|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 276, Issue 6, 4485-4493, February 9, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Microbiology, Ohio State University,
Columbus, Ohio 43210
Received for publication, August 17, 2000, and in revised form, November 8, 2000
Methanogenesis from dimethylsulfide
requires the intermediate methylation of coenzyme M. This reaction is
catalyzed by a methylthiol:coenzyme M methyltransferase composed of two
polypeptides, MtsA (a methylcobalamin:coenzyme M methyltransferase) and
MtsB (homologous to a class of corrinoid proteins involved in
methanogenesis). Recombinant MtsA was purified and found to be a
homodimer that bound one zinc atom per polypeptide, but no
corrinoid cofactor. MtsA is an active
methylcobalamin:coenzyme M methyltransferase, but also methylates
cob(I)alamin with dimethylsulfide, yielding equimolar
methylcobalamin and methanethiol in an endergonic reaction with a
Keq of 5 × 10 Methanosarcina species and related genera comprise a
branch of methanogenic euryarcheaota capable of methylotrophic
methanogenesis from compounds such as methanol, trimethylamine
(TMA),1 dimethylamine (DMA),
and monomethylamine (MMA) (1, 2). During methylotrophic methanogenesis,
substrate methyl groups are reduced to methane with reducing power
derived from the simultaneous oxidation of methyl groups to carbon
dioxide (1, 2).
In recent years, it has been found that methylated thiols such as
dimethylsulfide (DMS) and methylmercaptopropionate (MMPA) are also
methylotrophic methanogenic precursors (3-7). These compounds arise in
nature from processes such as the breakdown of methionine (8),
reduction of dimethyl sulfoxide (9), anaerobic degradation of
methoxylated aromatics (10, 11), photosynthesis by some anoxygenic
phototrophs (12), and demethylation of the osmolyte
dimethylsulfoniopropionate (13, 14). Since emission of DMS over the
open ocean is thought to influence cloud formation, the metabolism of
these compounds has wide-ranging implications (15).
Methanosarcina species such as Methanosarcina
acetivorans and Methanosarcina siciliae will couple
growth to methane production from the methylated thiols DMS and MMPA
(3, 4, 16, 17). In contrast, Methanosarcina barkeri was long
thought not to utilize methylthiols as methane precursors (18).
However, it was found that this species differentially expressed
enzymes to produce methane from DMS or MMPA depending upon its growth
substrate (19, 20). During growth on acetate, but not methanol, cells
of M. barkeri MS will convert either methylated thiol to
methane. Cell-free extracts of these cells will catalyze methylation of
coenzyme M (CoM) with either DMS or MMPA. Methyl-CoM is the precursor
of methane with all known methanogenic substrates, and its reduction is
the major site of energy conversation in methanogens (1, 2).
A single enzyme was identified and purified from acetate grown cells of
M. barkeri (21) that carries out CoM methylation with either
DMS or MMPA (19). This methylthiol:CoM methyltransferase is a 480-kDa
corrinoid protein that is comprised of equimolar amounts of 40- and
30-kDa subunits termed, respectively, MtsA and MtsB. One corrinoid
cofactor is bound per MtsA:MtsB pair, and six or seven MtsA:MtsB pairs
comprise the 480-kDa protein (21). The corrinoid cofactor in the Co(I)
state is methylated by DMS, while the methylated Co(III) corrinoid can
in turn be demethylated by CoM, regenerating the Co(I) corrinoid
cofactor (19). These results indicate that protein-bound corrinoid
serves as an intermediate in the methylation of CoM with DMS or
MMPA.
The methylation of CoM with methylated thiols such as DMS by a
two-subunit protein (19) stands in contrast with the three component
systems effecting CoM methylation with methanol (22-24), monomethylamine (25), dimethylamine (26), or trimethylamine (27) (Fig. 1, panel A). In the latter CoM
methylation pathways, a corrinoid-binding protein sequentially
interacts with two methyltransferases. Substrate:corrinoid
methyltransferases initiate the demethylation of the methanogenic
substrate and methylation of a cognate corrinoid protein that
specifically interacts with that methyltransferase (25, 26, 28). Each
cognate corrinoid protein is then demethylated by a methylcorrinoid:CoM
methyltransferase. In the case of the methylamines, the
methylcorrinoid:CoM methyltransferase is a single protein, MtbA (29). A
different yet homologous protein, MtaA, methylates CoM with the
methanol cognate corrinoid protein, MtaC (24).
The sequence of genes encoding the polypeptides effecting CoM
methylation with methylamines (26, 30-32) and methanol (24, 32) have
revealed similarities to the two subunits of the methylthiol:CoM methyltransferase (33) (see Fig. 1 and accompanying legend). MtsA is
50% similar over its entire length to the methylcorrinoid:CoM methyltransferases of the methylamine (MtbA) and methanol (MtaA) pathways. Consistent with this, the methylthiol:CoM methyltransferase has a methylcobalamin:CoM methyltransferase activity, which is significantly enhanced in the presence of SDS (34). Activity staining
of SDS-PAGE gels revealed that MtsA catalyzes methylcobalamin:CoM methyl transfer, while MtsB did not display this activity (34).
The primary structure of MtsB itself is on the average 50% similar to
the entire lengths of each of the cognate corrinoid proteins of the
methanol- and methylamine-dependent CoM methylation pathways (Fig. 1). The methylamine cognate corrinoid proteins each bind
one corrinoid per polypeptide (21, 26, 35), and these proteins as a
group are homologous to the cobalamin binding domains of methionine
synthase, as well as coenzyme B12-dependent enzymes (30, 33, 36). MtsB contains all expected signature residues for
binding corrinoid (33, 37) and is therefore the likely corrinoid
binding subunit of methylthiol:CoM methyltransferase. Thus, a clear
route for the demethylation of methylated MtsB corrinoid protein and
methylation of CoM can be proposed, in that MtsA mediates the
demethylation of MtsB and methylation of CoM (Fig. 1, panel B). It is striking, however, that MtsA:MtsB complex is
capable of demethylating DMS without a third polypeptide initiating
methyl transfer from DMS, such as seen in the otherwise completely
analogous pathways for CoM methylation from methanol or the
methylamines, such as MMA (Fig. 1,
panel A). This leaves the manner by which the
methylthiol:CoM methyltransferase effects demethylation of DMS an open
question. Unfortunately, efforts to physically separate the two
subunits using denaturants and chromatography to search for the sites
of the relevant subreactions have not yielded active preparations of
either subunit.2
To resolve this problem, we expressed MtsA as a recombinant protein,
and tested its ability to interact with CoM, DMS, and free cobalamin.
We find that MtsA acts both to demethylate DMS and to methylate CoM
using non-protein-bound cobalamin as an intermediate methyl carrier.
Thus, this subunit carries out both CoM methylation and DMS
demethylation and can account for both corrinoid-dependent methyltransferase activities of the methylthiol:CoM methyltransferase. This appears to not be a universal property of
methylcorrinoid:CoM methylases, since a representative homologous CoM
methylase, MtbA, does not interact with DMS in any detectable manner.
Chemicals and Reagents--
N2 was purchased from
Linde Specialty Gases (Columbus, OH) and passed through catalyst R3-11
(Chemical Dynamics Corp., South Plainfield, NJ) to remove
O2 prior to use. MOPS, 2-mercaptoethanesulfonate (CoM),
dithiothreitol (DTT), hydroxycobalamin, methylcobalamin, isopropyl-1-thio- Construction of MtsA Expression Vector--
The tandem
mtsA and mtsB genes characterized previously were
cloned as two separate restriction fragments inserted into pUC19. Subclones of these restriction fragments were used as described below
to assemble the complete gene in an expression vector (Fig. 2).
The 5' end of the gene was generated from pPT1500 by polymerase chain
reaction (PCR). One of the primers used to generate the PCR fragment
introduced a NdeI site overlapping the ATG start codon of
mtsA. Primer 40ex1 (ATGGATCCCATATGGTAAGTGAAATGACTCC) corresponded to the region +1 to +20 on the coding strand of
mtsA and had an additional 11 base pairs at the 5' end to
accommodate a BamHI and a NdeI site. Primer 40ex2
(CCAATCAAGCTTGCATCCCAAAACC) corresponded to +267 to +243 (relative to
the translational start) on the noncoding strand of mtsA and
had a HindIII site which was also present in the template.
The amplification reaction contained 5 units of Taq
polymerase (Life Technologies, Inc.), 20 mM Tris-HCl, pH
8.4, 50 mM KCl, 3.0 mM MgCl2, 200 µM each dNTP, 200 nM each primer, and 2.0 ng
of template DNA (pPT1500) in a final volume of 100 µl. The reaction
was carried out for 30 cycles of 96 °C, 30 s; 60 °C, 30 s; 72 °C, 2.0 min.
The amplified fragment was introduced into the pGEM-T vector (Promega,
Madison, WI) yielding pGEM-4. The latter construct was digested with
HindIII and SalI and ligated simultaneously with
a HindIII/PstI fragment of pPT600 and a
PstI/SalI fragment of pCO300 yielding pGEM-4HS. A
NdeI/SspI fragment from pGEM-4HS beginning with
the 5' end of mtsA and ending 61 base pairs downstream of
the translational mtsA stop was introduced into the pET-17b vector (Novagen, Madison, WI) digested with NdeI and
EcoRV and cloned into the stringent expression host
Escherichia coli BL21(DE3)pLysS (Novagen). This generated an
expression vector for MtsA (pET-40ex) driven from the IPTG-inducible
lacUV5 promoter and without the T7 tag that is otherwise
present in the pET-17b vector. The mtsA insert and flanking
vector regions were sequenced. The mtsA gene in the insert
was found to be identical to the previously characterized mtsA sequence (GenBankTM U36337) and correctly oriented in
the expression vector.
Preparation of MtsA and MtbA--
Cultures of E. coli
with pET-40ex were grown in Luria-Bertani broth (40) with 34 µg/ml
chloramphenicol and 100 µg/ml ampicillin to an optical density of 0.6 at 600 nm and induced with 0.4 mM IPTG at 37 °C with
aeration. Samples were removed at 1-h intervals for analysis by
polyacrylamide gel electrophoresis. Cultures were harvested 3 h
after induction, washed with 50 mM MOPS, pH 7.0, and
resuspended in 50 mM Tris, pH 8.0, with 2 mM
EDTA. Cells were lysed by passage through a French pressure cell at
20,000 pounds per square inch.
Cell debris was removed from the extract by centrifugation at 1000 × g for 5 min at 4 °C, and then the inclusion bodies
were pelleted by subsequent centrifugation at 27,000 × g for 15 min at 4 °C. The inclusion bodies were then
washed with 0.5, 1, and 2 M urea and again collected by
centrifugation before solubilization in anoxic 6 M
guanidine hydrochloride, 50 mM DTT, and 20 mM
2-mercaptoethanol. MtsA was refolded by rapid dilution of 1 part
solubilized inclusion bodies into 59 parts anaerobic 1 M
KCl, 10 mM DTT, 10 mM 2-mercaptoethanol, 100 µM ZnCl2, in 0.5 M Tris, pH 8.0. The solution was stirred for 20 h at 20-24 °C. All anoxic
solutions were prepared by repeated evacuation and flushing with
N2.
The refolded MtsA was concentrated by ultrafiltration, dialyzed against
50 mM MOPS, pH 6.5, and further purified by anion exchange
chromatography using an Uno column (Bio-Rad) equilibrated with 100 mM MOPS, pH 6.5. Proteins binding to the column were eluted
with a 50-500 mM NaCl gradient in the same buffer. MtsA eluted at ~130 mM NaCl.
MtbA, the methylcobalamin:CoM methyltransferase of methylamine
catabolism, (formerly known as MT2-A) was purified from M. barkeri as described previously (35).
Metal Analysis of MtsA--
MtsA was dialyzed to equilibrium
against 2 liters of 10 mM TES, pH 7.0, and 0.7 mg (2 ml)
dialyzed MtsA submitted for metal analysis. MtsA and a sample of the
dialysis buffer were analyzed for the content of 30 metals by plasma
emission on a Thermo Jarrell-Ash 965 inductively coupled argon plasma
spectrometer by the Chemical Analysis Laboratory (University of
Georgia, Athens, GA). The metal content for MtsA was determined by
subtraction of the metal content of the dialysis buffer from the metal
content of the dialyzed protein sample.
Gel Electrophoresis and Molecular Sieving--
Denaturing
polyacrylamide gel electrophoresis (12% acrylamide) was performed with
the buffer system of Laemmli (41) in the presence of 0.1% SDS, using a
Mini-slab electrophoresis system (Idea Scientific Co., Minneapolis,
MN). Samples for electrophoresis were prepared with 5%
2-mercaptoethanol, 1% SDS, 10% glycerol, and 0.002% bromthymol blue
and were heated to 80 °C for 15 min prior to electrophoresis.
Molecular size markers (Bio-Rad) were
The molecular mass of renatured recombinant MtsA was estimated with a
Biologic medium pressure chromatography unit (Bio-Rad) equipped with a
Superose 6HR column (Amersham Pharmacia Biotech) and eluted with 100 mM NaCl, 50 mM MOPS, pH 7.0, at a flow rate of
0.4 ml/min. Molecular mass standards (Sigma) for the Superose 6HR
column included Methylcobalamin:CoM Methyltransferase Activity--
CoM
methylation with methylcobalamin was measured by either the cyanide
derivatization assay or by direct spectral assay. For the cyanide
derivatization assay, samples (300 µl) were prepared in
nitrogen-flushed vials at 4 °C containing 1-20 µg of MtsA or MtbA, 1 mM methylcobalamin, and 20 mM CoM in
MOPS buffer, pH 7.0, unless otherwise stated. Concentrations of
methylcobalamin and CoM were varied for determination of apparent
Km values. Reactions were initiated by transfer of
the vials to 37 °C, and methyltransferase activity and the reaction
rates determined by periodic removal of aliquots that were subjected to
the cyanide derivatization (42). In the cyanide derivatization
procedure, hydroxycobalamin reacts with cyanide to generate
dicyanocobalamin while methylcobalamin does not react with cyanide (42,
43). Rates were determined with a minimum of three linear time points. The apparent Km value reported in the paper were the average of two determinations that varied by no more than 6%, the only
exception being the apparent Km value for CoM in the
methylcobalamin:CoM methyltransferase reaction, which is an average of
five separate determinations with S.D.
Methylcobalamin:CoM methyltransferase activity was also quantified by
measuring the decrease in absorbance at 540 nm upon methylcobalamin
demethylation (10) in the presence of 0.2 mM methylcobalamin in N2-flushed cuvets (1-cm pathlength)
under dim red light at 22 °C. Samples (750 µl) were prepared with
5 µg of MtbA and 40 µM CoM in MOPS buffer, pH 7.0.
