![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 8, 5459-5466, February 23, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
**
From the Departments of
Endodontics,
§ Physiology, and
Periodontology, Nihon University
School of Dentistry at Matsudo, Chiba 271-8587, Japan and the
¶ Canadian Institutes of Health Research Group in
Periodontal Physiology, Faculty of Dentistry and Department of
Biochemistry, Faculty of Medicine, University of Toronto,
Toronto, Ontario M5S 3E2, Canada
Received for publication, October 2, 2000, and in revised form, November 7, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Bone sialoprotein (BSP) is a sulfated and
phosphorylated glycoprotein, found almost exclusively in mineralized
connective tissues, that may function in the nucleation of
hydroxyapatite crystals. We have found that expression of BSP in
osteoblastic ROS 17/2.8 cells is stimulated by fibroblast growth factor
2 (FGF2), a potent mitogen for mesenchymal cells. Stimulation of BSP
mRNA with 10 ng/ml FGF2 was first evident at 3 h (~2.6-fold)
and reached maximal levels at 6 h (~4-fold). From transient
transfection assays, a FGF response element (FRE) was identified
(nucleotides Bone sialoprotein (BSP)1
is a highly sulfated, phosphorylated, and glycosylated protein that is
characterized by its ability to bind to hydroxyapatite, through
polyglutamic acid sequences, and to mediate cell attachment, through an
RGD sequence (1-4). The expression of BSP is essentially restricted in
the mineralized connective tissues. Studies on the developmental
expression of BSP have shown that BSP mRNA is produced at high
levels at the onset of bone, dentin, and cementum formation (5, 6).
Furthermore, the temporo-spatial deposition of BSP into the
extracellular matrix (6-8) and the ability of BSP to nucleate
hydroxyapatite crystal formation (9) indicate a role for this protein
in the initial mineralization of bone, dentin, and cementum (4). Recent
studies have shown that BSP is also expressed in osteotropic
cancers, suggesting BSP might play a role in the pathogenesis of bone
metastases (10). Thus, regulation of the BSP gene is important in the
differentiation of osteoblasts, in bone matrix mineralization and in
tumor metastasis. The human (11, 12), mouse (13), and rat (14) BSP
genes have been cloned and partially characterized. These promoters include a highly conserved region (BSP box) that extends upstream from
the transcription start site to nt Fibroblast growth factor-2 (FGF2 or basic FGF), a member of the
heparin-binding growth factor family of mitogens, has been implicated
in a range of normal physiological processes from embryonic mesoderm
induction and pattern formation to angiogenesis and wound repair (24,
25). FGF2 is also synthesized by osteoblasts and is stored in a
bioactive form in the extracellular matrix (26-29), where it acts as a
local regulator of bone formation. The FGF family of molecules
transduce signals to the cytoplasm via a family of transmembrane
receptors with tyrosine kinase activity (30-34). Four distinct gene
products encode highly homologous FGF receptors (FGFRs; FGFR1-4),
which share 56-71% amino acid sequence identity. The FGF
receptors contain three extracellular immunoglobulin-like domains, a
single transmembrane domain, and an intracellular tyrosine kinase
domain. Immunoglobulin-like domains II and III are sufficient for FGF
binding and determine affinity (30-34). Mutations in the FGFR1 gene
are associated with Pfeiffer syndrome, which is one of the classic
autosomal dominant craniosynostosis syndromes (31), while mutations in
FGFR2 and FGFR3 produce genetic disorders involving bone development.
Jackson-Weiss and Crouzon syndromes are allelic with mutations in FGFR2
(32, 33). Thanatophoric dysplasia, the most common neonatal lethal
skeletal dysplasia, and achondroplasia are caused by mutations in FGFR3
(34). Analysis of FGFR3-deficient mice has revealed prolonged bone
growth, showing that FGFR3 is a negative regulator of bone growth (35).
Collectively these studies, and the observation that intravenous FGF2
stimulates bone formation and mineralization (28, 36), indicate that FGF is an important regulator of bone formation.
FGF2 inhibits alkaline phosphatase activity in ROS 17/2.8 cells (27)
and the calcification of hypertrophic chondrocytes (37). FGF2 also
inhibits type I collagen and osteocalcin transcription in ROS 17/2.8
cells and MC3T3-E1 cells (26, 27, 38). However, the combination of FGF2
and forskolin markedly up-regulates osteocalcin mRNA accumulation
in MC3T3-E1 cells (38). An osteocalcin FGF2 response element (GCAGTCA
motif) has been identified in the proximal promoter of the rat
osteocalcin gene as a target of FGF2 and cAMP stimulation (38). The
induction of human osteocalcin transcription by FGF2 requires the
interaction of CCAAT motif that overlaps with three tandem repeats of a
nuclear factor-1 half-site (TTGGC) (39).
To determine the molecular mechanism of FGF2 regulation of the BSP
gene, we have analyzed the effects of the FGF2 on the expression of BSP
in ROS 17/2.8 cells. These studies have revealed a novel FRE that
mediates both the constitutive and FGF2-induced expression of BSP in
osteoblastic cells.
Materials--
Cell culture media, fetal bovine serum,
LipofectACE, penicillin, streptomycin, and trypsin were obtained
from Life Technologies, Inc., Tokyo, Japan. The pGL2-promoter vector,
pSV- Cell Culture--
The rat clonal cell lines, ROS 17/2.8
(generously provided by Dr. G. A. Rodan, Merck-Sharpe and Frosst,
West Point, PA) was used in these studies as an osteoblastic
cell line that synthesizes BSP (20). Cells grown to confluence in 60-mm
tissue culture dishes in Northern Hybridization--
Total RNA from the culture cells was
extracted with guanidium thiocyanate and, following purification,
20-µg aliquots of RNA were fractionated on a 1.2% agarose gel and
transferred onto a Hybond N membrane, as described previously (20).
Hybridizations were performed at 42 °C with either a
32P-labeled rat BSP or rat glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), DNA probe. Following hybridization, membranes
were washed four times for 5 min each at 21 °C in 300 mM
sodium chloride, 30 mM trisodium citrate, pH 7.0, containing 0.1% SDS. This was followed by two, 20-min washes at
55 °C in 15 mM sodium chloride, 1.5 mM
trisodium citrate, pH 7.0, 0.1% SDS. The hybridized bands, representing the two polyadenylated forms (1.6 and 2.0 kilobases) of rat BSP mRNA, were scanned in a Bio-imaging
analyzer (Fuji BAS 2000, Tokyo, Japan) and normalized to the
expression of GAPDH.
Transient Transfection Assays--
Exponentially growing ROS
17/2.8 cells were used for transfection assays. Twenty-four hours after
plating, cells at 50-70% confluence were transfected using
a LipofectACE reagent. The transfection mixture included 1 µg
of a luciferase (LUC) construct (20) and 2 µg of
pSV- Gel Mobility Shift Assays--
Confluent ROS 17/2.8 cells in
T-75 flasks incubated for 6 and 12 h with 10 ng/ml FGF2 in Statistical Analysis--
Triplicate samples were analyzed for
each experiment and experiments replicated to ensure consistency of the
responses to FGF2. Significant differences between control and FGF2
treatment were determined using Student's t test.
Stimulation of BSP mRNA Expression in ROS 17/2.8 Cells--
To
study the regulation of BSP expression by FGF2, we used ROS 17/2.8
cells, which have been shown to have osteoblastic characteristics (44,
45) and to express BSP mRNA constitutively (20). First, a
dose-response relation for FGF2 induction of BSP was established by
treating the ROS 17/2.8 cells with different concentrations of FGF2 for
6 h and measuring the BSP mRNA levels by Northern blot
analysis. At 1-50 ng/ml, FGF2 increased BSP mRNA with a maximal effect at 10 ng/ml (Fig. 1A).
This optimal level of FGF2 (10 ng/ml) was used to determine a time
course of BSP mRNA expression (Fig. 1B). FGF2
up-regulated BSP mRNA accumulation markedly in ROS 17/2.8 cells. A
stimulation of 2.6-fold was evident 3 h after the addition of
FGF2, with maximal levels (4.0-fold) of BSP mRNA obtained at 6 h. In comparison, osteopontin mRNA, which has been shown previously to be stimulated by FGF2 (27), was increased at 3 h and returned to base line at 12 h, whereas no effect on GAPDH mRNA was
observed.
Analysis of BSP mRNA Stability--
To determine whether the
increase in BSP mRNA was due to an increased stability of the BSP
mRNA in response to FGF2 treatment, ROS 17/2.8 cells were incubated
in the presence of the transcription inhibitor
5,6-dichloro-1- Transient Transfection Analysis of Rat BSP Promoter
Constructs--
To determine the site of FGF2-regulated transcription
in the 5'-flanking region of the BSP gene, various sized promoter
constructs ligated to a luciferase reporter gene were transiently
transfected into ROS 17/2.8 cells and their transcriptional activity
determined in the presence of FGF2. The constructs used, pLUC1-pLUC5,
encompassing nucleotides
By using a series of 5' deletion constructs between nts
Since protein kinases mediate FGF2 signaling activities, we also
investigated the effects of the PKC inhibitor H7, the PKA inhibitor
H89, the tyrosine kinase inhibitor herbimycin A, the Src kinase
inhibitor PP1, and the MEK inhibitor U0126 on FGF-mediated
transcription. Whereas FGF2-induced pLUC3 promoter activation was
inhibited by herbimycin A, PP1, and U0126, no effects were observed for
either H7 or H89 (Fig. 7), indicating an
involvement of Src and MAP kinase in the signaling pathway.
Gel Mobility Shift Assays--
To identify nuclear proteins that
bind to the FRE and mediate the FGF2 effects on transcription,
double-stranded oligonucleotides were end-labeled and incubated with
equal amounts (3 µg) of nuclear proteins extracted from confluent ROS
17/2.8 cells that were either not treated (control) or treated with 10 ng/ml FGF2 for 6 and 12 h. With nuclear extracts from confluent,
control cultures of ROS 17/2.8 cells, a shift of a single FRE
DNA-protein complex was evident (Fig. 8,
lane 1). After stimulation by FGF2 (10 ng/ml) for 6 and
12 h, DNA binding activity was increased (Fig. 8, lanes 2 and 3). That the DNA-protein complex represents a
specific interaction was indicated by competition experiments in which
an excess of FRE reduced the amount of complex formed in a
dose-dependent manner (20-, 40-, and 100-fold molar excess)
(Fig. 8, lanes 4-6). In contrast, consensus sequences for
CCAAT (20-100-fold excess), AP1 (40-fold excess) and GRE
(40-fold excess) did not compete with complex formation (Fig. 8,
lanes 7-11). However, double nucleotide mutations in the
FRE oligonucleotides produced in FREm2 and FREm3 (corresponding to
mutations in pLUC3M2 and pLUC3M3) eliminated its ability to compete for complex formation (Fig.
9, lanes 7-12), whereas
mutations in FREm1, and particularly FREm4, were able to compete (Fig.
9, lanes 4-6 and 13-15). These results show
that the middle portion of this motif (GGTGAGAA) is
necessary for binding. Since cycloheximide decreased the amount of the
FRE-protein complex induced by FGF2 (Fig. 9, lane 3), FGF2
appears to stimulate the synthesis of the nuclear factor. When used in
noncompetitive gel shifts, FREm1 (Fig.
10, lanes 4-6) and FREm4
(Fig. 10, lanes 13-15) showed similar DNA-protein complexes
as FRE (Fig. 10, lanes 1-3), whereas no shift was seen with
FREm3 (Fig. 10, lanes 10-12), and FREm2 generated a slower
migrating DNA-protein complex (Fig. 10, lanes 7-9).
To verify that the FGF2 was operating through a unique FRE, we also
used gel mobility shift analyses to evaluate the potential effects of
FGF2 on the nearby inverted CCAAT, NF FGFs have a prominent role in bone development and growth. During
endochondral ossification unregulated FGF signaling can produce
premature suture closure (craniosynostosis) and other craniofacial
anomalies. BSP has been characterized as a unique marker of osteogenic
differentiation that can regulate the formation of mineral crystals
(4). Our studies have identified a novel GGTGAGAA element in the
proximal promoter of the BSP gene that mediates both basal and
FGF2-stimulated transcription of BSP promoter-reporter constructs. This
BSP-FRE binds a nuclear protein, the presence of which in unstimulated
ROS 17/2.8 cells indicates that it is expressed constitutively. The
nuclear protein also appears to be necessary for basal transcription of
BSP, since double mutations in the FRE abrogate nuclear protein binding
and transcription. FGF2 stimulated the expression of this nuclear
protein in association with the increased transcription of both the
endogenous BSP gene and chimeric constructs containing the FRE.
Since osteoblastic cells derived from an osteosarcoma were in our
studies, the regulation of BSP by FGF2 that we have observed may also
be relevant to the expression of BSP in tumors. In addition to being
produced by osteogenic tumors, BSP is also expressed in breast, lung,
thyroid, and prostate cancers (46-49), and the presence of BSP in
human primary breast cancers has been associated with an increased risk
for subsequent bone metastases and a poor survival rate (10, 46). The
ability of BSP to bind to hydroxyapatite crystals and to mediate cell
attachment through cell-surface integrins may be involved in the
osteotropism of the metastatic cells (4, 10, 50). FGF2 is significantly
increased in prostate cancers, relative to normal prostate (51), and
the concentrations of FGF2 in nipple fluid is significantly increased
in breast cancer patients (52). Recent reports have also shown
expression of FGF and FGF receptor genes in human breast cancer cell
lines and tumor samples (53), indicating a close relation between FGF expression and osteotropic cancers. Thus, it is conceivable that the
BSP regulation by FGF2 could also relate to cancer cells.
The biological effects of FGFs are initiated by the autophosphorylation
of receptor tyrosines, which provide high affinity binding sites for
Src Homology 2 domain-containing signaling molecules, such as PLC In ROS 17/2.8 cells, FGF2 increased the steady-state level of BSP
mRNA ~4-fold (Fig. 1B). Since there was no apparent
change in BSP mRNA stability, which has a half-life of ~16 h in
both the presence and absence of FGF2, and FGF2 stimulated BSP promoter activity (pLUC3) ~3-fold (Fig. 2), FGF2 could be shown to regulate BSP mRNA expression primarily via transcriptional control. From transient transfection assays we initially located the FGF2-responsive region to the proximal promoter (nts We identified a protein in nuclear extracts of ROS 17/2.8 cells that
selectively bound to the FRE and which was up-regulated by FGF2 (Fig.
8) in association with increased transcription (Fig. 2). That the
protein binds specifically to the FRE was demonstrated by a combination
of competition gel mobility shift assays (Fig. 8) and gel mobility
shifts with oligonucleotides representing the mutated forms of the FRE
(Fig. 9) used for transcriptional analysis. Moreover, the FRE
DNA-protein complex was unaffected by an inverted CCAAT, and consensus
AP1 and GRE (Fig. 8), BSP-NF Transcriptional regulation of the BSP gene by FGF2 contrasts mechanisms
described for other genes. Thus, FGF2 leads to its own synthesis
through an autoregulated transcriptional response that requires the
transcription factor Egr-1, which binds to a site overlapping an SP1
binding motif (63). In comparison, up-regulation of matrix
metalloproteinase-1 gene expression by FGF2 in NIH3T3 fibroblasts is
mediated through an AP1 consensus sequence (64). FGF2 signaling in
Xenopus requires AP1/Jun for early development and mesoderm
induction (65), while FGF2 and cAMP synergistically activate
proenkephalin gene expression via ATF3 and c-Jun through a cAMP
response element (66). Members of the ATF/CREB family utilize a leucine
zipper region to form heterodimers that bind to a consensus DNA
sequence (TGACGTCA), and both ATF1 and ATF2 have been demonstrated to
stimulate transcription. In contrast, ATF3 represses rather than
activates transcription (42). In the rat osteocalcin gene, expression
is synergistically induced by FGF2 and cAMP through a GCAGTCA motif
rather than an AP1 sequence (TCAGTCA) (38). Transient coexpression of
ATF3, but not ATF2, selectively attenuates the FGF2/forskolin induction
of rat osteocalcin transcription (38). The induction of human
osteocalcin promoter activity by FGF2 requires the interaction of a
CCAAT motif that overlaps with three tandem repeats of nuclear factor-1
half-sites (39). However, the factors mediating the FGF responses have not been identified. Our studies show that FGF2 alone can stimulate BSP
transcription, and neither ATF2 and ATF3 has any effect on FGF2
stimulation (results not shown). Moreover, while AP1 binding activities
were up-regulated by FGF2 in gel shift assays (Fig. 11B),
and the AP1 sequence (TGAGTCA) is quite similar to central
portion of the FRE motif (GGTGAGAA), the AP1 and FRE-protein
complexes did not comigrate (Fig. 11B), and AP1 could not
compete FRE DNA-protein complex (Fig. 8), indicating that the
FRE-binding protein is distinct from AP1. Furthermore, we have shown
that BSP gene expression is suppressed by
12-O-tetradecanoylphorbol 13-acetate through an AP1 motif
(21). Although the FRE and NF In summary, we have shown that a FRE motif (GGTGAGAA) exists in the rat
BSP proximal promoter through which the stimulatory effects of FGF2 on
BSP gene transcription are mediated. Since BSP is expressed by
differentiated osteoblasts, and FGF2 is a crucial factor for bone
metabolism, it is conceivable that a FRE-binding transcription factor
may contribute to the cell-specific expression of the BSP gene during
the formation of the mineralized extracellular matrix of bone.
92 to
85, "GGTGAGAA") as a target of
transcriptional activation by FGF2. Ligation of two copies of the FRE
5' to an SV40 promoter was sufficient to confer FGF-responsive
transcription. A sequence-specific protein-DNA complex, formed with a
double-stranded oligonucleotide encompassing the FRE and nuclear
extracts from ROS 17/2.8 cells, but not from fibroblasts, was increased
following FGF2 stimulation. Several point mutations within the critical
FRE sequence abrogated the formation of this complex and suppressed
both basal and FGF2-mediated promoter activity. These studies,
therefore, have identified a novel FRE in the proximal promoter of the
BSP gene that mediates both constitutive and FGF2-induced BSP transcription.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
370 (15). This region includes a
functional, inverted TATA element (nts
24 to
19) (16), which
overlaps a vitamin D response element (17). In addition, putative sites of regulation through an inverted CCAAT box
(
50 to
46) (18) and an AP-2 site (
447 to
440), which overlaps a transforming growth factor-
activation element,
have been identified in the proximal promoter (19). Further upstream, a
glucocorticoid response element (GRE) overlapping an AP-1 site has been
characterized (20, 21). Recently, we have identified a
pituitary-specific transcription factor-1 (Pit-1) motif through which
the stimulatory effects of parathyroid hormone on BSP transcription are
mediated (22), while studies by Benson et al. (23) have indicated that a homeodomain binding element in the BSP promoter is
required for osteoblast-specific expression.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-galactosidase control vector, and MEK inhibitor U0126 were
purchased from Promega Co., Madison, WI.
5,6-Dichloro-1-
-D-ribofuranosyl benzimidazole was from
Sigma-Aldrich Japan, Tokyo, Japan, the protein kinase inhibitors H89
and H7 were from Seikagaku Corp., Tokyo, Japan, and herbimycin A and
guanidium thiocyanate were purchased from Wako Pure Chemical
Industries, Ltd., Tokyo, Japan. PP1 was from Biomol Research
Laboratories, Inc., Plymouth Meeting, PA, and recombinant human
FGF2 was from Genzyme, Techne, Minneapolis, MN.
-MEM medium containing 10% fetal bovine
serum were changed to
-MEM without serum and incubated with or
without 10 ng/ml FGF2 for time periods extending over 3-24 h. To
determine the effect of FGF2 on the stability of BSP mRNA, cells
were first incubated for 6 h in the presence or absence of 10 ng/ml FGF2 and the incubation continued for up to 24 h in the
presence of 60 µM concentration of the
transcription inhibitor, 5,6-dichloro-1-
-D-ribofuranosyl benzimidazole. RNA was isolated from triplicate cultures at various time intervals and analyzed for the expression of BSP mRNA by Northern hybridization as described below.
-galactosidase vector as an internal control. Two days
post-transfection, cells were deprived of serum for 12 h, and 10 ng/ml FGF2 was added for 6 h prior to harvesting. The luciferase assay was performed according to the supplier's protocol (picaGene, Toyo Inki, Tokyo, Japan) using a Luminescence reader BLR20
(Aloka) to measure the luciferase activity. The protein kinase
inhibitor H89 (5 µM) and H7 (5 µM) were
used to inhibit protein kinases A and C. Herbimycin A (1 µM) and PP1 (10 µM) were used for tyrosine kinase and Src tyrosine kinase inhibition, respectively (40). U0126 (5 µM) was used for MAP kinase kinase (MEK)
inhibitor (41). The FRE sequence, identified from the transient
transfection studies, was cloned in the BglII site of
pGL2-promoter vector, immediately upstream of the enhancerless SV40
promoter. This construct was used to identify the sequence within the
BSP promoter that is required for transcriptional induction by FGF2.
Oligonucleotide-directed mutagenesis by PCR was utilized to introduce
the dinucleotide substitutions using the Quikchange
Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA). All
constructs were sequenced as described previously (20) to verify the
fidelity of the mutagenesis. The pCG-ATF2 and pCG-ATF3 expression
plasmids were kindly provided by Dr. T. Hai (42).
-MEM
without serum were used to prepare nuclear extracts as we have
described previously (19-22), with the addition of extra proteinase
inhibitors (the extraction buffer was 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM dithiothreitol, 25% (v/v) glycerol, 0.5 mM
phenylmethylsulfonyl fluoride, 2 µg/ml leupeptin, 2 µg/ml pepstatin
A, 1 µg/ml aprotinin, pH 7.9). Double-stranded oligonucleotides
encompassing the inverted CCAAT (nts
61 to
37, 5'-CCGTGACCGTGATTGGCTGCTGAGA) and the FRE (nts
98 to
79, 5'-TTTTCTGGTGAGAACCCACA) in the BSP promoter, together with
FRE mutation 1 (FREm1; 5'-TTTTCTaaTGAGAACCCACA); FRE mutation 2 (FREm2; 5'-TTTTCTGGcaAGAACCCAC), FRE mutation 3 (FREm3; 5'-TTTTCTGGTGcaAACCCAC), FRE mutation 4 (FREm4; 5'-TTTTCTGGTGAGctCCCAC), 3'-FRE (nts
95 to
73,
5'-TCTGGTGAGAACCCACAGCCTGA), BSP-NF
B (nts
112 to
93,
5'-GTTGTAGTTACGGATTTTCT), and NF
B binding site identified
in mouse Ig
enhancer (43) (Ig
-NF
B; 5'-AGAGGGGACTTTCCGAGA), were prepared by Bio-Synthesis, Inc., Lewisville, TX; while consensus AP-1
(5'-CGCTTGATGAGTCAGCCGGAA) and GRE
(5'-TCGACTGTACAGGATGTTCTAGCTACT) were
purchased from Promega. For gel shift analysis the
double-stranded-oligonucleotides were end-labeled with
[
-32P]ATP and T4 polynucleotide kinase. Nuclear
protein extracts (3 µg) were incubated for 20 min at room temperature
(room temperature = 21 °C) with 0.1 pM
radiolabeled double-stranded oligonucleotide in buffer containing 50 mM KCl, 0.5 mM EDTA, 10 mM
Tris-HCl, pH 7.9, 1 mM dithiothreitol, 0.04% Nonidet P-40,
5% glycerol, and 1 µg of poly(dI-dC). For competition experiments
unlabeled oligonucleotides for the inverted CCAAT, FRE, FREm1,
2,3,4,3'-FRE, BSP-NF
B, Ig
-NF
B, and consensus AP1 and
GRE (Promega) were used at 20-, 40-, and 100-fold molar excess.
Following incubation, the protein-DNA complexes were resolved by
electrophoresis on 5% nondenaturing acrylamide gels (38:2
acrylamide/bis acrylamide) run at 150 V at room temperature. Following
electrophoresis, the gels were dried and autoradiograms prepared and
analyzed using an image analyzer.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (49K):
[in a new window]
Fig. 1.
Northern hybridization analysis of FGF2
effects on BSP mRNA expression. A, dose response of
the effect of FGF2 on BSP mRNA levels in osteoblastic cell line ROS
17/2.8 treated for 6 h. B, a 24-h time course revealed
an increase in BSP mRNA following the administration of 10 ng/ml
FGF2 to ROS 17/2.8 cells. Total RNA was isolated from triplicate
cultures harvested after incubation times of 3, 6, 12, and 24 h
and used for Northern hybridization analysis using a
32P-labeled rat BSP DNA probe and a GAPDH DNA probe. In
addition, results of a hybridization analysis for osteopontin
(OPN) on the same ROS17/2.8 samples are shown for
comparison. Results of a representative hybridization analysis for
Control and FGF2-treated cells are shown.
-d-ribofuranosyl benzimidazole and the BSP mRNA
levels determined over a 24-h period. From regression analysis a
t1/2 of ~16 h was determined for BSP mRNA in
the ROS 17/2.8 cells with no significant change observed in the
presence of FGF2, indicating that the increase in mRNA was due to
increased gene transcription (data not shown).
116 to +60, gave a 2.9-fold increase
in transcription after 6 h treatment with 10 ng/ml FGF2 (Fig.
2). FGF2 also increased transcription of
pLUC4 (
425 to +60) and pLUC5 (
801 to +60). Within the DNA
sequence that is unique to pLUC3 (between nts
116 to
43),
an inverted CCAAT box (ATTGG; between nts
50 and
46), a possible
cAMP response element (CRE; between nts
75 and
68), and a
pituitary-specific transcription factor-1 (Pit-1) motif (between nts
111 and
105), which is the target of parathyroid hormone
stimulation, are present (Fig.
3A).

View larger version (14K):
[in a new window]
Fig. 2.
FGF2 up-regulates BSP promoter activity.
Transient transfections of ROS 17/2.8 cells, in the presence or absence
of FGF2 (10 ng/ml) for 6 h, were used to determine transcriptional
activity of chimeric constructs that included various regions of the
BSP promoter ligated to a luciferase reporter gene. The results of
transcriptional activity obtained from three separate transfections
with constructs pLUC basic (pLUCB) and pLUC1 to pLUC5 have been
combined and the values expressed with standard errors. Significant
differences from control: *, p < 0.1; ****,
p < 0.01.

View larger version (22K):
[in a new window]
Fig. 3.
The nucleotide sequences of the rat BSP gene
proximal promoter is shown from nts
116 to
43. A,
the inverted CCAAT box, CRE, NF
B, Pit-1, and FRE are present.
B, comparison of rat, mouse, and human DNA sequences from
nucleotide
111 to
68. The rat sequence is shown on the top
line and the mouse and human sequence below. DNA sequences that
are identical between the species are shown by a dot.
116 and
43,
we found that the FGF2 response was mediated by a region between nts
108 and
84 of the promoter sequence (Fig.
4). A series of 2-base pair mutations
were made between nts
92 and
85 within pLUC3 construct (Fig.
5). All four constructs (mutations 1-4;
pLUC3M1-4) had lower basal activities than pLUC3 and
resulted in near abolition of the FGF2 effects on the promoter. In
particular, the mutation in pLUC3M2 drastically reduced
basal expression and completely abolished the FGF2 effect (Fig. 5).
Thus, the GGTGAGAA motif (FRE, FGF response element) in the region nts
92 to
85 is important for basal expression as well as being
necessary for the FGF2 induction of BSP promoter activity. To examine
whether the FRE of the rat BSP promoter confers
FGF2-dependent inducibility in the context of a promoter
that is not stimulated by FGF2, the DNA segment between nts
98 and
79 in the rat BSP gene was inserted 5' to the SV40 in the
BglII site of the pGL2-promoter. While the insertion of a
single FRE sequence in the same orientation as in the BSP promoter did
not influence basal activity of the SV40 promoter, and only a modest
increase in FGF-mediated transcription was found, two copies of FRE
increased basal activity and significantly increased FGF-mediated
transcription (Fig. 6). Notably, the FRE sequences identified in the rat BSP promoter are conserved in the mouse
and human BSP promoters (Fig. 3B;
underlined).

View larger version (17K):
[in a new window]
Fig. 4.
Fine 5' deletion mapping of the nts
116 to
43 element in the BSP promoter. A series of rat BSP promoter 5'
deletion constructs were analyzed for relative promoter activity after
transfection into ROS17/2.8 cells and examined for induction in the
presence of FGF2 (10 ng/ml). The results of transcriptional activity
obtained from three separate transfections with constructs
43 BSPLUC
(
43 to +60),
60 BSPLUC (
60 to +60),
84 BSPLUC (
84 to +60),
and
116 BSPLUC (
116 to +60) have been combined and the values
expressed with S.E. Significant differences from control: *,
p < 0.1; #, p < 0.2.

View larger version (17K):
[in a new window]
Fig. 5.
GGTGAGAA motif at nts
92 to
85 in the rat
BSP promoter is necessary for induction by FGF2. A series of
dinucleotide substitutions were made within context of the homologous
116 to +60 BSP promoter fragment (pLUC3). The constructs were
analyzed for relative promoter activity after transfection into
ROS17/2.8 cells and examined for induction in the presence of FGF2 (10 ng/ml). The results of transcriptional activity obtained from three
separate transfections with constructs pLUCB, pLUC3, and pLUC3
mutations 1-4 (pLUC3M1 to pLUC3M4) were
combined and the values expressed with S.E. Significant differences
from relative luciferase activity of pLUC3: *, p < 0.1; **, p < 0.05; ***, p < 0.02.

View larger version (16K):
[in a new window]
Fig. 6.
The FRE site in BSP promoter confers FGF2
inducibility to the SV40 promoter. One or two copies of the FRE
sequence (
98 TTTTCTGGTGAGAACCCACA
79) were inserted 5'
to the SV40 in the BglII site of pGL2 promoter vector.
Transcriptional activities were measured in the presence and absence of
FGF2 and results obtained from three separate transfections combined.
The values are expressed with S.E. Significant differences from
control: **, p < 0.05.

View larger version (18K):
[in a new window]
Fig. 7.
Effect of kinase inhibitors on
transcriptional activation by FGF2. Transient transfection
analysis of pLUC3 in the presence or absence of FGF 2 (10 ng/ml) in ROS
17/2.8 cells is shown together with the effects of the PKC inhibitor
(H7, 5 µM), PKA inhibitor (H89, 5 µM),
tyrosine kinase inhibitor (herbimycin A (HA), 1 µM), Src kinase inhibitor (PP1, 10 µM) and MEK inhibitor (U0126, 5 µM). The
results obtained from three separate transfections were combined and
the values expressed with S.E. Significant differences from control: *,
p < 0.1; **, p < 0.05.

View larger version (76K):
[in a new window]
Fig. 8.
FGF2 up-regulates a nuclear protein that
recognizes the FRE. Radiolabeled double-stranded FRE (
98
TTTTCTGGTGAGAACCCACA
79) was incubated for 20 min at
21 °C with nuclear protein extracts (3 µg) obtained from ROS
17/2.8 cells incubated without (lane 1) or with FGF2 at 10 ng/ml for 6 h (lane 2) and 12 h (lanes
3-11). Competition reactions were performed using a 20-, 40-, and
100-fold molar excess of unlabeled FRE (lanes 4-6), CCAAT
(lanes 7-9), and a 40-fold excess of unlabeled consensus
AP1 (lane 10) and consensus GRE (lane 11).
DNA-protein complexes were separated on 5% polyacrylamide gel in low
ionic strength Tris borate buffer, dried under vacuum, and exposed to
an imaging plate for quantitation using an imaging analyzer.
CONT, nuclear extract from control confluent cells.

View larger version (87K):
[in a new window]
Fig. 9.
Specific binding of a nuclear protein
to the FRE. Radiolabeled double-stranded FRE were incubated for 20 min at 21 °C with nuclear protein extracts (3 µg) obtained from
ROS 17/2.8 cells incubated without (lane 1) or with FGF2 at
10 ng/ml for 12 h (lanes 2-15). Competition reactions
were performed using a 20-, 40-, and 100-fold molar excess of unlabeled
mutated oligonucleotide FREm1 (
98 TTTTCTaaTGAGAACCCACA
79; lanes 4-6), FREm2 (
98
TTTTCTGGcaAGAACCCACA
79; lanes 7-9), FREm3
(
98 TTTTCTGGTGcaAACCCACA
79; lanes 10-12),
and FREm4 (
98 TTTTCTGGTGAGctCCCACA
79; lanes
13-15). CONT, nuclear extract from control confluent
cells. Cyclo, incubated with 28 µg/ml cycloheximide.

View larger version (84K):
[in a new window]
Fig. 10.
Comparison of nuclear protein binding to the
FRE and FRE-mutated oligonucleotides. Radiolabeled double-stranded
FRE (lanes 1-3), FREm1 (lanes 4-6), FREm2
(lanes 7-9), FREm3 (lanes 10-12), and FREm4
(lanes 13-15) were incubated for 20 min at 21 °C with
nuclear protein extracts (3 µg) obtained from ROS 17/2.8 cells,
incubated without or with FGF2 at 10 ng/ml for 6 h and 12 h,
and analyzed by gel shift assays. CONT, nuclear extract from
control confluent cells.
B, and AP1 sites. When we used
the inverted CCAAT sequence as a probe, the DNA-NF-Y protein complex
(18) did not change after FGF2 stimulation (Fig. 11A, lanes 1-3).
Also, whereas a 20-100-fold molar excess of unlabeled homologous probe
attenuated the signal of the complex (Fig. 11A, lanes
4-6), the FRE did not compete the shifted band (Fig.
11A, lanes 7-9). In comparison, AP1 binding was
increased by FGF2 (Fig. 11B, lanes 3-5).
Although a BSP-NF
B DNA-protein complex did not change after FGF2
stimulation (Fig. 11B, lanes 6-8), an
Ig
-NF
B DNA-protein complex was increased after 6 h and
returned to control levels at 12 h (Fig. 11B,
lanes 9-11). As the BSP-FRE and -NF
B response elements
are close to each other in the BSP promoter (Fig. 3A), and
their DNA-protein complexes have similar mobility, competition
experiments were performed. A 20-100-fold molar excess of unlabeled
FRE-3', which extends further 3' from FRE, competed the FRE DNA-protein
complex, whereas BSP-NF
B and Ig
-NF
B (20-100-fold excess) did
not compete the complex formation (data not shown), showing that the
FRE-binding protein is distinct from NF
B family proteins. This was
confirmed by the inability of NF
B p50 or p65 antibodies to either
supershift or disrupt the FRE-nuclear protein complex, which was also
unaffected by antibodies to CREB, Pit-1, Oct1, c-Jun, and c-Fos (data
not shown).

View larger version (77K):
[in a new window]
Fig. 11.
Comparison of CCAAT, FRE, AP1,
BSP-NF
B, and
Ig
-NF
B DNA-protein
complexes. A, a radiolabeled double-stranded CCAAT
oligonucleotide (
61 CCGTGACCGTGATTGGCTGCTGAGA
37) was
incubated with nuclear protein extract (3 µg) obtained from cells
incubated without (lane 1) or with FGF2 (10 ng/ml) for
6 h (lane 2) and 12 h (lanes 3-9).
Competition reactions were performed using a 20-, 40-, and 100-fold
molar excess of unlabeled CCAAT (lanes 4-6) and FRE
(lanes 7-9). B, radiolabeled double-stranded
FRE, consensus AP1, BSP-NF
B, and Ig
-NF
B were incubated for 20 min at 21 °C with nuclear protein extracts obtained from cells
incubated without (lanes 1, 3, 6, and
9) or with FGF2 (10 ng/ml) for 6 h (lanes 4,
7, and 10) and 12 h (lanes 2,
5, 8, and 11). DNA-protein complexes
were separated on a 5% polyacrylamide gel in low ionic strength Tris
borate buffer, dried under vacuum, and exposed to an imaging plate for
quantitation using an image analyzer. CONT, nuclear extract
from control confluent cells.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
,
Src, FRS2, Grb2, PI3-K, and SHP-2, that activate a number of
intracellular signaling pathways (54). In our studies the tyrosine
kinase inhibitor, herbimycin A, and a Src family-selective tyrosine kinase inhibitor, PP1, inhibited FGF2-induced promoter activity (Fig. 7), indicating that FGF2 increases expression of the BSP
gene in ROS 17/2.8 cells through a tyrosine kinase and, more
specifically, through Src tyrosine kinase-dependent
pathway. Subsequent signaling also appears to involve the extracellular signal-regulated kinase/MAP kinase pathway, since the MEK1 and MEK2 inhibitor U0126 also inhibited FGF2-induced promoter activity. Notably, the Ras/Raf/MAP kinase pathway is required for mesoderm induction by FGF in Xenopus (55, 56), for elongation of
neurite outgrowth in PC12 cells by nerve growth factor and FGF (57) and
for endothelial cell differentiation (58), whereas the mitogenic effects of FGF2 on rat osteoblastic Py1a cells are transduced by the
PKC pathway (59). In contrast, protein kinase B is activated by stimuli
such as insulin, platelet-derived growth factor, epidermal growth
factor, and bFGF (60), whereas FGF receptor 3 (FGFR3) has been shown to
be associated with Stat1 (61).
116 and
44; Fig. 2) of the BSP
gene, which encompasses an inverted CCAAT box (nts
50 and
46),
putative CRE (nts
75 and
68) and NF
B (nts-102 and-93) sites and
a Pit-1 (nts
111 and
105) motifs (Fig. 3A). The results of luciferase analyses using fine 5' deletion constructs between nts
116 to
43 in the BSP promoter show that nts
108 and
84 are a
target sequence of FGF2 (Fig. 4). Within this region of the promoter, a
putative FRE was identified at nts
92 to
85. Notably, this sequence
is conserved in the rat, mouse, and human BSP promoters (Fig.
3B), indicative of a potentially important role in
transcriptional regulation of the BSP gene. That the FRE mediates FGF2
transcriptional regulation was shown using pLUC3 constructs
encompassing mutations in the putative FRE element (Fig. 5). These
experiments further identified a centrally located TGAG sequence to be
crucial for FGF2-mediated transcription. The loss of basal
transcription with pLUC3M2 further suggests that the FRE is
critical for constitutive BSP expression.
B, and Ig
-NF
B
double-stranded oligonucleotides (results not shown). Interestingly,
the protein binding to the FRE was not detected in nuclear extracts
from cells that do not express the BSP gene, such as human gingival
fibroblasts and human periodontal ligament cells (62), indicating that
it could be bone cell
specific.2
B sequences are closely spaced in the
BSP promoter, we found that unlabeled BSP-NF
B and Ig
-NF
B could
not compete FRE DNA-protein complex (results not shown), showing that
the FRE-binding protein is distinct from NF
B binding proteins.
Current studies are aimed at identifying and characterizing the BSP-FRE
binding protein because of its potential role in the regulating basal
as well as FGF2-induced transcription of BSP in osteoblasts.
| |
FOOTNOTES |
|---|
* This work was supported in part by Grants-in-aid for Scientific Research (07771795, 08771738, 09771650, and 12671865) from the Ministry of Education, Science, and Culture of Japan, by Nihon University Research Grant (General Individual Research Grant) for 1997, by Suzuki Memorial Grant of Nihon University School of Dentistry at Matsudo (Joint Research Grant for 1998 and 2000 and General Individual Research Grant for 1999 and 2000), and by Research for the Frontier Science (The Ministry of Education, Science, Sports and Culture).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
** To whom correspondence should be addressed: Dept. of Periodontology, Nihon University School of Dentistry at Matsudo, Chiba 271-8587, Japan. Tel.: 81-47-360-9326; Fax: 81-47-360-9327; E-mail: ogata@mascat.nihon-u.ac.jp.
Published, JBC Papers in Press, November 21, 2000, DOI 10.1074/jbc.M008971200
2 E. Shimizu-Sasaki and Y. Ogata, unpublished results.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
BSP, bone
sialoprotein;
FGF2, fibroblast growth factor 2;
FRE, FGF response
element;
FGFRs, fibroblast growth factor receptors;
nt(s), nucleotide(s);
PKC, protein kinase C;
PKA, cAMP-dependent
protein kinase;
MAP kinase, mitogen-activated protein kinase;
MEK, MAP
kinase kinase;
Pit-1, pituitary-specific transcription factor-1;
LUC, luciferase;
AP-1, activator protein-1;
AP-2, activator protein-2;
ATF, activating transcription factor;
GRE, glucocorticoid response element;
NF
B, nuclear factor
B;
CRE, cAMP response element;
CREB, cAMP
response element-binding protein;
MEM, minimum essential
medium;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Oldberg, Å., Franzén, A., and Heinegård, D. (1988) J. Biol. Chem. 263, 19430-19432 |
| 2. | Fisher, L. W., McBride, O. W., Termine, J. D., and Young, M. F. (1990) J. Biol. Chem. 265, 2347-2351 |
| 3. | Zhang, Q., Domenicucci, C., Goldberg, H. A., Wrana, J. L., and Sodek, J. (1990) J. Biol. Chem. 265, 7583-7589 |
| 4. | Ganss, B., Kim, R. H., and Sodek, J. (1999) Crit. Rev. Oral. Biol. Med. 10, 79-98 |
| 5. | Chen, J., Shapiro, H. S., Wrana, J. L., Reimers, S., Heersche, J. N. M., and Sodek, J. (1991) Matrix 11, 133-143 |
| 6. | Chen, J., Shapiro, H. S., and Sodek, J. (1992) J. Bone Miner. Res. 7, 987-997 |
| 7. | Kasugai, S., Nagata, T., and Sodek, J. (1992) J. Cell. Physiol. 152, 467-477 |
| 8. | Bianco, P., Fisher, L. W., Young, M. F., Termine, J. D., and Robey, P. G. (1991) Calcif. Tissue Int. 49, 421-426 |
| 9. | Hunter, G. K., and Goldberg, H. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8562-8565 |
| 10. | Waltregny, D., Bellahcène, A., Leval, X. D., Florkin, B., Weidle, U., and Castronovo, V. (2000) J. Bone Miner. Res. 15, 834-843 |
| 11. | Kim, R. H., Shapiro, H. S., Li, J. J., Wrana, J. L., and Sodek, J. (1994) Matrix Biol. 14, 31-40 |
| 12. | Kerr, J. M., Fisher, L. W., Termine, J. D., Wang, M. G., McBride, O. W., and Young, M. F. (1993) Genomics 17, 408-415 |
| 13. | Benson, M. D., Aubin, J. E., Xiao, G., Thomas, P. E., and Franceschi, R. T. (1999) J. Bone Miner. Res. 14, 396-405 |
| 14. | Li, J. J., and Sodek, J. (1993) Biochem. J. 289, 625-629 |
| 15. | Sodek, J., Li, J. J., Kim, R. H., Ogata, Y., and Yamauchi, M. (1996) Connect. Tissue Res. 35, 23-31 |
| 16. | Li, J. J., Kim, R. H., and Sodek, J. (1995) Biochem. J. 310, 33-40 |
| 17. | Kim, R. H., Li, J. J., Ogata, Y., Yamauchi, M., Freedman, L., and Sodek, J. (1996) Biochem. J. 318, 219-226 |
| 18. | Kim, R. H., and Sodek, J. (1999) Cancer Res. 59, 565-571 |
| 19. | Ogata, Y., Niisato, N., Furuyama, S., Cheifetz, S., Kim, R. H., Sugiya, H., and Sodek, J. (1997) J. Cell. Biochem. 65, 501-512 |
| 20. | Ogata, Y., Yamauchi, M., Kim, R. H., Li, J. J., Freedman, L. P., and Sodek, J. (1995) Eur. J. Biochem. 230, 183-192 |
| 21. | Yamauchi, M., Ogata, Y., Kim, R. H., Li, J. J., Freedman, L. P., and Sodek, J. (1996) Matrix Biol. 15, 119-130 |
| 22. | Ogata, Y., Nakao, S., Kim, R. H., Li, J. J., Furuyama, S., Sugiya, H., and Sodek, J. (2000) Matrix Biol. 19, 395-407 |
| 23. | Benson, M. D., Bargeon, J. L., Xiao, G., Thomas, P. E., Kim, A., Cui, Y., and Franceschi, R. T. (2000) J. Biol. Chem. 275, 13907-13917 |
| 24. | Mason, I. J. (1994) Cell 78, 547-552 |
| 25. | Yamasaki, M., Miyake, A., Tagashira, S., and Itho, N. (1996) J. Biol. Chem. 271, 15918-15921 |
| 26. | Hurley, M. M., Abreu, C., Harrison, J. R., Lichtler, A. C., Raisz, L. G., and Kream, B. (1993) J. Biol. Chem. 268, 5588-5593 |
| 27. | Rodan, S. B., Wesolowski, G., Yoon, K., and Rodan, G. A. (1989) J. Biol. Chem. 264, 19934-19941 |
| 28. | Nakamura, T., Hanada, K., Tamura, M., Shibanushi, T., Nigi, H., Tagawa, M., Fukumoto, S., and Matsumoto, T. (1995) Endocrinology 136, 1276-1284 |
| 29. | Noda, M., and Vogel, R. (1989) J. Cell Biol. 109, 2529-2535 |
| 30. | Debiais, F., Hott, M., Graulet, A. M., and Marie, P. J. (1998) J. Bone Miner. Res. 13, 645-654 |
| 31. | Muenke, M., Schell, U., Hehr, A., Robin, N. H., Losken, H. W., Schinzel, A., Pulleyn, L. J., Rutland, P., Reardon, W., Malcolm, S., and Winter, R. M. (1994) Nat. Genet. 8, 269-274 |
| 32. | Jabs, E. W., Li, X., Scott, A. F., Meyers, G., Chen, W., Eccles, M., Mao, J., Charnas, L. R., Jackson, C. E., and Jaye, M. (1994) Nat. Genet. 8, 275-279 |
| 33. | Reardon, W., Winter, R. M., Rutland, P., Pulleyn, L. J., Jones, B. M., and Malcalm, S. (1994) Nat. Genet. 8, 98-103 |
| 34. | Tavormina, P. L., Shiang, R., Thompson, L. M., Zhu, Y. Z., Wilkin, D. J., Lachman, R. S., Wilcox, W. R., Rimoin, D. L., Cohn, D. H., and Wasmuth, J. J. (1995) Nat. Genet. 9, 321-328 |
| 35. | Den, C., Wynshaw-Boris, A., Zhou, F., Kuo, A., and Leder, P. (1996) Cell 84, 911-921 |
| 36. | Liang, H., Pun, S., and Wronski, T. J. (1999) Endocrinology 140, 5780-5788 |
| 37. | Kato, Y., and Iwamoto, M. (1990) J. Biol. Chem. 265, 5903-5909 |
| 38. | Boudreaux, J. M., and Towler, D. A. (1996) J. Biol. Chem. 271, 7508-7515 |
| 39. | Schedlich, L. J., Flanagan, J. L., Crofts, L. A., Gillies, S. A., Goldberg, D., Morrison, N. A., and Eisman, J. A. (1994) J. Bone Miner. Res. 9, 143-152 |
| 40. | Hanke, J. H., Gardner, J. P., Dow, R. L., Changelian, P. S., Brissette, W. H., Weringer, E. J., Pollok, B. A., and Connelly, P. A. (1996) J. Biol. Chem. 271, 695-701 |
| 41. | Favata, M. F., Horiuchi, K. Y., Manos, E. J., Daulerio, A. J., Stradley, D. A., Feeser, W. S., Van Dyk, D. E., Pitts, W. J., Earl, R. A., Hobbs, F., Copeland, R. A., Magolda, R. L., Scherle, P. A., and Trzaskos, J. M. (1998) J. Biol. Chem. 273, 18623-18632 |
| 42. | Chen, B. P. C., Liang, G., Whelan, J., and Hai, T. (1994) J. Biol. Chem. 269, 15819-15826 |
| 43. | Kurokouchi, K., Kambe, F., Yasukawa, K., Izum, R., Ishiguro, N., Iwata, H., and Seo, H. (1998) J. Bone Miner. Res. 13, 1290-1299 |
| 44. | Majeska, R. J., Rodan, S. B., and Rodan, G. A. (1980) Endocrinology 107, 1494-1503 |
| 45. | Majeska, R. J., and Rodan, G. A. (1982) Calcif. Tissue Int. 34, 59-66 |
| 46. | Bellahcène, A., Menard, S., Bufalino, R., Moreau, L., and Castronovo, V. (1996) Int. J. Cancer 69, 350-353 |
| 47. | Bellahcène, A., Maloujahmoum, N., Fisher, L. W., Pastorino, H., Tagliabue, E., Ménard, S., and Castronovo, V. (1997) Calcif. Tissue Int. 61, 183-188 |
| 48. | Bellahcène, A., Albert, V., Pollina, L., Basolo, F. N., Fisher, L. W., and Castronovo, V. (1998) Thyroid 8, 637-6451 |
| 49. | Waltregny, D., Bellahcène, A., Van, R. I., Fisher, L. W., Young, M., Fernandez, P., Dewe, W., deLeval, J., and Castronovo, V. (1998) J. Natl. Cancer Inst. 90, 1000-1008 |
| 50. | Ibrahim, T., Leong, I., Sanchez-Sweatman, O., Sodek, J., Tenenbaum, H. C., Ganss, B., and Cheifetz, S. (2001) Clin. Exp. Metastasis, in press |
| 51. | Giri, D., Ropiquet, F., and Ittmann, M. (1999) Clin. Cancer Res. 5, 1063-1071 |
| 52. | Liu, Y., Wang, J. L., Chang, H., and Nguyen, M. (2000) Lancet 356, 567 |
| 53. | Penault-Llorca, F., Bertucci, F., Adélaïde, J., Parc, P., Coulier, F., Jacquemier, J., Birnbaum, D., and DeLapeyriere, O. (1995) Int. J. Cancer 61, 170-176 |
| 54. | Klint, P., and Claesson-Welsh, L. (2000) Front. Biosci. 4, 165-177 |
| 55. | MacNicol, A. M., Muslin, A. J., and Williams, L. T. (1993) Cell 73, 571-583 |
| 56. | Umbhauer, M., Marshall, C. J., Mason, C. S., Old, R. W., and Smith, J. C,. (1995) Nature 376, 58-62 |
| 57. | Kremer, K. E., D'Arcangelo, G., Thomas, S. M., DeMarco, M., Brugge, J. S., and Halegoua, S. (1991) J. Cell Biol. 115, 809-819 |
| 58. | Klint, P., Kanda, S., Kloog, Y., and Claesson-Welsh, L. (1999) Oncogene 18, 3354-3364 |
| 59. | Hurley, M. M., Marcello, K., Abreu, C., and Kessker, M. (1996) J. Bone Miner. Res. 11, 1256-1263 |
| 60. | Burgering, B. M. Th., and Coffer, P. J. (1995) Nature 376, 599-602 |
| 61. | Su, W. S. S., Kitagawa, M., Xue, N., Xie, B., Garofalo, S., Cho, J., Deng, C., Horton, W. A., and Fu, X. (1997) Nature 386, 288-292 |
| 62. | Ogata, Y., Niisato, N., Sakurai, T., Furuyama, S., and Sugiya, H. (1995) J. Periodontol. 66, 1025-1031 |
| 63. | Wang, D., Mayo, M. W., and Baldwin, A. S., Jr. (1997) Oncogene 14, 2291-2299 |
| 64. | Aho, A., Rouda, S., Kennedy, S. H., Qin, H., and Tan, E. M. (1997) Eur. J. Biochem. 247, 503-510 |
| 65. | Dong, Z., Xu, R., Kim, J., Zhan, S., Ma, W., Colburn, N. H., and Kung, H. (1996) J. Biol. Chem. 271, 9942-9946 |
| 66. | Tan, Y., Low, K. G., Boccia, C., Grossman, J., and Comb, M. J. (1994) Mol. Cell. Biol. 14, 7546-7556 |
This article has been cited by other articles:
![]() |
W.-C. Huang, Z. Xie, H. Konaka, J. Sodek, H. E. Zhau, and L. W.K. Chung Human Osteocalcin and Bone Sialoprotein Mediating Osteomimicry of Prostate Cancer Cells: Role of cAMP-Dependent Protein Kinase A Signaling Pathway Cancer Res., March 15, 2005; 65(6): 2303 - 2313. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Samoto, E. Shimizu, Y. Matsuda-Honjyo, R. Saito, S. Nakao, M. Yamazaki, S. Furuyama, H. Sugiya, J. Sodek, and Y. Ogata Prostaglandin E2 Stimulates Bone Sialoprotein (BSP) Expression through cAMP and Fibroblast Growth Factor 2 Response Elements in the Proximal Promoter of the Rat BSP Gene J. Biol. Chem., August 1, 2003; 278(31): 28659 - 28667. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xiao, D. Jiang, R. Gopalakrishnan, and R. T. Franceschi Fibroblast Growth Factor 2 Induction of the Osteocalcin Gene Requires MAPK Activity and Phosphorylation of the Osteoblast Transcription Factor, Cbfa1/Runx2 J. Biol. Chem., September 20, 2002; 277(39): 36181 - 36187. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||