![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 7, 4894-4900, February 16, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Arrestin 2-mediated Desensitization of
the µ-Opioid Receptor in Xenopus Oocytes*
,
,
§,
From the
Department of Pharmacology, University of
Washington, Seattle, Washington 98195-7280 and the ¶ Ralph and
Muriel Roberts Laboratory for Vision Science, Sun Health Research
Institute, Sun City, Arizona 85351
Received for publication, August 15, 2000, and in revised form, October 20, 2000
| |
ABSTRACT |
|---|
|
|
|---|
To determine the sites in the µ-opioid
receptor (MOR) critical for agonist-dependent
desensitization, we constructed and coexpressed MORs lacking potential
phosphorylation sites along with G-protein activated inwardly
rectifying potassium channels composed of Kir3.1 and
Kir3.4 subunits in Xenopus oocytes. Activation
of MOR by the stable enkephalin analogue,
[D-Ala2,MePhe4,Glyol5]enkephalin,
led to homologous MOR desensitization in oocytes coexpressing both
G-protein-coupled receptor kinase 3 (GRK3) and Opiates are the drugs of choice for the treatment of chronic pain,
and a better understanding of the mechanisms underlying tolerance to
opioids will undoubtedly lead to greater clinical utility. The
molecular basis of tolerance manifests as a reduction in opioid agonist
efficacy as demonstrated by a reduction in the rate of G-protein
activation by the agonist-bound receptor complex (1-3). Furthermore,
the modest reduction in cell surface receptor does not account for the
observed decrease in agonist efficacy that accompanies tolerance
measured biochemically (4, 5), cytochemically (6), or
electrophysiologically (7). One mechanism of opioid receptor
desensitization may be a receptor uncoupling from its effector system
caused by receptor phosphorylation by a G-protein receptor kinase
(GRK)1 and subsequent binding
of an arrestin.
The process of G-protein-coupled receptor (GPCR) desensitization can be
resolved as a series of steps leading from GPCR activation to receptor
uncoupling, internalization, and receptor recycling (Table
I). This model has evolved from the
studies done in a large number of laboratories but principally
championed by the Lefkowitz group using the
-arrestin 2 (arr3).
Coexpression with either GRK3 or arr3 individually did not
significantly enhance desensitization of responses evoked by wild type
MOR activation. Mutation of serine or threonine residues to alanines in
the putative third cytoplasmic loop and truncation of the C-terminal
tail did not block GRK/arr3-mediated desensitization of MOR. Instead,
alanine substitution of a single threonine in the second cytoplasmic
loop to produce MOR(T180A) was sufficient to block homologous
desensitization. The insensitivity of MOR(T180A) might have resulted
either from a block of arrestin activation or arrestin binding to MOR.
To distinguish between these alternatives, we expressed a dominant
positive arrestin, arr2(R169E), that desensitizes G protein-coupled
receptors in an agonist-dependent but
phosphorylation-independent manner. arr2(R169E) produced robust
desensitization of MOR and MOR(T180A) in the absence of GRK3
coexpression. These results demonstrate that the T180A mutation
probably blocks GRK3- and arr3-mediated desensitization of MOR by
preventing a critical agonist-dependent receptor
phosphorylation and suggest a novel GRK3 site of regulation not yet
described for other G-protein-coupled receptors.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-adrenergic receptor
signaling as a prototypic GPCR (8, 9). In this scheme, GRKs
phosphorylate the agonist-activated GPCR (8, 9). The phosphorylated
GPCR induces a conformational change in arrestin, leading to arrestin activation (step 4), which unmasks arrestin's GPCR binding site and
allows arrestin to bind the agonist-bound state of the GPCR (10-12).
Arrestin binding then uncouples the GPCR from its effector by
sterically blocking G-protein binding. Arrestin can also promote receptor internalization by serving as an adapter linking the GPCR-arrestin complex to dynamin and the clathrin-mediated endocytotic machinery (8, 9). The internalized GPCR-arrestin complex can
subsequently be recycled to the plasma membrane in its preactivated state following receptor dephosphorylation and disassembly of the
complex. Alternatively, the arrestin-GPCR complex can be targeted to
lysosomes for receptor degradation (8, 9).
Lefkowitz model of GRK and arrestin regulation of G-protein-coupled
receptors
We previously reported that homologous desensitization of MOR can be mediated by GRK and arrestin (13, 14). When MOR is coexpressed in the Xenopus oocyte heterologous gene expression system with G-protein-gated inwardly rectifying potassium channels Kir3 (Kir3.1/3.4), receptor activation by the selective MOR agonist, DAMGO, elicits a sustained increase in potassium conductance. Additional expression of both GRK3 and arr3 led to a dramatic increase in the desensitization rate of this MOR response (13, 14).
Strong evidence for a critical GRK phosphorylation site in the
C-terminal tail of MOR necessary for homologous MOR desensitization exists, although it remains a matter of controversy. Depending on both
the expression system and the MOR agonist used, Thr394
(15-18) or Thr354, Ser355, Ser356,
and Thr357 (19) or Ser356 and
Thr358 (20), when substituted with alanines, have
separately been shown to block MOR desensitization by GRKs and
arrestins. Differences in the intrinsic GRKs and arrestins in the cell
lines used may have caused the apparent discrepancies between the
studies. In addition, the desensitization assays used did not clearly
distinguish between a change in opioid tolerance caused by receptor
uncoupling, internalization, and impaired receptor recycling. Our goal
then was to dissect GRK- and arrestin-mediated regulation of MOR in a
simpler system to more specifically define the critical GRK phosphorylation sites required for homologous MOR desensitization. To
this end, we constructed MOR mutants lacking potential GRK phosphorylation sites and asked whether GRK3- and arrestin
3-dependent desensitization of MOR was affected.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Chemicals-- DAMGO was from Peninsula Laboratories. Naloxone was from Research Biochemicals International. [3H]CTAP was from Multiple Peptide Systems. All other chemicals were from Sigma.
Mutagenesis of MOR--
The rat MOR cDNA described
previously (13, 14) was subcloned into the HindIII site of
pBluescript (Stratagene), which was used for one of three PCR-based
site-directed mutagenesis protocols described previously (21, 22).
Depending on the protocol used, appropriate pairs of sense and
antisense oligonucleotides and/or oligonucleotides designed to target
the 5'- and 3'-ends of the MOR cDNA were used to generate the
described deletions or substitutions of the MOR cDNA. The sense
oligonucleotides for the site-directed mutagenesis were as follows:
ttacgactcaaggccgttcgcatgctagcgggcgccaaagaa (S261A/S266A/S268A)
47) gatacgccaaaatgaaggcggccgccaaca (T97A/T101A/T103A), and
gccctggatttccgtgccccccgaaatgccaaaatcgttaacgtc (T180A). An adaptation of
the QuickChange protocol from Stratagene was used to substitute serines
190, 195, and 195 to alanine. MOR(T97A/T101A/T103A) and
MOR(T180A) cDNAs were made using the polymerase chain
reaction overlap extension method (23). The resulting PCR products were subcloned into pGEM-T from Promega. All MOR cDNA templates for RNA
synthesis were amplified from corresponding mutagenized clones using a
5' oligonucleotide
(aatctagcatttaggtgacactatagaataggggccatggacagcac) that introduced an
SP6 transcriptional recognition site and a 3' oligonucleotide
(t30agggcaatggagcagtttc) that introduced a 3' poly(A) tail.
In the same manner, using the 5' oligonucleotide above and a 3'
oligonucleotide (t30tcatggatgcagaactctctgaagca), we
introduced a stop site corresponding to a 47-amino acid truncation of
the translated MOR for the construction of MOR(S261A/S266A/S268A)
47
and MOR
47. All MOR mutations were confirmed by sequencing.
Complementary DNA Clones and cRNA Synthesis-- All cDNA clones used in this study were described previously (14, 23). T7, T3, or SP6 mMESSAGE MACHINE kits (Ambion, Austin, TX) were used to generate capped cRNAs from the PCR templates of WT MOR and MOR mutants described under "Mutagenesis of MOR" or from linearized plasmid templates for rat GRK3 and bovine arr3.
Oocyte Culture and Injection-- Defolliculated, stage IV oocytes were prepared as described (13). cRNA was injected (50 nl/oocyte) using a Drummond automatic microinjector, and then oocytes were incubated at 18 °C for 3-4 days in normal oocyte saline buffer (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 5 mM HEPES, pH 7.5) solution supplemented with sodium pyruvate (2.5 mM) and gentamycin (50 µg/ml).
Electrophysiology--
Oocytes were clamped at
80 mV with two
electrodes filled with 3 M KCl having resistances of
0.5-1.5 ohms using a Geneclamp 500 amplifier and pCLAMP 6 software
(Axon Instruments, Foster City, CA). Data were digitally recorded
(Digidata 1200 (Axon Instruments) and an Intel 386 PC) and filtered.
Membrane current traces were also recorded using a chart recorder. To
facilitate the inward potassium current flow through the
Kir3 channels, normal oocyte saline buffer (ND96) was
modified to increase the KCl concentration to 16 mM, and
the NaCl concentration was decreased correspondingly.
Whole Oocyte [3H]CTAP Binding-- Oocytes were injected with 0.05 ng of MOR, 0.25 ng of GRK3, and 5 ng of arr3 cRNA and then 3 days later were either untreated or pretreated for 1 h with 1 µM DAMGO and washed three times with room temperature ND96. Each group was then incubated for 20 min in 20 nM [3H]CTAP (0.25 µCi/mmol) in ND96 at 4 °C. Four oocytes per group were placed on Whatman GF/C 25-mm circular glass microfiber filter paper under vacuum pressure and washed twice with 500 µl of cold ND96 and placed in 2.5-ml Ecolite scintillation fluid (ICN) for quantification of bound [3H]CTAP.
Statistical Analysis--
Student's t test (with
two-tailed p values) was used for comparison of the
independent mean values. Dose-response curves were fitted to a simple
Emax model using NFIT software (Island Products, Galveston, TX).
| |
RESULTS |
|---|
|
|
|---|
GRK3- and arr3-mediated Desensitization of the MOR-- As described previously (13, 14), in oocytes injected with MOR, Kir3.1, and Kir3.4, DAMGO activation of MOR led to an increase in Kir3 current. Provided MOR expression was relatively low and both channel subunits, Kir3.1 and Kir3.4, were coexpressed, this MOR activation of Kir3 was remarkably stable, with only slight decreases in responsiveness during treatments as long as 12 h (14). This is in contrast to previous reports in which MOR activation of Kir3 currents in Xenopus oocytes, desensitized rapidly (up to 60% in 4 min) when MOR was expressed with Kir3.1 alone or when MOR was expressed at relatively high levels (24, 25). Under these latter conditions, the reduction in current observed was demonstrated to be heterologous desensitization, probably by receptor-independent channel inactivation (25). Thus, for this study the expression system was deliberately manipulated to minimize heterologous desensitization and to optimize the sensitivity of the system to homologous (GRK3- and arr3-mediated) desensitization of MOR. In addition, levels of MOR expression were adjusted to avoid the confounding effects of spare receptors.
As previously reported, coexpression of GRK3 and arr3 led to a marked
decrease in MOR responsiveness after pretreatment with DAMGO (Fig.
1B) (13, 14). Peak MOR
responses from oocytes injected with cRNA for MOR, Kir3.1, and Kir3.4,
or also with GRK3 or arr3 cRNA under the two-electrode voltage clamp
configuration were measured in oocytes clamped at
80 mV. Oocytes from
each group were then incubated in 1 µM DAMGO for 30-60
min. Each oocyte was then washed for 10 min in normal oocyte saline
buffer (ND96), and the peak MOR response to 1 µM DAMGO
after agonist pretreatment was measured and compared with the response
prior to DAMGO incubation. In oocytes injected with MOR and
Kir3, responses after DAMGO treatment were greater than
75% of the pretreatment values, and expression of GRK3 or arr3 alone
did not significantly alter the MOR desensitization (Fig.
1B). Representative traces of the MOR responses measured before and after DAMGO treatments are displayed in Fig. 1A.
In contrast, coexpression of GRK3 and arr3 increased the extent of MOR
desensitization (Fig. 1) as described previously (13, 14). The rate of
desensitization was found to be most dependent on the levels of arr3
expression. For example, increasing the amount of cRNA injection for
arr3 with the same levels of GRK3 cRNA injected led to MOR responses
that desensitized to similar extents in less than 10 min (14).
Conversely, decreasing the arr3 cRNA injected required much longer
DAMGO incubations for the same degree of MOR desensitization to occur
(13).
|
To determine whether the reduction in apparent MOR responsiveness was caused by receptor internalization, we performed [3H]CTAP binding assays with whole oocytes under the same conditions in which MOR desensitization was measured electrophysiologically. [3H]CTAP is an antagonist; thus, it will not induce desensitization. Also, it is a charged peptide; thus, it will label only cell surface receptors (26). [3H]CTAP binding was significantly higher in oocytes expressing MOR than in uninjected oocytes (Fig. 1C). After treatment with 1 µM DAMGO for 60 min, specific binding of [3H]CTAP was not significantly changed in oocytes expressing MOR, GRK3, and arr3. This result demonstrates that the reduction in response seen electrophysiologically was not caused by receptor internalization.
Dose-Response Relationships of WT MOR and MORs Lacking Potential
GRK3 Phosphorylation Sites in the C-terminal Tail or the Third
Cytoplasmic Loop--
To determine the critical phosphorylation sites
important for the GRK3- and arr3-dependent desensitization
described above, we began by removing the serines and threonines in the
C-terminal tail by introducing a stop codon at residue 352 of MOR; MOR
47 lacks the last 47 amino acids (Fig.
2A). In addition, we
substituted three of the serines in the third cytoplasmic loop of MOR
(S261A/S266A/S268A) and introduced the C-terminal truncation resulting
in MOR L3
47 (Fig. 2A). Cumulative dose-response curves to
DAMGO for WT MOR, MOR L3, MOR
47, and MOR L3
47 were generated
(Fig. 2B). EC50 values for DAMGO activation of
WT MOR, MOR
47, and MOR L3
47 were not significantly different.
The result indicates that the binding affinity and intrinsic efficacy
of MOR were not significantly altered by the respective alanine
substitutions or truncations (Fig. 2B).
|
GRK3- and arr3-mediated Desensitization of MORs Lacking Potential
GRK3 Phosphorylation Sites in the Third Cytoplasmic Loop and C-terminal
Tail--
GRK3 phosphorylation of the third cytoplasmic loop or the
C-terminal tail has repeatedly been implicated in desensitization of
G-protein-coupled receptors, and strong evidence exists for a critical
role of the C-terminal tail in MOR desensitization (15-20). Thus, we
coexpressed GRK3 and arr3 with WT MOR and MOR
47 to determine if the
serines and threonines in the C-terminal tail were required for GRK3-
and arr3-mediated desensitization of MOR in the Xenopus
oocyte expression system. As with the WT MOR, MOR
47 did not
desensitize significantly in the absence of GRK3 and arr3 expression.
However, when coexpressed with GRK3 and arr3, MOR
47 desensitized at
rate that was indistinguishable from WT MOR. The result demonstrates
that the serine and threonine residues in the C-terminal tail were not
necessary for GRK3- and arr3-mediated desensitization in this system.
To determine whether either residues in the third cytoplasmic loop or
the C-terminal tail were sufficient for GRK3- and arr3-mediated
desensitization of MOR, we compared the desensitization of WT MOR and
MOR L3
47, which lacked potential GRK3 phosphorylation sites in the
third cytoplasmic loop and the C-terminal tail. As before, MOR L3
47 expression by itself did not lead to significant receptor
desensitization. Coexpression of GRK3 and arr3 with MOR L3
47,
however, caused a MOR L3
47 desensitization that was
indistinguishable from GRK3- and arr3-dependent
desensitization of the wild type MOR. These data suggest that GRK3- and
arr3-dependent desensitization of MOR in this system did
not require phosphorylation of the third cytoplasmic loop or the
C-terminal tail of MOR.
Dose-Response Relationships of WT MOR and MORs Lacking Potential
GRK3 Phosphorylation Sites in the First and Second Cytoplasmic
Loop--
Since alanine substitution or removal of potential GRK3
phosphorylation sites of MOR in the third cytoplasmic loop and the C-terminal tail failed to block GRK3- and arr3-mediated desensitization of MOR, we next constructed MOR(T97A/T101A/T103A) and MOR(T180A), which
lacked potential GRK3 phosphorylation sites in the first and second
cytoplasmic loop, respectively (Fig.
3A). To ensure that the
described mutations did not alter receptor functioning, we constructed
cumulative dose-response curves to DAMGO for WT MOR,
MOR(T97A/T101A/T103A), and MOR(T180A) (Fig. 3B).
EC50 values for DAMGO activation of WT MOR,
MOR(T97A/T101A/T103A), and MOR(T180A) did not significantly differ,
indicating that the receptor functioning of each receptor mutant was
intact (Fig. 3B).
|
GRK3- and arr3-mediated Desensitization of MORs Lacking Potential
GRK3 Phosphorylation Site in the First and Second Cytoplasmic
Loop--
To determine whether the critical phosphorylation sites of
MOR necessary for GRK3- and arr3-dependent desensitization
reside in the first or second cytoplasmic loop, we coexpressed GRK3 and arr3 with MOR(T97A/T101A/T103A) and MOR(T180A) and compared the rates
of desensitization with that of WT MOR. MOR(T97A/T101A/T103A) and
MOR(T180A) did not desensitize significantly in the absence of GRK3 or
arr3 expression (Fig. 3B). Furthermore,
MOR(T97A/T101A/T103A), when expressed with GRK3 and arr3, desensitized
at a rate that was indistinguishable from that of WT MOR under the same
conditions (Fig. 4B).
MOR(T180A), in which a single threonine was substituted for an alanine,
however, failed to desensitize in the presence of GRK3 and arrestin
coexpression. Instead, MOR(T180A), expressed with GRK3 and arr3,
desensitized at rate that was indistinguishable from control rates in
the absence of GRK3 and arr3 expression. As a positive control for GRK3
and arr3 expression in the oocytes injected with MOR(T180A),
Kir3, GRK3, and arr3, some of the oocytes from the
following groups were also injected with cRNA for the
2-adrenergic receptor and G
s. As
previously reported,
2-adrenergic receptor activation by
isoproterenol (1 µM) activated Kir3, a response that
desensitizes rapidly only in oocytes also coexpressing GRK3 and arr3.
2-Adrenergic receptor desensitization rates in the
oocytes injected with WT MOR; the WT MOR, GRK3, and arr3; and
MOR(T180A), GRK3, and arr3 were 4.6 ± 1.9, 18.8 ± 3.8, and 16.7 ± 1.7% per min, respectively. The lack of significance
between the latter two groups indicates that GRK3 and arr3 expressed
well in oocytes expressing MOR WT and MOR(T180A).
|
In addition, the lack of GRK- and arrestin-dependent desensitization of MOR(T180A) was not due to receptor overexpression or a change in the intrinsic efficacy of MOR(T180A). Specific [3H]CTAP binding to oocytes injected with 0.05 ng of cRNA for MOR WT or MOR(T180A) was not statistically different, 6.7 ± 0.9 and 4.7 ± 0.7 fmol bound, respectively (n = 10). In addition, the DAMGO-evoked peak responses measured electrophysiologically were similar, 620 ± 157 nA (MOR WT) and 350 ± 87 nA (MOR(T180A). Thus, the lack of GRK3/arr-mediated desensitization of MOR(T180A) did not result from a relative excess of MOR(T180A) expression compared with WT MOR expression. Furthermore, the average peak MOR response from oocytes injected with a higher dose of cRNA (0.1 ng) for each receptor was significantly higher for both receptor responses (1320 ± 1220 and 1000 ± 164 nA for MOR WT and MOR(T180A), respectively); the result demonstrated a lack of a receptor reserve for each receptor at the dose of cRNA used. These data suggest that MOR(T180A) failed to desensitize because threonine 180 is required for GRK3- and arr3-dependent desensitization of MOR.