DMS:Cob(I)alamin Methyl Transfer--
Cob(I)alamin methylation
was monitored by the increase in absorbance at 540 nm upon methylation
(10). Methyl transfer was performed in N2-flushed cuvets
(2-mm pathlength) under dim red light at 22 °C. Assays were
performed with 0.18-1.2 mg/ml MtsA or MtbA, 0.5-2.5 mM
cob(I)alamin, and 20-200 mM soluble DMS. Cob(I)alamin was
generated from an equal amount of hydroxycob(III)alamin and 6-fold
greater concentration of titanium(III) citrate.
Methanethiol (MSH) generated from the
cob(I)alamin-dependent demethylation of DMS was measured by
gas chromatography using a model 8A gas chromatograph (Shimadzu
Scientific Instruments, Columbia, MD) equipped with a flame ionization
detector and a 0.5-meter Poropak R column (Alltech Associates Inc.,
Deerfield, IL). The column, injector, and detector were at 130 °C.
The carrier gas was nitrogen at flow rate of 20 ml/min. It was
determined that, under the conditions of the assay, 84% of total MSH
in the closed vial was in the liquid phase of the reaction mixture at equilibrium.
DMS:CoM Methyl Transfer--
MtsA catalyzed CoM methylation with
DMS in the presence of 1 mM cob(I)alamin was measured by
monobromobimane derivatization of thiols and analysis of bimane
derivatives by reverse phase HPLC as described previously (19) and
based on the procedures of Fahey and co-workers (44, 45). Reactions
were performed in N2-flushed vials under dim red light at
37 °C. Reactions contained 0.53 mg/ml MtsA or 1.2 mg/ml MtbA, 10 mM CoM, 100 mM DMS, and 1 mM
cob(I)alamin generated from the reduction of 1 mM
hydroxycobalamin by 6 mM titanium(III) citrate. Samples
were removed at 30-min intervals for monobromobimane derivatization.
Reactions were performed in duplicate.
Heterologous Expression of MtsA--
Methylcobalamin:CoM
methyltransferase activity was quantified in cells of E. coli BL21(DE3)pLysS transformed with pET-40ex using an assay based
on cyanide derivatization of the hydroxycobalamin produced from
oxidation of the cob(I)alamin generated by demethylation of
methylcobalamin (42). The 30,000 × g supernatant of
extracts made with pET-40x-transformed cells catalyzed
CoM-dependent demethylation of 16 nmol of methylcobalamin
min
The inclusion bodies were harvested from cells 3 h after induction
and solubilized using 6 M guanidine hydrochloride, 50 mM DTT, and 20 mM 2-mercaptoethanol. The
solubilized protein was diluted 60-fold with a variety of refolding
buffers, pH 8.0, and methylcobalamin:CoM methyltransferase activity was
measured at 1, 4, and 24 h after dilution. Optimal activity was
achieved by protein refolding at room temperature for 24 h in
refolding buffer consisting of 500 mM Tris, pH 8.0, 1 M KCl, 10 mM DTT, 10 mM
2-mercaptoethanol, and 100 µM ZnCl2.
Refolding buffers containing 500 mM guanidine hydrochloride, 33 mM CHAPS, 0.5% Triton X-100, 5 mM SDS, or 20% glycerol did not produce active
methyltransferase, nor did refolding at 4 °C in the optimal
refolding buffer. Preparations of recombinant MtsA made without
addition of zinc typically had 3-fold lower methylcobalamin:CoM
methyltransferase activity than MtsA refolded in the presence of added zinc.
The solubilized and refolded MtsA was further purified by a subsequent
anion exchange chromatography step. SDS-PAGE of the purified
recombinant MtsA preparation revealed a single homogenous polypeptide
with a molecular mass of 41 kDa (Fig. 3). Approximately 40 mg of
purified MtsA was obtained from 1 liter of induced recombinant cells.
The purified recombinant enzyme catalyzed methylcobalamin:CoM methyl
transfer at 15.8 µmol min Characteristics of Recombinant MtsA--
Methylcorrinoid:CoM
methyltransferases are typically monomers in solution. However, the
molecular mass of purified and refolded MtsA was determined by size
exclusion chromatography as 77 kDa, indicating recombinant MtsA is a
homodimer in solution. The purified protein was examined for metals by
plasma emission spectroscopy. The only metal bound at stoichiometric
levels was zinc, and the purified protein bound 1.06 nmol of zinc/nmol
of MtsA polypeptide. Any cobalt bound to the enzyme was below the lower
level of detection, which was 0.1 cobalt/polypeptide. The spectrum of
MtsA was essentially featureless except for the peak at 279 nm, indicating that the enzyme as isolated from E. coli bound no corrinoid or other UV-visible detectable prosthetic
group. An extinction coefficient of 86.9 mM
Kinetic analysis of the methylcobalamin:CoM methyltransferase reaction
catalyzed by the recombinant enzyme was undertaken. The reaction did
not appear to be first order with respect to methylcobalamin in the
presence of 40 mM CoM and best fit a curve approaching
saturation with this substrate (Fig. 4).
However, complete saturation of the reaction rate was not possible due to the limited solubility of methylcobalamin (Fig. 4). The data allowed
calculation of an apparent Km value of 5.5 mM methylcobalamin and an apparent
Vmax of 103 µmol of CoM methylated min MtsA Is a DMS:Cob(I)alamin Methyltransferase--
Methylthiol:CoM
methyltransferase-bound corrinoid has been implicated as a methylated
intermediate in the methylation of CoM with DMS. As quantified above,
recombinant MtsA catalyzes methylcobalamin:CoM methyl transfer
activity, confirming the previously reported role of this subunit in
the demethylation of corrinoid bound to MtsB and methylation of CoM. To
determine if MtsA might also be involved in the methylation of
MtsB-bound corrinoid with methylated thiols such as dimethylsulfide,
MtsA was examined for its ability to catalyze methylation of
cob(I)alamin with DMS.
Cob(I)alamin was generated by reduction of 1 mM
hydroxycobalamin with 6 mM Ti(III)citrate, and
DMS:cob(I)alamin methyl transfer measured as the increase in absorbance
at 540 nm (10). MtsA catalyzed the methylation of 78 nmol of
cob(I)alamin min
Saturation with increasing concentrations of DMS was observed for the
initial rates of the DMS:cob(I)alamin methyltransferase reaction
catalyzed by MtsA. In the presence of 1 mM cob(I)alamin, MtsA had an apparent Km for DMS of 33 mM, and an apparent Vmax of 98 nmol
min
The DMS:cob(I)alamin reaction did not proceed to completion. Addition
of fresh MtsA to reactions that had ceased did not result in further
cob(I)alamin methylation; however, addition of more DMS to reactions
that had ceased did result in further cob(I)alamin methylation (Fig. 5,
panel E). This indicated that the reaction ceased
because equilibrium had been reached. An equilibrium constant of
5.4 ± 0.4 × 10
The dependence on cob(I)alamin of DMS demethylation by MtsA was
examined more closely using a high amount of MtsA in the absence of
cob(I)alamin to sensitively detect DMS-dependent
methanethiol formation. MtsA (19.5 nmol) incubated with 100 mM DMS for 30 min did not produce any detectable
methanethiol. The lower limit of detection under these conditions was
200 pmol of methanethiol. To liberate any acid-labile methanethiol
bound to the enzyme, 1 M HCl was subsequently added to the
reaction mixture to denature MtsA. However, no methanethiol was
detected after acidification. These results indicate that demethylation
of DMS by MtsA obligatorily requires the presence of cob(I)alamin.
The methylamine-specific methylcobalamin:CoM methyltransferase, MtbA,
did not catalyze any detectable methyl transfer from DMS to
cob(I)alamin when 1.2 mg of MtsA/ml was incubated with 2.5 mM cob(I)alamin and 100 mM DMS and monitored
for as long as 8 h. Assuming the same linear rate observed for
MtsA mediated DMS:cob(I)alamin methyl transfer, this assay would have
detected an activity as low as 70 pmol of cob(I)alamin methylated
min DMS:CoM Methyl Transfer Is Catalyzed by MtsA and
Cob(I)alamin--
The above results demonstrated that MtsA alone
can carry out both DMS:cob(I)alamin methyl transfer, as well as
methylcobalmin:CoM methyl transfer. This indicated that MtsA possessed
the active sites for both half reactions of the methylation of CoM with
DMS; therefore, it was tested if DMS:CoM methyl transfer could be
catalyzed solely by recombinant MtsA with the corrinoid cofactor bound
to the native methylthiol:CoM methyltransferase replaced by free cob(I)alamin.
MtsA was incubated in the presence of 1 mM cob(I)alamin
(generated with 6 mM Ti(III)citrate and hydroxycobalamin),
100 mM DMS, and 10 mM CoM. Methyl transfer from
DMS to CoM was assayed by monobromobimane derivatization of the
unmethylated thiol of CoM and subsequent HPLC analysis. This assay has
been previously demonstrated to accurately measure
DMS-dependent CoM methylation, and due to the presence of
the strongly reducing Ti(III)citrate is not subject to interference
from CoM oxidation to the dithiol derivative (19). Under these
conditions, MtsA catalyzed DMS:CoM methyl transfer (Fig.
6) at a rate of 18.7 nmol of CoM
methylated min
The methylamine-specific CoM methylase, MtbA, did not catalyze DMS:CoM
methyl transfer at a detectable rate under the same conditions used to
assay methyl transfer by MtsA (Fig. 6). MtbA (1.2 mg/ml) was monitored
for this activity for as long as 8 h. Assuming the same linear
rate of reaction observed with the DMS:CoM methyltransferase reaction
catalyzed by MtsA and cob(I)alamin, this would have been sufficient to
detect 0.4 nmol of CoM methylated min DMS Is a Competitive Inhibitor of MtsA-catalyzed CoM
Methylation--
The ability of MtsA to carry out both DMS
demethylation and CoM methylation with cobalamin intermediates
raised the question as to whether one or two active sites might exist
on MtsA for DMS demethylation and CoM methylation. MtsA-catalyzed
methylcobalamin:CoM methyl transfer is 160-fold faster compared with
DMS:cob(I)alamin methyl transfer; therefore, it was decided to study
the effect of DMS on the former reaction, since this would limit the
effects of product removal on kinetic analysis.
A plot of the reciprocals of the initial rates of methylcobalamin:CoM
methyl transfer versus different concentrations of CoM in
the presence of different amounts of DMS revealed a pattern of DMS
inhibition of CoM methylation that was most consistent with DMS acting
as a competitive inhibitor of the methylcobalamin:CoM methyltransferase
reaction (Fig. 7, panel
A). A replot of the slopes of the lines of the reciprocal
plots versus the concentration of DMS allowed determination
of an apparent Ki value for DMS as 14.2 mM.
The above results suggested that DMS inhibited MtsA CoM methylation
with methylcobalamin due to competition with CoM at the same active
site. As a further test of this model, the mode of inhibition of DMS
relative to the methylcobalamin was also examined. A double-reciprocal
plot of the rate of the methylcobalamin:CoM methyl transfer reaction
versus methylcobalamin in the presence of different fixed
concentrations of DMS revealed a pattern most consistent with mixed
inhibition of methylcobalamin demethylation by DMS (Fig. 7,
panel B).
DMS Does Not Detectably Inhibit MtbA--
DMS did not
significantly inhibit methylcobalamin:CoM methyltransferase reaction
catalyzed by MtbA, the methylcobalamin:CoM methyltransferase of
methylamine catabolism, when assayed by the dicyano derivatization
assay in the presence of 20 mM CoM and 1 mM
methylcobalamin. However, since MtbA has been shown to have a
relatively low apparent Km for CoM, the potential
for DMS as a competitive inhibitor of the methylcobalamin:CoM methyl transfer reaction catalyzed by MtbA was also tested at lower CoM concentrations. Our purified preparations of MtbA had an apparent Km of 38 µM in the presence of 200 µM methylcobalamin, which compared favorably to 35 µM CoM in the presence of 50 µM methylcobalamin reported previously by LeClerc and Grahame (32). Therefore, DMS was tested as a competitive inhibitor of the
methylcobalamin:CoM methyl transfer reaction by MtbA with initial
concentrations of 40 µM CoM and 200 µM
methylcobalamin. The specific activity of purified MtbA was 8.9 µmol
min The methylation of CoM with methanol or methylamines requires
three different polypeptides (24-27). CoM methylation with DMS or MMPA
is different, requiring an enzyme composed of two tightly complexed
polypeptides. The results presented here resolve this apparent anomaly
in the pathways for initiation of methanogenesis from methylotrophic
substrates. MtsA, the CoM methylase subunit of the methylthiol:CoM
methyltransferase, is capable of both subreactions necessary for the
methylation of CoM by DMS.
Our current results indicate methylation and demethylation of
enzyme-bound corrinoid in the native methylthiol:CoM methyltransferase is mediated by MtsA. Our previous work has shown that the corrinoid cofactor bound to the native methylthiol:CoM methyltransferase can
serve as an intermediate methyl carrier in DMS:CoM methyl transfer (19,
34). DMS will methylate the enzyme-bound Co(I) corrinoid, and CoM will
demethylate the methylated enzyme-bound corrinoid. Recombinant MtsA
itself does not possess tightly bound corrinoid; however, this protein
does react with non-protein-bound corrinoid. MtsA carries out the
methylation of cob(I)alamin with DMS, and the methylation of CoM with
methylcobalamin. In the presence of DMS, CoM, and cob(I)alamin, MtsA
will catalyze the DMS:CoM methyl transfer reaction. Taken together, our
current and previous observations support a model of methylthiol:CoM
methyltransferase action in which MtsA methylates enzyme-bound
corrinoid with DMS, and subsequently demethylates that same bound
corrinoid with CoM during DMS:CoM methyl transfer.
One corrinoid is bound per MtsA:MtsB pair, and it is most likely that
the cofactor is bound to MtsB. MtsB is highly similar to the entire
length of methylotrophic corrinoid proteins such as MttC, MtbC, or MtmC
(30, 33). These latter proteins bind one corrinoid cofactor per
polypeptide (21, 26, 27, 35). MtsA thus appears to have the essential
methyltransferase activities for DMS:CoM methyl transfer with corrinoid
as an intermediate methyl carrier, with MtsB serving to direct close
interaction of its corrinoid cofactor with the methyltransferase active
site of MtsA. In this, MtsB is similar to other corrinoid proteins involved in CoM methylation with methylotrophic substrates such as
monomethylamine (25), dimethylamine (26), or methanol (28), which as
yet have no detectable enzymatic capabilities and interact specifically
with certain methyltransferases. The role of MtsB in presenting the
corrinoid cofactor to MtsA is quite dramatically illustrated by the
100-fold faster rate of DMS demethylation by the intact MtsA:MtsB
complex (19) relative to the rates observed here with only MtsA.
The methylation and demethylation of corrinoid during
DMS:CoM methyl transfer may require only a single active site,
since in essence DMS demethylation by Co(I) corrinoid is functionally analogous to the reversal of methylcorrinoid:CoM methyl transfer. Our
current data demonstrate that DMS is a competitive inhibitor with
respect to CoM of the methylcobalamin:CoM methyltransferase reaction
mediated by MtsA. Although it remains possible that DMS binds to a
separate site on MtsA and deforms the CoM active site, the most
straightforward interpretation of competitive inhibition is that the
demethylation of DMS and methylation of CoM share at least some of
the same active site determinants.
The relatively high apparent Km value found here for
recombinant MtsA may reflect modifications of the active site to
accommodate both CoM and DMS. MtbA and MtaA have apparent
Km values for CoM reported in the range of 20-40
µM (32), whereas MtsA has an apparent
Km value for CoM of ~10 mM. The native
methylthiol:CoM methyltransferase also has a high apparent Km for CoM relative to MtbA and MtaA, and was
measured as 1.4 mM using the methyliodide:CoM
methyltransferase reaction catalyzed by the intact enzyme (19). The
apparent Km value for CoM of MtsA in the MtsB:MtsA
complex using the methyl iodide:CoM methyltransferase assay is lower
than the apparent Km for CoM of recombinant MtsA
using the methylcobalamin:CoM methyltransferase reaction. This may be
due to measurement of the latter Km value with
non-protein-bound methylcobalamin at a value below the
Km for the free cofactor, while the former
Km value is derived using an assay that relies upon
methylation of enzyme-bound corrinoid by methyl iodide.
Recombinant MtsA catalyzes methylcobalamin:CoM methyl transfer
approximately 40-fold faster than MtsA in the native methylthiol:CoM methyltransferase when measured with the same CoM and methylcobalamin concentrations. It is relatively rare that a recombinant enzyme is more
active than the native enzyme. The higher activity of recombinant MtsA
relative to MtsA in the native intact complex may be due to the
interaction of the corrinoid-binding site of native MtsA with
MtsB-bound corrinoid. The corrinoid-binding site of MtsA would be
accessible by free methylcobalamin upon dissociation from MtsB. In
evidence of this, exposure of native methylthiol:CoM methyltransferase
to SDS leads to a 9.5-fold higher rate of methylcobalamin:CoM methyl
transfer. Treatment with the same concentration of SDS led to
dissociation of the MtsA subunits from the MtsB subunits during
SDS-PAGE (34).
MtsA shares ~50% similarity over nearly its entire length to the CoM
methylases involved in CoM methylation by methanol (MtaA) and
methylamine (MtbA) (33), and, as one would predict, they share some
similarities. Like MtaA and MtbA, MtsA catalyzes an active
methylcobalamin:CoM methyl transfer reaction. The sequence of all three
proteins (32, 33) possess the proposed binding motif (V/I)LHICG, where
zinc may coordinate to the His and Cys residues, as well as to a second
Cys residue found 75 residues C-terminal to the first Cys residue (32,
46). MtsA, like MtbA and MtaA, binds 1 mol of zinc/mol of polypeptide.
Zinc has been implicated in deprotonation of CoM in preparation for
that coenzyme's methylation (32, 47) by MtaA. Zinc did seem necessary
for folding and/or catalysis of MtsA, since deletion of exogenous zinc
from the MtsA refolding buffer led to a significant drop in
methylcobalamin:CoM methyltransferase activity.
Key differences are also found between MtsA and the other CoM
methylation enzymes. These differences appear to be those that would
adapt a member of this family of homologous CoM methylases to the
functions required for DMS:CoM methyl transfer.
One of the major distinctions between MtsA and the homologous CoM
methylases is that MtaA and MtbA, the methylcobalamin:CoM methyltransferases from methylamine and methanol catabolism,
respectively (23, 32), do not form stable complexes with their cognate corrinoid proteins. In contrast, the methylthiol:CoM methyltransferase is part of a very stable 480-kDa protein complex composed of MtsA and
the corrinoid protein homolog, MtsB, in equimolar stoichiometry (21).
This unique arrangement of a corrinoid protein homolog tightly bound to
a CoM methylase homolog was at the outset puzzling. However, our
current results indicate why such a complex is achieved and is feasible
for the methylthiol:CoM methyltransferase. Unlike the other CoM
methylases such as MtaA or MtbA, recombinant MtsA is a homodimer. This
may help in achieving the higher-order structure of the methylthiol:CoM
methyltransferase. The complex itself is feasible since only the single
active site of MtsA both methylates and demethylates the corrinoid
bound to MtsB. In contrast, the corrinoid proteins of methanol- or
methylamine-dependent CoM methylation must interact with
two separate methyltransferases during CoM methylation from the
methylamines or methanol (see Fig. 1, panel A).
In these cases, it may be necessary to allow conformational changes
that allow the corrinoid to sequentially interact with one polypeptide
active site after another. Such a conformational change would not be
required to expose the corrinoid of MtsB to methylation and
demethylation by the active site of MtsA.
The energetics of the individual subreactions of DMS:CoM methyl
transfer may provide a rationale for why formation of the MtsA:MtsB
complex would be not only be feasible, but favorable. The methylation
of the thiolate of CoM with methylcobalamin is an exergonic reaction,
with The largest discernible difference between MtsA and the CoM methylase
of methylamine:CoM methyl transfer, MtbA, is the lack of interaction
between DMS and MtbA. MtsA will demethylate DMS and methylate
cob(I)alamin, whereas such an activity is undetectable in MtbA. Indeed,
inhibition of MtbA-catalyzed methylcobalamin:CoM methyl transfer by DMS
is not detectable, even at CoM concentrations near the apparent
Km. In sharp contrast, DMS is a potent competitive
inhibitor with respect to CoM of MtsA-catalyzed methylcobalamin:CoM methyl transfer.
Recently it was demonstrated that metabolism of chloromethane by an
aerobic methylotrophic bacteria required a 60-kDa protein designated
CmuA (49). The sequence of CmuA reveals an apparent fusion of two
proteins. The C-terminal region is most similar to MtmC, the corrinoid
protein of MMA:CoM methyl transfer. The N-terminal region of the
protein is most similar to MtbA, the CoM methylase of MMA:CoM methyl
transfer (49). The methylation of the corrinoid-binding domain appears
to be mediated by the MtbA homolog. This enzyme thus provides the first
example of a CoM methylase homolog, which functions in corrinoid
methylation and growth substrate demethylation, rather than
demethylation of corrinoid and methylation of a cellular intermediate.
The results presented here illustrate that members of the CoM methylase
family of methyltransferases within methanogens themselves can function physiologically in either the methylation or demethylation of corrinoid. MtsA thus provides an interesting example of the how relative modifications of members of an existing protein family have
resulted in the extended catabolic diversity of methanogenic Archaea.
*
This work was supported by U.S. Department of Energy Grant
DE-FG-02-91ER20042.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 614-292-1578;
Fax: 614-292-8120; E-mail: krzycki.1@osu.edu.
Published, JBC Papers in Press, November 9, 2000, DOI 10.1074/jbc.M007514200
2
T. C. Tallant, unpublished results.
The abbreviations used are:
TMA, trimethylamine;
CoM, coenzyme M;
DMS, dimethylsulfide;
MMPA, methylmercaptopropionate;
MMA, monomethylamine;
DMA, dimethylamine;
MSH, methanethiol;
PAGE, polyacrylamide gel electrophoresis;
HPLC, high performance liquid
chromatography;
MOPS, 3-(N-morpholino)propanesulfonic acid;
PCR, polymerase chain reaction;
IPTG, isopropyl-1-thio-
The MtsA Subunit of the Methylthiol:Coenzyme M Methyltransferase
of Methanosarcina barkeri Catalyses Both Half-reactions
of Corrinoid-dependent Dimethylsulfide: Coenzyme M
Methyl Transfer*
, and
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
4.
MtsA and cob(I)alamin mediate dimethylsulfide:coenzyme M methyl transfer in the complete absence of MtsB. Dimethylsulfide inhibited methylcobalamin:coenzyme methyl transfer by MtsA. Inhibition by dimethylsulfide was mixed with respect to methylcobalamin, but competitive with coenzyme M. MtbA, a MtsA homolog participating in
coenzyme M methylation with methylamines, was not inhibited by
dimethylsulfide and did not catalyze detectable
dimethylsulfide:cob(I)alamin methyl transfer. These results are most
consistent with a model for the native methylthiol:coenzyme M
methyltransferase in which MtsA mediates the methylation of corrinoid
bound to MtsB with dimethylsulfide and subsequently demethylates
MtsB-bound corrinoid with coenzyme M, possibly employing elements of
the same methyltransferase active site for both reactions.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (24K):
[in a new window]
Fig. 1.
Schematic of the subreactions initiating CoM
methylation with methylotrophic substrates. A,
methyltransferases with high substrate specificity methylate their
cognate corrinoid proteins in reactions specific for the substrates
indicated in parentheses. The methylated corrinoid proteins
are then demethylated by one of two homologous methylcorrinoid:CoM
methyltransferases, again specific for the substrates indicated in
parentheses. The corrinoid proteins form a single homologous
protein family, as do the two CoM methyltransferases. In contrast, the
methylotrophic substrate:corrinoid methyltransferases are not
homologous. R is the appropriate leaving group for TMA, DMA,
MMA, or methanol following methyl transfer from those substrates.
B, schematic of the proteins initiating methanogenesis from
DMS. The methylthiol:CoM methyltransferase is composed of two tightly
bound subunits. MtsB is homologous to the corrinoid proteins described
above and is the probable binding site of the corrinoid cofactor. MtsA
is homologous to the CoM methyltransferases described above, has been
shown to mediate methylcobalamin:CoM methyl transfer, and is implicated
in mediating MtsB-bound methylcorrinoid:CoM methyl transfer. Unlike the
methylamine- and methanol-dependent pathways of CoM
methylation, a substrate:corrinoid methyltransferase is not located on
a separate third polypeptide as in methylamine- or
methanol-dependent CoM methylation pathways.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-galactopyranoside (IPTG),
EDTA, and Tris were purchased from Sigma. Sodium dodecyl
sulfate (SDS), acrylamide, 2-mercaptoethanol, bromthymol blue, and
Coomassie R-250 were purchased from Bio-Rad. Titanium(III) chloride
(10% aqueous solution), 3-thiopropionic acid, and
methyl-3-(methylthio)propionate were purchased from Aldrich.
Titanium(III) citrate was prepared from titanium(III) chloride (38).
MMPA was prepared by alkaline hydrolysis of
methyl-3-(methylthio)propionate (39). DMS was purchased from Spectrum
Chemical (Gardenia, CA). Guanidine hydrochloride was purchased from
Roche Molecular Biochemicals.
View larger version (30K):
[in a new window]
Fig. 2.
Construction of pET-40ex for heterologous
expression of MtsA in E. coli. A NdeI
restriction site was introduced overlapping the start codon of
mtsA by PCR and the PCR fragment introduced into pGEM-T to
generate pGEM-4. A complete mtsA gene was reconstructed from
the HindIII/PstI and
PstI/SalI fragments from pPT600 and pCO300,
clones generated during the sequencing of mtsA and
mtsB, and pGEM-4 to generate pGEM-4HS. MtsA was excised from
pGEM-4HS with NdeI and SspI and inserted into
pET-17b digested with NdeI/EcoRV to generate
pET-40ex with transcription of mtsA under the control of a
T7 promoter. Further details are found under "Experimental
Procedures."
-galactosidase (116 kDa),
phosphorylase b (97.4 kDa), bovine serum albumin (66.2 kDa),
ovalbumin (45 kDa), carbonic anhydrase (31 kDa), soybean trypsin
inhibitor (21.5 kDa), and hen egg white lysozyme (14.4 kDa). Gels were
stained with Coomassie R-250.
-amylase (200 kDa), alcohol dehydrogenase (150 kDa),
bovine serum albumin (66 kDa), carbonic anhydrase (31 kDa), and
cytochrome c (12.4 kDa).
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 mg1 total
protein with 1 mM methylcobalamin and 20 mM
CoM. No methylcobalamin:CoM methyltransferase activity was detectable
in extracts of cells transformed with pET-17b lacking the
mtsA insert. Although no increase in soluble
methyltransferase activity was observed following induction with IPTG,
a notable increase in a prominent 41-kDa polypeptide, the expected size
of MtsA, was found upon electrophoresis of SDS extracts of induced
cells (Fig. 3). Microscopic examination of the induced cells revealed the presence of inclusion bodies, indicating that MtsA had been expressed largely in an insoluble form.
View larger version (109K):
[in a new window]
Fig. 3.
Heterologous expression of MtsA in E. coli. Denaturing polyacrylamide (12%) electrophoretic
gel of whole cell extracts of E. coli with pET-40ex induced
with IPTG and purified recombinant MtsA. Protein samples are as
indicated across the top of the gel: 480, 6 µg of native
methylthiol:CoM methyltransferase; S, molecular mass
standards (masses in kilodaltons are indicated to the left);
E0, whole cell extract of 100 µl culture of E. coli with pET-40ex prior to induction; E1 to
E3, 100-µl culture of E. coli with pET-40ex
1-3 h after induction; MtsA, 4 µg of purified recombinant
MtsA. The gel was stained with Coomassie R-250.
1
mg1 MtsA in the presence of 20 mM
CoM and 1 mM methylcobalamin. For comparison, the
methylcobalamin:CoM methyltransferase activity of the purified
methylamine specific CoM methylase, MtbA, was measured as 34.6 µmol
of methyl groups transferred min1
mg1 MtbA when assayed under the same
conditions. MtsA in association with MtsB (the native methylthiol:CoM
methyltransferase) catalyzed methylcobalamin:CoM methyl transfer at 0.4 µmol min1 mg1
(34).
1 cm1
at 279 nm was calculated for the homodimer of MtsA.
1 mg1 MtsA. In
contrast, a complete saturation of the reaction rate with respect to
CoM was observed in the presence of 1 mM methylcobalamin, the enzyme displayed an apparent Km for CoM of
10.8 ± 0.6 mM and an apparent
Vmax of 21 ± 2.2 µmol of CoM methylated min1 mg-1.
View larger version (18K):
[in a new window]
Fig. 4.
Dependence of the rate of the MtsA-catalyzed
methylcobalamin:CoM methyl transfer reaction on methylcobalamin.
Reaction mixtures contained 40 mM CoM, 3 µg of MtsA, and
1.07-7.2 mM methylcobalamin. Methyl transfer was monitored
by cyanide derivatization of the oxidized product of cob(I)alamin. The
inset is a Lineweaver-Burk plot of the same data.
1
mg1 MtsA with 100 mM DMS (Fig.
5, panel A). To
confirm that cob(I)alamin was being methylated with DMS by MtsA, the
formation of methanethiol was also monitored by gas chromatography
(Fig. 5, panel B). Methanethiol and
methylcobalamin were formed at nearly equivalent rates and at the same
stoichiometry, indicating that DMS was converted to equimolar amounts
of methanethiol and methylcobalamin by MtsA.
View larger version (27K):
[in a new window]
Fig. 5.
Cob(I)alamin methylation from DMS catalyzed
by MtsA. A, visible spectra of methylation of
cob(I)alamin by MtsA. Spectra were recorded prior to addition of DMS,
and 1, 2, 3, 4, 5, 6, 8.5, 10 14, 18, 24, 32, 40, and 48 min after
addition of DMS. The reaction took place with 1 mM
hydroxycobalamin, 6 mM Ti(III) citrate, and 0.53 mg of MtsA
in an anaerobic cuvette with a 2-mm path length, and was initiated by
the addition of 100 mM DMS. B, methylcobalamin
and MSH generation by MtsA from cob(I)alamin and DMS with the same
conditions as in panel A. MSH formation was
monitored by gas chromatography, whereas methylation was measured by an
increase in absorbance at 540 nm from visible spectra. MSH in the
headspace was sampled 1 min after each spectra was recorded. The amount
of MSH reported is corrected for gas dissolved in the aqueous phase.
C, initial rates of cob(I)alamin methylation at
concentrations of DMS from 20 to 200 mM. All other
conditions are as in panel A. The
inset is a Lineweaver-Burk plot of the same data.
D, initial rates of cob(I)alamin methylation at
concentrations of cob(I)alamin from 0.5 to 2.5 mM. Rates
were determined with 0.12 mg of MtsA, 0.5-2.5 mM
hydroxycobalamin, 3-15 mM Ti(III)citrate, and 100 mM DMS. The reaction was monitored as in panel
A. E, methylcobalamin formed from DMS and
cob(I)alamin. The reaction was monitored spectrally as in
panel A. At the arrow, 100 mM additional DMS was added.
1 mg1 MtsA (Fig.
5, panel C). Saturation of the rate of CoM
methylation with 100 mM DMS was not observed with
concentrations of cob(I)alamin from 0.5 to 2.5 mM. The rate
of cob(I)alamin methylation increased linearly in response to
increasing cob(I)alamin concentration (Fig. 5, panel
D). Higher concentrations of cob(I)alamin could not be
tested due to the limits of the spectrophotometric assay.
4 was calculated
for the conversion of DMS and cob(I)alamin to methanethiol and
methylcobalamin from a series of different reactions in which either
DMS or methylcobalamin concentrations were varied.
1 mg1 protein.
In contrast, with these same concentrations of reactants, MtsA
catalyzed DMS-dependent cob(I)alamin methylation at a rate of 167 nmol min1
mg1 protein.
1 mg1
MtsA. In separate reactions performed under the same conditions, the
evolution of methanethiol was followed, and found to proceed at nearly
the same linear rate as CoM methylation (17.8 nmol of methanethiol
liberated min1
mg1). This rate of methylthiol production was
lower than measured in the absence of CoM, and this may be ascribed to
the competition of CoM and DMS for the same active site, as described
below.
View larger version (20K):
[in a new window]
Fig. 6.
DMS:CoM methyl transfer in the presence of
cob(I)alamin and MtsA. The complete reaction contained 0.53 mg/ml MtsA, 1 mM cob(I)alamin generated from 1 mM hydroxycobalamin and 6 mM Ti(III) citrate,
10 mM CoM, and 100 mM DMS. Components were
omitted from the reaction as indicated. MtbA (1.2 mg/ml) was
substituted for MtsA in one set of reactions while all other components
were unchanged. Activity was monitored by monobromobimane
derivatization of thiols and analysis of the bimane derivative of CoM
by reverse phase HPLC.
1
mg1 protein. These results demonstrated that
MtsA, but not MtbA, had determinants that allow the transfer of methyl
groups from DMS to CoM with cob(I)alamin as a free intermediate methyl carrier.
View larger version (25K):
[in a new window]
Fig. 7.
Dimethylsulfide inhibition of MtsA
methylcobalamin:CoM methyltransferase activity. A,
competitive inhibition with respect to CoM. CoM concentrations were
varied from 2.67 to 40 mM CoM in reaction mixtures
containing 1 mM methylcobalamin, 2.3 mM
Ti(III)citrate, 10.5 µg/ml MtsA, and from 0 to 80 mM
DMS. B, mixed inhibition with respect to methylcobalamin.
Methylcobalamin concentrations were varied from 1.07 to 7.47 mM in the presence of 20 mM CoM, 2.3 mM Ti(III)citrate, 12 µg/ml MtsA, and 0-80
mM DMS. Rates of methylcobalamin:CoM methyl transfer
activity were measured by the dicyano derivatization assay in both
experiments.
1mg1 MtbA, and
did not significantly change in the presence and absence of 20 or 100 mM DMS, indicating that DMS is not an effective inhibitor of methylcobalamin:CoM methyl transfer catalyzed by MtbA.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
G°' of-18.25 kJ/reaction (48). The methylation of
cobalt with a methylated thiol would be predicted to be endergonic, and
this is indeed what is revealed by the measured equilibrium constant
for the DMS:cob(I)alamin methyltransferase reaction mediated by MtsA,
which corresponds to a free energy of +17.9 kJ/mol. The
thermodynamically unfavorable DMS-dependent methylation of
Co(I) corrinoid would be enhanced though constant product removal via
the exergonic demethylation of methylcorrinoid by CoM in a stable
complex of the MtsA active site with MtsB-bound corrinoid. The overall
methylthiol:CoM methyl transfer reaction has G°'
of-0.35 kJ/reaction, but this reaction would further displaced toward
CoM methylation by the subsequent exergonic reduction of methyl-CoM to methane.
FOOTNOTES
Present address: Biophysics Research Div., University of Michigan,
Ann Arbor, MI 48109.
ABBREVIATIONS
-D-galactopyranoside;
DTT, dithiothreitol;
CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid;
TES, N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic
acid.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Ferry, J. G.
(1999)
FEMS Microbiol. Rev.
23,
13-38
2.
Thauer, R. K.
(1998)
Microbiol.
144,
2377-2406
3.
van der Maarel, M. J. E. C.,
and Hansen, T. A.
(1997)
Mar. Geol.
137,
5-12
4.
Ni, S.,
Woese, C. R.,
Aldrich, H. C.,
and Boone, D. R.
(1994)
Int. J. Syst. Bacteriol.
44,
357-359
5.
Oremland, R. S.,
and Boone, D. R.
(1994)
Int. J. Syst. Bacteriol.
44,
573-575
6.
Kiene, R. P.,
Oremland, R. S.,
Catena, A.,
Miller, L. G.,
and Capone, D. G.
(1986)
Appl. Environ. Microbiol.
52,
1037-1045
7.
Zinder, S. H.,
and Brock, T. D.
(1978)
J. Gen. Microbiol.
105,
335-342
8.
Kiene, R. P.,
and Visscher, P. T.
(1987)
Appl. Eniron. Microbiol.
53,
2426-2434
9.
Jonkers, H. M.,
van der Maarel, M. J. E. C.,
van Gemerden, H.,
and Hansen, T. A.
(1996)
FEMS Microbiol. Letts.
136,
283-287
10.
Kreft, J. U.,
and Schink, B.
(1993)
Eur. J. Biochem.
226,
945-951
11.
Bak, F.,
Finster, K.,
and Rothfu , F.
(1992)
Arch. Microbiol.
157,
529-534
12.
McCarty, S.,
Chasteen, T.,
Marshall, M.,
Fall, R.,
and Bachofen, R.
(1993)
FEMS Microbiol. Lett.
112,
93-97
13.
Visscher, P. T.,
Kiene, R. P.,
and Taylor, B. F.
(1994)
FEMS Microbiol. Ecol.
14,
179-190
14.
Taylor, B. F.,
and Gilchrist, D. C.
(1991)
Appl. Environ. Microbiol.
57,
3581-3584
15.
Charlson, R. J.,
Lovelock, J. E.,
Andreae, M. O.,
and Warren, S. G.
(1987)
Nature
326,
655-651
16.
van der Maarel, M., J. E. C.,
Jansen, M. J.,
and Hansen, T. A.
(1995)
Appl. Environ. Microbiol.
61,
48-51
17.
Sowers, K. R.,
Baron, S. F.,
and Ferry, J. G.
(1984)
Appl. Environ. Microbiol
47,
971-978
18.
Boone, D. R.,
Whitman, W. B.,
and Rouviére, P.
(1993)
in
Methanogenesis. Ecology, Physiology, Biochemistry, and Genetics
(Ferry, J. G., ed)
, pp. 35-80, Chapman & Hall, New York
19.
Tallant, T. C.,
and Krzycki, J. A.
(1997)
J. Bacteriol.
179,
6902-6911
20.
Kremer, J.,
Burchfield, S.,
Frazier, C.,
and Krzycki, J.
(1994)
J. Bacteriol.
176,
253-255
21.
Kremer, J. D.,
Cao, X.,
and Krzycki, J.
(1993)
J. Bacteriol.
175,
4824-4833
22.
van der Meijden, P.,
te Brömmelstroet, B. W.,
Poirot, C. M.,
van der Drift, C.,
and Vogels, G. D.
(1984)
J. Bacteriol.
160,
629-635
23.
van der Meijden, P.,
Heythuysen, H. J.,
Pouwels, A.,
Houwne, F.,
van der Drift, C.,
and Vogels, G. D.
(1983)
Arch. Microbiol.
134,
238-242
24.
Sauer, K.,
Harms, U.,
and Thauer, R. K.
(1997)
Eur. J. Biochem.
243,
670-677
25.
Burke, S. A.,
and Krzycki, J. A.
(1997)
J. Biol. Chem.
272,
16570-16577
26.
Ferguson, D. J., Jr.,
Gorlatova, N.,
Grahame, D. A.,
and Krzycki, J. A.
(2000)
J. Biol. Chem.
275,
29053-29060
27.
Ferguson, D. J., Jr.,
and Krzycki, J. A.
(1997)
J. Bacteriol.
179,
846-852
28.
Sauer, K.,
and Thauer, R. K.
(1999)
Eur. J. Biochem.
261,
674-681
29.
Ferguson, D. J., Jr.,
Krzycki, J. A.,
and Grahame, D. A.
(1996)
J. Biol. Chem.
271,
5189-5194
30.
Paul, L.,
Ferguson, D. J.,
and Krzycki, J. A.
(2000)
J. Bacteriol.
182,
2520-2529
31.
Burke, S. A.,
Lo, S. L.,
and Krzycki, J. A.
(1998)
J. Bacteriol.
180,
3432-3440
32.
LeClerc, G. M.,
and Grahame, D. A.
(1996)
J. Biol. Chem.
271,
18725-18731
33.
Paul, L.,
and Krzycki, J. A.
(1996)
J. Bacteriol.
178,
6599-6607
34.
Tallant, T. C.,
and Krzycki, J. A.
(1996)
J. Bacteriol.
178,
1295-301
35.
Burke, S. A.,
and Krzycki, J. A.
(1995)
J. Bacteriol.
177,
4410-4416
36.
Ludwig, M. L.,
and Matthews, R. G.
(1997)
Annu. Rev. Biochem.
66,
269-313
37.
Drennan, C. L.,
Huang, S.,
Drummond, J. T.,
Matthews, R. G.,
and Ludwig, M. L.
(1994)
Science
266,
1669-1674
38.
Seefeldt, L. C.,
and Ensign, S. A.
(1994)
Anal. Biochem.
221,
379-386
39.
Wackett, L. P.,
Honek, J. F.,
Begley, T. P.,
Wallace, V.,
Orme, J. W. H.,
and Walsh, C. T.
(1987)
Biochemistry
26,
6012-6018
40.
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
41.
Laemmli, U. K.
(1970)
Nature
227,
680-685
42.
Grahame, D. A.
(1989)
J. Biol. Chem.
264,
12890-12894
43.
Pol, A.,
Gage, R. A.,
Neis, J. M.,
Reijnen, J. W. M.,
Van, D. D. C.,
and Vogels, G. D.
(1984)
Biochim. Biophys. Acta
797,
83-93
44.
Fahey, R. C.,
Newton, G. L.,
Dorian, R.,
and Kosower, E. M.
(1981)
Anal. Biochem.
111,
357-365
45.
Newton, G. L.,
Dorian, R.,
and Fahey, R. C.
(1981)
Anal. Biochem.
112,
383-387
46.
Zhou, Z. S.,
Peariso, K.,
Penner-Hahn, J. E.,
and Matthews, R. G.
(1999)
Biochem.
38,
15915-15926
47.
Sauer, K.,
and Thauer, R. K.
(2000)
Eur. J. Biochem.
267,
2498-2504
48.
Weiss, D. S.,
Gärtner, P.,
and Thauer, R. K.
(1994)
Eur. J. Biochem.
226,
799-809
49.
Vannelli, T.,
Messmer, M.,
Studer, A.,
Vuilleumier, S.,
and Leisinger, T.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
4615-4620
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Ferguson, J. A. Soares, T. Lienard, G. Gottschalk, and J. A. Krzycki RamA, a Protein Required for Reductive Activation of Corrinoid-dependent Methylamine Methyltransferase Reactions in Methanogenic Archaea J. Biol. Chem., January 23, 2009; 284(4): 2285 - 2295. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Schilhabel, S. Studenik, M. Vodisch, S. Kreher, B. Schlott, A. Y. Pierik, and G. Diekert The Ether-Cleaving Methyltransferase System of the Strict Anaerobe Acetobacterium dehalogenans: Analysis and Expression of the Encoding Genes J. Bacteriol., January 15, 2009; 191(2): 588 - 599. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Krishnakumar, D. Sliwa, J. A. Endrizzi, E. S. Boyd, S. A. Ensign, and J. W. Peters Getting a Handle on the Role of Coenzyme M in Alkene Metabolism Microbiol. Mol. Biol. Rev., September 1, 2008; 72(3): 445 - 456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Moran, C. H. House, J. M. Vrentas, and K. H. Freeman Methyl Sulfide Production by a Novel Carbon Monoxide Metabolism in Methanosarcina acetivorans Appl. Envir. Microbiol., January 15, 2008; 74(2): 540 - 542. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. H. Hagemeier, M. Krer, R. K. Thauer, E. Warkentin, and U. Ermler Insight into the mechanism of biological methanol activation based on the crystal structure of the methanol-cobalamin methyltransferase complex PNAS, December 12, 2006; 103(50): 18917 - 18922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bose, M. A. Pritchett, M. Rother, and W. W. Metcalf Differential Regulation of the Three Methanol Methyltransferase Isozymes in Methanosarcina acetivorans C2A. J. Bacteriol., October 1, 2006; 188(20): 7274 - 7283. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |