![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 8, 5598-5604, February 23, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
§,From the Institut de Biologie Moléculaire et Cellulaire, UPR 9002 du CNRS, 15 rue René Descartes, 67084 Strasbourg, France
Received for publication, September 21, 2000, and in revised form, November 10, 2000
| |
ABSTRACT |
|---|
|
|
|---|
Although their genomes cannot be aligned at the
nucleotide level, the HIV-1/SIVcpz and the HIV-2/SIVsm viruses are
closely related lentiviruses that contain homologous functional and
structural RNA elements in their 5'-untranslated regions. In both
groups, the domains containing the trans-activating region,
the 5'-copy of the polyadenylation signal, and the primer binding site
(PBS) are followed by a short stem-loop (SL1) containing a
six-nucleotide self-complementary sequence in the loop, flanked by
unpaired purines. In HIV-1, SL1 is involved in the dimerization of the
viral RNA, in vitro and in vivo. Here, we
tested whether SL1 has the same function in HIV-2 and SIVsm RNA.
Surprisingly, we found that SL1 is neither required nor involved in the
dimerization of HIV-2 and SIV RNA. We identified the NarI
sequence located in the PBS as the main site of HIV-2 RNA dimerization.
cis and trans complementation of point
mutations indicated that this self-complementary sequence forms
symmetrical intermolecular interactions in the RNA dimer and suggested
that HIV-2 and SIV RNA dimerization proceeds through a kissing loop
mechanism, as previously shown for HIV-1. Furthermore, annealing of
tRNA3Lys to the PBS strongly inhibited
in vitro RNA dimerization, indicating that, in
vivo, the intermolecular interaction involving the
NarI sequence must be dissociated to allow annealing of the
primer tRNA.
Based on phylogenetic analysis, the HIV-1/SIVcpz and the
HIV-2/SIVsm primate viruses belong to the same lentivirus genus of the
retrovirus family (1). Furthermore, they cause similar diseases
characterized by long and variable incubation periods, persistent viral
replication, neurological manifestations, and destruction of specific
hematologic and immunologic cells (for a review see Ref. 2). The
HIV-1/SIVcpz and the HIV-2/SIVsm possess equivalent accessory proteins,
and although their genomes cannot be aligned with each other at the
nucleotide level, their leader regions contain equivalent functional
and structural RNA elements (3).
In HIV-1,1 the
trans-activating region stem-loop, the hairpin containing
the polyadenylation signal, and the structural domain containing the
primer binding site (PBS) are followed by four short hairpins involved
in genomic RNA dimerization, splicing of the viral RNAs, packaging of
the genomic RNA, and initiation of gag translation,
respectively (see Fig. 1A) (3). A similar situation also
prevails in HIV-2 and SIVsm genomic RNAs (Fig. 1B). In those
viruses, six short hairpins follow the first three structural domains.
The third and the sixth short stem-loops contain the major splice donor
site and the initiation codon of the gag gene, respectively,
whereas the second, the fourth, and the fifth are parts of the
packaging signal (3). Interestingly, the first of the short HIV-2/SIVsm
stem-loops (SL1) contains a loop with a six-nucleotide
self-complementary sequence flanked by one or more purines, as does the
HIV-1/SIVcpz DIS loop (see Fig. 1) (3, 4). Thus, it is appealing to
hypothesize that SL1 fulfills similar functions in HIV-1/SIVcpz and in
HIV-2/SIVsm (3, 4).
In vitro experiments identified the HIV-1 SL1 as the
dimerization initiation site (DIS) of the genomic RNA (5), and it is
now widely accepted that dimerization is initiated by symmetric intermolecular interactions between the self-complementary sequences of
the loop (5-19). Indeed, mutations affecting the self-complementarity of the DIS loop inhibited dimerization (5, 7, 8, 19), whereas the
introduction of complementary mutations restored the process (7, 8).
Furthermore, the unpaired purines flanking the self-complementary
sequence appeared to modulate the dimer stability (7, 8, 10, 19).
When infectious HIV-1 molecular clones were mutated in the DIS, the
replication rate of the viruses dramatically decreased (18, 20, 21),
and their infectivity was reduced by two to three orders of magnitude
(21-24). A significant fraction of the genomic RNA inside the viral
particles was monomeric (18), and the residual dimer appeared abnormal
when assessed by nondenaturing electrophoresis (25), even though the
thermal stability of the dimers of mutated RNAs was similar to that of
the wild-type dimer (20, 22). Mutations in the DIS affected at least
two steps of the HIV-1 replication cycle: encapsidation of the genomic
RNA (20-22, 26-28), and reverse transcription (21, 24).
As dimerization of genomic RNA is ubiquitous among retroviruses
(29-42), and the location and structural features of the HIV-1 DIS and
the HIV-2/SIVsm SL1 are conserved (see Fig. 1), it has been proposed
that SL1 might be involved in the dimerization of the HIV-2/SIVsm
genomic RNA (3, 4). However, unlike that of HIV-1, dimerization of the
HIV-2/SIVsm genomic RNA has received little attention, and the
sequences governing this process have not been precisely identified
(43).
Thus, we decided to test whether SL1 is involved in the dimerization of
the HIV-2/SIVsm genomic RNA, in vitro. In this study, we
showed that, despite its similarity to the HIV-1 DIS, the SL1 of HIV-2
ROD and SIV MM239 is neither required for nor involved in RNA
dimerization. Furthermore, we identified a self-complementary sequence located in the primer binding site (PBS) that is required for
the dimerization of the HIV-2 ROD and SIV MM239 RNAs. Interestingly, tRNA3Lys annealing to the PBS prevented
in vitro RNA dimerization. The implications of this finding
for the mechanism of RNA dimerization and tRNA annealing in
vivo are discussed.
Template Construction for in Vitro Transcription--
A sense
primer containing an EcoRI site and the promoter for the T7
RNA polymerase (GAA TTC TAA TAC GAC TCA CTA TAG GTC GCT CTG CGG AGA GGC
TGG) and an antisense primer (GAA TTC AGT TTC TCG CGC CCA TCT CCC) were
used to amplify the 550 first nucleotides of SIV MM239 and the 561 first nucleotides of HIV-2 ROD. The PCR products were cloned in a pUC18
vector at the EcoRI site, generating pFJ239 and pSLROD, respectively.
Mutations were introduced in the NarI site of HIV-2 ROD by
site-directed mutagenesis, using the QuikChange site-directed
mutagenesis kit (Stratagene). Plasmids pFJRODC305, pFJRODG308, and
pFJRODC305G308 were obtained from pSLROD and contained the
substitutions, G305 to C, C308 to G, or the double substitution, respectively.
RNA Synthesis and Purification--
Plasmids pSLROD, pFJRODC305,
pFJRODG308, and pFJRODC305G308 were linearized with EcoRI
prior to in vitro transcription, to generate wild-type and
mutant HIV-2 ROD RNAs encompassing nucleotides 1 to 561. Plasmid pSLROD
was also linearized with KpnI, BbsI, and
NarI, to generate HIV-2 ROD RNAs 1-420, 1-337, and 1-307, respectively. SIV MM239 RNAs 1-419, 1-334, and 1-308 were obtained by in vitro transcription of pFJ239 linearized with
KpnI, BsmAI, and NarI, respectively.
The RNA fragments encompassing the SL1 structure of HIV-2 and the DIS
stem-loop of HIV-1 MAL, were obtained by in vitro
transcription of templates generated by PCR (10) and purified by
agarose gel electrophoresis. The HIV-2 SL1 PCR product was generated
using primers GGAATTCTAATACGACTCACTATAGCTCCTAGAAAGGCG (sense) and
TCCCCCGGGCTCCACACGCTGC (antisense).
RNA was synthesized and purified as described (7), except RNAs
encompassing the HIV-2 SL1 and the HIV-1 DIS, which were purified from
the unincorporated nucleotides using a Centricon 10 (Amicon). These
RNAs were 5'-end-labeled for 30 min at 37 °C with
[ In Vitro Dimerization of HIV-2 ROD and SIV MM239 RNAs--
5.5
pmol of RNA (or 5.5 pmol of each RNA species for the heterodimerization
experiments) were denatured in 8 µl water for 2 min at 90 °C and
cooled on ice. After addition of 2 µl of monomer buffer (final
concentrations: 50 mM sodium cacodylate, pH 7.5, 40 mM KCl) or dimer buffer (final concentrations: 50 mM sodium cacodylate, pH 7.5, 300 mM KCl, 5 mM MgCl2), dimerization was allowed to proceed
for 20 min at 37 °C. Except for the 50-mer and 47-mer RNAs, the
samples were cooled on ice and loaded on 0.8% agarose gel.
Electrophoresis was carried out at 4 °C in Tris borate, 45 mM, pH 8.3, 0.1 mM MgCl2 for 2 h at 8 V/cm. The RNAs corresponding to the HIV-1 DIS and the HIV-2 SL1
were analyzed on a 10% nondenaturing polyacrylamide gel, in the same buffer.
Dimerization of HIV-2 ROD or SIV MM239 RNA withtRNA3Lys prehybridized at the
PBS--
Eight picomoles of HIV-2 ROD RNA 1-561 or SIV MM239 RNA
1-550 were incubated with 8 pmol of cytoplasmic
tRNA3Lys purified from beef liver (44),
and 50,000 cpm (<0.1 pmol) of 3'-end-labeled
tRNA3Lys in 12 µl of 100 mM NaCl. Hybridization of
tRNA3Lys to the PBS was performed by
heating the reaction mixture for 2 min at 90 °C, cooling on ice for
2 min, and incubating at 70 °C for 20 min (45). After hybridization,
samples were cooled on ice for 20 min. Dimerization was then allowed to
proceed as described above. A mock reaction, in which
tRNA3Lys was omitted, was performed in parallel.
Potential Role of SL1--
Given the structural similarity between
the HIV-1 DIS and SL1 in the HIV-2 and SIVsm genomic RNAs (Fig.
1), our first experiments were designed
to test the involvement of SL1 in the in vitro dimerization of HIV-2 and SIV RNAs. HIV-2 ROD and SIV MM239 were chosen as prototypes of the human and simian immunodeficiency viruses,
respectively. These two viruses contain rather divergent SL1. Indeed,
the SL1 loop contains 11 nucleotides in HIV-2 ROD RNA, but only 7 nucleotides in SIV MM239 RNA. However, both loops contain the same
GGUACC self-complementary sequence (Fig. 1B).
To test the putative role of SL1 in the dimerization of HIV-2 RNA, we
compared the salt-induced dimerization of RNAs encompassing nucleotides
1-561 or 1-420 of HIV-2 ROD (+1 corresponding to the transcription
start). Although the larger RNA contains the complete 5'-untranslated
region (5'-UTR) of HIV-2 ROD, the shorter one stops at the first
nucleotide of the self-complementary sequence in the SL1 loop (Fig. 1).
As observed with RNA fragments corresponding to 5'-UTR of other
retroviruses, HIV-2 ROD RNA 1-561 was essentially monomeric under low
salt conditions but efficiently dimerized in a buffer containing 50 mM sodium cacodylate, 300 mM KCl, and 5 mM MgCl2 (Fig.
2A). Quite surprisingly, HIV-2
ROD RNA 1-420 also dimerized under high salt conditions, and its
dimerization yield was comparable to that of HIV-2 ROD RNA 1-561 (Fig.
2A).
Similarly, we compared the dimerization of RNA fragments corresponding
to nucleotides 1-549 or 1-417 of SIV MM239, the shorter one ending in
the SL1 loop (Fig. 1). The salt-induced dimerization of SIV RNAs was
somewhat less efficient than that of HIV-2 RNAs. However, as observed
for HIV-2 RNAs, the dimerization efficiencies of the large and the
short RNA were similar.
These results indicated that neither the SL1 hairpin structure, nor the
self-complementary sequence in the SL1 loop were required for
dimerization of HIV-2 ROD and SIV MM239 RNAs. However, the possibility
remained that, although not absolutely required, SL1 was nevertheless
involved in one way or another in the dimerization process. To test
this possibility, we synthesized a 47-mer RNA containing the HIV-2 SL1,
and compared its salt-induced dimerization with that of a 50-mer RNA
containing the HIV-1 DIS (Fig. 2B). In agreement with
previous observations (6, 10), the HIV-1 DIS dimerized efficiently,
even at the rather low RNA concentration used in this assay. On the
contrary, no dimer could be detected when using the HIV-2 SL1 (Fig.
2B). The lack of dimerization of the HIV-2 SL1 was not due
to RNA misfolding, because chemical probing indicated that SL1 adopted
the expected stem-loop structure, both in the 47-mer RNA and in the
1-561 HIV-2 RNA.2 Thus, our
results indicated that SL1 was not involved in the dimerization of
HIV-2 RNA.
Dimerization of 3'-Truncated RNAs--
To identify the sequences
involved in the dimerization of HIV-2 RNA, we synthesized RNAs
gradually devoid of the 3'-part of the UTR by in vitro
transcription of plasmid pSLROD linearized with EcoRI,
KpnI, BbsI, or NarI, respectively.
This allowed us to compare dimerization of RNAs encompassing
nucleotides 1-561, 1-420, 1-337, and 1-307 of HIV-2 ROD (Fig.
3A). As described above, RNA
1-561 and RNA 1-420 dimerized efficiently under high salt conditions.
In addition, we observed that RNA 1-337 dimerized with the same
efficiency as those RNAs, whereas dimerization of RNA 1-307 was
strongly reduced (Fig. 3A). Similarly, we compared dimerization of RNAs corresponding to nucleotides 1-550, 1-419, and
1-308 of SIV MM239. Dimerization of the SIV RNA fragments was somewhat
reduced, as compared with HIV-2. Nevertheless, we observed that RNA
1-550 and RNA 1-419 dimerized with a similar efficiency, whereas RNA
1-308 hardly dimerized (Fig. 3B). Thus, our deletion
experiments indicated that the RNA stretch located between nucleotides
307 and 337 in HIV-2 ROD, and 308 and 419 in SIV MM239 is required for
efficient in vitro dimerization of those RNAs.
Site-directed Mutagenesis of the NarI Site in the PBS of HIV-2
RNA--
In HIV-1 (4-12, 15, 16, 18-23, 25, 46), murine leukemia
virus (33, 41, 47-50), and avian sarcoma and leukemia virus (36, 51), dimerization of the genomic RNA involves a self-complementary sequence. No such sequence is contained between nucleotides 307 and 337 of HIV-2 ROD (Fig. 3A). This prompted us to test whether the
self-complementary NarI sequence, located at nucleotides
304-309 in HIV-2 ROD and 305-310 in SIV MM239, was involved in RNA
dimerization. Interestingly, region 283-323 of HIV-2 ROD RNA and SIV
MM239 RNA can be folded into a hairpin structure with the
NarI sequence located in the loop (Fig.
4A). However, because the
NarI site was used to generate HIV-2 ROD RNA 1-307 and SIV
MM239 RNA 1-308, only part of the NarI sequence was
incorporated in these RNAs.
To test the role of the NarI sequence in the dimerization of
HIV-2 ROD RNA, we mutated nucleotide G305 to C. If, as has been shown
for HIV-1, HIV-2 RNA dimerizes by forming a kissing loop complex
between self-complementary sequences, this substitution should destroy
two out of six intermolecular base pairs (Fig. 4B). In
agreement with this model, we observed that substituting C for G305 in
HIV-2 RNA 1-561 dramatically reduced dimerization of that mutant RNA
(Fig. 4C). According to the kissing loop model, substituting
G for C308 should compensate for the C305 substitution, by restoring
six intermolecular base pairs between the kissing loops (Fig.
4B). Indeed, we observed that the C305G308 compensatory HIV-2 RNA dimerized even more efficiently than the wild-type HIV-2 ROD
RNA 1-561. Thus, our results strongly suggest that HIV-2 RNA dimerizes
by a kissing loop mechanism involving the self-complementary NarI sequence.
However, one could not totally exclude that this sequence played an
indirect role. The crucial point could be a particular structure of the
NarI sequence in the monomer maintained by base pairing of
nucleotides 305 and 308, which would be required for dimerization,
without any interaction of these sequences in the dimer. To test this
possibility, we investigated the capability of the C305G308
compensatory HIV-2 RNA to form heterodimers with the wild-type HIV-2
RNA. Because both RNAs are able to form homodimers, they should also be
able to form heterodimers, if the interaction between nucleotides 305 and 308 is intramolecular. On the contrary, no heterodimer should be
formed between these RNAs if this interaction is intermolecular. We
used RNA of either 561 or 337 nucleotides in length to distinguish
between homo- and heterodimers (Fig. 5).
When wild type HIV-2 RNA 1-561 and 1-337 were mixed in low salt
buffer, two main bands corresponding to the monomeric RNA species were
observed. When these RNAs were coincubated in high salt buffer, three
bands were observed (Fig. 5). They were attributed to the HIV-2
RNA 1-337 homodimer (bottom), the HIV-2 RNA 1-561 homodimer (top), and the HIV-2 RNA 1-337/HIV-2 RNA 1-561
heterodimer (middle). On the contrary, when C305G308 HIV-2
RNA 1-561 and wild-type HIV-2 RNA 1-337 were coincubated in the high
salt buffer, only the two bands corresponding to the homodimeric
species were observed (Fig. 5). Thus, this experiment suggested that
the interaction between nucleotides 305 and 308 is intermolecular.
To further test the kissing loop model, and unambiguously prove that
the NarI sequence is involved in intermolecular
interactions, we examined the possibility of forming a heterodimer
between C305 and G308 HIV-2 RNAs (Fig.
6). In this experiment, the heterodimer should be favored over the homodimers if the interaction between nucleotides 305 and 308 is intermolecular (Fig. 6A). To test
this prediction, we used 32P-labeled G308 HIV-2 RNA 1-561
and unlabeled C305 HIV-2 RNA 1-561. As observed above with C305 HIV-2
RNA 1-561, we found that G308 HIV-2 RNA 1-561 hardly dimerized in the
high salt buffer (Fig. 6B, lane 2). However, the
fraction of G308 HIV-2 RNA 1-561 in the dimeric form strongly
increased in the presence of unlabeled C305 HIV-2 RNA 1-561,
indicating that these two RNAs efficiently formed heterodimers (Fig.
6B, lane 3). These results unambiguously demonstrated the direct intermolecular interaction, in the HIV-2 RNA
dimer, between the NarI sequences located in the PBS of each monomer.
Effect of tRNA3Lys Annealing on RNA
Dimerization--
Because the NarI site is located within
the PBS, we tested whether annealing of primer
tRNA3Lys interfered with RNA
dimerization (Fig. 7). We first
heat-annealed a mixture of 32P-labeled and unlabeled
tRNA3Lys purified from beef liver to the
viral RNA by a 20-min incubation at 70 °C in a buffer lacking
magnesium chloride, followed by a standard incubation in the
dimerization buffer (see "Materials and Methods") (Fig.
7A, lane 2). In a control experiment, the same
thermal treatment was applied to the viral RNA, in the absence of
tRNA3Lys (Fig. 7A, lane
1). When tRNA3Lys was omitted, wild
type HIV-2 RNA 1-561 was found almost completely in the dimeric form,
indicating that the thermal treatment per se did not inhibit
RNA dimerization. However, dimerization of wild type HIV-2 RNA was
strongly inhibited in the presence of tRNA3Lys. Similarly, we observed that
binding of tRNA3Lys to the PBS of SIV
RNA 1-550 strongly inhibited its dimerization (data not shown). On the
other hand, tRNA3Lys did not affect
dimerization of C305G308 HIV-2 RNA 1-561 (Fig. 7A,
lanes 3 and 4). Autoradiography of the gel
indicated that tRNA3Lys was bound to
wild type but not to C305G308 HIV-2 RNA 1-561 (Fig. 7B).
Furthermore, it showed that tRNA3Lys was
also bound to the small fraction of dimeric wild type HIV-2 RNA 1-561
(Fig. 7B, lane 2). These results supported the
involvement of the NarI site in the dimerization of HIV-2
RNA, and they also showed that even though this site greatly favored
this process, it was not strictly required for RNA dimerization. This
result was in keeping with the fact that point mutations in the
NarI site strongly decreased but did not totally inhibit
dimerization (Figs. 4 and 6) and that HIV-2 RNA 1-307 weakly dimerized
(Fig. 3).
The similar location of the HIV-2/SIVsm SL1 and the HIV-1/SIVcpz
DIS and the presence of a self-complementary sequence in the loop of
both hairpins led to the proposal that SL1 might be involved in the
dimerization of the HIV-2/SIVsm genomic RNA (3, 4). However,
experiments performed to test this hypothesis led to a different
conclusion. Unexpectedly, SL1 is neither required nor involved in the
dimerization of RNAs corresponding to the 5'-end of the HIV-2 ROD.
Furthermore, even though most experiments were conducted with HIV-2
ROD-derived RNAs, the experiments performed with the SIV MM239-derived
RNAs suggest that our conclusions also hold true for the latter virus.
At first sight, the finding that SL1 is unable to dimerize despite the
presence of a six-nucleotide self-complementary sequence in the loop is
surprising. However, recent systematic evolution of ligands by
exponential enrichment experiments on the HIV-1 DIS revealed
that the presence of U and A at the central positions of the
self-complementary sequence is strongly detrimental to dimerization
(52).
Because SL1 is not involved in RNA dimerization, our data indicate that
the HIV-2/SIVsm SL1 and the HIV-1/SIVcpz DIS are not totally
functionally equivalent. However, mutations introduced in the DIS
indicated a dual function for this hairpin. Indeed, although
substitutions in the DIS loop and deletions of the DIS hairpin
similarly prevent dimerization of HIV-1 RNA in vitro, encapsidation of the genomic RNA and viral replication are more severely affected by the latter mutations (21, 22, 25). The role of the
DIS stem in RNA encapsidation is likely linked to its ability to bind
the Gag precursor (53). However, the replacement of the DIS hairpin by
an RNA aptamer, which binds Gag but does not dimerize, is unable
to restore RNA packaging at wild type levels (54). On the other hand,
SL1 is required for efficient packaging of HIV-2 RNA (55). Thus, SL1
performs only one of the two known DIS functions.
Our experiments unambiguously identified the NarI sequence
located in the PBS as the primary dimerization site of HIV-2 and SIV
RNAs. The reason why this site was not identified in a previous study
using 3'-truncated HIV-2 RNAs is unclear (43). However, these authors
did observe inhibition of HIV-2 RNA dimerization in the presence of
large amounts of total yeast tRNA (43). The cis and
trans complementation of mutations in the NarI
sequence that we observed indicates that this sequence makes symmetric intermolecular contacts in the RNA dimer and suggests that HIV-2 (and
SIV) RNA dimerizes by forming a kissing loop complex. Such a mechanism
was previously demonstrated by complementary mutations in the case of
HIV-1 (7, 8) and avian sarcoma and leukemia virus RNA (51) and
is likely involved in the dimerization of murine leukemia virus RNA,
even though, in this latter case, the dimerization mechanism is more
complex (33, 48, 56, 57).
Several lines of evidence indicate that the PBS cannot promote the
dimerization of HIV-1 RNA. An HIV-1 RNA encompassing R, U5, and the
PBS, and truncated in the middle of the DIS self-complementary sequence
does not dimerize (58). Similarly, HIV-1 RNAs containing the complete
5'-untranslated region and extending into the gag coding
region do not dimerize if they contain deletions or substitutions in
this self-complementary sequence (5, 7, 19), even though they contain
the PBS. Furthermore, annealing of
tRNA3Lys to the PBS does not inhibit
HIV-1 RNA dimerization in vitro (59), indicating that the
PBS is not required for the DIS-mediated HIV-1 RNA dimerization.
Finally, deletion of the PBS does not impair RNA dimerization in
vivo, and it does not affect the thermal stability of the dimer
(60). Thus, the results obtained with HIV-1 indicate that the presence
of a self-complementary sequence in the PBS is not sufficient for the
PBS to be involved in RNA dimerization.
However, the involvement of the PBS sequence in RNA dimerization is not
unique to HIV-2 and SIV. It has been previously described for bovine
leukemia virus (38), which utilizes tRNAPro to prime
reverse transcription. Because tRNA binding is compatible with RNA
dimerization in retroviruses, tRNA annealing in bovine leukemia virus,
HIV-2, and SIVsm may be a more sophisticated process than initially
thought. We propose that, in vivo, dimerization of HIV-2 and
SIVsm RNA may be initiated in the cytoplasm of infected cells, as
suggested by studies on avian and murine retroviruses (32, 61), and
mediated by the NarI sequence located in the PBS (Fig.
8). This specific RNA recognition would
require no viral protein and would be followed by the establishment of
intermolecular interactions all along the genomic RNA. These secondary
interactions could take place either in the cytoplasm or during
encapsidation and budding due to the annealing activity of the Gag
precursor (62) (Fig. 8). The dimeric genomic RNA and the
tRNA3Lys would be encapsidated by the NC
domain of Gag (63) and the reverse transcriptase domain of Gag-Pol
(64-66), respectively. The NC domain of the Gag precursor (62, 67), or
the mature NCp (59, 68-70) would then disrupt the kissing loop
interaction involving the NarI sequence of the PBS and
anneal tRNA3Lys to this site, whereas
the secondary RNA-RNA interactions would be maintained, therefore
maintaining a dimeric RNA (Fig. 8).
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-32P]ATP (3000 Ci/mmol) and T4 polynucleotide kinase.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (37K):
[in a new window]
Fig. 1.
Schematic representation of the secondary
structure of the 5'-untranslated region of the genomic RNA of HIV-1
(A) and HIV-2/SIVsm (B) (3). The
main stem-loop structures associated with known functions are shown.
The detailed structure and sequence of the HIV-1 DIS from subtypes A
and B, and of the SL1 from HIV-2 ROD and SIV MM239 isolates are
represented in the right part of the figure.

View larger version (18K):
[in a new window]
Fig. 2.
SL1 is not involved in the dimerization of
HIV-2 ROD RNA. A, HIV-2 RNAs 1-561 and 1-420 (550 nM) were incubated in monomer (lanes marked
M) and dimer (lanes marked D) buffer.
The monomeric (m) and dimeric (d) species were
separated on an agarose gel and stained with ethidium bromide.
B, radioactively labeled 50-mer RNA corresponding to the
HIV-1 DIS and 47-mer RNA encompassing the HIV-2 ROD SL1 were incubated
in dimer buffer. The monomeric (m) and dimeric
(d) species were separated on a nondenaturing polyacrylamide
gel and revealed by autoradiography.

View larger version (40K):
[in a new window]
Fig. 3.
Localization of sequences involved in the
dimerization of HIV-2 ROD and SIV MM 239 RNAs. In A:
Top, schematic drawing of the HIV-2 ROD RNAs used to
localize the dimer linkage sequences; bottom, RNAs
encompassing nucleotides 1-561, 1-420, 1-337, and 1-307 of HIV-2
ROD were incubated in monomer (M) and dimer (D)
buffer. The monomeric (m) and dimeric (d) species
were separated on an agarose gel and stained with ethidium bromide. In
B: top, schematic drawing of the SIV MM239 RNAs;
bottom, RNAs encompassing nucleotides 1-550, 1-419, and
1-308 of SIV MM239 were incubated in monomer (M) and dimer
(D) buffer. The monomeric (m) and dimeric
(d) species were separated and stained as above.

View larger version (30K):
[in a new window]
Fig. 4.
Mutations in the NarI
sequence located in the PBS affect RNA dimerization. A,
possible stem-loop structure encompassing nucleotides 283-323 of HIV-2
ROD RNA and presenting the NarI sequence (shaded)
in the loop. The positions that were mutated are indicated by
asterisks. The PBS is indicated by a gray double
arrow. B, predicted intermolecular interactions for
wild-type (left), C305 (middle), and C305G308
(right) HIV-2 RNA 1-561 if the NarI sequence
forms a kissing loop complex. C, wild type, C305, and
C305G308 HIV-2 RNAs 1-561 were incubated in monomer (M) and
dimer (D) buffer. The monomeric (m) and dimeric
(d) species were separated on an agarose gel and stained
with ethidium bromide.

View larger version (59K):
[in a new window]
Fig. 5.
Heterodimer formation supports the
direct involvement of the NarI sequence in
intermolecular interactions. Wild-type HIV-2 RNA 1-337 was
incubated in the monomer (M) or dimer (D) buffer
in the presence of wild type or C305G308 HIV-2 RNA 1-561. The
monomeric species of the short (ms) and the long
(ml) RNAs, as well as the species containing two
short (ds), two long (dl), or one
long and one short (hdls) RNA molecules, were separated on an
agarose gel and stained with ethidium bromide.

View larger version (19K):
[in a new window]
Fig. 6.
trans complementation of mutations
in the NarI sequence indicates a direct intermolecular
interaction. A, intermolecular interactions predicted
by the kissing loop model for the C305 HIV-2 RNA 1-561
homodimer (left), the G308 HIV-2 RNA 1-561
homodimer (middle), and C305/G308 HIV-2 RNA
1-561 heterodimer (right). The G308 HIV-2 RNA
1-561 that is labeled in the experiment is marked by an
asterisk. B, radioactively labeled G308 HIV-2 RNA
1-561 alone (lanes 1 and 2) or with
stoichiometric amounts of unlabeled C305 HIV-2 RNA 1-561 (lane
3) was incubated in monomer (M) or dimer (D)
buffer. The monomeric (m) and dimeric (d) species
were separated on an agarose gel and revealed by autoradiography.

View larger version (21K):
[in a new window]
Fig. 7.
Binding of
tRNA3Lys to the PBS inhibits
dimerization of HIV-2 RNA. A, a mixture of unlabeled and
labeled tRNA3Lys was annealed to wild
type or C305G308 HIV-2 RNA 1-561, followed by incubation at 37 °C
in the dimer buffer (lanes 2 and 4). A mock
annealing reaction was performed in parallel in the absence of
tRNA3Lys (lanes 1 and
3). The monomeric (m) and dimeric (d)
species were separated on an agarose gel and stained with ethidium
bromide. B, autoradiography of the gel shown in
A. The positions of the
tRNA3Lys either free (f) or
bound to the monomeric (mb) and dimeric
(db) forms of the HIV-2 RNA are indicated.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (31K):
[in a new window]
Fig. 8.
Tentative representation of the
interrelationship between HIV-2 (and SIV) RNA dimerization and
tRNA3Lys annealing.
Indeed, even in the well-documented case of HIV-1, there is no evidence that the initial interaction at the DIS is maintained in the mature dimer. Secondary interactions stabilizing the dimer are known to exist in vitro (7, 71), and likely take place in vivo during the NCp-induced maturation of the dimer (72, 73). Our finding that deletions and mutations of the NarI sequence or annealing of tRNA3Lys do not totally abolish HIV-2 RNA dimerization indicates that secondary interactions also exist in this RNA, which could be favored by the primary interaction at the NarI site. Because NCp is able to anneal almost any complementary sequences (74, 75), the role of the primary interaction could be to ensure that the NCp-mediated secondary interactions are not made randomly, but are properly oriented. Indeed, these interactions may be crucial for the strand-transfer events taking place during reverse transcription. This hypothesis is consistent with the observation that mutations in the HIV-1 DIS affect reverse transcription (21, 24).
The data presented in this paper reinforce the notion that the
retroviruses fall into two classes depending on whether or not the PBS
is involved in the dimerization of the genomic RNA. Remarkably, recent
studies indicate that the yeast retrotransposons Ty1 (76) and Ty3 (77)
belong to a third class, because dimerization of their genomic RNA was
found to be mediated by the tRNAMet annealed to the
PBS.
| |
ACKNOWLEDGEMENTS |
|---|
D. Mignot is acknowledged for skillful technical assistance. Thanks are due to J. C. Paillart for stimulating discussions and critical reading of this manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by a grant from the Agence Nationale de Recherche sur le SIDA (ANRS).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Both authors contributed equally to this work.
§ Was a fellow of the ANRS. To whom correspondence may be addressed. Present address: Division of Biological Sciences, The University of Montana, Missoula, MT 59812. Tel.: 406-243-6393; Fax: 406-243-4304; E-mail: lodmell@selway.umt.edu.
¶ To whom correspondence may be addressed: Institut de Biologie Moléculaire et Cellulaire, UPR 9002 du CNRS, 15 rue René Descartes, 67084 Strasbourg, France. Tel.: 33-3-8841-7091; Fax: 33-3-8860-2218; E-mail: r.marquet@ibmc.u-strasbg.fr.
Published, JBC Papers in Press, November 22, 2000, DOI 10.1074/jbc.M008642200
2 F. Jossinet, unpublished results.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HIV-1 and -2, human immunodeficiency virus types 1 and 2; DIS, dimerization initiation site; PBS, primer binding site; SIV, simian immunodeficiency virus; SL1, stem-loop 1; PCR, polymerase chain reaction; UTR, untranslated region; NCp, nucleocapsid protein.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Korber, B., Hahn, B., Foley, B., Mellors, J. W., Leitner, T., Myers, G., McCutchan, F., and Kuiken, C. (eds) (1997) Human Retroviruses and AIDS. A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences , Theoretical Biology and Biophysics Group T-10, Los Alamos, NM |
| 2. | Fauci, A. S., and Desrosiers, R. C. (1997) in Retroviruses (Coffin, J. M. , Hughes, S. H. , and Varmus, H. E., eds) , pp. 587-635, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
| 3. | Berkhout, B. (1996) Prog. Nucleic Acids Res. Mol. Biol. 54, 1-34 |
| 4. | Paillart, J. C., Marquet, R., Skripkin, E., Ehresmann, C., and Ehresmann, B. (1996) Biochimie (Paris) 78, 639-653 |
| 5. | Skripkin, E., Paillart, J. C., Marquet, R., Ehresmann, B., and Ehresmann, C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4945-4949 |
| 6. | Skripkin, E., Paillart, J. C., Marquet, R., Blumenfeld, M., Ehresmann, B., and Ehresmann, C. (1996) J. Biol. Chem. 271, 28812-28817 |
| 7. | Paillart, J. C., Marquet, R., Skripkin, E., Ehresmann, B., and Ehresmann, C. (1994) J. Biol. Chem. 269, 27486-27493 |
| 8. | Paillart, J.-C., Skripkin, E., Ehresmann, B., Ehresmann, C., and Marquet, R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5572-5577 |
| 9. | Paillart, J. C., Westhof, E., Ehresmann, C., Ehresmann, B., and Marquet, R. (1997) J. Mol. Biol. 270, 36-49 |
| 10. | Jossinet, F., Paillart, J. C., Westhof, E., Hermann, T., Skripkin, E., Lodmell, J. S., Ehresmann, C., Ehresmann, B., and Marquet, R. (1999) RNA 5, 1222-1234 |
| 11. | Laughrea, M., and Jetté, L. (1994) Biochemistry 33, 13464-13474 |
| 12. | Laughrea, M., and Jetté, L. (1996) Biochemistry 35, 9366-9374 |
| 13. | Laughrea, M., and Jetté, L. (1996) Biochemistry 35, 1589-1598 |
| 14. | Laughrea, M., and Jetté, L. (1997) Biochemistry 36, 9501-9508 |
| 15. | Muriaux, D., Girard, P.-M., Bonnet-Mathonière, B., and Paoletti, J. (1995) J. Biol. Chem. 270, 8209-8216 |
| 16. | Muriaux, D., Fossé, P., and Paoletti, J. (1996) Biochemistry 35, 5075-5082 |
| 17. | Muriaux, D., de Rocquigny, H., Roques, B. P., and Paoletti, J. (1996) J. Biol. Chem. 271, 33686-33692 |
| 18. | Haddrick, M., Lear, A. L., Cann, A. J., and Heaphy, S. (1996) J. Mol. Biol. 259, 58-68 |
| 19. | Clever, J. L., Wong, M. L., and Parslow, T. G. (1996) J. Virol. 70, 5902-5908 |
| 20. | Berkhout, B., and van Wamel, J. L. B. (1996) J. Virol. 70, 6723-6732 |
| 21. | Paillart, J.-C., Berthoux, L., Ottmann, M., Darlix, J.-L., Marquet, R., Ehresmann, B., and Ehresmann, C. (1996) J. Virol. 70, 8348-8354 |
| 22. | Laughrea, M., Jetté, L., Mak, J., Kleiman, L., Liang, C., and Wainberg, M. A. (1997) J. Virol. 71, 3397-3406 |
| 23. | Laughrea, M., Shen, N., Jette, L., and Wainberg, M. A. (1999) Biochemistry 38, 226-234 |
| 24. | Shen, N., Jette, L., Liang, C., Wainberg, M. A., and Laughrea, M. (2000) J. Virol. 74, 5729-5735 |
| 25. | Clever, J. L., and Parslow, T. G. (1997) J. Virol. 71, 3407-3414 |
| 26. | Harrison, G. P., Miele, G., Hunter, E., and Lever, A. M. L. (1998) J. Virol. 72, 5886-5896 |
| 27. | McBride, M. S., and Panganiban, A. T. (1996) J. Virol. 70, 2963-2973 |
| 28. | McBride, M. S., and Panganiban, A. T. (1997) J. Virol. 71, 2050-2058 |
| 29. | Bender, W., and Davidson, N. (1976) Cell 7, 595-607 |
| 30. | Bender, W., Chien, Y. H., Chattopadkyay, S., Vogt, P. K., Gardner, M. B., and Davidson, N. (1978) J. Virol. 25, 888-896 |
| 31. | Darlix, J. L., Gabus, C., Nugeyre, M. T., Clavel, F., and Barré-Sinoussi, F. (1990) J. Mol. Biol. 216, 689-699 |
| 32. | Darlix, J. L., Gabus, C., and Allain, B. (1992) J. Virol. 66, 7245-7252 |
| 33. | De Tapia, M., Metzler, V., Mougel, M., Ehresmann, B., and Ehresmann, C. (1998) Biochemistry 37, 6077-6085 |
| 34. | Erlwein, O., Cain, D., Fischer, N., Rethwilm, A., and McClure, M. O. (1997) Virology 229, 251-258 |
| 35. | Feng, Y. X., Fu, W., Winter, A. J., Levin, J. G., and Rein, A. (1995) J. Virol. 69, 2486-2490 |
| 36. | Fossé, P., Motte, N., Roumier, A., Gabus, C., Muriaux, D., Darlix, J. L., and Paoletti, J. (1996) Biochemistry 35, 16601-16609 |
| 37. | Greatorex, J. S., Laisse, V., Dockhelar, M. C., and Lever, A. M. (1996) Nucleic Acids Res. 24, 2919-2923 |
| 38. | Katoh, I., Yasunaga, T., and Yoshinaka, Y. (1993) J. Virol. 67, 1830-1839 |
| 39. | Kung, H. J., Hu, S., Bender, W., Bailey, J. M., Davidson, N., Nicolson, M. O., and McAllister, R. M. (1976) Cell 7, 609-620 |
| 40. | Murti, K. G., Bondurant, M., and Tereba, A. (1981) J. Virol. 37, 411-419 |
| 41. | Roy, C., Tounekti, N., Mougel, M., Darlix, J.-L., Paoletti, C., Ehresmann, C., Ehresmann, B., and Paoletti, J. (1990) Nucleic Acids Res. 18, 7287-7292 |
| 42. | Stokrova, J., Korb, J., and Riman, J. (1982) Acta Virol. 26, 417-426 |
| 43. | Berkhout, B., Essink, B. B., and Schoneveld, I. (1993) FASEB. J. 7, 181-187 |
| 44. | Bénas, P., Bec, G., Keith, G., Marquet, R., Ehresmann, C., Ehresmann, B., and Dumas, P. (2000) RNA 6, 1347-1455 |
| 45. | Isel, C., Marquet, R., Keith, G., Ehresmann, C., and Ehresmann, B. (1993) J. Biol. Chem. 268, 25269-25272 |
| 46. | St. Louis, D. C., Gotte, D., Sanders-Buell, E., Ritchey, D. W., Salminen, M. O., Carr, J. K., and McCutchan, F. E. (1998) J. Virol. 72, 3991-3998 |
| 47. | Tounekti, N., Mougel, M., Roy, C., Marquet, R., Darlix, J. L., Paoletti, J., Ehresmann, B., and Ehresmann, C. (1992) J. Mol. Biol. 223, 205-220 |
| 48. | Ly, H., Nierlich, D. P., Olsen, J. C., and Kaplan, A. H. (1999) J. Virol. 73, 7255-7261 |
| 49. | Prats, A. C., Roy, C., Wang, P. A., Erard, M., Housset, V., Gabus, C., Paoletti, C., and Darlix, J. L. (1990) J. Virol. 64, 774-783 |
| 50. | Bonnet-Mathoniere, B., Girard, P. M., Muriaux, D., and Paoletti, J. (1996) Eur. J. Biochem. 238, 129-135 |
| 51. | Polge, E., Darlix, J. L., Paoletti, J., and Fossé, P. (2000) J. Mol. Biol. 300, 41-56 |
| 52. | Lodmell, J. S., Ehresmann, C., Ehresmann, B., and Marquet, R. (2000) RNA 6, 1267-1276 |
| 53. | Berkowitz, R. D., Luban, J., and Goff, S. P. (1993) J. Virol. 67, 7190-200 |
| 54. | Clever, J. L., Taplitz, R. A., Lochrie, M. A., Polisky, B., and Parslow, T. G. (2000) J. Virol. 74, 541-546 |
| 55. | McCann, E. M., and Lever, A. M. (1997) J. Virol. 71, 4133-4137 |
| 56. | Girard, P. M., de Rocquigny, H., Roques, B. P., and Paoletti, J. (1996) Biochemistry 35, 8705-8714 |
| 57. | Oroudjev, E. M., Kang, P. C., and Kohlstaedt, L. A. (1999) J. Mol. Biol. 291, 603-613 |
| 58. | Marquet, R., Paillart, J.-C., Skripkin, E., Ehresmann, C., and Ehresmann, B. (1996) in Biological Structure and Dynamics (Sarma, R. H. , and Sarma, M. H., eds), Vol. 2 , pp. 61-72, Adenine Press, Albany, NY |
| 59. | de Rocquigny, H., Gabus, C., Vincent, A., Fournié-Zaluski, M. C., Roques, B., and Darlix, J. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6472-6476 |
| 60. | Berkhout, B., Das, A. T., and van Wamel, J. L. (1998) Virology 249, 211-218 |
| 61. | Pal, B. K., Scherer, L., Zelby, L., Bertrand, E., and Rossi, J. J. (1998) J. Virol. 72, 8349-8353 |
| 62. | Feng, Y. X., Campbell, S., Harvin, D., Ehresmann, B., Ehresmann, C., and Rein, A. (1999) J. Virol. 73, 4251-4256 |
| 63. | Kaye, J. F., and Lever, A. M. (1998) J. Virol. 72, 5877-5885 |
| 64. | Mak, J., Khorchid, A., Cao, Q., Huang, Y., Lowy, I., Parniak, M. A., Prasad, V. R., Wainberg, M. A., and Kleiman, L. (1997) J. Mol. Biol. 265, 419-431 |
| 65. | Rong, L., Liang, C., Hsu, M., Kleiman, L., Petitjean, P., de Rocquigny, H., Roques, B. P., and Wainberg, M. A. (1998) J. Virol. 72, 9353-9358 |
| 66. | Khorchid, A., Javanbakht, H., Wise, S., Halwani, R., Parniak, M. A., Wainberg, M. A., and Kleiman, L. (2000) J. Mol. Biol. 299, 17-26 |
| 67. | Cen, S., Huang, Y., Khorchid, A., Darlix, J. L., Wainberg, M. A., and Kleiman, L. (1999) J. Virol. 73, 4485-4488 |
| 68. | Li, X., Quan, Y., Arts, E. J., Li, Z., Preston, B. D., de Rocquigny, H., Roques, B. P., Darlix, J. L., Kleiman, L., Parniak, M. A., and Wainberg, M. A. (1996) J. Virol. 70, 4996-5004 |
| 69. | Huang, Y., Khorchid, A., Gabor, J., Wang, J., Li, X., Darlix, J. L., Wainberg, M. A., and Kleiman, L. (1998) J. Virol. 72, 3907-3915 |
| 70. | Prats, A. C., Housset, V., de Billy, G., Cornille, F., Prats, H., Roques, B., and Darlix, J. L. (1991) Nucleic Acids Res. 19, 3533-3541 |
| 71. | Marquet, R., Paillart, J.-C., Skripkin, E., Ehresmann, C., and Ehresmann, B. (1994) Nucleic Acids Res. 22, 145-151 |
| 72. | Fu, W., Gorelick, R. J., and Rein, A. (1994) J. Virol. 68, 5013-5018 |
| 73. | Feng, Y. X., Copeland, T. D., Henderson, L. E., Gorelick, R. J., Bosche, W. J., Levin, J. G., and Rein, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7577-7581 |
| 74. | Rein, A., Henderson, L. E., and Levin, J. G. (1998) Trends Biochem. Sci. 23, 297-301 |
| 75. | Dib-Hajj, F., Khan, R., and Giedroc, D. P. (1993) Protein Sci. 2, 231-243 |
| 76. | Cristofari, G., Ficheux, D., and Darlix, J. L. (2000) J. Biol. Chem. 275, 19210-19217 |
| 77. | Gabus, C., Ficheux, D., Rau, M., Keith, G., Sandmeyer, S., and Darlix, J. L. (1998) EMBO J. 17, 4873-4880 |
This article has been cited by other articles:
![]() |
T. T. Baig, J.-M. Lanchy, and J. S. Lodmell HIV-2 RNA dimerization is regulated by intramolecular interactions in vitro RNA, August 1, 2007; 13(8): 1341 - 1354. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Lanchy, Q. N. Szafran, and J. S. Lodmell Splicing affects presentation of RNA dimerization signals in HIV-2 in vitro Nucleic Acids Res., August 27, 2004; 32(15): 4585 - 4595. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. LANCHY, J. D. IVANOVITCH, and J. S. LODMELL A structural linkage between the dimerization and encapsidation signals in HIV-2 leader RNA RNA, August 1, 2003; 9(8): 1007 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. G. Dirac, H. Huthoff, J. Kjems, and B. Berkhout Requirements for RNA heterodimerization of the human immunodeficiency virus type 1 (HIV-1) and HIV-2 genomes J. Gen. Virol., October 1, 2002; 83(10): 2533 - 2542. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. G. Dirac, H. Huthoff, J. Kjems, and B. Berkhout Regulated HIV-2 RNA dimerization by means of alternative RNA conformations Nucleic Acids Res., June 15, 2002; 30(12): 2647 - 2655. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ly and T. G. Parslow Bipartite Signal for Genomic RNA Dimerization in Moloney Murine Leukemia Virus J. Virol., March 7, 2002; 76(7): 3135 - 3144. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. G. Dirac, H. Huthoff, J. Kjems, and B. Berkhout The Dimer Initiation Site Hairpin Mediates Dimerization of the Human Immunodeficiency Virus, Type 2 RNA Genome J. Biol. Chem., August 17, 2001; 276(34): 32345 - 32352. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |