|
Originally published In Press as doi:10.1074/jbc.M006824200 on December 4, 2000
J. Biol. Chem., Vol. 276, Issue 8, 5636-5642, February 23, 2001
Regulation of Elongation Factor-1 Expression by Growth
Factors and Anti-receptor Blocking Antibodies*
Amjad H.
Talukder,
Helle Færk
Jørgensen ,
Mahitosh
Mandal,
Sandip K.
Mishra,
Ratna K
Vadlamudi,
Brian F. C.
Clark ,
John
Mendelsohn, and
Rakesh
Kumar¶
From the Department of Molecular and Cellular Oncology, University
of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 and the
Institute of Molecular and Structural Biology, Aarhus
University, Aarhus, DK-8000, Denmark
Received for publication, July 31, 2000, and in revised form, November 20, 2000
 |
ABSTRACT |
The epidermal growth factor (EGF) family and its
receptors regulate normal and cancerous epithelial cell proliferation,
a process that could be suppressed by anti-receptor blocking
antibodies. Polypeptide elongation factor-1 (EF-1 ) is a
multifunctional protein whose levels are positively correlated with the
proliferative state of cells. To identify genes, whose expression may
be modulated by anti-receptor blocking antibodies, we performed a
differential display screening and isolated differentially expressed
cDNAs. Isolates from one clone were 100% identical to human
EF-1 . Both EGF and heregulin- 1 (HRG) induced
EF-1 promoter activity and mRNA and protein
expression. Growth factor-mediated EF-1 expression was effectively
blocked by pretreatment with humanized anti-EGF receptor antibody C225
or anti-human epidermal growth factor receptor-2 (HER2) antibody
herceptin. Mutants and pharmacological inhibitors of
p38MAPK and MEK, but not phosphatidylinositol 3-kinase,
suppressed both constitutive and HRG-induced stimulation of
EF-1 promoter activity in MCF-7 cells. Deletion analysis
of the promoter suggested the requirement of the 393 to 204 region
for growth factor-mediated transcription of EF-1 . Fine
mapping and point mutation studies revealed a role of the SP1 site in
the observed HRG-mediated regulation of the EF-1
promoter. In addition, we also provide new evidence to suggest that HRG
stimulation of the EF-1 promoter involves increased
physical interactions with acetylated histone H3 and histone H4. These
results suggest that regulation of EF-1 expression by extracellular
signals that function through human EGF receptor family members that
are widely deregulated in human cancers and that growth factor
regulation of EF-1 expression involve histone acetylation.
 |
INTRODUCTION |
Growth factors and their receptors play an important role in the
regulation of epithelial cell growth. Abnormalities in the expression,
structure, or activity of proto-oncogene products contribute to the
development and the pathogenesis of cancer. For example, the
human epidermal growth factor
receptor (HER1)1
is overexpressed in a number of epithelial tumor cells (1). HER2, the
second member of the HER family, shares extensive sequence homology
with the tyrosine kinase domain of HER1 (1, 2) and is overexpressed
and/or amplified in a number of human malignancies, including breast,
ovarian, colon, lung, prostate, and cervical cancers. Recently, HER3
and HER4 have been added to the family, as they share sequence homology
with the tyrosine kinase domain of HER1 (2). Regulation of these
receptor family members is complex, and they can be transactivated in a
ligand-dependent manner. For example, binding of
heregulin- 1 (HRG) to HER3 or HER4 can activate HER2 receptor as a
result of HER2/HER3 or HER4/HER2 heterodimeric interactions (3, 4).
HER1 and HER2 have been shown to induce transformation in recipient
cell, possibly because of excessive activation of signal transduction
pathways. In contrast, transformation by HER3 or HER4 requires the
presence of HER1 or HER2 (3, 4).
Since growth factors regulate the proliferation of cancer cells by
activating receptors on the surface of the cells, one approach to
controlling cell proliferation is to use anti-receptor blocking monoclonal antibodies that interfere with growth factor
receptor-mediated autocrine/paracrine growth stimulation. The humanized
antibody C225 against the EGF receptor (EGFR) blocks binding of ligand and prevents ligand-induced activation of receptor tyrosine kinase (5,
6). C225 is currently being used in phase IIA multicenter clinical
trials alone and in combination with chemotherapy or radiation to treat
to patients with head and neck, lung, or prostate carcinomas (7-9).
Similarly, the humanized form of anti-HER2 monoclonal antibody HCT
(herceptin) inhibits the growth of breast cancer cells overexpressing
HER2 (10, 11) and is currently being used as an effective drug against
some forms of breast cancer (12). Anti-receptor antibodies are known to
inhibit many processes, including mitogenesis, cell cycle progression,
invasion and metastasis, angiogenesis, and DNA repair.
Mitogenic growth factors stimulate protein synthesis in eukaryotic
cells. Polypeptide elongation factor-1 (EF-1 ) is a ubiquitously expressed protein that plays a key role in the elongation cycle during
translation. EF-1 forms a complex with aminoacyl-tRNA and GTP that
transfers the aminoacyl-tRNA group to the 80 S ribosome and hydrolyzes
GTP (13). EF-1 is also involved in cytoskeleton reorganization (14,
15) and proliferation (16). It can regulate embryogenesis (17), actin
bundling, and microtubule severing and is associated with the
centrosome and mitotic machinery (14, 18, 19). EF-1 is also one of
the actin-associated activators of phosphatidylinositol 4-kinase, which
regulates the levels of phosphatidylinositol 4-phosphate and
phosphatidylinositol 4,5-bisphosphate (20). These phospholipids
regulate the capping of actin filaments by actin-binding protein (18).
In brief, EF-1 regulates cellular functions that are both dependent
on and independent of translational controls.