Desensitization of WT MOR and MOR(T180A) by a Dominant Positive
Arrestin, arr2(R169E)--
The insensitivity of MOR(T180A) presumably
results from the loss of a critical GRK3 phosphorylation site.
Alternatively, GRK3 could phosphorylate MOR(T180A) normally and
activate arrestin, but the binding of the activated arr3 to MOR(T180A)
might be impaired. To distinguish between these alternatives, we
coexpressed WT MOR and MOR(T180A) with a form of arrestin known to
desensitize the
opioid receptor (DOR) and the
2-adrenergic receptor in a manner that was
agonist-dependent but GRK-independent (11). This
"dominant positive" form of arrestin does not require activation by
the phosphorylated GPCR, but it can bind and inactivate the agonist bound GPCR. Oocytes expressing arr2(R169E) showed robust
agonist-dependent but GRK-independent, desensitization of
MOR, whereas oocytes expressing WT arr2 did not show enhanced
desensitization of MOR (Fig. 4). Furthermore, arr2(R169E) also caused
robust desensitization of MOR(T180A) that was not statistically
different from WT MOR desensitization by arr2(R169E). This enhanced
desensitization of MOR by arr2(R169E) was not due to greater expression
compared with arr2 WT. Expression of arr2 WT and arr2(R169E) in
the oocytes used for in the desensitization experiments was found to be
0.53 ± 0.06 and 0.40 ± 0.05, respectively, in the MOR
WT-expressing oocytes and 0.53 ± 0.07 and 0.41 ± 0.04 in
the MOR(T180A)-expressing oocytes (ng of arrestin/µg of protein ± S.D.). These data suggest that the T180A mutation of MOR blocks GRK3- and arrestin-mediated desensitization, not by disrupting the
arrestin binding to the receptor downstream of GRK action but because
it removed a critical agonist-dependent GRK3
phosphorylation site necessary for arrestin activation.
| |
DISCUSSION |
|---|
|
|
|---|
The principal finding of the study was that threonine 180 of MOR
was required for GRK3- and arr3-dependent homologous
desensitization of MOR expressed in Xenopus oocytes. In our
investigation, the removal of potential GRK phosphorylation sites in
all other cytoplasmic domains of MOR failed to block MOR
desensitization by GRK3 and arr3. Because receptor internalization does
not contribute to the desensitization events in this system, the study
clearly focuses on the roles of GRK3 and arr3 in the initial receptor
uncoupling process. In addition, we further characterized the actions
of the dominant positive form of arrestin. Previously, we demonstrated the agonist-dependent but GRK-independent desensitization
of DOR and
2-adrenergic receptor by the dominant
positive arr2(R169E). Here we report that arr2(R169E) also desensitized
MOR in a GRK-independent but agonist-dependent manner. The
observation that MOR(T180A) remained sensitive to arr2(R169E) suggested
that MOR(T180A) lacked a critical GRK3 phosphorylation site necessary
for homologous MOR desensitization.
From extensive studies of GRK and arrestin regulation of
G-protein-coupled receptors, a common theme has evolved. Serine or threonine residues in the third cytoplasmic loop or the C-terminal tail
have repeatedly been demonstrated to be responsible for the regulation
of GPCRs by GRKs and arrestins. For example, GRK phosphorylation of
muscarinic acetylcholine receptor m1 and m2
subtypes is predominately in the third cytoplasmic loop (27, 28). In
contrast, the
- and
-opioid receptors (DORs and KORs) require GRK
phosphorylation of the C-terminal tail for GRK- and
arrestin-dependent desensitization (13, 22). The difference
between the critical site in MOR and the other GPCRs cannot be
attributed to the differences in the expression system, since DOR and
KOR desensitization were also characterized using the oocyte system.
Interestingly, the finding that homologous MOR desensitization in Xenopus oocytes does not require a C-terminal tail determinant was not the only disparity among these closely related opioid receptor subtypes in this system. Homologous MOR desensitization by GRK3 and arr3 proceeds with a dramatically slower time course compared with that of DOR and KOR. Although the rate of MOR desensitization can be accelerated with increased arrestin expression, under conditions where DOR and KOR desensitize in minutes, MOR desensitization required hours in this system (13, 22). The relatively slow desensitization rate of MOR might result from a slower kinetics of GRK3 phosphorylation, a less efficient activation of arrestin, or a slower association of activated arrestin with the GPCR. The observation that the dominant positive form of arrestin desensitizes MOR at rates that were equivalent to DOR and KOR desensitization rates suggests that the last explanation is unlikely. Our hypothesis is that GRK3-phosphorylated MOR is a less efficient activator of arrestin than either DOR or KOR, but this remains to be directly tested.
The findings that threonine 180 was required for the GRK- and arrestin-mediated desensitization of MOR and that the C-terminal tail was not involved are in sharp contrast with studies of this type in mammalian cell line expression systems (15-20). Although not agreeing on the exact residues responsible, prior studies of MOR desensitization in hypertransfected mammalian cell lines have pointed to sites within the C-terminal tail. The basis for the discrepancy between those studies and this one is not clear. The results using mammalian cell lines often rely on the intrinsic kinase and arrestins expressed; thus, the difference could be due to differences in GRK3 and arr3 and the unknown intrinsic proteins. The desensitization assays using mammalian cell lines are also strongly affected by internalization and receptor recycling rates, and overexpression of receptors produces a large opioid receptor reserve. The contributions of each of these to the tolerance observed would confound the measure of receptor desensitization. The receptor domains responsible for internalization and recycling are likely to be different from those responsible for receptor uncoupling. This distinction has been clearly demonstrated for cannabanoid and muscarinic acetylcholine receptors (21, 24). Furthermore, as discussed by Law et al. (30), recycling of MOR in mammalian cell lines can occur within minutes of agonist treatment such that the number of uncoupled receptors in cells highly overexpressing MOR may not be large enough to see a decrease in MOR-mediated second messenger responses. In addition, the presence of a large receptor reserve requires a large fraction of receptor uncoupling before a significant change in the second messenger response can be measured. This is supported by those who have found a lack of correlation of MOR phosphorylation with receptor desensitization in cells highly overexpressing MOR (31, 32). This correlation was clearly demonstrated, however, when receptor recycling pathways were blocked or when the functional receptor number was decreased with the treatment of cells with a irreversible MOR antagonist (30). Since desensitization can potentially occur either by receptor uncoupling or internalization, to fully understand both processes it is necessary to have assays that distinguish these mechanisms and clearly define which is involved in terminating the MOR response in the system used.
For this reason, we deliberately expressed levels of MOR that were significantly less than those required to fully activate the coexpressed Kir3. This ensured a lack of receptor reserve for the response measured and allowed us to measure receptor desensitization as it occurred. Furthermore, the finding that the C-terminal tail truncation that has been shown to block MOR internalization in mammalian cell lines did not affect MOR desensitization in this system suggests that MOR internalization in the manner that it occurs in mammalian cell lines is not responsible for the homologous MOR desensitization that we observed. This conclusion is supported by the finding that specific [3H]CTAP binding was not decreased under conditions where MOR desensitization occurred. Therefore, it is likely that we have defined a critical role of Thr180 of MOR necessary for receptor uncoupling that is distinct from the role of the C-terminal tail in MOR internalization.
Another intriguing possibility is that these data represent a homologue-specific action of GRK3 and arr3. In the Xenopus oocyte expression system, coexpression of GRK3 and arr3 was required for homologous MOR desensitization, which suggests the lack of endogenous enzymes that can substitute for either role. This is in contrast to mammalian cell expression systems where exogenous expression of GRK and arrestin is not required, making it difficult to clearly define roles of exogenously or endogenously expressed GRKs and arrestins.
Receptor uncoupling and internalization of MOR represent intimately
related cellular processes that may be involved in the development of
tolerance to opioid drugs. Thus, understanding these processes in
greater detail may enable the elucidation of the roles of these
processes separate from other mechanisms of opioid tolerance such as
learning and memory and other compensatory changes in neuronal
circuitry. Similarly, defining markers for receptor internalization
distinct from receptor uncoupling may provide tools to elucidate the
roles of each of these processes in opioid tolerance as well as
providing multiple targets for improving the clinical use of opioid drugs.
| |
FOOTNOTES |
|---|
* This work was supported by United States Public Health Service Grant DA11672 from the National Institute on Drug Abuse.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Present address: Division of Biology, 156-29, California Institute of Technology, 1201 E. California Blvd., Pasadena, CA 91125.
To whom correspondence should be addressed: Dept. of
Pharmacology, Box 357280, Seattle WA 98195-7280. Tel. 206-543-4266;
Fax: 206-685-3822; E-mail: cchavkin@u.washington.edu.
Published, JBC Papers in Press, November 1, 2000, DOI 10.1074/jbc.M007437200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
GRK, G-protein
receptor kinase;
GRK3, G-protein receptor kinase 3 or
-ARK2;
DAMGO, [D-Ala2,MePhe4,Glyol5]enkephalin;
MOR, µ-opioid receptor;
arr2, arrestin 2;
arr3, arrestin 3 (
-arrestin 2);
Kir3, G-protein-gated inwardly rectifying
potassium channel (GIRK);
GPCR, G-protein-coupled receptor;
PCR, polymerase chain reaction;
DOR,
-opioid receptor;
KOR,
-opioid
receptor;
CTAP, D-Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH2.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Chavkin, C., and Goldstein, A. (1982) Life Sci. 31, 1687-1690 |
| 2. | Chavkin, C., and Goldstein, A. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 7253-7237 |
| 3. | Porreca, F., and Burks, T. F. (1983) J. Pharmacol. Exp. Ther. 227, 22-27 |
| 4. | Werling, L. L., McMahon, P. N., and Cox, B. M. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 6393-6397 |
| 5. | Tao, P. L., Chang, L. R., Chou, Y. P., and Loh, H. H. (1993) Eur. J. Pharmacol. 246, 233-238 |
| 6. | Sim, L. J., Selley, D. E., Dworkin, S. I., and Childers, S. R. (1996) J. Neurosci. 15, 2684-2692 |
| 7. | Christie, M. J., Williams, J. T., and North, R. A. (1987) Mol. Pharmacol. 32, 633-638 |
| 8. | Pitcher, J. A., Freedman, N. J., and Lefkowitz, R. J. (1998) Annu. Rev. Biochem. 67, 653-692 |
| 9. | Freedman, N. J., and Lefkowitz, R. J. (1996) Recent Prog. Horm. Res. 51, 319-351 |
| 10. | Hirsch, J. A., Schubert, C., Gurevich, V. V., and Sigler, P. B. (1999) Cell 97, 257-269 |
| 11. | Kovoor, A., Celver, J., Abdryashitov, R. I., Chavkin, C., and Gurevich, V. V. (1999) J. Biol. Chem. 274, 6831-6834 |
| 12. | Vishnivetskiy, S. A., Paz, C. L., Schubert, C., Hirsch, J. A., Sigler, P. B., and Gurevich, V. V. (1999) J. Biol. Chem. 274, 11451-11454 |
| 13. | Kovoor, A., Nappey, V., Kieffer, B. L., and Chavkin, C. (1997) J. Biol. Chem. 272, 27605-27611 |
| 14. | Kovoor, A., Celver, J. P., Wu, A., and Chavkin, C. (1998) Mol. Pharmacol. 54, 704-711 |
| 15. | Deng, H. B., Yu, Y., Pak, Y., O'Dowd, B. F., George, S. R., Surratt, C. K., Uhl, G. R., and Wang, J. (1999) Biochemistry 39, 5492-5499 |
| 16. | Pak, Y., O'Dowd, B. F., Wang, J. B., and George, S. R. (1999) J. Biol. Chem. 274, 27610-27616 |
| 17. | Wolf, R., Koch, T., Schulz, S., Klutzny, M., Schroder, H., Raulf, E., Buhling, F., and Hollt, V. (1999) Mol. Pharmacol. 55, 263-268 |
| 18. | Pak, Y., O'Dowd, B. F., and George, S. R. (1997) J. Biol. Chem. 272, 24961-24965 |
| 19. | Wang, H. L. (2000) Neuropharmacology 39, 353-363 |
| 20. | Burd, A. L., El-Kouhen, R., Erickson, L. J., Loh, H. H., and Law, P. Y. (1998) J. Biol. Chem. 273, 34488-34495 |
| 21. | Jin, W., Brown, S., Roche, J. P, Hsieh, C., Celver, J. P., Kovoor, A., Chavkin, C., and Mackie, K. J. (1999) Neuroscience 19, 3773-3780 |
| 22. | Appleyard, S. M., Celver, J. P., Pineda, V., Kovoor, Wayman, G. A., and Chavkin, C. (1999) J. Biol. Chem. 274, 23802-23807 |
| 23. | Sterne-Marr, R., Gurevich, V. V., Goldsmith, P., Bodine, R. C., Sanders, C, Donioso, L. A., and Benovic, J. L. (1993) J. Biol. Chem. 268, 15640-15648 |
| 24. | Yu, Y., Zhang, L., Yin, X., Sun, H., Uhl, G. R., and Wang, J. B. (1997) J. Biol. Chem. 272, 28869-28874 |
| 25. | Kovoor, A., Henry, D. J., and Chavkin, C. (1995) J. Biol. Chem. 270, 589-595 |
| 26. | Kramer, T. H., Shook, J. E., Kazmierski, W., Ayres, E. A., Wire, W. S., Hruby, V. J., and Burks, T. F. (1989) J. Pharmacol. Exp. Ther. 249, 544-551 |
| 27. | Tsuga, H., Kameyama, K., Haga, T., Honma, T., Lameh, J., and Sadee, W. (1998) J. Biol. Chem. 273, 5323-5330 |
| 28. | Haga, K., Kameyama, K., Haga, T., Kikkawa, U., Shiozaki, K., and Uchiyama, H. (1996) J. Biol. Chem. 271, 2776-2782 |
| 29. | Pak, Y., Kouvelas, A., Scheideler, M. A., Rasmussen, J., O'Dowd, B. F., and George, S. R. (1996) Mol. Pharmacol. 50, 1214-1222 |
| 30. | Law, P. Y., Erickson, L. J., El-Kouhen, R., Dicker, L., Solberg, J., Wang, W., Miller, E., Burd, A. L., and Loh, H. H. (2000) Mol Pharmacol. 58, 388-398 |
| 31. | Pals-Rylaarsdam, R., Xu, Y., Witt-Enderby, P., Benovic, J. L., and Hosey, M. M. (1995) J. Biol. Chem. 270, 29004-29011 |
| 32. | El Kouhen, R., Kouhen, O. M., Law, P. Y., and Loh, H. H. (1999) J. Biol. Chem. 274, 9207-9215 |
This article has been cited by other articles:
![]() |
Y. Qiu, H. H. Loh, and P.-Y. Law Phosphorylation of the {delta}-Opioid Receptor Regulates Its beta-Arrestins Selectivity and Subsequent Receptor Internalization and Adenylyl Cyclase Desensitization J. Biol. Chem., August 3, 2007; 282(31): 22315 - 22323. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Groer, K. Tidgewell, R. A. Moyer, W. W. Harding, R. B. Rothman, T. E. Prisinzano, and L. M. Bohn An Opioid Agonist that Does Not Induce {micro}-Opioid Receptor--Arrestin Interactions or Receptor Internalization Mol. Pharmacol., February 1, 2007; 71(2): 549 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Johnson, S. Oldfield, E. Braksator, A. Gonzalez-Cuello, D. Couch, K. J. Hall, S. J. Mundell, C. P. Bailey, E. Kelly, and G. Henderson Agonist-Selective Mechanisms of {micro}-Opioid Receptor Desensitization in Human Embryonic Kidney 293 Cells Mol. Pharmacol., August 1, 2006; 70(2): 676 - 685. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Marion, R. H. Oakley, K.-M. Kim, M. G. Caron, and L. S. Barak A beta-Arrestin Binding Determinant Common to the Second Intracellular Loops of Rhodopsin Family G Protein-coupled Receptors J. Biol. Chem., February 3, 2006; 281(5): 2932 - 2938. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Kenski, C. Zhang, M. von Zastrow, and K. M. Shokat Chemical Genetic Engineering of G Protein-coupled Receptor Kinase 2 J. Biol. Chem., October 14, 2005; 280(41): 35051 - 35061. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Venkatesha, J. Ahamed, C. Nuesch, A. K. Zaidi, and H. Ali Platelet-activating Factor-induced Chemokine Gene Expression Requires NF-{kappa}B Activation and Ca2+/Calcineurin Signaling Pathways: INHIBITION BY RECEPTOR PHOSPHORYLATION AND {beta}-ARRESTIN RECRUITMENT J. Biol. Chem., October 22, 2004; 279(43): 44606 - 44612. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Cox and A. T. Crowder Receptor Domains Regulating {micro} Opioid Receptor Uncoupling and Internalization: Relevance to Opioid Tolerance Mol. Pharmacol., March 1, 2004; 65(3): 492 - 495. [Full Text] [PDF] |
||||
![]() |
J. Celver, M. Xu, W. Jin, J. Lowe, and C. Chavkin Distinct Domains of the {micro}-Opioid Receptor Control Uncoupling and Internalization Mol. Pharmacol., March 1, 2004; 65(3): 528 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qiu, P.-Y. Law, and H. H. Loh {micro}-Opioid Receptor Desensitization: ROLE OF RECEPTOR PHOSPHORYLATION, INTERNALIZATION, AND RESENSITIZATION J. Biol. Chem., September 19, 2003; 278(38): 36733 - 36739. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. McLaughlin, M. Xu, K. Mackie, and C. Chavkin Phosphorylation of a Carboxyl-terminal Serine within the {kappa}-Opioid Receptor Produces Desensitization and Internalization J. Biol. Chem., September 5, 2003; 278(36): 34631 - 34640. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Mandyam, D. R. Thakker, and K. M. Standifer {micro}-Opioid-Induced Desensitization of Opioid Receptor-Like 1 and {micro}-Opioid Receptors: Differential Intracellular Signaling Determines Receptor Sensitivity J. Pharmacol. Exp. Ther., September 1, 2003; 306(3): 965 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Borgland, M. Connor, P. B. Osborne, J. B. Furness, and M. J. Christie Opioid Agonists Have Different Efficacy Profiles for G Protein Activation, Rapid Desensitization, and Endocytosis of Mu-opioid Receptors J. Biol. Chem., May 23, 2003; 278(21): 18776 - 18784. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Mandyam, D. R. Thakker, J. L. Christensen, and K. M. Standifer Orphanin FQ/Nociceptin-Mediated Desensitization of Opioid Receptor-Like 1 Receptor and {micro} Opioid Receptors Involves Protein Kinase C: A Molecular Mechanism for Heterologous Cross-Talk J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 502 - 509. [Abstract] [Full Text] [PDF] |
||||
![]() |
|