![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 7, 4988-4997, February 16, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,From the Max-Planck-Institut für Biologie, Corrensstrasse 38, 72076 Tübingen, Germany
Received for publication, September 1, 2000, and in revised form, November 3, 2000
| |
ABSTRACT |
|---|
|
|
|---|
The human pathogen Leishmania
synthesizes phosphoglycans (PGs) formed by variably modified
phosphodisaccharide [6-Gal Leishmania are protozoan human pathogens that cycle
between an extracellular promastigote stage residing in the digestive tract of vector sandflies, and an intracellular amastigote stage colonizing the phagolysosomal compartment of mammalian macrophages (1).
A family of unique Leishmania glycoconjugates, the
phosphoglycans (PGs),1 have
been implicated as virulence factors of these parasites in the
mammalian host and as essential molecules for survival and development
in their sandfly vector (2). The phosphoglycan family of parasite
molecules is characterized by linear or branched arrays of disaccharide
phosphate repeats
([6-Gal A series of earlier investigations have demonstrated that developmental
modifications of LPG in the Leishmania insect (promastigote) stages are instrumental for the phenomenon of vector competence, and
that they may play an important role during transmission to the
mammalian host (8-12). Furthermore, a recent study has shown unequivocally an essential role for both LPG and PPGs for successful colonization of Phlebotomus papatasi by Leishmania
major (13).
The notion that phosphoglycan assembly in Leishmania is a
specialized virulence pathway (14, 15) required for infection of a
mammalian host was based on a number of investigations on LPG-deficient
mutants, which were shown to be unable to colonize macrophages or
mammals (16-18). This lack of virulence was explained by an apparently
essential role of LPG in parasite uptake by macrophages, for resistance
of the parasites to toxic and lytic host influences inside and outside
the macrophage, and for modulation of the host immune response (19). By
contrast to these studies, recent results in our laboratory have shown
that LPG is not required for successful experimental infections of
macrophages or mice by Leishmania mexicana (7), arguing
against a crucial role for this molecule in virulence to mammals. These
results did not, however, preclude a role for PG assembly as a
virulence pathway, as the virulent LPG-deficient L. mexicana
strains generated in this study still contained abundant PGs linked to
various PPGs (7). Furthermore, one of the avirulent LPG-deficient
L. donovani mutants (C3PO) generated by chemical mutagenesis
in earlier studies (17) proved to be not only deficient for LPG, but
appeared to lack also protein-bound PG repeats on the secreted acid
phosphatase (SAP) (14). A defect in the gene lpg2 encoding a
Golgi GDP-Man transporter was identified as the cause for the
down-regulation of PG repeat synthesis in this mutant (14, 20). These
results taken together with the identification of abundantly expressed
amastigote-specific PPGs in Leishmania-infected tissue (21,
22) raised the possibility that, instead of LPG, PG repeat-modified
PPGs may be crucial for Leishmania virulence in the
mammalian host (6, 19).
In this study, we investigated this question more stringently in
L. mexicana using a fortuitously isolated mutant with an unknown defect and defined mutants generated by targeted disruption of
the Golgi GDP-Man transporter gene of this species. These mutants were
devoid of PG repeats, but synthesized normal or reduced levels of
mannooligosaccharide caps, respectively. Surprisingly, despite the lack
of PG repeat synthesis in promastigotes as well as amastigotes, both
mutants were as efficient or more efficient than wild type L. mexicana with respect to binding to and uptake into macrophages, and did not show any impairment with respect to survival,
transformation and multiplication within macrophages. After
experimental infections of mice, lesions developed with both mutants at
high and low challenge doses and disease progression was comparable to
that observed in infections with wild type parasites. These results
suggest that, in contrast to previous assumptions, phosphoglycan
synthesis is not an absolute requirement for infectivity of L. mexicana to mammals.
Parasites and Experimental Infections of Mice and Cultured
Peritoneal Macrophages--
Promastigotes of the Leishmania
mexicana wild type (WT) strain MNYC/BZ/62/M379 and derived gene
deletion mutants were grown at 27 °C in semi-defined medium 79 (SDM)
supplemented with 4% heat-inactivated fetal calf serum as described
previously (23). Infection of mice with either 107 or
105 stationary phase promastigotes, binding studies on, and
infection of peritoneal cells were performed as outlined previously
(7).
Immunofluorescence Microscopy (IFM) and Fluorescence-activated
Cell Sorting (FACS) of Leishmania Promastigotes and Infected
Macrophages--
IFM and FACS studies on Leishmania
promastigotes and infected macrophages were performed as described
previously using the monoclonal antibodies (mAbs) (23) LT6 (directed
against
[-6Gal Cloning of the L. mexicana lpg2 Gene and Generation of Gene
Knockout Mutants--
DNA techniques were performed as described
previously (24). The L. donovani lpg2 gene was obtained from
L. donovani 1S-2D genomic DNA by polymerase chain reaction
(PCR) using the primers TCCGGATCCATGAACCATACTCGCTCTGT and
GATCTAGAAGCTTCTACGACTGCTGCTAAC (14). Boldface bases indicate
the restriction sites introduced by the PCR primers. The PCR product
was subcloned into BamHI/HindIII-cut pQE30
(Qiagen). The digoxygenin-labeled PCR product was used to screen a
Analytical Procedures--
Production of SDS cell lysates;
discontinuous SDS-polyacrylamide electrophoresis (SDS-PAGE);
immunoblotting using the mAbs LT6, L7.25, LT17, LT8.2 (23), and
affinity-purified rabbit anti-SAP antibodies (28), as well as acid
phosphatase enzyme assays (29) were performed as described previously.
Total lipids from washed L. mexicana promastigotes were
obtained by two extractions with chloroform/methanol/water (4:8:3).
High performance thin layer chromatography (HPTLC; Silica 60, Merck,
Darmstadt, Germany) of total lipids was performed as described earlier
(30) using the solvent chloroform/methanol/1 M
NH4OH (10:10:3). Glycolipids on HPTLC plates were
selectively stained by orcinol/H2SO4.
Leishmania promastigotes were metabolically labeled by
incubating 5 × 107 cells/ml overnight at 27 °C
with either 10 µCi/ml myo-[3H]inositol or 50 µCi/ml 2-[3H]D-mannose (Hartmann Analytics)
in myo-inositol- or glucose/mannose-free SDM, respectively.
HPTLC-separated radioactively labeled lipids were detected by spraying
with En3Hance (DuPont) and fluorography.
myo-[3H]Inositol or
2-[3H]D-mannose-labeled delipidated cells
were incubated with benzonuclease to cleave nucleic acids (7) and then
separated by SDS-PAGE. Labeled compounds were detected by immersion of
the polyacrylamide gel in AmplifyTM (Amersham Pharmacia Biotech),
followed by drying and fluorography.
Isolation of a PG-deficient L. mexicana Mutant and Targeted Gene
Replacement of the L. mexicana lmexlpg2 Gene--
L.
mexicana amastigotes were isolated from BALB/c mice that were
infected 10 weeks earlier with L. mexicana wild type
promastigotes. After their transformation to promastigotes, IFM studies
using the mAb LT6 directed against PG disaccharide repeats (Fig.
1A) unexpectedly showed that
>95% of the parasites in one of the reisolated L. mexicana
lines displayed no surface fluorescence signal. Limiting dilution
cloning resulted in several L. mexicana clones that were completely unreactive with mAb LT6.
This fortuitous isolation of a mAb LT6-negative, and therefore
potentially PG repeat-negative, L. mexicana strain (termed "PG repeat-negative mutant") from an infected mouse prompted us to
generate more defined deletion mutants for the lmexlpg2
gene, whose homologue in L. donovani is essential for PG
repeat synthesis (14). The L. mexicana lmexlpg2 gene, which
was isolated by homology cloning using a PCR-amplified L. donovani lpg2 gene probe, contained an open reading frame of 1023 base pairs and the deduced protein sequence showed a remarkably high
identity (94.7%) and similarity (96.5%) to L. donovani
LPG2 (Fig. 1B). A hydrophobicity plot indicates the presence
of 10-12 transmembrane regions (Fig. 1C), as observed previously for L. donovani LPG2 (14). Southern blot analysis indicates that lmexlpg2 is a single-copy gene (data not
shown), and double targeted gene replacement (Fig.
2A) led to the generation of
lmexlpg2 null mutants (Fig. 2B). The resulting
promastigote clones showed no growth defect in culture compared with
wild type cells (data not shown).
Expression of Phosphoglycans and Glycoinositolphospholipids by the
PG Repeat-negative Mutant and the
The modification of L. mexicana SAP by phosphoglycans was
assessed by immunoblots of culture supernatant. Wild type parasites secrete SAP composed of the two subunits SAP1 and SAP2 (Fig.
7A, lane
1), which are modified by mannooligosaccharide caps (Fig. 7B, lane 1) and LT17 binding sites
(Fig. 7C, lane 1). Expression of these
epitopes is up-regulated in
In summary, it appears that the PG repeat-negative mutant is completely
defective in phosphoglycan repeat synthesis but synthesizes normal
levels of mannooligosaccharide caps, while
Recent reports suggest that the L. mexicana phosphoglycan
synthesis pathway is distinct from glycoinositolphospholipid (GIPL) synthesis pathway (33). The GIPL profiles of L. mexicana
Infection of Macrophages by the PG Repeat-negative Mutant and
The L. mexicana PG Repeat-negative and L. mexicana Previous reports have proposed that PG repeat synthesis in
Leishmania belongs to a specialized virulence pathway that
is essential for survival and development of the parasites throughout
their life cycle and for virulence in the mammalian host (14, 15, 19).
PG repeat-modified molecules include free PG chains, lipid-containing LPG, and the protein-containing PPGs (6, 15). Although a crucial role
for phosphoglycan synthesis has been unequivocally demonstrated for
Leishmania promastigotes within the sandfly (13), and an
important role for these molecules during transmission from the insect
vector to the mammalian host appears likely (8, 34), the
importance of PG-modified compounds during actual disease formation by
Leishmania in the mammalian host has been questioned more recently (7). In experimental infections with L. mexicana, LPG-deficient lines are indistinguishable from wild type
in their infectivity to macrophages and mice; furthermore, a recent
study on L. major suggests that this is also the case for
this Leishmania species, once transmission has been achieved
(35). Although LPG is absent in these virulent LPG-deficient mutants,
they still synthesize abundant PPGs, which raises the possibility that
these molecules may be the crucial products of the proposed virulence pathway (6, 15, 19). Important arguments for this notion were 1) the
discovery of an avirulent PG repeat-negative L. donovani mutant that was deficient in the Golgi GDP-Man transporter LPG2 (14,
17, 20) (it should be noted, however, that recovery of virulence by
reexpression of lpg2 gene in the L. donovani
The data collected in this study show that, in contrast to the common
expectation, at least in L. mexicana, PG repeat synthesis is
not a requirement for virulence to the mammalian host. The spontaneous,
undefined PG repeat-negative mutant and a defined It is possible that in other Leishmania species like
L. donovani and L. major, the Golgi GDP-Man
transporter LPG2 or PG synthesis in general, are of greater importance
to the invading promastigotes and/or the disease-causing amastigotes.
Final conclusions on this topic will require studies on mutants of
these organisms. In L. mexicana, amastigote-expressed aPPG
has been implicated in parasite virulence to the mammalian host (42,
43). Our more recent results here argue against a central role of aPPG
in the disease process caused by this Leishmania species.
However, it should be kept in mind that experimental infections of mice
mimic the natural situation only incompletely. It is possible that, in
the natural life cycle, aPPG and other PPGs provide a subtle advantage to mammalian stage parasites that may, for instance, translate into
higher transmission rates.
1-4Man
1-PO4] repeats and
mannooligosaccharide phosphate
[(Man
1-2)0-5Man
1-PO4] caps that occur
lipid-bound on lipophosphoglycan, protein-bound on
proteophosphoglycans, and as an unlinked form. PG repeat synthesis has
been described as essential for survival and development of Leishmania throughout their life cycle, including for
virulence to the mammalian host. In this study, this proposal was
investigated in Leishmania mexicana using a spontaneous
mutant that was fortuitously isolated from an infected mouse, and by
generating a lmexlpg2 gene deletion mutant
(
lmexlpg2), that lacks a Golgi GDP-Man
transporter. The spontaneous mutant lacks PG repeats but synthesizes
normal levels of mannooligosaccharide phosphate caps, whereas the
lmexlpg2 mutant is deficient in PG repeat
synthesis and down-regulates cap expression. In contrast to
expectations, both L. mexicana mutants not only retain
their ability to bind to macrophages, but are also indistinguishable
from wild type parasites with respect to colonization of and
multiplication within host cells. Moreover, in mouse infection studies,
the spontaneous L. mexicana repeat-deficient mutant and the
lmexlpg2 mutant showed no significant
difference to a wild type strain with respect to the severity of
disease caused by these parasites. Therefore, at least in
Leishmania mexicana, PG repeat synthesis is not an absolute
requirement for virulence.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1-4Man
1-PO4-]n) that
may carry glycan side chains and often terminate at their nonreducing
ends with mannose-rich oligosaccharide caps (Fig. 1A).
Leishmania PG repeats and caps exists 1) as free secreted phosphoglycan chains (3), 2) linked to a glycolipid core on lipophosphoglycan (LPG) (4, 5), and 3) attached to a large range of
secreted and cell surface-associated parasite proteins collectively
called proteophosphoglycans (PPGs) (6, 7).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1-4Man
1PO4-]x, x = unknown), L7.25 and AP3 (directed against
[Man
1-2]0-2Man
1-PO4), LT17 (most
likely directed against
[6(Glc
1-3)Gal
1-4Man
1PO4-]x, x = unknown) and mAb L3.8 directed against a
polypeptide epitope of L. mexicana leishmanolysin/gp63, as
well as the biotinylated lectin concanavalin A (Sigma). The mAbs were
diluted 1:2-1:10 (hybridoma supernatant) or 1:500-1:2000 (ascites
fluid), and the lectin was used at 10 µg/ml. Bound mAbs and the
biotinylated lectin were detected by incubation with Cy3-labeled goat
anti mouse IgG/IgM (Dianova, 1:500) and fluorescein
isothiocyanate-labeled streptavidin (Sigma, 1:250), respectively.
-Dash-II library (25) and a dedicated pBSK+ (Stratagene)
plasmid library of 1.5-2.5-kilobase pair XhoI fragments derived from genomic L. mexicana DNA. Positive clones
were subcloned into pBSK+ or pGEM-5z (Promega) and
sequenced on both strands by the dideoxy chain termination method using
an ALFexpress automated sequencer (Amersham Pharmacia Biotech) as
described previously (24) and the open reading frame corresponding to
lmexlpg2 was identified by homology to L. donovani
lpg2 (14). Double targeted gene replacement was performed by PCR
amplification of the 5'-untranslated region (5'-UTR) of
lmexlpg2 using the primers KO1
(AGATCTAGACAGGGTGCCGTGTC) and KO2
(AGTACTAGTAGATGCTGATGCAATCTT) and by amplification of the
3'-UTR of lmexlpg2 using the primers KO3
(TCCGGATCCACCATTGCTAGCAGCAGT) and KO4
(GATATCGATGAATTCAATGGGCTCTGTGTAC). The
XbaI/SpeI-cut lmexlpg2 5'-UTR PCR DNA
fragment, the BamHI/ClaI-cut lmexlpg2 3'-UTR PCR DNA fragment, and a SpeI/BamHI DNA fragment
containing a hygromycin phosphotransferase gene (hyg) (26)
were ligated consecutively into pBSK+. For the second
lmexlpg2 gene replacement cassette, a SpeI/BamHI fragment containing the phleomycin-binding protein gene
(phleo) was used (7). The hyg- and
phleo-containing gene replacement cassettes were excised
from the plasmids by XbaI/ClaI digestion and transfected
into L. mexicana promastigotes as described previously (24).
Selection on 96-well microtiter plates and analysis of positive clones
was performed as outlined previously (7). For gene addback studies, the
open reading frame of lmexlpg2 was amplified from a
gene-containing plasmid using the primers
TCCGGATCCGCATCTACCATGAACCACACG and
CTTGCGGCCGCTGTTTTTTAGTACGGAC. The
BamHI/NotI-cut PCR fragment was then cloned into
pX (27). L. mexicana
lmexlpg2 promastigotes
were transfected with this construct as described previously (24), and
transfectants were selected by growth in SDM plus 5% heat-inactivated
fetal calf serum containing 10-50 µg/ml G418 (Roche). The sequence
data for the lmexlpg2-containing DNA fragment have been
submitted to the EMBL data base under accession no. AJ278970.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (39K):
[in a new window]
Fig. 1.
A, structure of L. mexicana
LPG and promastigote PPGs. The sites of the defects caused by the
absence of LPG2 are indicated by bold bars and
double arrows, partial defects by the
dotted bar and dotted
double arrows (Ref. 14 and this study). The
putative defect of the PG repeat-negative mutant (PG
) is
indicated by double arrows. The defect caused by
the absence of LPG1 (38) is marked by an arrowhead. The
binding sites of the mAbs L7.25, LT17, and LT6 are indicated by
arrows. B, alignment of L. mexicana
LPG2 with L. donovani LPG2 (14). C,
hydrophobicity plot of L. mexicana LPG2 according to Kyte
and Doolittle (39).

View larger version (37K):
[in a new window]
Fig. 2.
Targeted gene replacement of the
lmexlpg2 alleles. A, restriction map
of the lmexlpg2 locus. The resistance genes phleo
and hyg and the primer binding sites for the construction of
gene deletion cassettes are indicated. B, Southern blot
analysis of NcoI restriction enzyme-digested chromosomal DNA
(5 µg) from a L. mexicana lmexlpg2 gene deletion mutant
for both alleles (lanes 1) or for one allele
(lanes 2) and from L. mexicana wild
type. DNA was separated on an ethidium bromide-containing 0.7% agarose
gel (left panel), blotted onto a nylon membrane
and incubated with a digoxygenin-labeled lmexlpg2 gene probe
(right panel). The sizes of DNA standards are
indicated in kilobase pairs.
lmexlpg2 Mutant--
Immunoblot
studies on total cell lysates using the
anti-([6-Gal
1-4Man
1PO4-]n)
repeat mAb LT6 (Fig. 1A) showed that, as in the
lmexlpg1 mutant (7), LPG-like molecules were completely absent in the PG repeat-negative mutant and in the
lmexlpg2 mutant. However, in contrast to the
lmexlpg1 mutant, PPG-like molecules were also absent
(Fig. 3A). These results were
confirmed by IFM and FACS studies, which
revealed a prominent flagellar pocket and
a weak cell surface signal on
lmexlpg1 mutants (Figs.
4F and 5A), but no
reaction on either the PG repeat-negative mutant or the
lmexlpg2 mutant (Figs. 4 (G and
H) and 5A). With the distinct anti-repeat mAb
LT17 (Fig. 1A), which binds preferentially to PPGs
versus LPG (Fig. 3B), similar results were
obtained, except for a very weak signal in immunoblots of the
lmexlpg2 mutant, which was also apparent in FACS analysis
(Fig. 5B). The anti-mannooligosaccharide cap antibody L7.25
(Fig. 1A) recognizes LPG and a large number of
phosphoglycosylated parasite PPGs (Fig. 3C, lane
1) (7, 29). In the
lmexlpg1 mutant, the
immunoblot signal of LPG is absent, as expected (7), whereas the signal
of PPGs is increased (Fig. 3, B and C,
lanes 2). In the PG repeat-negative mutant, L7.25
recognizes the full set of PPGs, whereas LPG is absent. Instead, in the
low molecular weight region near the front of the gel, a broad band of
L7.25-reactive material is visible that is absent in either wild type
parasites or the
lmexlpg1 mutant (Fig.
3C, lanes 1-3). This material is
reminiscent of the LPG precursor GIPL-6 from L. major (31),
which is also reactive with
L7.25.2 FACS analysis (Fig.
5C) and IFM (data not shown) suggests that surface L7.25
epitopes are not down-regulated in the LT6-negative mutant.
Mannooligosaccharide cap synthesis is, however, down-regulated in the
lmexlpg2 mutant, as judged by immunoblotting
(Fig. 3C, lane 4), FACS analysis (Fig.
5C), and IFM (data not shown), but not to undetectable
levels (Fig. 3C, lane 4). This result
indicates that, in contrast to repeat synthesis, the assembly of
mannooligosaccharide caps is only partially affected by the loss of the
Golgi GDP-mannose transporter. In immunoblot and FACS analysis of the
LPG2-deficient L. donovani mutant C3PO (14, 17) using mAb
L7.25, we obtained similar results (data not shown). Concanavalin A, a
lectin directed preferentially against
-mannosyl residues, bound
more avidly to the surface of
lmexlpg2 mutants
than to the wild type (Fig. 5D), while its binding to PG
repeat-negative or
lmexlpg1 parasites was
unchanged (data not shown). Surface expression of the
glycosylphosphatidylinositol membrane-anchored cell surface
metalloproteinase leishmanolysin (gp63) was not diminished in either
lmexlpg1, the PG repeat-negative mutant or
lmexlpg2 (Fig. 4, A-D). FACS
analysis suggested an increase of surface fluorescence by a factor of
2-3 in these mutants (Fig. 5E), most likely due to better
access of the mAb L3.8 to surface gp63 in the absence of LPG rather
than an increase in expression of this metalloproteinase (7). Attempts
to purify LPG-like molecules from promastigotes of L. mexicana PG repeat-negative and
lmexlpg2
mutants by a standard method (32) were unsuccessful, as described
previously for L. mexicana
lmexlpg1
(data not shown; Ref. 7). Furthermore, absence of LPG in the
LT6-negative and
lmexlpg2 mutants was
confirmed by [3H]inositol labelings, which also suggested
that there is no increase in gp63 expression in either mutant (Fig.
6).

View larger version (43K):
[in a new window]
Fig. 3.
SDS-PAGE/immunoblot analysis of total
promastigote lysates (2 × 107 cells) from L. mexicana wild type and different PG-deficient mutant
promastigotes. A-C, lanes 1,
L. mexicana wild type; lanes 2,
L. mexicana
lmexlpg1; lanes
3, L. mexicana, PG repeat-negative mutant;
lanes 4, L. mexicana
lmexlpg2; lanes 5, L. mexicana
lmexlpg2 + pXlpg2. The blots
were probed with the mAbs LT6 (A), LT17 (B), and
L7.25 (C). The boundary between the stacking and the
separating gel is marked by arrows. The molecular masses of
standard proteins are indicated in kilodaltons.

View larger version (41K):
[in a new window]
Fig. 4.
Immunofluorescence labeling of L. mexicana WT and phosphoglycan-deficient mutant
promastigotes. A, E, and
I, L. mexicana WT; B, F,
and J, L. mexicana
lmexlpg1, clone
I/8D; C, G, and K, L. mexicana
lmexlpg2; D, H, and
L, L. mexicana repeat-negative mutant;
A-D, mAb L3.8; E-H, mAb LT6; I-L,
mAb LT17. The exposure times within rows are identical.

View larger version (43K):
[in a new window]
Fig. 5.
FACS analysis of live L. mexicana
wild type and different PG-deficient mutant promastigotes
(
lmexlpg1,
lmexlpg2,
lmexlpg2 + pXlpg2, and
PG repeat-negative mutant). A, mAb LT6; B,
mAb LT17; C, mAb L7.25; D, concanavalin A;
E, mAb L3.8.

View larger version (47K):
[in a new window]
Fig. 6.
SDS-PAGE/fluorography of delipidated lysates
(5 × 107 cells) from
myo-[3H]inositol-labeled L. mexicana wild type and different phosphoglycan-deficient
mutant promastigotes. Lane 1, L. mexicana wild type; lane 2, L. mexicana
lmexlpg1; lane 3, PG
repeat-negative mutant; lane 4,
lmexlpg2. The positions of mPPG, gp63, and LPG are marked
by bars, and the boundary between the stacking gel and the separating
gel (S) is marked by an arrow. The molecular
masses of 14C-labeled standard proteins are indicated in
kilodaltons.
lmexlpg1 mutants,
as indicated by a stronger signal and an increase in apparent molecular
mass on immunoblots (Fig. 7A, B and C,
lanes 3). The PG repeat-negative mutant showed a
normal level of L7.25 epitopes, but LT17 epitopes were absent (Fig. 7,
A-C, lanes 4), whereas SAP of the
lmexlpg2 mutant was devoid of either binding
sites. This lack of phosphoglycan caps and repeats led to a
considerable decrease in apparent molecular mass (Fig. 7A,
lane 2). As indicated by immunoblots of total
cell lysates (Fig. 3, A-C, lanes 4)
and the FACS analyses (Fig. 5, A-D), the PG-deficient
phenotype of
lmexlpg2 could be reversed by
episomal expression of the lmexlpg2 gene from plasmid
pX.

View larger version (30K):
[in a new window]
Fig. 7.
SDS-PAGE/immunoblot analysis of culture
supernatant from L. mexicana wild type and different
PG-deficient mutant promastigotes. The loading was normalized to
the acid phosphatase activity secreted by the parasites (~20
milliunits corresponding to ~30 ng of SAP (Ref. 40)).
A-C, lanes 1, L. mexicana
wild type; lanes 2, L. mexicana
lmexlpg2; lanes 3, L. mexicana
lmexlpg1 clone I/8D; lanes
4, L. mexicana, PG repeat-negative mutant. The
blots were probed with affinity-purified polyclonal rabbit anti-SAP
antibodies (A), mAb L7.25 (B), and mAb LT17
(C). The positions of SAP1, SAP2, and fPPG (7)
are marked by bars. The molecular masses of standard
proteins are indicated in kilodaltons.
lmexlpg2 is almost completely deficient for
phosphoglycan repeats and severely down-regulates mannooligosaccharide
cap synthesis.
lmexlpg1, the PG repeat-negative, and the
lmexlpg2 mutant are in agreement with this
view, as no gross changes in abundance and composition of GIPLs could
be detected in comparison with the wild type by either isolation and
chemical staining (Fig. 8A),
by [3H]mannose (Fig. 8B), or by
myo-[3H]inositol labeling (data not
shown). Some extra glycolipid bands observed in
[3H]mannose labelings of
lmexlpg1 and
lmexlpg2 may be due to accumulating LPG core precursors
(Fig. 8B).

View larger version (59K):
[in a new window]
Fig. 8.
Silica gel 60 HPTLC analysis of the
predominant L. mexicana promastigote glycolipids.
A, total lipids from 2 × 108 promastigotes
were loaded onto a HPTLC plate. After chromatography, glycolipids were
visualized by orcinol/H2SO4 spraying.
B, 50,000 cpm of total lipids from
[3H]mannose-labeled promastigotes were loaded onto a
HPTLC plate. After chromatography, glycolipids were visualized by
fluorography. The positions of the abundant L. mexicana
GIPLs are indicated by the bars, the start and front of the TLCs are
marked by S and F, respectively.
Asterisks mark putative LPG core intermediates accumulating
in
lmexlpg1 and
lmexlpg2 mutants.
A and B, lanes 1, wild
type; lanes 2, PG repeat-negative mutant;
lanes 3,
lmexlpg1; lanes
4,
lmexlpg2.
lmexlpg2--
Phosphoglycan synthesis of Leishmania is
considered to be crucial for successful invasion and colonization of
mammalian macrophages (6, 15, 17, 19). However, in macrophage binding
experiments,
lmexlpg2 mutants appeared to be
more efficient in attachment than either wild type parasites or gene
addback mutants (Fig. 9A).
Transformation to amastigotes and intracellular survival in long
term infection studies of macrophages was very similar for
lmexlpg2,
lmexlpg1, and PG repeat-negative
L. mexicana mutants compared with wild type parasites or
gene addback
lmexlpg2 mutants (Fig. 9B).
Intracellular multiplication of
lmexlpg2,
lmexlpg1, and PG repeat-negative L. mexicana
mutant amastigotes appeared to be even more pronounced than that of
wild type parasites or gene addback
lmexlpg2 mutants
(Fig. 9C). Immunofluorescence studies on infected
macrophages demonstrated that, as expected, in L. mexicana
lmexlpg2-parasitized macrophages PG repeats and
mannooligosaccharide caps are largely absent (Fig.
10, A, B,
E, F, I, and J), while these epitopes are abundant in L. mexicana wild
type-infected host cells (Fig. 10, C, D,
G, H, K, and L).
Collectively these data suggest that, in contrast to previous
assumptions, PG repeats and mannooligosaccharide caps are not essential
for successful macrophage infections by L. mexicana.

View larger version (15K):
[in a new window]
Fig. 9.
Analysis of macrophage binding and macrophage
infection by L. mexicana wild type and
phosphoglycan-deficient mutant promastigotes. A,
binding of L. mexicana wild type,
lmexlpg2,
and
lmexlpg2 + pXlmexlpg2 to peritoneal
macrophages after incubation with 5 parasites/cell for 1 h. The
bars show the percentage of macrophages with attached
promastigotes and represent the average of two to three experiments.
The standard error is indicated. B, infection of peritoneal
macrophages by L. mexicana wild type,
lmexlpg2,
lmexlpg2 + pXlmexlpg2,
PG repeat-deficient, and
lmexlpg1 promastigotes
(2/macrophage). The bars show the percentage of infected
macrophages 6 days after challenge with 2 promastigotes/host cell and
represent the average of three to four experiments. The standard error
is indicated. C, infected macrophages containing >10
parasites 6 days after challenge with 2 promastigotes/host cell. The
bars represent the average of two to three experiments, and
the standard error is indicated.

View larger version (22K):
[in a new window]
Fig. 10.
Immunofluorescence of saponin-permeabilized
peritoneal macrophages infected with five L. mexicana
lmexlpg2 (A,
B, E, F,
I, and J) or wild type
(C, D, G,
H, K, and L)
promastigotes per host cell. Infected macrophages were labeled
after 3 days in culture with the mAbs LT6 (A and
C), LT17 (E and G), and L7.25
(I and K). Counterstaining of the same specimen
for DNA was performed with 4,6-diamidino-2-phenylindole
(Dapi; B, D, F,
H, J, and L).
Leishmania-infected macrophages that can be recognized by
the intracellular spotlike 4,6-diamidino-2-phenylindole signals of the
parasite kinetoplasts are marked by arrows, whereas
uninfected cells are marked by asterisks. The exposure times
are identical for specimens stained with the same antibody.
lmexlpg2
Mutants Remain Infective to Mice--
PG repeat synthesis in general
(15) and the Golgi GDP-mannose transporter LPG2 specifically (2, 14)
have been implicated in a specialized virulence pathway of
Leishmania that is thought to be required for their
infectivity to mammals. To investigate these proposals more
stringently, BALB/c mice were infected with wild type,
lmexlpg2, PG repeat-negative, and, for
comparison, with
lmexlpg1 L. mexicana
promastigotes. Mice infected with 107 parasites immediately
developed footpad lesions with all parasite strains, whereas a
challenge dose of 105 parasites led to a 30-40-day delay
in lesion formation (Fig. 11,
A-D). Surprisingly, only minor differences in lesion
development were observed between L. mexicana wild type
parasites or L. mexicana lmexlpg2 + pXlmexlpg2
addback mutants and PG repeat-negative or
lmexlpg2 mutants (Fig. 11, A-D).
As observed previously (7) disease progression caused by the L. mexicana
lmexlpg1 mutant, which is selectively
deficient in LPG synthesis, was faster than in all other strains and
mutants investigated in this study. L. mexicana
lmexlpg2 and PG repeat-negative parasites could be
reisolated from lesion tissue, draining lymph nodes and the spleen of
infected animals, suggesting that they retained the ability to
metastasize in mice. Lack of PG repeat expression in reisolated
promastigotes was confirmed by IFM analysis. These results indicate
that, in contrast to expectation, PG repeat synthesis in L. mexicana is not required for efficient experimental infection of
BALB/c mice.

View larger version (31K):
[in a new window]
Fig. 11.
Infection of BALB/c mice with L. mexicana wild type PG-deficient mutant promastigotes.
Mice were challenged with either 107 (A and
B) or 105 (C and D)
L. mexicana promastigotes in the right hind footpad. The
swelling caused by L. mexicana wild type,
lmexlpg2, and
lmexlpg2 + pXlmexlpg2 are shown in A and C,
whereas the courses of the disease elicited by
lmexlpg1
and the PG-negative mutant compared with the same wild type curve as in
A and C are shown in B and
D. The infection experiments were performed in triplicate,
and the standard error is indicated.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
lpg2 mutant has not been tested, which raised the
possibility that the loss of virulence may have been unrelated to the
loss of PG synthesis); 2), the multitude of proposed biological and
pharmacological activities for LPG and PG chains (19), which suggested
an essential function; and 3), a range of functional studies on
amastigote-expressed aPPG (6), which indicated an important role for
this molecule for the colonization of mammalian tissue by
Leishmania.
lmexlpg2 mutant are as efficient in colonizing
macrophages and BALB/c mice as their parental wild type strain. Both
the PG repeat-negative mutant and the
lmexlpg2 mutant
lack wild type LPG and PG repeats on PPGs such as SAP, mPPG (this
study), and fPPG (Ref. 6; data not shown). By contrast,
mannooligosaccharide cap structures appear to be present at normal
levels in the PG-negative mutant, whereas the
lmexlpg2
mutant down-regulates the expression of such epitopes considerably on
cellular proteins and to undetectable levels on secreted SAP and fPPG.
This suggests that, like PG repeat synthesis, mannooligosaccharide cap
synthesis occurs primarily in the Leishmania Golgi. However,
the presence of some cap epitopes in
lmexlpg2 promastigotes suggests that these are synthesized in a manner or at a
location that does not require the Golgi GDP-Man transporter. By
contrast, in immunofluorescence studies on
Leishmania-infected macrophages, neither PG repeats nor
mannooligosaccharide caps could be detected by monoclonal antibodies,
which indicates that amastigotes do not even require this residual cap
synthesis observed in promastigotes. The increase in concanavalin A
binding on L. mexicana
lmexlpg2 promastigotes
could be due to the increased exposure of
-Man-terminating GIPLs
(30) or N-glycans on the cell surface or the PG
repeat-deficient parasites. This increase of potential mannose/fucose
receptor binding sites may explain the more avid macrophage binding of
mutant versus wild type parasites. The synthesis of the
abundant cell surface GIPLs is not affected in any of the virulent PG
repeat-deficient mutants, which is in agreement with a potentially
essential role for these glycolipids (41). The results of this study
provide also an explanation for our recent finding that deletion of the
gene ppg2 (36) encoding the dominant secreted PPG of
amastigotes, the aPPG (22), has only a minor impact on parasite
virulence to macrophages or mice (37).2
| |
ACKNOWLEDGEMENTS |
|---|
We thank Peter Overath and Suzanne Gokool for valuable suggestions on the manuscript and Salvatore Turco for the L. donovani mutant C3PO.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ278970.
To whom correspondence should be addressed. Fax: 49-7071-601235;
E-mail: thomas.ilg@tuebingen.mpg.de.
Published, JBC Papers in Press, November 8, 2000, DOI 10.1074/jbc.M008030200
2 T. Ilg, unpublished results.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PG, phosphoglycan; LPG, lipophosphoglycan; PPG, proteophosphoglycan; fPPG, filamentous proteophosphoglycan; mPPG, membrane-bound proteophosphoglycan; aPPG, amastigote proteophosphoglycan; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; GIPL, glycoinositol phospholipid; FACS, fluorescence-activated cell sorting; mAb, monoclonal antibody; WT, wild type; UTR, untranslated region; IFM, immunofluorescence microscopy; SAP, secreted acid phosphatase; SDM, semi-defined medium 79.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alexander, J., and Russell, D. G. (1992) Adv. Parasitol. 31, 175-254 |
| 2. | Beverley, S. M., and Turco, S. J. (1998) Trends Microbiol. 6, 35-40 |
| 3. | Greis, K. D., Turco, S. J., Thomas, J. R., McConville, M. J., Homans, S. W., and Ferguson, M. A. J. (1992) J. Biol. Chem. 267, 5876-5881 |
| 4. | Turco, S. J., and Descoteaux, A. (1992) Annu. Rev. Microbiol. 46, 65-94 |
| 5. | McConville, M. J., and Ferguson, M. A. J. (1993) Biochem. J. 294, 305-324 |
| 6. | Ilg, T., Handman, E., and Stierhof, Y.-D. (1999) Biochem. Soc. Trans. 27, 518-525 |
| 7. | Ilg, T. (2000) EMBO J. 19, 1-11 |
| 8. | Sacks, D. L. (1989) Exp. Parasitol. 69, 100-103 |
| 9. | Pimenta, P. F. P., Turco, S. J., McConville, M. J., Lawyer, P. G., Perkins, P. V., and Sacks, D. L. (1992) Science 256, 1812-1815 |
| 10. | Pimenta, P. F., Saraiva, E. M., Rowton, E., Modi, G. B., Garraway, L. A., Beverley, S. M., Turco, S. J., and Sacks, D. L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9155-9160 |
| 11. | Sacks, D. L., Pimenta, P. F. P., McConville, M. J., Schneider, P., and Turco, S. J. (1995) J. Exp. Med. 181, 685-697 |
| 12. | Butcher, B. A., Turco, S. J., Hilty, B. A., Pimenta, P. F., Panunzio, M., and Sacks, D. L. (1996) J. Biol. Chem. 271, 20573-20579 |
| 13. | Sacks, D. L., Modi, G., Rowton, E., Späth, G., Epstein, L., Turco, S. J., and Beverley, S. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 406-411 |
| 14. | Descoteaux, A., Luo, Y., Turco, S. J., and Beverley, S. M. (1995) Science 269, 1869-1872 |
| 15. | Mengeling, B. J., Beverley, S. M., and Turco, S. J. (1997) Glycobiology 7, 873-880 |
| 16. | King, D. L., and Turco, S. J. (1988) Mol. Biochem. Parasitol. 28, 285-294 |
| 17. | McNeely, T. B., and Turco, S. J. (1990) J. Immunol. 144, 2745-2750 |
| 18. | Elhay, M. J., Kelleher, M., Bacic, A., McConville, M. J., Tolson, D. L., Pearson, T. W., and Handman, E. (1990) Mol. Biochem. Parasitol. 40, 255-268 |
| 19. | Descoteaux, A., and Turco, S. J. (1999) Biochim. Biophys. Acta 1455, 341-352 |
| 20. | Ma, D., Russell, D. G., Beverley, S. M., and Turco, S. J. (1997) J. Biol. Chem. 272, 3799-3805 |
| 21. | Ilg, T., Stierhof, Y.-D., McConville, M. J., and Overath, P. (1995) Eur. J. Cell Biol. 66, 215-227 |
| 22. | Ilg, T., Craik, D., Currie, G., Multhaup, G., and Bacic, A. (1998) J. Biol. Chem. 273, 13509-13523 |
| 23. | Ilg, T., Harbecke, D., Wiese, M., and Overath, P. (1993) Eur. J. Biochem. 217, 603-615 |
| 24. | Ilg, T., Montgomery, J., Stierhof, Y.-D., and Handman, E. (1999) J. Biol. Chem. 274, 31410-31420 |
| 25. | Wiese, M., Ilg, T., Lottspeich, F., and Overath, P. (1995) EMBO J. 14, 1067-1074 |
| 26. | Cruz, A., Coburn, C. M., and Beverley, S. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 89, 7170-7174 |
| 27. | LeBowitz, J. H., Coburn, C. M., McMahon-Pratt, D., and Beverley, S. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9736-9740 |
| 28. | Stierhof, Y.-D., Wiese, M., Ilg, T., Overath, P., Häner, M., and Aebi, U. (1998) J. Mol. Biol. 282, 137-148 |
| 29. | Ilg, T., Menz, B., Winter, G., Russell, D. G., Etges, R., Schell, D., and Overath, P. (1991) J. Cell Sci. 99, 175-180 |
| 30. | McConville, M. J., Collidge, T. A., Ferguson, M. A. J., and Schneider, P. (1993) J. Biol. Chem. 268, 15595-15604 |
| 31. | McConville, M. J., and Homans, S. W. (1992) J. Biol. Chem. 267, 5855-5861 |
| 32. | McConville, M. J., Thomas-Oates, J., Ferguson, M. A. J., and Homans, S. W. (1990) J. Biol. Chem. 265, 19611-19623 |
| 33. | Ralton, J. E., and McConville, M. J. (1998) J. Biol. Chem. 273, 4245-4257 |
| 34. | Stierhof, Y.-D., Bates, P. A., Jacobson, R., Schlein, Y., Rogers, M. E., Handman, E., and Ilg, T. (1999) Eur. J. Cell Biol. 78, 675-689 |
| 35. | Späth, G. F., Epstein, L., Leader, B., Singer, S. M., Avila, H. A., Turco, S. J., and Beverley, S. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 9258-9263 |
| 36. | Göpfert, U., Goehring, N., Klein, C., and Ilg, T. (1999) Biochem. J. 344, 787-795 |
| 37. | Ilg, T. (2000) Parasitol. Today 16, 489-497 |
| 38. | Huang, C., and Turco, S. J. (1993) J. Biol. Chem. 268, 24060-24066 |
| 39. | Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 |
| 40. | Ilg, T., Stierhof, Y.-D., Etges, R., Adrian, M., Harbecke, D., and Overath, P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8774-8778 |
| 41. | Ilgoutz, S. C., Zawadzki, J. C., Ralton, J. E., and McConville, M. J. (1999) EMBO J. 18, 2746-2755 |
| 42. | Peters, C., Stierhof, Y.-D., and Ilg, T. (1997) Infect. Immun. 65, 783-786 |
| 43. | Peters, C., Kawakami, M., Kaul, M., Ilg, T., Overath, P., and Aebischer, T. (1997) Eur. J. Immunol. 27, 2666-2672 |
This article has been cited by other articles:
![]() |
A. A. Capul, S. Hickerson, T. Barron, S. J. Turco, and S. M. Beverley Comparisons of Mutants Lacking the Golgi UDP-Galactose or GDP-Mannose Transporters Establish that Phosphoglycans Are Important for Promastigote but Not Amastigote Virulence in Leishmania major Infect. Immun., September 1, 2007; 75(9): 4629 - 4637. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Turnock and M. A. J. Ferguson Sugar Nucleotide Pools of Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major Eukaryot. Cell, August 1, 2007; 6(8): 1450 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Capul, T. Barron, D. E. Dobson, S. J. Turco, and S. M. Beverley Two Functionally Divergent UDP-Gal Nucleotide Sugar Transporters Participate in Phosphoglycan Synthesis in Leishmania major J. Biol. Chem., May 11, 2007; 282(19): 14006 - 14017. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kleczka, A.-C. Lamerz, G. van Zandbergen, A. Wenzel, R. Gerardy-Schahn, M. Wiese, and F. H. Routier Targeted Gene Deletion of Leishmania major UDP-galactopyranose Mutase Leads to Attenuated Virulence J. Biol. Chem., April 6, 2007; 282(14): 10498 - 10505. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Sernee, J. E. Ralton, Z. Dinev, G. N. Khairallah, R. A. O'Hair, S. J. Williams, and M. J. McConville Leishmania beta-1,2-mannan is assembled on a mannose-cyclic phosphate primer PNAS, June 20, 2006; 103(25): 9458 - 9463. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Segawa, R. P. Soares, M. Kawakita, S. M. Beverley, and S. J. Turco Reconstitution of GDP-mannose Transport Activity with Purified Leishmania LPG2 Protein in Liposomes J. Biol. Chem., January 21, 2005; 280(3): 2028 - 2035. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Spath, L.-F. Lye, H. Segawa, S. J. Turco, and S. M. Beverley Identification of a Compensatory Mutant (lpg2-REV) of Leishmania major Able To Survive as Amastigotes within Macrophages without LPG2-Dependent Glycoconjugates and Its Significance to Virulence and Immunization Strategies Infect. Immun., June 1, 2004; 72(6): 3622 - 3627. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Uzonna, G. F. Spath, S. M. Beverley, and P. Scott Vaccination with Phosphoglycan-Deficient Leishmania major Protects Highly Susceptible Mice from Virulent Challenge without Inducing a Strong Th1 Response J. Immunol., March 15, 2004; 172(6): 3793 - 3797. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Ralton, T. Naderer, H. L. Piraino, T. A. Bashtannyk, J. M. Callaghan, and M. J. McConville Evidence That Intracellular {beta}1-2 Mannan Is a Virulence Factor in Leishmania Parasites J. Biol. Chem., October 17, 2003; 278(42): 40757 - 40763. [Abstract] [Full Text] [PDF] |
||||
![]() |