Next only to actin, EF-1 is the most abundant protein in normal
cells, accounting for 1-2% of total protein. Regulation of its levels
may be important for normal cell function; rapidly growing cells
usually exhibit a large increase in their EF-1 mRNA levels (21);
overexpression of EF-1 correlates with metastasis (22); and EF-1
mRNA levels decrease during murine erythroleukemic cell
differentiation (23). EF-1 expression can be regulated at both the
transcriptional and post-transcriptional levels (24, 25). EF-1
mRNA levels have been shown to be up-regulated by oncogenes and
induced by phytohemagglutinin in human blood lymphocytes (22, 26). In
addition, overexpression of EF-1 in fibroblasts leads to increased
susceptibility to oncogenic transformation (27). In addition to its
predominant cytoplasmic presence, EF-1 has been reported in the
nucleus (28) where it binds to RNA polymerase (29). Recently, EF-1
has been shown to be physically associated with the novel zinc finger
protein ZPR1 in A-431 cells and to be translocated to the nucleus in an
EGF-dependent manner (30). Furthermore, insulin can
regulate translational elongation activity of EF-1 by regulating its
phosphorylation by multipotential S6 kinase (31-33). Yet, despite
knowledge of these cellular functions, the possible regulation of
EF-1 by the EGF family of growth factors and by therapeutic
anti-receptor antibodies remains unexplored.
To identify genes whose expression may be down-regulated by
anti-receptor blocking antibodies, presumably owing to ligand-induced activation of receptor tyrosine kinase and/or interference of receptor-associated functions, we used differential display approach to
isolate differentially expressed cDNAs. We report that one of these
clones had 100% identity with human elongation factor-1 (EF-1 ).
Both EGF and HRG induced EF-1 promoter activity and mRNA and protein expression that could be effectively blocked by
pretreatment with anti-receptor monoclonal antibodies. Our results also
suggest involvement of specific signaling pathways in the base-line
regulation of EF-1 transcription. In addition, we also provide new
evidence to suggest that HRG stimulation of EF-1 promoter
requires the SP1 site and that the EF-1 promoter undergoes histone acetylation in response to HRG.
 |
EXPERIMENTAL PROCEDURES |
Cell Cultures and Reagents--
Human breast cancer cells MCF-7,
MDA-MB468, BT-474, SK-BR-3, MDA-MB231, and MDA-MB435 (34), mouse NIH3T3
cells transfected with human EGFR (HER14 cells, Fan et al.
(35)), and vulvar carcinoma A-431 cells (6) were maintained in
Dulbecco's modified Eagle's medium/F-12 (1:1) supplemented with 10%
fetal calf serum. Recombinant HRG- 1 was purchased from Neomarkers
Inc. Anti-vinculin antibody and recombinant EGF were purchased from Sigma.
Differential Display and Cloning of EF-1
cDNA--
Differential display was performed according to the
method described in Ref. 36. In brief, MDA-MB435 and MDA-MB231 cells were treated with or without C225 or herceptin. Total RNA was isolated
using Trizol reagent (Life Technologies, Inc.). Total RNA was digested
with RNase-free DNase (Promega) and purified by phenol/chloroform
extraction. First strand cDNA was synthesized by reverse
transcriptase reaction containing 200 ng of total RNA using four
different degenerate anchored oligo(dT) primer set (dT12VA, dT12VG,
dT12VC, dT12VT; Operon Technologies Inc.). Reactions were performed in
a 20-µl volume using Moloney murine leukemia virus reverse
transcriptase (Promega). Amplification of cDNA fragments was
performed using 2 µl of the cDNA in reaction buffer containing 2 µl of 10× PCR buffer, 10 µCi of -35S-dATP,
dNTPs (2 µM), 1 unit of Taq polymerase (Roche
Molecular Biochemicals), the same 3'-degenerate oligo(dT) primer, and 1 of the 10 5'-orbitary decamers (OP-26-01 to OP-26-10, Operon
Technology, Inc.). PCR cycles were as follows: denaturation 95 °C
for 5 min, 40 cycles at 94 °C for 30 s, 40 °C for 2 min,
72 °C for 30 s with a final extension of 72 °C for 10 min.
PCR products were separated on a 6% polyacrylamide gel and developed
by autoradiography. Bands of interest were excised, extracted, and
reamplified with same set of primers. Amplified DNA was separated on an
agarose gel, and bands were purified and cloned into PCR2.1 vector
using Topocloning kit (Invitrogen). Five to ten independent clones were
isolated, miniprepared, and sequenced at the M. D. Anderson Cancer
Core facility. Sequences were compared with GenBankTM
sequences using BLAST search.
Construction of EF-1 Promoter Deletion
Constructs--
Construction of deletion constructs pEF (construct
numbers 1-7) was described (37). Sub-fragmentation of the insert of
construct 6 was done using restriction sites
HindIII/SphI, HindIII/StyI, and AvaII/SphI. Cloning of blunt-ended fragments
into the XbaI site of pBLCAT5 (38) yielded constructs 8, 9, and 12, respectively. The mutations in construct 9 were made using the
QuickChange kit (Stratagene) according to the instructions.
Cell Extracts, Immunoblotting, and Immunoprecipitation--
To
prepare cell extracts, cells were washed three times with
phosphate-buffered saline and lysed in buffer (50 mM
Tris-HCl, pH 7.5, 120 mM NaCl, 0.5% Nonidet P-40, 100 mM NaF, 200 mM NaVO5, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml aprotinin) for 15 min on ice. The lysates were centrifuged in an Eppendorf centrifuge at 4 °C for 15 min. Cell lysates containing equal amounts of protein were resolved by SDS-PAGE, transferred to
nitrocellulose, and probed with the appropriate antibodies. An equal
number of cells were metabolically labeled for 4-8 h with 100 µCi/ml
[35S]methionine in methionine-free medium containing 2%
dialyzed fetal bovine serum in the absence or presence of indicated
treatments. Cell extracts containing equal trichloroacetic
acid-precipitable counts were immunoprecipitated with the desired
antibody, resolved on SDS-PAGE, and analyzed (34).
Northern Hybridization--
Total cytoplasmic RNA was isolated
using the Trizol reagent (Life Technologies, Inc.), and 20 µg of RNA
was analyzed by Northern hybridization using a 1.8-kilobase pair
cDNA fragment of human EF1- . rRNA (28 S and 18 S) was used to
assess the integrity of the RNA, and for RNA loading and transfer
control, the blots were routinely reprobed with
glyceraldehyde-3-phosphate dehydrogenase cDNA.
Transfection and Promoter Assays--
Cells were split in 100-mm
tissue culture dishes (Falcon) 24 h before transfection.
Subconfluent cells were transiently transfected with pEF 1090CATSp1
or with other constructs as needed or control pSVb-Gal vector using
LipofectAMINE method (Life Technologies, Inc.). After 5 h of
transfection, medium was changed to Dulbecco's modified Eagle's
medium containing 10% serum. After 24 h, cultures were shifted to
0% serum (for growth factor treatment) or 2% serum (for antibody
treatment) for 12 h before harvesting. CAT activity was measured
48 h after transfection using a CAT assay kit (Promaga) (39). When
indicated, cells were treated with HRG or EGF (30-ng/ml medium) or
herceptin or C225 (50 nM final concentration). In some experiments, cells were pretreated with 20 µM PD098059 (a
MEK inhibitor), 20 µM SB203580 (a p38MAPK
inhibitor), and 20 µM LY294002 (PI3K inhibitor) for
1 h before HRG treatment. Each experiment was repeated two to five
times and transfection efficiency varied between 30 and 50%.
Chromatin Immunoprecipitation Assays--
MCF-7 cells were split
in 100-mm tissue culture dishes (Falcon). About 70% confluent dishes
were serum-starved for 24 h followed by overnight treatment with
HRG (30 ng/ml). Quantitative chromatin immunoprecipitation assay was
done as described previously (40-42) with some modifications.
Approximately 106 cells were treated with formaldehyde (1%
final concentration) for 10 min at 37 °C to cross-link histones to
DNA. The cells were washed twice with phosphate-buffered saline, pH
7.4, containing protease inhibitor mixture (Roche Molecular
Biochemicals). Cells were lysed and sonicated as described (40).
Sonicated lysate was centrifuged for 10 min at 12,000 rpm at 4 °C.
Supernatant was diluted 10-fold by dilution buffer containing 0.01%
SDS, 1.1% Triton X-100, and protease inhibitor mixture (Roche
Molecular Biochemicals). A portion (1%) of the chromatin solution was
kept to check the amount of input DNA in different samples before
immunoprecipitation. Chromatin solutions were precleared with 80 µl
of protein A-Sepharose beads (60 mg/ml) saturated with salmon sperm DNA
and bovine serum albumin for 30 min at 4 °C before
immunoprecipitating with either anti-acetylated histone H3 or
anti-acetylated H4 antibody (Upstate Biotechnology, Inc.) at 4 °C
overnight. Immunocomplexes were recovered with 60 µl of protein A-
Sepharose beads at 4 °C for 1 h. Beads were washed as described
(40) on a rotating platform before eluting the immunocomplexes by
incubation with 400 µl of 1% SDS containing 0.1 M
NaHCO3. The elution was heated to 65 °C for 6 h to
reverse the formaldehyde cross-links. Phenol/chloroform extraction was
performed, and the supernatant was ethanol-precipitated (using 20 µg
of glycogen as an inert carrier). DNA was resuspended in 50 µl of
10 mM Tris, 1 mM EDTA, pH 8.0. Quantitative PCR was done with 10 µl of DNA sample restricted to 25 cycles. The EF-1 DNA sequence of the 5' primer was 5'
GATTTGTCCCGGACTAGCGAG and of the 3' primer was 5'
TCTTCTCCACCTCAGTGATGACG 3'. The PCR products were resolved on a 1.5%
agarose gel and stained with ethidium bromide.
 |
RESULTS AND DISCUSSION |
Identification of Human Polypeptide Elongation Factor-1 as an
Anti-receptor Antibody-regulated Gene--
In an attempt to identify
genes whose expression may be modulated in human cancer cells by
anti-receptor blocking antibodies, total RNA was isolated from two
highly invasive human breast cancer cell lines, MDA-MB435 and
MDA-MB231, and treated with or without C225 and herceptin for 10 h. Although MDA-MB435 and MDA-MB231 cells have normal levels of EGFR
and HER2, the in vitro invasive properties of these cells
were inhibited by herceptin and C225 (43). A total of 160 reactions was
performed using four 3'-degenerate oligo(dT) primers and 10 5'-random
primers for each antibody treatment. Analysis of gels showed
amplification of a number of bands ranging from 100 to 600 base pairs,
and the majorities of the bands were of equal intensity. By using these
bands as internal control, we analyzed for the bands with differences
in intensity in C225- or herceptin-treated lanes. This analysis
resulted in the identification of five differentially expressed gene
products ranging in size from 120 to 350 base pairs. A representative
portion of the gel is shown in Fig.
1A.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
Identification of EF-1 as
a differentially expressed gene. A,
representative differential display band patterns of control, C225, or
HCT-treated MDA-MB231 cells. Arrow indicates the band of
interest, which is down-regulated by herceptin treatment. B,
sequence of the purified bands that matches (100%) those with human
EF-1 . C, Northern blot analysis showing down-regulation
of EF-1 mRNA in herceptin- or C225-treated breast cancer cell
lines. GAPDH, glyceraldehyde-3-phosphate
dehydrogenase.
|
|
Each differentially expressed gene product was amplified, cloned, and
sequenced. The resulting sequence was compared with sequences deposited
in GenBankTM. For each gene product five clones were
sequenced, and all five sequences from one band were 100% identical to
human elongation factor-1 from 1580 to 1694 (EF1 ,
GenBankTM accession number X16869) (Fig. 1B). To
determine whether EF-1 expression can be modulated by anti-receptor
blocking antibodies C225 and herceptin on EF-1 mRNA levels in
tumor cells, we did Northern blot hybridization using the 1.8-kilobase
pair EF-1 cDNA as a probe. Treatment of human breast carcinoma
cells (SK-BR-3, BT-474, and MDA-MB468) and vulvar carcinoma cells
(A-431) with C225 or herceptin was accompanied by a significant
decrease in EF-1 mRNA levels (Fig. 1C).
Regulation of EF-1 mRNA Expression by Anti-receptor
Antibodies and Growth Factors--
A-431 cells, which overexpress
EGFR, are growth-stimulated by autocrine transforming growth factor-
(TGF- ) and growth-inhibited by C225 (6). To determine whether
TGF- is involved in the regulation of EF-1 , we asked whether
C225, which blocks TGF- from binding to EGFR, could down-regulate
the steady-state level of EF-1 mRNA. Treatment of A-431 cells
with C225 was accompanied by a gradual decrease in EF-1 mRNA
expression (Fig. 2A).
Similarly, herceptin treatment of BT-474 cells, which overexpress HER2,
was associated with reduced expression of EF-1 mRNA (Fig.
2B). The observed suppression was not related to high levels
of EGFR, as C225 was effective in selectively reducing EF-1 levels
(but not EF-1 ) in breast cancer MDA-MB231 cells, which have normal
levels of EGFR and HER2 (Fig. 2C).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2.
Regulation of EF-1
mRNA expression by anti-receptor antibodies and growth
factors. A-C, tumor cell lines were treated with or
without C225 or (50 nM) for the indicated times.
D and E, MDA-MB231 or HER14 cells were treated
with EGF or HRG (30 nM) for 16 h. Total RNA was
isolated, and EF-1 mRNA levels were detected by Northern blot
analysis. Subsequently, the blot was reprobed with a
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA
probe. Quantitation of mRNA is shown in the bottom
panel. Results are representative of three experiments.
|
|
Since MDA-MB231 cells are known to constitutively secrete HRG, a
combinatorial ligand for HER3 and HER4 that can transactivate EGFR and
HER2, the above results raised the possibility that EF-1 mRNA
expression could be induced by HRG. Indeed, both HRG and EGF were
potent inducers of EF-1 mRNA (but not EF-1 ) in MDA-MB231 cells (Fig. 2D). EGF regulation of EF-1 mRNA
expression was confirmed using a mouse NIH3T3 cell line (HER14) that
stably expressed human EGFR and responded to exogenous recombinant EGF
by growth stimulation (35). EGF treatment of HER14 cells for 8 h
was accompanied by a significant increase in EF-1 mRNA levels
(Fig. 2E). Taken together, these results suggest that
EF-1 mRNA levels in a number of cell types are modulated by EGF,
HRG, and anti-receptor monoclonal antibodies that interfere with EGFR
and HER2.
Regulation of EF-1 Protein Expression by Anti-receptor
Antibodies and Growth Factors--
Western blot analysis was performed
to determine whether the modulation of EF-1 mRNA levels by
growth factors and anti-receptor monoclonal antibodies was associated
with a corresponding modulation in the expression of EF-1 protein.
Results demonstrated that A-431 cells and human colon carcinoma DiFi
cells, which have a functional TGF- autocrine loop (44), expressed a
lower level of the 51-kDa EF-1 protein, after C225 treatment (Fig.
3, A and B).
Similarly, herceptin inhibited EF-1 protein levels in BT-474 cells
(Fig. 3C). In contrast, treatment of MCF-7 cells with EGF or
HRG significantly increased the level of EF-1 protein (Fig. 3D).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 3.
Anti-receptor antibodies decrease and growth
factors increase EF-1 protein level.
A-C, cells were treated with C225 or HCT for the indicated
times; D, cells were treated with EGF or HRG for 16 h.
Total lysates were run on SDS-PAGE and blotted with anti-EF-1
monoclonal antibody. Anti-vinculin antibody or anti- -actin antibody
was used as an internal control. Quantitation of the ratio of EF-1
to -actin is shown in the bottom panel. Results are
representative of three to five separate experiments.
|
|
To validate further the modulation of EF-1 protein expression by
growth factors, we examined the effects of growth factors and
anti-receptor monoclonal antibodies on the level of newly synthesized
EF-1 protein in cells metabolically labeled with [35S]methionine. Similar to our results from Western
analysis, treatment with C225 or herceptin resulted in a reduction of
35S-labeled EF-1 protein in A-431, BT-474, and MDA-MB231
cells (Fig. 4, A-C). In
contrast, HRG treatment caused an increase in 35S-labeled
EF-1 protein in BT-474 (Fig. 4A) and MDA-MB231 (Fig. 4D) cells and EGF in HER14 cells (Fig. 4E). The
observed induction of 35S-labeled EF-1 protein by HRG
and EGF was mediated through HER2 and EGFR, as it was effectively
suppressed by herceptin and C225 (Fig. 4, A and
E). These results indicate the ability of growth factors to
induce expression of EF-1 and of growth factor receptor antibodies
to block it.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 4.
Regulation of newly synthesized
EF-1 protein by anti-receptor antibodies and
growth factors. A-E, cells were treated with
C225 or HCT in the presence or absence of EGF or HRG for 16 h and
metabolically labeled with [35S]methionine for 10 h
before harvesting. Cell lysates were immunoprecipitated with an
anti-EF-1 monoclonal antibody and analyzed by SDS-PAGE and
fluorography. Results are representative of three independent
experiments.
|
|
Regulation of the EF-1 Promoter by Anti-receptor Antibodies and
Growth Factors--
The regulatory elements in the human
EF-1 are not completely understood. Recently,
Clark and colleagues (37) have shown the significance of specific
elements (44), located in the first intron and also close to the TATA
box, in the regulation of EF-1 transcription. To examine the effect
of growth factor-blocking monoclonal antibodies on EF-1
promoter activity, tumor cells were transfected with the
EF-1 promoter construct pEF 1090CATSp1, which contains
all regulatory elements upstream of the human EF-1 TATA box fused to
the thymidine kinase promoter (37). Treatment of A-431 and MDA-MB231
cells with C225 (Fig. 5, A and
B) and of MDA-MB231 and BT-474 cells with herceptin (Fig. 5,
B and C) resulted in a significant inhibition of
EF-1 promoter-driven reporter transcription. Conversely,
exposure of HER14 cells to EGF was accompanied by 2-4-fold stimulation
of EF-1 promoter-driven transcription, and EGF receptor
antagonist C225 blocked the EGF-mediated stimulation of
EF-1 promoter activity (Fig. 4D). Similarly,
stimulation of EF-1 promoter activity by HRG was also
suppressed by pretreatment of MCF-7 cells with herceptin (Fig.
4E).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 5.
Modulation of EF-1
promoter activity by C225 and herceptin and growth
factors. Tumor cells were transiently transfected with an
EF-1 promoter (pEF 1090CATSp1),
and CAT activity was measured 36 h after transfection.
A-C, cultures were treated with C225 and HCT (50 nM) for 16 h before lysis. Results are representative
of two experiments. D and E, after transfection
with EF-1 promoter (pEF 1090CATSp1), HER14 and MCF-7
cells were treated with EGF or HRG (30 nM) in the presence
or absence of C225 or herceptin (50 nM) for 16 h, and
CAT activity was measured. These studies were independently repeated
four times. Relative CAT activities are shown in the bottom
panels.
|
|
Growth Factor Signaling and Regulation of EF-1 Promoter
Activity--
Distinct signaling pathways regulate different functions
of growth factors. For example, HRG utilizes p38MAPK and
PI3K pathways to regulate the spreading and formation of lamellipodia
(39, 45). A careful analysis of EF-1 promoter (GenBankTM accession number E02627) revealed several
important motifs, including AP1, SP1, CREB, CRE-BP, and NF- B that
are activated by multiple growth factor signaling pathways. To
understand the nature of growth factor signaling pathways leading to
stimulation of the EF-1 promoter, we employed
cotransfection of EF1 promoter pEF 1090CATSp1 reporter
with dominant-negative tagged mutants that specifically inhibit
p38MAPK and PI3K activation or dominant-negative mutant of
MEK (39, 45, 46). In these studies, we used HRG as a model growth
factor. Mutants of p38MAPK and MEK, but not PI3K,
suppressed both constitutive and the extent of HRG-induced stimulation
of EF-1 promoter activity in MCF-7 cells (Fig.
6A). The observed inhibitory
effects of mutants were not due to variability in the expression levels
of the transfected genes in cells treated with or without HRG, as shown
by the expression levels of FLAG-tagged p38AF and HA-tagged p85 by
antibodies against FLAG and HA moieties, respectively (Fig.
6B). To confirm these findings further, we next used
pharmacological inhibitors, such as PD098059 (for MEK), SB203580 (for
p38MAPK), and LY294002 (for PI3K), and similar results were
obtained (Fig. 6C). In brief, these results suggested a
preferential involvement of MEK and p38MAPK, but not PI3K,
in the base-line and HRG-inducible regulation of EF-1
promoter activity.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Delineation of signaling pathways involved in
ligand-induced stimulation of EF-1 promoter
activity. A, MCF-7 cells were transiently
transfected with a full-length EF-1 promoter
(pEF 1090CATSp1) in the absence or presence of dominant-negative
mutants of MEK, p38MAPK, and PI3K. One set of cultures was
treated with or without HRG for 16 h before assaying for CAT
activity. Quantitation of CAT activity is shown as fold induction of
CAT reporter activity by HRG treatment over the control culture for
each mutant group. B, Western blot analysis of expression of
FLAG-tagged p38MAPK and HA-tagged PI3K mutants in lysates
from the above panel, using antibodies against FLAG-tagged and HA
epitopes, respectively. NS indicates nonspecific band in the
same blot. Results shown are representative of two experiments.
C, cells were pretreated with specific inhibitors PD098059,
SB203580, and LY294002 (20 µM each) for 1 h before
HRG treatment for 16 h. Quantitation of CAT activity is shown as
fold induction of CAT reporter activity by HRG treatment over the
control culture in each inhibitor.
|
|
Stimulation of cytoplasmic kinases by growth factors leads to
phosphorylation and activation of multiple transcription factors, including c-Jun, ATF-2, NF- B, CREB, and SP1. Since the binding motifs for these transcription factors are present in the
EF-1 promoter (GenBankTM accession number
E02627), it is possible that a combination of these factors may be
responsible for optimal EF-1 promoter regulation. Recent
studies have shown transcriptional regulation of the human
EF-1 gene by upstream sequences, including a novel C8-stretch element.2
A Role of SP1 in HRG Regulation of EF-1 Promoter--
To
understand the mechanism by which HRG mediates its effect on
EF-1 promoter, we employed a series of deletion mutants
to map the HRG-responsive regulatory region in the EF-1
promoter. All mutants were fussed to a CAT reporter system. Initially,
we used constructs 1-6, and we examined the effect of HRG on the EF-1 promoter activity. There was minimal effect of the
deletions from 1090 to 393 of the EF-1 promoter on
the levels of HRG-mediated up-regulation of EF-1 (Fig.
7, construct numbers 1-6).
To delineate further the minimal region required for HRG
stimulation of the EF-1 promoter, we next used additional
mutants (Fig. 7, construct numbers 8, 9, and 12).
Constructs 8 ( 393 to 204) and 9 ( 313 to 314) responded to HRG
well, whereas constructs 12 ( 204 to 127) and 7 ( 119 to 29)
showed no regulation in response to HRG. The results indicated that
393 to 314 region contained the regulatory elements that may confer
the HRG-mediated induction of EF-1 . Analysis of the transcription
factor sites present in the 393 to 314 revealed presence of
an SP1 site. Recently it was shown that HRG regulate the activity of
SP1 transcription factor (47). To verify the potential involvement of
the SP1 site in HRG induction of EF-1 promoter, we next
mutated the SP1 site at 369 to 363 (construct 11). Point mutation
of the SP1 site completely abolished the HRG-mediated induction of the
construct containing 393 to 314 region. Mutation of another region
other than Sp1 site has no effect on HRG-mediated induction (construct 10), suggesting a role of SP1 in the HRG regulation of
EF-1 promoter. Interestingly, construct 8 ( 393 to
204), which contains two Sp1 sites, demonstrated a significantly
higher HRG-inducible activity (4-fold) than the construct containing
393 to 314 (construct number 10) with one SP1 site (2.1-fold).
Together, these observations suggested a role of SP1 site in the
observed HRG-mediated regulation of EF-1 promoter.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 7.
A role of SP1 in HRG Regulation of
EF-1 promoter. A, deletion
constructs were made as described under "Experimental Procedures."
Fold of induction by HRG over untreated control cells is shown in the
right-hand columns. Construct numbers 10-12 have
similar sequence, except that number 10 is wild type and has
one Sp1 site at 379 to 374 position; construct number 11 was mutated nonspecifically at 387 to 385 where CCC were replaced
with AGA, and construct number 12 was mutated at Sp1 site at
391 to 389 where CGC were replaced with 5' TTA 3'. B,
regulation of EF-1 deletion constructs by HRG (16 h). Results shown
are representative of three experiments.
|
|
Involvement of Histone Acetylation in HRG Regulation of
EF-1 --
The eukaryotic genome is compacted with histone and other
proteins to form chromatin, which consists of repeating units of nucleosomes (48, 49). For transcription factors to access DNA, the
repressive chromatin structure needs to be remodeled. Dynamic
alterations in the chromatin structure can facilitate or suppress the
access of the transcription factors to nucleosomal DNA, leading to
transcription regulation. One way to achieve this is through
alterations in the acetylation state of nucleosomal histones.
Hyperacetylated chromatin is generally associated with transcription
activation, whereas hypoacetylated chromatin is associated with
transcriptional repression (48, 49). To investigate whether the HRG
regulation of EF-1 expression involves histone acetylation on
the EF-1 gene, we next performed chromatin
immunoprecipitation (ChIP) assay of the target gene, i.e.
EF- around a target sequence in the promoter ( 535 to 209) which
has multiple SP1 sites by using antibodies specific for acetylated
forms of H3 and H4. Representative results from several independent
experiments are shown in Fig. 8. HRG
treatment of MCF-7 cells was accompanied by a significant enhancement
in the association of EF-1 promoter region with the acetylated histones H3 and H4 (5.0- and 3.5-fold induction of associated-acetylated H3 and -acetylated H4 by HRG as compared with
untreated cells). In addition, there was also easily detectable levels
of EF-1 promoter association with the acetylated H3 and H4 in control untreated cells (Fig. 8, lanes 1 and
3), implying a potential role of histone acetylation in the
base-line expression of EF-1 . Earlier reports have shown a close
correlation of up-regulation of histone H3 and H4 acetylation with an
increased transcriptional activity (48, 49). In brief, our findings
clearly demonstrated the involvement of histone acetylation in
HRG-mediated stimulation of EF- gene expression.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 8.
Acetylation of histone H3 and histone H4 at
the identified multiple SP1 sites by chromatin immunoprecipitation
assay. A, schematic representation of
EF-1 promoter sequence used for in vivo
chromatin association. B, MCF-7 cells were treated with
(lanes 2 and 4) or without (lanes 1 and 3) HRG (30 ng/ml for 16 h), and chromatin lysates
were immunoprecipitated with antibodies against acetylated H3
(lanes 1 and 2) or acetylated H4 (lanes
3 and 4), and samples were processed as described under
"Experimental Procedures." The top panel shows the PCR
analysis of the input DNA. The middle panel demonstrates the
PCR analysis of 326 base pairs of EF-1 DNA fragment associated with
acetylated histone H3 or H4. Quantitation of signals in the
bottom panel is presented as fold induction over control
untreated cells. IP, immunoprecipitation. Results are
representative of three independent experiments.
|
|
In summary, we have presented new evidence that treatment of tumor
cells with growth factors significantly increases EF-1 promoter activity and mRNA and protein expression and that HRG increases the acetylation of H3 and H4 on the EF-1
promoter. Since constitutive EF-1 expression was not well correlated
with EGFR or HER2 overexpression in different cell types,
ligand-activated cellular pathways, rather than receptor levels, may be
significant in the regulation of EF-1 expression. These views are
supported by a recent report showing no effect of EGFR and HER2
overexpression on levels of related EF-1 in human keratinocytes
(50). However, despite the lack of correlation with receptor levels,
the ligand-induced up-regulation of EF-1 expression was mediated by
a specific ligand-receptor interaction, as the anti-receptor blocking
antibodies C225 and herceptin could effectively reduce it. Our study
also shows the potential roles of MEK and p38MAPK in the
constitutive regulation of EF-1 promoter activity.
There are a number of possible functional implications for growth
factor-regulated EF-1 expression as follows: 1) promotion of
polypeptide elongation and thus potential contribution to increased translation of mRNA encoding growth-related proteins; 2) increased reorganization of the cytoskeleton, since it is one of the earliest phenotypic responses of most cells to growth factors and since EF-1
regulates actin bundling; 3) potential undefined roles in the nucleus,
due to the ability of EF-1 to form a complex with ZPR1 (30). In
summary, our findings have clearly demonstrated for the first time a
potential role of EF-1 in the actions of HER growth factors that are
widely deregulated in human cancers and that
ligand-dependent EF-1 expression was effectively
inhibited with humanized anti-receptor blocking antibodies C225 and
herceptin. In addition, we also provide new evidence to suggest that
HRG stimulation of EF-1 promoter requires the SP1 site
and that the EF-1 promoter undergoes histone acetylation
in response to HRG.
 |
ACKNOWLEDGEMENTS |
We thank Genentech Inc. for providing
herceptin and ImClone Inc. for C225.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grants CA80066 and CA65746, by the Breast Cancer Research Program of the University of Texas M. D. Anderson Cancer Center, and
Bristol-Myers Squibb Funds for Biomedical Research (to R. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Member of the Board of Directors of Imclone System Inc. and holds
stock option.
¶
To whom correspondence should be addressed: Dept. of Molecular
and Cellular Oncology, University of Texas M. D. Anderson Cancer Center-108, 1515 Holcombe Blvd., Houston, TX 77030. E-mail:
rkumar@notes.mdacc.tmc.edu.
Published, JBC Papers in Press, December 4, 2000, DOI 10.1074/jbc.M006824200
2
H. F. Jørgensen and B. F. C. Clark, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
HER, human epidermal
growth factor receptor;
HRG, heregulin- 1;
EGF, epidermal growth
factor;
EGFR, EGF receptor;
HCT, herceptin;
C225, anti-EGF receptor
antibody;
EF-1 , elongation factor-1 ;
PI3K, phosphatidylinositol
3-kinase;
MAPK, mitogen-activated protein kinase;
PCR, polymerase chain
reaction;
PAGE, polyacrylamide gel electrophoresis;
HA, hemagglutinin;
CAT, chloramphenicol acetyltransferase;
MEK, mitogen-activated protein
kinase/extracellular signal-regulated kinase kinase;
TGF- , transforming growth factor- .
 |
REFERENCES |
| 1.
|
Ullrich, A.,
and Schlessinger, J.
(1990)
Cell
61,
203-212
|
| 2.
|
Hynes, N. C.,
and Stern, D. F.
(1994)
Biochim. Biophys. Acta
1198,
165-184
|
| 3.
|
Zhang, K.,
Sun, J.,
Liu, N.,
Wen, D.,
Chang, D.,
Thomas, A.,
and Yoshinaga, S. K.
(1996)
J. Biol. Chem.
271,
3884-3890
|
| 4.
|
Carraway, K. L., III,
and Cantley, L. C.
(1994)
Cell
78,
5-8
|
| 5.
|
Kawamoto, T.,
Sato, J. D.,
Le, A.,
Polikoff, J.,
Sato, G.,
and Mendelsohn, J.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
1337-1341
|
| 6.
|
Van de Vijver, M. J.,
Kumar, R.,
and Mendelsohn, J.
(1992)
J. Biol. Chem.
266,
7503-7508
|
| 7.
|
Mendelsohn, J.
(1997)
Clin. Cancer Res.
3,
2703-2707
|
| 8.
|
Ezekiel, M. P.,
Robert, F.,
Meredith, R. F.,
Spencer, S. A.,
Newsome, J.,
Khazaelli, M. B.,
Peters, G. E.,
Saleh, M.,
LoBuglio, A. F.,
and Waksal, H.
(1998)
Proc. Am. Soc. Clin. Oncol.
12,
1522.395
|
| 9.
|
Baselga, J.,
Pfister, D.,
Cooper, M. R.,
Cohen, R.,
Burtness, B.,
Bos, M.,
D'Andrea, G.,
Seidman, A.,
Norton, L.,
Gunnett, K.,
Anderson, V.,
Waksal, H.,
and Mendelsohn, J.
(2000)
J. Clin. Oncol.
18,
904-914
|
| 10.
|
Hudziak, R. M.,
Lewis, G. D.,
Winget, M.,
Fendly, B. M.,
Shepard, H. M.,
and Ulrich, A.
(1989)
Mol. Cell. Biol.
9,
1165-1172
|
| 11.
|
Kumar, R.,
Shepard, H. M.,
and Mendelsohn, J.
(1991)
Mol. Cell. Biol.
11,
979-986
|
| 12.
|
Cobleigh, M. A.,
Vogel, C. L.,
Tripathy, D.,
Robert, N. J.,
Scholl, S.,
Fehrenbacher, L.,
Wolter, J. M.,
Paton, V.,
Shak, S.,
Lieberman, G.,
and Slamon, D. J.
(1999)
J. Clin. Oncol.
17,
2639-2648
|
| 13.
|
Riis, B.,
Rattan, A. I. S.,
Clark, B. F. C.,
and Merrick, W. C.
(1990)
Trends Biochem. Sci.
15,
420-424
|
| 14.
|
Dharmawardhane, S.,
Demma, M.,
Yang, F.,
and Condeelis, J.
(1991)
Cell Motil. Cytoskeleton
20,
279-288
|
| 15.
|
Okazaki, K.,
and Yumura, S.
(1995)
Eur. J. Cell Biol.
66,
75-81
|
| 16.
|
Sanders, J.,
Maassen, J.,
and Moller, W.
(1992)
Nucleic Acids Res.
20,
5907-5910
|
| 17.
|
Kreig, P.,
Varnus, S.,
Worminton, W.,
and Melton, D.
(1989)
Dev. Biol.
133,
93-100
|
| 18.
|
Condeelis, J.
(1995)
Trends Biochem. Sci.
20,
169-170
|
| 19.
|
Yang, F.,
Demma, S.,
Warren, V.,
Dharmawardhane, S.,
and Condeelis, J.
(1990)
Nature
347,
494-496
|
| 20.
|
Yang, W.,
Burkhart, W.,
Cavallius, J.,
Merrick, W. C.,
and Boss, W. F.
(1993)
J. Biol. Chem.
268,
392-398
|
| 21.
|
Sanders, J.,
Brandsma, M.,
Janssen, G. M. C.,
Dijk, J.,
and Moller, W.
(1996)
J. Cell Sci.
109,
1113-1117
|
| 22.
|
Taniguchi, S.,
Miyamoto, S.,
Sadano, H.,
and Kobayashi, H.
(1992)
Nucleic Acids Res.
19,
6949
|
| 23.
|
Roth, W. W.,
Braff, P. W.,
Corrias, M. V.,
Reddy, N. S.,
Dholakia, J. N.,
and Wahba, A. J.
(1987)
Mol. Cell. Biol.
7,
3929-3936
|
| 24.
|
Loreni, F.,
Francesconi, A.,
and Amaldi, F.
(1993)
Nucleic Acids Res.
21,
4721-4725
|
| 25.
|
Jefferies, H. B. J.,
Thomas, G.,
and Thomas, G.
(1994)
J. Biol. Chem.
269,
4367-4372
|
| 26.
|
Koch, I.,
Hofschneider, P. H.,
Lottspeich, F.,
Eckerskorn, C.,
and Koshy, R.
(1990)
Oncogene
5,
839-843
|
| 27.
|
Tatsuka, M.,
Mitsui, H.,
Wada, M.,
Nagata, A.,
Nojima, H.,
and Okayama, H.
(1992)
Nature
359,
333-336
|
| 28.
|
Billaut-Mulot, O.,
Fernandez-Gomez, R.,
Loyens, M.,
and Ouaissi, A.
(1996)
Gene (Amst.)
174,
19-26
|
| 29.
|
Das, T.,
Mathur, M.,
Gupta, A. K.,
Janssen, G. M. C.,
and Banerjee, A. K.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
1449-1454
|
| 30.
|
Gangwani, L.,
Mikrut, M.,
Galcheva-Gargova, Z.,
and Davis, R. J.
(1998)
J. Cell Biol.
143,
1471-1484
|
| 31.
|
Morley, S. J.,
and Traugh, J. A.
(1993)
Biochimie (Paris)
75,
985-989
|
| 32.
|
Morley, S. J.,
and Traugh, J. A.
(1993)
J. Biol. Chem.
265,
10611-10616
|
| 33.
|
Chang, Y-W. E.,
and Traugh, J. A.
(1997)
J. Biol. Chem.
272,
28252-28257
|
| 34.
|
Kumar, R.,
Mandal, M.,
Lipton, A.,
Harvey, H.,
and Thompson, C. B.
(1996)
Clin. Cancer Res.
2,
1215-1219
|
| 35.
|
Fan, Z.,
Mendelsohn, J.,
Masui, H.,
and Kumar, R.
(1993)
J. Biol. Chem.
268,
21073-21079
|
| 36.
|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidma, J. G., Smith, J. A., and Struhl, K.
(eds)
(1997)
Current Protocols in Molecular Biology
, John Wiley & Sons, Inc., New York
|
| 37.
|
Nielsen, S. J.,
Praestegaard, M.,
Jorgensen, H. F.,
and Clark, B. F. C.
(1998)
Biochem. J.
333,
511-517
|
| 38.
|
Boshart, M.,
Kluppel, M.,
Schmidt, A.,
Schutz, G.,
and Luckow, B.
(1992)
Gene (Amst.)
110,
129-130
|
| 39.
|
Vadlamudi, R.,
Adam, L.,
Talukder, A.,
Mendelsohn, J.,
and Kumar, R.
(1999)
Oncogene
18,
7253-7264
|
| 40.
|
Braunstein, M.,
Rose, A. B.,
Holmes, S. G.,
Allis, C. D.,
and Broach, J. R.
(1993)
Genes Dev.
7,
592-604
|
| 41.
|
Hecht, A.,
Strahl-Bolsinger, S.,
and Grunstein, M.
(1996)
Nature
383,
92-96
|
| 42.
|
Alberts, A. S.,
Geneste, O.,
and Treisman, R.
(1998)
Cell
92,
475-487
|
| 43.
| Kumar, R., Mandal, M., and Vadlamudi, R. (2001) Semin.
Oncol., in press
|
| 44.
|
Wakabayashi-Ito, N.,
and Nagata, S.
(1994)
J. Biol. Chem.
269,
29831-29837
|
| 45.
|
Mandal, M.,
Adam, L.,
Mendelsohn, J.,
and Kumar, R.
(1998)
Oncogene
18,
999-1007
|
| 46.
|
Adam, L.,
Vadlamudi, R.,
Kondapaka, S. B.,
Chernoff, J.,
Mendelsohn, J.,
and Kumar, R.
(1998)
J. Biol. Chem.
273,
28238-28246
|
| 47.
|
Alroy, I.,
Soussan, L.,
Seger, R.,
and Yarden, Y.
(1999)
Mol. Cell. Biol.
19,
1961-1972
|
| 48.
|
Chen, W. Y.,
and Townes, T. M.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
377-382
|
| 49.
|
Chen, H.,
Lin, R. J.,
Xie, W.,
Wilpitz, D.,
and Evans, R. M.
(1999)
Cell
98,
675-686
|
| 50.
|
Kolettas, E.,
Lymboura, M.,
Khazaie, K.,
and Luomani, Y.
(1998)
Anticancer Res.
18,
385-392
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Koiwai, S. Maezawa, T. Hayano, M. Iitsuka, and O. Koiwai
BPOZ-2 directly binds to eEF1A1 to promote eEF1A1 ubiquitylation and degradation and prevent translation.
Genes Cells,
June 1, 2008;
13(6):
593 - 607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Barnes, F. Li, A. H. Talukder, and R. Kumar
Growth Factor Regulation of a 26S Proteasomal Subunit in Breast Cancer
Clin. Cancer Res.,
April 15, 2005;
11(8):
2868 - 2874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yang, R. Bagheri-Yarmand, S. Balasenthil, G. Hortobagyi, A. A. Sahin, C. J. Barnes, and R. Kumar
HER2 Regulation of Peroxisome Proliferator-activated Receptor {gamma} (PPAR{gamma}) Expression and Sensitivity of Breast Cancer Cells to PPAR{gamma} Ligand Therapy
Clin. Cancer Res.,
August 1, 2003;
9(8):
3198 - 3203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. L. Kagan, R. T. Henke, R. Cabal-Manzano, G. E. Stoica, Q. Nguyen, A. Wellstein, and A. T. Riegel
Complex Regulation of the Fibroblast Growth Factor-binding Protein in MDA- MB-468 Breast Cancer Cells by CCAAT/Enhancer-binding Protein {beta}
Cancer Res.,
April 1, 2003;
63(7):
1696 - 1705.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Barnes, F. Li, M. Mandal, Z. Yang, A. A. Sahin, and R. Kumar
Heregulin Induces Expression, ATPase Activity, and Nuclear Localization of G3BP, a Ras Signaling Component, in Human Breast Tumors
Cancer Res.,
March 1, 2002;
62(5):
1251 - 1255.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|