![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 6, 4150-4157, February 9, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
§¶
**
From the
Department of Human Genetics,
¶ Department of Internal Medicine, Division of Cardiology, and
Howard Hughes Medical Institute, § University of
Utah, Eccles Institute of Human Genetics,
Salt Lake City, Utah 84112
Received for publication, June 5, 2000, and in revised form, October 23, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Using differential display of rat fetal and
postnatal cardiomyocytes, we have identified a novel
seven-transmembrane receptor, ETL. The cDNA-predicted amino acid
sequence of ETL indicated that it encodes a 738-aa protein composed of
a large extracellular domain with epidermal growth factor (EGF)-like
repeats, a seven-transmembrane domain, and a short cytoplasmic tail.
ETL belongs to the secretin family of G-protein-coupled peptide hormone
receptors and the EGF-TM7 subfamily of receptors. The latter are
characterized by a variable number of extracellular EGF and cell
surface domains and conserved seven transmembrane-spanning regions. ETL
mRNA expression is up-regulated in the adult rat and human heart.
In situ hybridization analyses revealed expression in rat
cardiomyocytes and abundant expression in vascular and bronchiolar
smooth muscle cells. In COS-7 cells transfected with Myc-tagged rat
ETL, rat ETL exists as a stable dimer and undergoes endoproteolytic
cleavage of the extracellular domain. The proteolytic activity can be
abolished by a specific mutation, T455A, in this domain. In transfected mammalian cells, ETL is associated with cell membranes and is also
observed in cytoplasmic vesicles. ETL is the first seven-transmembrane receptor containing EGF-like repeats that is developmentally regulated in the heart.
A complex series of events takes place during growth and
maturation of cardiac myocytes. The proliferative growth of cardiac myocytes is primarily limited to fetal and early neonatal periods of
development (1). Postnatal maturation of cardiac myocytes is marked by
cellular hypertrophy and is also accompanied by ventricular remodeling
of the nonmyocyte compartment, such as extracellular matrix
formation and coronary angiogenesis (2). The signals that coordinate
these processes in cardiac muscle are not well understood, but several
growth factors and hormones have been shown to influence heart
development (3, 4). It is becoming clear that developmentally regulated
gene expression of specific extracellular factors and their
cognate receptors contributes to cardiac muscle differentiation
(4-9).
Complex cellular responses, such as proliferation and differentiation,
are frequently modulated by external stimuli. Intracellular signaling
cascades, in turn, act as mediators to translate the stimulus into
transcriptional activity. A large family of receptors involved in a
broad spectrum of cell signaling is the G-protein-coupled seven-transmembrane (TM7)1
receptor (GPCR) family. This family of molecules mediates signals from
hormones, cytokines, light, and odorants (10). GPCRs, activated by
humoral, endothelial, or platelet-derived factors, are also able to
stimulate mitogen-activated protein kinase pathways (11, 12), signaling
intermediates involved in cellular mitogenesis and proliferation.
GPCRs have a common topology characterized by an extracellular N
terminus, seven membrane-spanning helices flanked by a cytoplasmic tail. A group of receptors that shares homology in the heptahelical region and activated by peptide hormones is the secretin receptor family (13, 14). Recently, a subfamily of secretins has emerged that
exhibit cell-surface interaction and cell adhesion modules in unusually
large extracellular domains (15-19). This novel subtype of GPCRs
consists of a small number of EGF-TM7 receptors such as EMR1, a
receptor of neuroectodermal origin (20), its mouse homolog, F4/80 (21),
and CD97, a leukocyte-activating antigen (22). All three receptors
contain EGF modules and mucin-like domains in the N terminus. The
recently discovered Celsr1 gene also belongs to the EGF-TM7 group. In
addition to EGF repeats, Celsr1 contains cadherin and laminin type
repeats (16).
In an effort to pinpoint the stimuli and signal transduction machinery
that regulate the transition of myocyte from hyperplasia to
hypertrophy, coronary capillary formation, and extracellular matrix
deposition in the mammalian heart, we conducted differential display
analysis on mRNAs using fetal and adult cardiomyocytes. As a
result, we have identified a new member of the EGF-TM7 receptor family
named ETL (for
EGF-TM7-latrophilin-related
protein). The large extracellular domain of rat ETL consists of EGF
modules, a Ser/Thr rich linker region, and a Cys-rich proteolysis
domain. A seven-transmembrane region is followed by a short cytoplasmic tail. Besides having structural homology to the EGF-TM7 family, ETL
shares considerable similarity with closely related heptahelical receptors CL1 (calcium-independent receptor for latrotoxin
(CIRL)/latrophilin 1), CL2, and CL3 (18, 19). The similarity with
latrophilins includes a Cys-rich domain that may direct endoproteolytic
cleavage of the extracellular domain. The expression of the ETL
mRNA is developmentally regulated in the heart, suggesting that ETL
seven-transmembrane receptors may be important in cardiac switching
from fetal to adult phenotypes.
Differential mRNA Display--
Purified preparations of
cardiomyocytes were generated as described (23, 24) from 50 embryonic
day 16, postnatal day 1, day 3, day 5, and day 12 rat hearts.
Differential display was carried out using a RNAimage kit (GenHunter)
according to the manufacturer's instructions. Differentially displayed
bands were excised from the polyacrylamide gels and reamplified. The
resultant PCR amplicons were tested for differential expression on
Northern blots using whole heart poly(A+) RNA and then used
as probes to screen cDNA libraries for full-length transcripts.
cDNA Library Construction and Screening--
Double-selected
poly(A+) mRNAs from rat heart and total RNAs from lung
were obtained using Messagemaker (Life Technologies, Inc.). The
cDNA libraries were constructed using a Superscript cDNA
synthesis kit. The cDNAs were size-fractionated, adapted with
linkers, ligated into ZipLox arms (Life Technologies, Inc.), and
packaged using GigapackIII Gold (Stratagene). Approximately 30 clones
were incorporated into the ETL cDNA contig. The
GenBankTM accession number for rat ETL is AF192401, and the
accession number for the type II isoform is AF192402.
Nucleotide Sequencing and Analysis--
Clones obtained from
cDNA library were sequenced and a contig was compiled using
Sequencher 3.0 software. The consensus sequence was analyzed by Blast
for homologies and ExPASy tools for protein motifs and patterns.
RH Mapping--
Primers RP29.2A-RP29.2B, that amplify a genomic
STS from human BAC RP11-29e12 (Research Genetics), were used in PCR
with DNAs from medium resolution (G3) and high resolution (TGN3)
radiation hybrid panels (Research Genetics). Results were analyzed
using the Stanford RH mapping data bases (available on the World Wide Web).
RT-PCR of hETL (Human ETL)--
Four human-specific
primer pairs were used to amplify hETL: 29.13A-B, 29.18A-11B, 29.8A-B,
and 29.7A-B. The GenBankTM accession number for a partial
hETL cDNA sequence is AF192403.
Human ESTs Incorporated into the Contig of
hETL--
Incorporated ESTs had the following GenBankTM
accession numbers: AA364110, W72803, H00259, AA487827, T10363, AI024874, AI024852, AA296694 (EST 112416), AA429137, AW604713, W68553,
AI802994, AW204065, AI241562, AA487977, AI093076, AA370362, and
AA724866.
Northern Blot Analyses--
Equal amounts of RNA were run on
formaldehyde gels, blotted on nylon membranes (GeneScreen) and
UV-cross-linked. Membranes were stained with methylene blue for
visualization of 28 and 18 S RNAs (25). Hybridizations were performed
in Express Hyb solution (CLONTECH) followed by
washes and autoradiography. For normalization of poly(A+)
RNAs, blots were probed with GAPDH and quantified by PhosphorImager analysis (Molecular Dynamics, Inc., Sunnyvale, CA).
Construction of Expression Vectors--
The cDNA sequence
corresponding to the ETL open reading frame was amplified by RT-PCR
from rat heart using primers 69F50XH and 69XBB, containing 5'
restriction site overhangs. The amplified product was cloned into
pBluescript, and 10 clones were sequenced. Clone 1 contained no
mutations, while clone 3 harbored a T455A substitution. These were
selected and subcloned in frame with Myc-His 3' tag sequences into the
pcDNA 3.1 vector (Invitrogen). The extracellular region was
amplified using primers 69F50BI and 69R45H3. The extracellular region
up to the cleavage site, including Thr455, was
amplified using 69F50BI and 69R46H3. PCR products were fused in frame
with the Fc portion of human IgG and subcloned into the pcDNA 3.1 vector. The Fc portion of human IgG was also amplified by PCR using the
human EST clone 809684 (GenBankTM accession number
AA456339) as a template. The 1-455 aa extracellular region was also
fused in frame with Myc-His 3' tag sequences in the pcDNA 3.1 vector.
Transfection into COS-7 Cells and Western Blotting--
1.5 × 105 COS-7 cells were seeded into six-well dishes and
transfected with constructs using LipofectAMINE reagent (Life
Technologies, Inc.) and 1 µg of plasmid DNA purified with a Qiagen
column. Proteins were harvested 48 h after transfection in 300 µl of triple detergent solution (25). Ten µl of total protein
extracts and 10 µl of a protein molecular weight ladder (New England
Biolabs) were heated in the presence of 1% In Situ Hybridization--
The transmembrane region of rat ETL
was PCR-cloned into pBluescript using two primers with restriction site
overhangs, TRE1A and TRH3B. Plasmid was linearized, and sense/antisense
probes were synthesized using a DIG RNA labeling kit (Roche) and used in hybridization at 1 ng/µl. Paraffin-embedded 2-week-old rat lung
and heart tissues were sectioned, 8-9 µm thick, deparaffinized in
Hemo-DE, hydrated through a series of graded ethanol and water, and
treated with proteinase K at 6 µg/ml for 90 min. Sections were
hybridized overnight at 60 °C in a buffer containing 50% deionized
formamide, 10% dextran sulfate, 1× Denhardt's solution, 100 mM dithiothreitol, 20 mM Tris-HCl, pH 7.5, 5 mM EDTA, 300 mM NaCl, in
diethylpyrocarbonate-treated water. Washes were as follows: 4×
SSC, 10 mM dithiothreitol for 1 h; 5% formamide, 2× SSC, 20 mM dithiothreitol for 30 min at 50 °C; 1×
NTE for 15 min at 37 °C. Immunological detection was
performed using a DIG nucleic acid detection kit (Roche Molecular
Biochemicals). Washes consisted of 2× SSC for 5 min, 0.1× SSC for 15 min, buffer 1 (Roche) for 15 min, buffer 2 containing 20% sheep serum
for 30 min. Washes were followed by incubation with anti-DIG-AP
conjugate, 1:500 dilution, for 2 h. Postincubation washes were
performed in buffer 1 (Roche Molecular Biochemicals) three times for 10 min and buffer 3 for 5 min, followed by incubation with the substrate,
1% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in
buffer 3 (Roche Molecular Biochemicals). Development was carried out for several hours and terminated for both antisense and sense slides at
the same time. Slides were counterstained in 0.5% methylene blue,
washed in water and 100% butanol, dehydrated in Hemo-DE, mounted, and
photographed using a Zeiss microscope.
Immunofluorescence and Confocal Microscopy--
COS-7 cells were
seeded at a density of 4 × 104 on chamber slides,
transiently transfected with an ETL-Myc expression construct, allowed
to recover for 24-48 h, serum-starved for 4 h where indicated, and stained for immunofluorescence. Washed cells were fixed in Zamboni
(Vector Laboratories), permeabilized in 0.2% Triton X-100, and blocked
in 1% nonfat milk. Cells were then incubated with anti-Myc antibody
(Oncogene Research Products) followed by appropriate secondary IgG
conjugated to biotin and Alexa-594 conjugated to streptavidin
(Molecular Probes, Inc., Eugene, OR). Cells were examined by
fluorescent microscopy using a Texas Red filter or by confocal
microscopy at 594-nm wavelength.
Primers--
The following primers were used: 29.13A,
GAAATTTAACTCAGTCCTGTGG; 29.13B, GTCCCAAACTACAAATGTATCC; 29.18A,
GCTGAATCATCTTCATTACTAGGT; 29.11B, AGTAATTCCAAAATGCACATAGACT; 29.2B,
AGGCAACACGAGTCACA; 29.2B, ATAGAGAATGGTGGATAATTAC; 29.8A,
CCACCCACATTATATGAACTTGA; 29.8B, GGCATGCTGGTCCTATAAAACTC; 29.7A,
GGCATACATCTCTATCTCATTGT; 29.7B, TCAAAGGCAACACGAGTCACAGA; 69F50XH,
CTCGAGATAAAATGGGACTCCTCCTGCTTCTA; 69XBB,
GGATCCTCTTAAACATTCAAAACAGCAGG; 69F50BI,
GGATCCATAAAATGGGACTCCTCCTGCTTCTA; 69R45H3,
AAGCTTAGGACCCAGCTGAGTGATCCTCGTC; TRE1A,
ATTCGATTCCACTTTGCGATTTTGATGTCCC; TRH3B,
ATATAAGCTTTCTTAAACATTCAAAACAGCAGG; 69R46H3,
AAGCTTTGTCAGATGACTACATCGGCAGGA. Bold ATG indicates initiating Met.
ETL Is Up-regulated in the Heart after Birth--
To
identify genes involved in heart development, we conducted a
differential display of fetal and postnatal mRNAs isolated from
purified cardiac myocytes using fetal, day 1, day 3, day 5, and day 12 rat hearts. Several genes were identified by RT-PCR as up-regulated or
down-regulated during heart development. Here, we describe clone 69, subsequently named ETL, that is up-regulated postnatally during
cardiomyocyte development (Fig.
1A). The differentially expressed PCR amplicon was subsequently excised from the polyacrylamide gel and used for Northern blot analyses.
The developmentally regulated expression of rETL was confirmed
on poly(A+) mRNA Northern blots from rat whole hearts,
where RNAs were extracted at several developmental time points: fetal,
day 1, day 3, and day 12 (Fig. 1B). The experiments
identified an increasing abundance of rETL mRNA that correlated
with developmental age. The GAPDH-normalized images of rETL indicated a
4.6-fold increase in expression by day 12 and 1.9-fold increase
by birth in comparison with embryonic day 16 mRNA levels. Using rat
poly(A+) RNA Northern blots, we examined the expression of
rETL in adult tissues. Rat ETL is abundantly expressed in heart, lung,
and kidney; less evident expression is observed in brain, skeletal
muscle, liver, and spleen, with the exception of testis, where no
expression is detected (Fig. 1D). Similarly, differential
expression of human ETL (hETL) was evident by probing total RNA
Northern blots from 3-month fetal and adult human hearts (Fig.
1C) with PCR-cloned human cDNA. Unlike rat, two messages
were detected in human heart and may represent distinct isoforms of hETL.
Two Alternatively Spliced Isoforms of rETL--
The PCR products
from differential display were used to screen an adult rat heart
library to generate a full-length cDNA contig. Several screens of
our rat heart cDNA library yielded 30 overlapping clones. Sequence
analyses revealed a cDNA sequence of 4274 bp that approximately
corresponds to the size of the 4.4-kilobase mRNA observed on
rat heart Northern blots (Fig. 1B). The longest open reading
frame is 2214 bp, starting with the putative initiation Met and ending
with a TAA termination codon. The 3'-untranslated region is 1821 bp and
contains a putative polyadenylation signal. The 5'-untranslated
sequence is 235 bp and contains a stop codon preceding the open reading frame.
Further analyses of cDNA clones revealed a second isoform of rETL.
Several clones encompassed an in-frame insertion sequence between
nucleotides 2129 and 2130. The alternatively spliced exon of 234 bp
contains a TAA termination codon and leads to premature termination
with a predicted peptide length of 660 aa, thereby deleting amino acids
C-terminal to the fifth transmembrane domain.
The Human ETL Homolog, hETL, Is Highly Conserved with rETL in the
Transmembrane Domain--
Homology searches with rat ETL cDNA
sequences revealed several highly homologous human ESTs, mostly
residing in 3'-coding and -untranslated regions. The most striking
homology was observed to unordered contigs of genomic sequences of
human BAC RP11-29e12 (accession number AC024326.2). The homology
extends through the majority of the open reading frame, including
sequences of the 3'-untranslated region. To obtain physical clones, we
designed human-specific pairs of PCR primers in the regions of
indicated homology and employed RT-PCR on cDNAs from human heart.
Sequences of RT-PCR products and several human ESTs allowed us to
identify a total of 13 exons (Table I)
spanning 2689 bp. Exon 1 contains the putative translation initiation
Met; however, it does not have an in-frame stop codon upstream of the
Met. Exon 1a was revealed by a high homology to the rat protein, yet is
it spliced out in several tissues we examined and in EST 112416. Exon
13 carries a conserved translational stop codon and 3'-untranslated
region sequences. Pairwise comparisons of human ETL cDNA sequence
and predicted peptide sequence against the rat homolog indicated 80% identity at the nucleotide and 87% similarity at the amino acid level.
In obtained 3'-untranslated region sequences, 234 bp show striking
interspecies identity (87%). This untranslated region is located
~200 bp from the conserved stop codon and potentially represents a
regulatory element for mRNA expression or stabililty.
Human ETL Maps to Chromosome 1--
Using 29.2A-2B primers, we
amplified a genomic STS from BAC RP11-29e12 and DNAs from medium and
high resolution Radiation Hybrid panels (Research Genetics). We linked
hETL to two chromosome 1 markers, SHGC-21318 within 8 centirays and to
SHGC-57820 within 15 centirays with LOD scores of 8 and 11, respectively (data not shown). These markers, although not ordered on
the chromosome 1 map, are tightly linked to the D1S500, a GDB
locus located on the 1p32-p33 band of chromosome 1 (26). A genomic
clone containing mouse ETL, BAC 322E17, was mapped by fluorescent
in situ hybridization analysis on mouse chromosome 3, H3-H4.2 This mouse genomic
region is syntenic with human chromosome 1p32-p33.
rETL Is a Predicted Seven-transmembrane Receptor with EGF Modules
in the Extracellular Domain--
The novel rETL cDNA sequence
codes for a 738-amino acid protein. The molecular masses of the deduced
ETL precursor and mature peptides are 82.5 and 80.3 kDa. As determined
by hydropathy and motif analyses, rETL peptide consists of three
regions: a large extracellular domain of 481 aa, a seven-transmembrane
region of 231 aa, and a short intracellular cytoplasmic tail of 26 aa
(Fig. 2). The N-terminal region begins
with a 19-aa signal peptide, followed by a short domain (~26 aa)
related to a lectin-type domain (27), one EGF-like domain, and two
identical Ca2+-binding EGF domains (~91 aa). A
Ser/Thr-rich linker region of ~297 aa follows the EGF domains and
precedes a conserved Cys-rich proteolysis domain (~50 aa). The latter
has recently been described in a small number of transmembrane proteins
and is also referred to as the GPCR proteolysis site (GPS) (19, 28,
29). This region, together with the short strech of the Ser/Thr linker
and the adjacent transmembrane and cytoplasmic domain, shows the
highest conservation between rat and human proteins (Fig.
3B).
Analyses of the putative hETL protein revealed only one
Ca2+-EGF binding domain. This domain is potentially encoded
by exon 1a. However, in human EST 112416, encompassing exons 1-3, as
well as in our RT-PCR experiments using human heart, placenta, lung, and kidney RNAs, exon 1a is spliced out. Since this exon shows a high
degree of identity in humans and rats (80% of 150 bp) and codes for a
potentially important functional EGF domain, we cannot rule out the
existence of isoforms carrying exon 1a.
The extracellular domain of rETL also contains a potential Asn
hydroxylation site within each Ca2+ binding EGF-like
domain. One O-linked putative glycosylation site is found at
Ser388 in the Ser/Thr rich domain. The extracellular domain
also carries nine potential N-linked glycosylation sites,
most of them within the Ser/Thr-rich linker and GPS domain, and all but
one conserved in both species. Rat and human ETLs also possess cAMP-
and cGMP-dependent protein kinase phosphorylation sites and
several common potential protein kinase C and casein-kinase II
phosphorylation sites.
The hydropathy and homology analyses of the rETL transmembrane segment
predicted seven helices and a class II/secretin G-protein-coupled receptor signature sequence. Fig. 3A displays the alignment
of rat ETL and a human homolog in the heptahelical domain along with several members of the secretin family, EGF-TM7 subfamily members, and
several receptors with large extracellular domains. The overall structure is most similar to the EGF-TM7 family, with 30% identity to
EMR1 and CD97 in pairwise comparisons (data not shown). The ETL TM7
segment together with the adjacent Cys-rich proteolysis domain and the
Ser/Thr linker, displays significant homology to the three related
heptahelical receptors, CL1, CL2, and CL3, with 40% identity. Based on
these homologies, we designated our protein ETL (for
EGF-TM7-latrophilin-related
protein). A comparison of rETL and rat CL1-3, revealed conservation of
the proteolysis domain, with 60% identity in the region (Fig.
3B). CL1 is endoproteolytically cleaved at the end of this
domain (18), and cleavage of CL2 and CL3 has been referenced as well
(19). The proteolysis domain is characterized by several invariant
amino acids; most numerous among them are Cys residues. Several
recently discovered TM7 receptors with large extracellular domains also
exhibit this motif (Fig. 3B and Ref. 19), but cleavage has
not been documented.
The short cytoplasmic tail carries a tyrosine kinase phosphorylation
site that could play a role in desensitization of the receptor (30) or
coupling to a tyrosine kinase signaling pathway (11). A putative
tyrosine phosphorylation site, preserved in both rat and human ETLs,
could be involved in cross-talk between signal transduction modules
employing tyrosine kinases such as a MAP kinase pathways (11) and could
represent a scaffold for the assembly of a
phosphotyrosine-dependent complex. The overall structure of
rETL suggests that the protein might participate in both cell surface
events such as cell-cell recognition and adhesion and in signal
transduction cascades.
rETL Forms a Stable Receptor-Dimer in COS-7 Cells--
We
expressed rETL protein tagged with a Myc epitope on the C terminus in
COS-7 cells and identified an ~85-kDa protein using anti-Myc antibody
on total protein lysates by Western blot analyses. This 85-kDa band was
not present in vector alone transfections (Fig.
4A). The observed mass of 85 kDa closely correlated with the expected mass of the mature
rETL-Myc-His protein (83.7 kDa). We also observed a broad intense band
at ~175 kDa. This band probably represents an rETL dimer with
additional post-translational modifications that is stable in the
presence of most reducing agents and boiling. Extraction of total
proteins with 6 M guanidine hydrochloride led to nearly
complete disappearance of the 175-kDa band (Fig. 4B,
ETL lane).
rETL Is Cleaved within the Putative Extracellular
Domain--
Conservation of the rETL Cys-rich domain, a domain known
to undergo cleavage in CL1, CL2, and CL3 receptors (18, 19), prompted
us to test whether rETL also undergoes proteolytic processing. Previously, the cleavage of CL1 was only demonstrated in the presence of 8 M urea, both in gel and sample buffer (18). When total protein extracts from COS-7 cells transfected with the rETL construct were subjected to these conditions, a band of ~35 kDa appeared, and
the 85-kDa band became less intense (Fig. 4D, ETL
lane). This observation correlated with the predicted
products of cleavage between Leu454 and
Thr455 of a 48-kDa peptide (untagged) and a C-terminal
35.7-kDa peptide (tagged with Myc) (Fig. 4D, ETL
lane). The 85-kDa doublet in rETL probably represents the
mature and precursor rETL proteins (Fig. 4D, ETL
lane). The fact that only certain chaotropic agents allowed us to observe the cleaved products suggests that these cleaved peptides
stay bound as it has been shown for CL1 receptor (18). This proteolytic
processing may play an important role in the formation of a functional receptor.
To further analyze the processing of rETL, we used a mutant clone,
rETL*T455A. This clone, generated as a PCR cloning artifact, carries a
mutation at the conserved Thr residue previously determined to be at
the processing site in latrophilin (18). The mutated protein shows
resistance to cleavage as assessed by the failure to detect a 35-kDa
band in the presence of 8 M urea (Fig. 4D, ETL*T455A lane). This suggests that Thr455 is
required for proteolytic processing. Interestingly, 8 M
urea did not lead to the disappearance of the 175-kDa band, implying strong modifications after receptor-dimer formation. In 6 M
guanidine HCl preparations, rETL*T455A displays a higher ratio of dimer to monomer conformation than wild type (Fig. 4B). Stable
dimer formation for rETL*T455A may also contribute to the overall
higher stability and, therefore, higher quantity of the protein.
rETL Transmembrane Domain Is Required for Dimerization but Not
Cleavage--
To determine whether the transmembrane domain is
required for endoproteolytic processing, we constructed a fusion
protein consisting of the rETL exodomain (aa 1-483) and the 226-aa Fc portion of human immunoglobulin (ETL483-Fc). The predicted molecular mass of the resultant peptide is 79.6 and 77.1 kDa, for the
precursor and mature proteins, respectively. Under regular Laemmli
conditions, we observed two peptides, ~30 and 80 kDa (Fig.
4E, ETL483-Fc lane), indicating that the
truncated protein can be cleaved in the absence of the heptahelical
portion. The predicted cleavage between Leu454 and
Thr455 was expected to produce a mature N-terminal peptide
of 48 kDa (untagged) and 29.6 kDa (tagged with Fc) C-terminal peptide.
The 80-kDa band most likely represents the unprocessed protein.
Interestingly, no dimer formation was observed, suggesting that
although the transmembrane domain is not required for cleavage, it is
required for dimer formation. We also constructed a fusion protein
consisting of the rETL exodomain up to the Thr455 residue,
including ETL455-Fc, and observed no 30-kDa species (Fig.
4E, ETL455-Fc lanes). These
observations demonstrate that the amino acids immediately following the
processing site play an important, most likely conformational, role in cleavage.
rETL Detected in Membrane Preparations--
Both rETL and
rETL*T455A were detected in membrane preparations of COS-7 cells
transfected with these constructs (Fig. 4C). Interestingly,
no 85-kDa protein species were observed in the Triton-extracted
membrane proteins. When proteins were resolved under regular Laemmli
conditions, wild type rETL appeared as a 68-kDa doublet, approximately
corresponding to the predicted mass of a cleaved dimer (Fig.
4C, ETL lane), 71.4 kDa. In these
experiments, rETL was not detected as an 85- or 175-kDa protein
species, corresponding to the rETL uncleaved monomer or uncleaved
dimer, respectively. The mutation T455A did not affect the membrane
association of the rETL*T455A protein. The cleavage-resistant ETL*T455A
protein was also detected in dimer-only conformation, as revealed by
the presence of a 175-kDa band on the Western blot (Fig. 4C,
ETL*T455A lane). In addition to the rETL membrane
association, these results suggest that rETL is cleaved during
intracellular processing because the membrane preparations included
both the ER and plasma membranes.
rETL Is a Plasma Membrane-associated Protein--
The predicted
amino acid sequence of rETL and the substantial structural homology to
known receptor families suggested that rETL localized to the plasma
membrane. Further data supporting a plasma membrane localization for
rETL were obtained using Western analyses. As noted above and in Fig.
4C, rETL was detected in membrane preparations. We also
generated a construct encoding only the extracellular domain of rETL.
When the exodomain of rETL, aa 1-455, tagged C-terminally with Myc
epitope, was transiently expressed in COS-7 cells, it was detected as a
soluble protein in both conditioned medium (Fig. 4F,
ETL455 sup) and whole cell lysates (Fig. 4F,
ETL455 cell). Taken together, these data are highly
suggestive that rETL is a plasma membrane protein.
We used confocal microscopy to determine a subcellular localization of
C-terminally Myc-tagged rETL in COS-7 cells. Rat ETL was observed in
the proximity of plasma membrane and intracellular vesicles in
permeabilized cells only (Fig.
5A). Transient transfection allowed us to control the specificity of indirect immunofluorescence, since only a percentage of cells receive the plasmid and fluoresce (data not shown). The vesicles most likely represent endoplasmic reticulum, Golgi apparatus, and cytoplasmic transport vesicles involved
in processing and trafficking of the receptor. After 4 h of serum
starvation, we observed rETL in perinuclear vesicles only (Fig.
5B). These data may be explained by a rapid turnover or
internalization rate of rETL in COS-7 cells in the response to serum
starvation.
rETL Is Expressed in Cardiac Myocytes, Bronchiolar and Vascular
Smooth Muscle--
To more precisely ascertain the localization of
rETL expression in adult rat heart and lung tissues, and shed light on
the potential sources of ligand, we performed in situ
mRNA hybridization on paraffin sections of 12-day-old rat hearts
and lungs. Using an antisense probe from the transmembrane region (Fig.
6, left images), we
show expression of rETL in cardiomyocytes (Fig. 6A) and
vascular smooth muscle cells in coronary vessels (Fig. 6C) in the epicardial layer of the heart. In lung, we observed staining of
vascular smooth muscle cells in blood vessels (Fig. 6E) as well as smooth muscle cells in bronchioles (Fig. 6G).
Hybridization of a sense probe to similar sections served as a control
(Fig. 6, right images). The expression of rETL in
smooth muscle was confirmed by RT-PCR on rat smooth muscle
poly(A+) RNA (data not shown). The expression of rETL was
also detected in vessels of the kidney.2
In this study, we have isolated and characterized a novel cDNA
clone, ETL, encoding a new member of the EGF-TM7 subfamily of
receptors. Similar to all members of the EGF-TM7 receptor family, ETL
has a tripartite domain structure consisting of a large extracellular domain, a seven-membrane-spanning domain, and a short cytoplasmic tail.
A characteristic feature of the EGF-TM7 protein group, an unusually
large exodomain, incorporates cell surface interaction modules, such as
EGF-like motifs, lectin-like motifs, and a Ser/Thr rich domain, with
numerous sites for N- and O-linked glycosylation. Rat ETL has several EGF domains, which are often found in extracellular portions of a large number of proteins, including fibrillin, fibulin, entactin, tenascin, and thrombospondins (31), and are functionally associated with protein-protein interactions. The evolutionary implications of the addition of cell surface modules, a feature previously found only in single membrane-spanning molecules, to the
GCPR's signal transduction domain remains obscure. One possibility is
that these modules are essential for ligand specificity or presentation.
Ca2+, potentially bound to an Asn As noted in Fig. 3B, we found a significant conservation
between TM7 regions of secretin receptors and ETL. The importance of
this homology is unknown but may indicate a conservation of critical
residues for G-protein coupling to intracellular loops and/or
ligand-binding determinants within the extracellular loops of GCPR
transmembrane domains (36-38).
We show here that ETL carries a Cys-rich proteolysis domain with a high
degree of identity to CL1, CL2, and CL3 heptahelical receptors. CL1,
also known as latrophilin, is shown to interact with Cleavage within the proteolysis domain of CL1 (18, 19) and rETL, shown
here, suggests that other proteins carrying the conserved domain may
also be cleaved. The detection of rETL in cleaved dimer conformation in
membrane preparations suggests that the proteolytic activity is an
intracellular event. The 68-kDa doublet may imply that cleavage of the
extracellular domain precedes the cleavage of N-terminal signaling
peptide. The detection of rETL cleavage with a limited number of
chaotropic agents suggests that the cleaved N-terminal domain of rETL
remains tightly tethered to the transmembrane domain, as has been shown
for CL1 receptor cleavage product (18). Interestingly, the mutation
T455A in rETL that we have shown completely abolishes cleavage is
present in the native EMR1 receptor, but there is no biochemical data available on EMR1 processing. Based on the high degree of homology in
the proteolysis domain of rETL and CL1 and on the size of rETL cleaved
product that we observed in our experiments, it is likely that rETL
utilizes the same site for proteolytic processing. Therefore, the T455A
mutation most likely resides directly at the cleavage site, as is the
case for CL1 (18). The ETL*T455A clone will be useful for determining
if post-translational processing is important for receptor function
when an ETL ligand is discovered. Prior to isolation of ETL ligand,
this cleavage site mutation could be tested in a known exogenous
ligand-receptor function system such as latrotoxin-latrophilin/CL1,
given the high degree of conservation of these proteolysis domains.
Unlike other members of the EGF-TM7 family, which are often described
as glycosylated proteins on the surface of leukocytes (15), ETL is
expressed in cells of mesenchymal origin such as cardiac myocytes and
smooth muscle. ETL is the first TM7 receptor containing EGF-like motifs
that is developmentally regulated in the heart. Developmental
regulation of ETL expression in rat and human heart coincides with the
terminal differentiation of cardiac muscle and the switch from
hyperplastic to hypertrophic growth phases in mature cardiac muscle.
ETL may be an important effector in these processes. The expression of
ETL in coronary vessels may also suggest involvement in coronary
angiogenesis. The cell adhesion and cell-cell interaction modules of
ETL may facilitate interaction with the extracellular matrix that is
deposited in the heart after birth and be important in cell-cell
communication. Although the function of the ETL receptor remains
unknown at this time, regulated ETL expression implies an involvement
in cardiac development.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-mercaptoethanol and
resolved in Laemmli buffer (25) on 4-20% SDS-polyacrylamide gel
electrophoresis gradient gels (Bio-Rad) or 7.5% nongradient gels with
8 M urea. Rat ETL (rETL)-Myc was visualized using mouse
monoclonal anti-Myc antibody (Oncogene Research Products) and the
appropriate secondary antibody for ECL detection (Amersham Pharmacia
Biotech). Peroxidase-labeled goat anti-human antibody (Kirkegaard & Perry Laboratories), followed by ECL detection, was used for ETL-Fc
protein visualization. Membrane preparations were processed as
described (17). Conditioned medium from COS-7 cells, transiently
transfected with the 1-455-Myc extracellular domain of ETL was
concentrated using a Centricon-3 spin column and loaded on
SDS-polyacrylamide gels along with total cell lysates.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (42K):
[in a new window]
Fig. 1.
ETL expression is up-regulated in the adult
heart. A, to characterize differences in gene
expression in adult and fetal hearts, we conducted a differential
display analysis of mRNAs from rat cardiac myocytes from embryonic
day 16, postnatal day 1, day 3, day 5, and day 12 rat hearts.
The arrow indicates the differentially displayed RT-PCR
product, clone 69, subsequently named rETL. B, to confirm
the regulated expression of rETL, we performed Northern analysis using
the PCR amplicon from the differential display as a probe on whole rat
heart poly(A+) RNA blots. Lanes represent rat
heart RNA from the fetal stage embryonic day 16 through postnatal day
12, as designated. A probe for GAPDH was used as a normalization
control. The data on differential expression of rETL were reproduced
using three different batches of mRNA. C, Northern
analyses of the hETL transcript using total RNA from human fetal (3 months) and adult heart, as designated. The blot was probed with human
ETL cDNA. D, Northern blot of poly(A+) RNA
from rat adult tissues probed with rat ETL cDNA. The
lane marked muscle represents skeletal
muscle.
Exons of human ETL are contained within three contigs of BAC
RP11-29e12

View larger version (25K):
[in a new window]
Fig. 2.
rETL is a putative seven-transmembrane
receptor with extracellular EGF-like domains. To derive a
predicted structure of rETL, we used motif and hydropathy searches.
From top to bottom, the rETL N-terminal
extracellular domain, followed by a transmembrane domain crossing the
lipid bilayer seven times and a short cytoplasmic tail. A putative
signal peptide cleavage site and an endoproteolytic cleavage site near
the first transmembrane domain are designated by arrows.
Amino acids, immediately preceding and following the cleavage sites,
are shown. Ovals represent EGF-like modules in the
extracellular domain. The conserved cysteines in the Cys-rich domain of
the G-protein-coupled receptor proteolysis domain and transmembrane and
cytoplasmic domains are designated by SHn, where
n is the amino acid number. The drawing is not to
scale.

View larger version (64K):
[in a new window]
Fig. 3.
ETL is related to the secretin peptide
hormone receptor family and has a conserved G- protein-coupled receptor
proteolysis domain. A, rat and human ETL transmembrane
domains were aligned with several members of the secretin receptor
family. GenBankTM accession numbers are given in
parentheses. h, r, or m,
sequence from human, rat, or mouse species. The aligned proteins are as
follows: rCL1/latrophilin, receptor for latrotoxin; rCL2; rCL3;
epidermal growth factor module-containing mucin-like receptor 1 (hEMR1); leukocyte antigen (hCD97); vasoactive
intestinal peptide receptor (hVIPR); secretin receptor
(hSECR); glucagon receptor (hGLUCR); and
corticotropin-releasing factor receptor (hCTRFR).
Transmembrane domains are shown in blocks and designated as
TM1 to TM7; identical amino acids are shown in white on
dark gray background and designated by
an asterisk. Conservative (colon) and semiconservative
(peri- od) amino acid changes are shown in light
gray columns. Alignments were built using
ClustalW. B, amino acids in the Cys-rich proteolysis domain
of rat and human ETLs were aligned with several transmembrane molecules
carrying this domain. Aligned proteins included seven-transmembrane
receptors CL1, CL2, CL3, hCD97, lectomedin-1
(hLec1),
Celsr1 receptor, (hCelsr1), Flamingo seven-pass
transmembrane cadherin (mFlamingo), brain-specific
angiogenesis inhibitor 3 (hBAI3), and serpentine receptor
(mCYT28). Other molecules, such as KIAA0279, h287,
hR29368_2, hMEGF2, and hTM7XN1, are putative TM7 receptors. CeB0286 is
a Caenorhabditis elegans putative G-protein-coupled
receptor; SuREJ is a Strongylocentrotus
purpuratus sperm receptor for egg jelly.
GenBankTM accession numbers are given in
parentheses. The putative proteolytic processing site is
shown by an arrow, and the location of the mutation in
rETL*T455A is indicated by a white letter
above the arrow.

View larger version (57K):
[in a new window]
Fig. 4.
rETL forms a dimer and undergoes
endoproteolytic cleavage in transfected COS-7 cells.
A-F, Western blot analysis of total proteins obtained from
transiently transfected COS-7 cells, lysed as indicated below. Proteins
were resolved on gradient gels, stained with monoclonal anti-Myc
antibody followed by ECL detection. A, cells were
transfected with pcDNA-ETL-Myc constructs or control vector as
indicated and lysed in triple detergent. Note that both rETL and
rETL*T455A display 175- and 85-kDa proteins, suggesting dimer
formation. B, cells were transfected as in A and
lysed with 6 M guanidine hydrochloride, precipitated, and
dissolved in 8 M urea. Note that under highly denaturing
conditions, the ratio of 175- to 85-kDa protein is much higher for the
mutant clone than for wild type. C, membrane proteins from
COS-7 cells, transfected as in A, were lysed in Triton
detergent. Note that sizes of the detected rETL and rETL*T455A peptides
correspond to the cleaved and uncleaved dimers, respectively. The
85-kDa species were not detected in these experiments. The faint band
between the two arrows is ~120 kDa and may
correspond to a dimer of cleaved and uncleaved rETL. D,
cells were transfected and lysed as in A and resolved on
7.5% SDS-polyacrylamide gel containing 8 M urea in the gel
and sample buffer. Note that these denaturing conditions revealed a
proteolytic cleavage of rETL. As predicted, mutant rETL resisted
cleavage. E, cells on the left were transfected
with the construct of extracellular domain of rETL (aa 1-483), fused
to Fc. On the right, cells were transfected with the
construct of extracellular domain of rETL N-terminal to the cleavage
site (aa 1-455, including Thr455 at the cleavage site),
fused to Fc. Anti-Fc antibody and subsequent ECL were used in
detection. Note that amino acids 456-483 are required for proteolytic
cleavage. F, COS-7 cells were transfected with rETL (aa
1-455) tagged with Myc. Conditioned medium (ETL455sup) was
collected, and cell lysates (ETL455cell) were prepared as in
A. Note that the extracellular domain is a soluble
extracellular peptide. Two bands below the 62-kDa arrow in
the ETL455cell lane represent the nonspecific antibody
binding, as determined by mock transfections as well.

View larger version (14K):
[in a new window]
Fig. 5.
ETL is localized to plasma membrane and
cytoplasmic vesicles. A, the expression vector carrying
rETL-Myc was transfected into COS-7 cells. Transfected cells were
examined for the expression and localization of rETL-Myc
protein. Rat ETL-Myc was detected in permeabilized cells with mouse
anti-Myc antibody, followed by incubation with a secondary antibody
conjugated to biotin and streptavidin-Alexa-594. Fluorescent cells were
examined using confocal laser scanning microscopy. B, cells
transfected with rETL-Myc were serum-starved for 4 h and examined
by confocal laser microscopy.

View larger version (127K):
[in a new window]
Fig. 6.
ETL is expressed in cardiac myocytes and
vascular and bronchiolar smooth muscle. Paired paraffin sections
of 2-week-old rat hearts and lungs were hybridized with DIG-labeled
antisense probes on the left and sense probes on the
right. The in situ hybridization signal was
detected as a purple product of the bound nitro blue
tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate (Roche
Molecular Biochemicals). Sections were counterstained in 0.5% methyl
green. Magnifications of × 25-125 were used to accommodate the
sizes of stained structures. A and B,
cross-section of heart, at the level of the ventricle, exhibiting a
dense cardiomyocyte population (magnification × 125).
C and D, cross-section of a coronary vessel in
the epicardial layer of the heart (magnification × 125).
E and F, cross-section of a pulmonary arteriole
(magnification × 100). G and H, lung
bronchiole, cross-section (× 25 magnification). Sections probed with
sense and antisense probes were hybridized and developed in
parallel.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-hydroxylation site
inside EGF domain, is likely to stabilize protein-protein interactions of rETL (32). Most of the members of the EGF-TM7 family display this
Ca2+-binding feature, suggesting a common mechanism for
ligand binding. To date, the only known ligand for the EGF-TM7 receptor
family is CD55, or decay-accelerating factor, a complement component. CD55 interacts with one of the isoforms of the CD97 receptor that is
expressed on the cell surface of leukocytes (33). CD97 carries several
tandem EGF repeats, and deletion analyses showed that binding requires
both Ca2+-EGF domains and Ca2+ for ligand
binding (34). In several human tissues examined, the
Ca2+-binding EGF domain of hETL appears to be spliced out.
However, protein motif analyses detected another potential
Ca2+-binding domain in hETL, an EF-hand signature sequence.
This human-specific domain is present in a large family of
calcium-binding proteins (35).
-latrotoxin, a
toxin from the black widow spider (39). Recent studies showed that
latrophilin tethers
-latrotoxin to the membrane, initiating
Ca2+ channel formation (39). The proteolysis domain shared
with CL1-3 receptors is present in all EGF-TM7 receptor family
members. Recently, this motif has been identified in other
transmembrane molecules, such as polycystin-1 (PKD1) (28), the protein
defective in ADPKD polycystic kidney disease (40), and two other
PKD1-related proteins, sea urchin egg jelly receptor, REJ, and its
human homolog, PKDREJ (41, 42). The latter three proteins exhibit a
different number of membrane helices, from 1 to 11. However, similar to CL1, these proteins support extracellular Ca2+ influx after
activation, functional characteristics thought to be due to the common
proteolysis domain and first transmembrane domain (28). This
commonality supports the hypothesis that ETL, upon activation, is
involved in cation influx.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Sutip Navankasattusas, Andrew Thorburn, and Alex Nechiporuk for review of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by an award from Bristol-Meyers Squibb (to M. T. K).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF192401, AF192402, and AF192403.
** To whom correspondence should be addressed. Tel.: 617-355-2111; Fax: 617-730-8317; E-mail: mkeating@genetics.med.harvard.edu.
Published, JBC Papers in Press, October 24, 2000, DOI 10.1074/jbc.M004814200
2 T. Nechiporuk, unpublished observation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: TM7, seven-transmembrane; GCPR, G-protein-coupled receptor; Celsr1, cadherin EGF LAG seven-pass G-type receptor; EMR1, epidermal growth factor module-containing mucin-like receptor 1; EGF, epidermal growth factor; PCR, polymerase chain reaction; RT-PCR, reverse transcription-PCR; contig, group of overlapping clones; DIG, digoxygenin; rETL and hETL, rat and human ETL, respectively; aa, amino acid(s); bp, base pair(s); GPS, GPCR proteolysis site; BAC, bacterial artificial chromosome.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Zak, R. (1984) Growth of the Heart in Health and Disease , pp. 140-150, Raven Press, New York |
| 2. | Anversa, P., Olivetti, G., and Loud, A. V. (1980) Circ. Res. 46, 495-502 |
| 3. | Engelmann, G. L., Campbell, S. E., and Rakusan, K. (1996) Mol. Cell Biochem. 163, 47-56 |
| 4. | Durocher, D., Grepin, C., and Nemer, M. (1998) Recent Prog. Horm. Res. 53, 7-23 |
| 5. | Engelmann, G. L. (1993) Cardiovasc. Res. 27, 1598-1605 |
| 6. | Cheng, W., Reiss, K., Kajstura, J., Kowal, K., Quaini, F., and Anversa, P. (1995) Lab. Invest. 72, 646-55 |
| 7. | Zhao, Y. Y., Sawyer, D. R., Baliga, R. R., Opel, D. J., Han, X., Marchionni, M. A., and Kelly, R. A. (1998) J. Biol. Chem. 273, 10261-10269 |
| 8. | Sheikh, F., Jin, Y., Pasumarthi, K. B., Kardami, E., and Cattini, P. A. (1997) Mol. Cell Biochem. 176, 89-97 |
| 9. | Zhu, X., Sasse, J., McAllister, D., and Lough, J. (1996) Dev. Dyn. 207, 429-38 |
| 10. | Watson, S. P., and Arkinstall, S. (1994) The G-protein Linked Receptor Factsbook , pp. 1-291, Academic Press, London |
| 11. | Luttrell, L. M., van Biesen, T., Hawes, B. E., Koch, W. J., Krueger, K. M., Touhara, K., and Lefkowitz, R. J. (1997) Adv. Second Messenger Phosphoprotein Res. 31, 263-277 |
| 12. | Luttrell, L. M., Daaka, Y., Della Rocca, G. J., and Lefkowitz, R. J. (1997) J. Biol. Chem. 272, 31648-31656 |
| 13. | Laburthe, M., Couvineau, A., Gaudin, P., Maoret, J. J., Rouyer-Fessard, C., and Nicole, P. (1996) Ann. N. Y. Acad. Sci. 805, 94-111 |
| 14. | Ulrich, C. D., II, Holtmann, M., and Miller, L. J. (1998) Gastroenterology 114, 382-397 |
| 15. | McKnight, A. J., and Gordon, S. (1998) J. Leukocyte Biol. 63, 271-280 |
| 16. | Hadjantonakis, A. K., Sheward, W. J., Harmar, A. J., de Galan, L., Hoovers, J. M., and Little, P. F. (1997) Genomics 45, 97-104 |
| 17. | Abe, J., Suzuki, H., Notoya, M., Yamamoto, T., and Hirose, S. (1999) J. Biol. Chem. 274, 19957-19964 |
| 18. | Krasnoperov, V. G., Bittner, M. A., Beavis, R., Kuang, Y., Salnikow, K. V., Chepurny, O. G., Little, A. R., Plotnikov, A. N., Wu, D., Holz, R. W., and Petrenko, A. G. (1997) Neuron 18, 925-937 |
| 19. | Sugita, S., Ichtchenko, K., Khvotchev, M., and Sudhof, T. C. (1998) J. Biol. Chem. 273, 32715-32724 |
| 20. | Baud, V., Chissoe, S. L., Viegas-Pequignot, E., Diriong, S., N'Guyen, V. C., Roe, B. A., and Lipinski, M. (1995) Genomics 26, 334-344 |
| 21. | McKnight, A. J., Macfarlane, A. J., Dri, P., Turley, L., Willis, A. C., and Gordon, S. (1996) J. Biol. Chem. 271, 486-489 |
| 22. | Hamann, J., Eichler, W., Hamann, D., Kerstens, H. M., Poddighe, P. J., Hoovers, J. M., Hartmann, E., Strauss, M., and van Lier, R. A. (1995) J. Immunol. 155, 1942-1950 |
| 23. | Thorburn, J., Xu, S., and Thorburn, A. (1997) EMBO J. 16, 1888-1900 |
| 24. | Navankasattusas, S., Zhu, H., Garcia, A. V., Evans, S. M., and Chien, K. R. (1992) Mol. Cell. Biol. 12, 1469-1479 |
| 25. | Sambrook, J., Maniatis, T., and Fritsch, E. F. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY |
| 26. | Bray-Ward, P., Menninger, J., Lieman, J., Desai, T., Mokady, N., Banks, A., and Ward, D. C. (1996) Genomics 32, 1-14 |
| 27. | Ozeki, Y., Matsui, T., Suzuki, M., and Titani, K. (1991) Biochemistry 30, 2391-2394 |
| 28. | Ponting, C. P., Hofmann, K., and Bork, P. (1999) Curr. Biol. 9, 585-588 |
| 29. | Krasnoperov, V., Bittner, M. A., Holz, R. W., Chepurny, O., and Petrenko, A. G. (1999) J. Biol. Chem. 274, 3590-3596 |
| 30. | Pak, Y., O'Dowd, B. F., Wang, J. B., and George, S. R. (1999) J. Biol. Chem. 274, 27610-27616 |
| 31. | Ayad, S. (1998) The Extracellular Matrix Factsbook , 2nd Ed. , Academic Press/Harcourt Brace, San Diego |
| 32. | Selander-Sunnerhagen, M., Ullner, M., Persson, E., Teleman, O., Stenflo, J., and Drakenberg, T. (1992) J. Biol. Chem. 267, 19642-19649 |
| 33. | Hamann, J., Vogel, B., van Schijndel, G. M., and van Lier, R. A. (1996) J. Exp. Med. 184, 1185-1189 |
| 34. | Hamann, J., Stortelers, C., Kiss-Toth, E., Vogel, B., Eichler, W., and van Lier, R. A. (1998) Eur. J. Immunol. 28, 1701-1707 |
| 35. | Heizmann, C. W., and Hunziker, W. (1991) Trends Biochem. Sci. 16, 98-103 |
| 36. | Schoneberg, T., Schultz, G., and Gudermann, T. (1999) Mol. Cell. Endocrinol. 151, 181-193 |
| 37. | Schreiber, R. E., Prossnitz, E. R., Ye, R. D., Cochrane, C. G., and Bokoch, G. M. (1994) J. Biol. Chem. 269, 326-331 |
| 38. | Liaw, C. W., Grigoriadis, D. E., Lorang, M. T., De Souza, E. B., and Maki, R. A. (1997) Mol. Endocrinol. 11, 2048-2053 |
| 39. | Hlubek, M. D., Stuenkel, E. L., Krasnoperov, V. G., Petrenko, A. G., and Holz, R. W. (2000) Mol. Pharmacol. 57, 519-528 |
| 40. | Rondeau, E. (1995) Nephrologie 16, 338-339 |
| 41. | Hughes, J., Ward, C. J., Aspinwall, R., Butler, R., and Harris, P. C. (1999) Hum. Mol. Genet. 8, 543-549 |
| 42. | Moy, G. W., Mendoza, L. M., Schulz, J. R., Swanson, W. J., Glabe, C. G., and Vacquier, V. D. (1996) J. Cell Biol. 133, 809-817 |
This article has been cited by other articles:
![]() |
E. Wallgard, E. Larsson, L. He, M. Hellstrom, A. Armulik, M. H. Nisancioglu, G. Genove, P. Lindahl, and C. Betsholtz Identification of a Core Set of 58 Gene Transcripts With Broad and Specific Expression in the Microvasculature Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1469 - 1476. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yona, H.-H. Lin, P. Dri, J. Q. Davies, R. P. G. Hayhoe, S. M. Lewis, S. E. M. Heinsbroek, K. A. Brown, M. Perretti, J. Hamann, et al. Ligation of the adhesion-GPCR EMR2 regulates human neutrophil function FASEB J, March 1, 2008; 22(3): 741 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Q. Davies, G.-W. Chang, S. Yona, S. Gordon, M. Stacey, and H.-H. Lin The Role of Receptor Oligomerization in Modulating the Expression and Function of Leukocyte Adhesion-G Protein-coupled Receptors J. Biol. Chem., September 14, 2007; 282(37): 27343 - 27353. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wei, K. Hackmann, H. Xu, G. Germino, and F. Qian Characterization of cis-Autoproteolysis of Polycystin-1, the Product of Human Polycystic Kidney Disease 1 Gene J. Biol. Chem., July 27, 2007; 282(30): 21729 - 21737. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nardelli, L. Zaritskaya, W. McAuliffe, Y. Ni, C. Lincoln, Y. H. Cho, C. E. Birse, W. Halpern, S. Ullrich, and P. A. Moore Osteostat/Tumor Necrosis Factor Superfamily 18 Inhibits Osteoclastogenesis and Is Selectively Expressed by Vascular Endothelial Cells Endocrinology, January 1, 2006; 147(1): 70 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-H. Lin, G.-W. Chang, J. Q. Davies, M. Stacey, J. Harris, and S. Gordon Autocatalytic Cleavage of the EMR2 Receptor Occurs at a Conserved G Protein-coupled Receptor Proteolytic Site Motif J. Biol. Chem., July 23, 2004; 279(30): 31823 - 31832. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Moriguchi, K. Haraguchi, N. Ueda, M. Okada, T. Furuya, and T. Akiyama DREG, a developmentally regulated G protein-coupled receptor containing two conserved proteo |