specific contribution of human T-type calcium channel isotypes ({alpha}1G, {alpha}1H and {alpha}1I) to neuronal excitability J. Physiol., April 1, 2002; 540(1): 3 - 14. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. P. Kumar, S. C. Stotz, R. Paramashivappa, A. M. Beedle, G. W. Zamponi, and A. S. Rao Synthesis and Evaluation of a New Class of Nifedipine Analogs with T-Type Calcium Channel Blocking Activity Mol. Pharmacol., March 1, 2002; 61(3): 649 - 658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jagannathan, E. L. Punt, Y. Gu, C. Arnoult, D. Sakkas, C. L. R. Barratt, and S. J. Publicover Identification and Localization of T-type Voltage-operated Calcium Channel Subunits in Human Male Germ Cells. EXPRESSION OF MULTIPLE ISOFORMS J. Biol. Chem., March 1, 2002; 277(10): 8449 - 8456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Isomura, Y. Fujiwara-Tsukamoto, M. Imanishi, A. Nambu, and M. Takada Distance-Dependent Ni2+-Sensitivity of Synaptic Plasticity in Apical Dendrites of Hippocampal CA1 Pyramidal Cells J Neurophysiol, February 1, 2002; 87(2): 1169 - 1174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Barreiro, C. R. W. Guimaraes, and R. B. de Alencastro A molecular dynamics study of an L-type calcium channel model Protein Eng. Des. Sel., February 1, 2002; 15(2): 109 - 122. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Santi, F. S. Cayabyab, K. G. Sutton, J. E. McRory, J. Mezeyova, K. S. Hamming, D. Parker, A. Stea, and T. P. Snutch Differential Inhibition of T-Type Calcium Channels by Neuroleptics J. Neurosci., January 15, 2002; 22(2): 396 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L Borgland, M. Connor, and M. J Christie Nociceptin inhibits calcium channel currents in a subpopulation of small nociceptive trigeminal ganglion neurons in mouse J. Physiol., October 1, 2001; 536(1): 35 - 47. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chemin, A. Monteil, E. Perez-Reyes, E. Bourinet, J. Nargeot, and P. Lory Specific contribution of human T-type calcium channel isotypes (1G, 1H and 1I) to neuronal excitability J. Physiol., February 15, 2002; (2002) 200101326. [Abstract] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |