|
Originally published In Press as doi:10.1074/jbc.M007687200 on November 27, 2000
J. Biol. Chem., Vol. 276, Issue 8, 5700-5706, February 23, 2001
An Insertion Sequence Prepares Pseudomonas putida
S12 for Severe Solvent Stress*
Jan
Wery §,
Budi
Hidayat,
Jasper
Kieboom ¶, and
Jan
A. M.
de Bont
From the Division of Industrial Microbiology,
Department of Agrotechnology and Food Sciences, Wageningen University,
P. O. Box 8129, 6700 EV Wageningen, The Netherlands
Received for publication, August 23, 2000, and in revised form, November 6, 2000
 |
ABSTRACT |
The novel insertion sequence ISS12
plays a key role in the tolerance of Pseudomonas putida S12
to sudden toluene stress. Under normal culturing conditions the
P. putida S12 genome contained seven copies of
ISS12. However, a P. putida S12 population
growing to high cell density after sudden addition of a separate phase of toluene carried eight copies. The survival frequency of cells in
this variant P. putida S12 population was 1000 times higher than in "normal" P. putida S12 populations. Analysis of
the nucleotide sequence flanking the extra ISS12 insertion
revealed integration into the srpS gene. srpS
forms a gene cluster with srpR and both are putative
regulators of the solvent resistance pump SrpABC. SrpABC makes a major
contribution to solvent tolerance in P. putida S12 and is
induced by toluene. The basal level of srp promoter activity in the P. putida S12 variant was seven times
higher than in wild-type P. putida S12. Introduction of the
intact srpRS gene cluster in the variant resulted in a
dramatic decrease of survival frequency after a toluene shock. These
findings strongly suggest that interruption of srpS by
ISS12 up-regulates expression of the solvent pump, enabling
the bacterium to tolerate sudden exposure to lethal concentrations of
toxic solvents. We propose that P. putida S12 employs
ISS12 as a mutator element to generate diverse mutations to
swiftly adapt when confronted with severe adverse conditions.
 |
INTRODUCTION |
It has long been recognized that DNA in living organisms is not a
static entity. The process of continuous mutation of DNA enables
adaptation to changing environments, and it is a prerequisite for
evolution. It was generally accepted that this mutation and subsequent
arising of variant organisms is a spontaneous process that generates a
pool of genetically different individuals in a population under
nonselective conditions, from which under selective conditions the
individual(s) with beneficial mutation(s) will originate.
In 1943 Luria and Delbrück (1) were the first to experimentally
study the origin of phage-resistant Escherichia coli mutants that arose from a sensitive population if plated in the presence of
phage. They concluded, in favor of the spontaneous or
growth-dependent mutation hypothesis, that the mutation to
phage resistance was already generated in the population prior to
exposure to the phage. Work by Cairns et al. (2) did not
support this conclusion, providing evidence that mutation could also
originate from a more "directed" process, which occurred after
cells were put on selective plates. This type of mutation was named
adaptive (3) or stationary phase mutation (4) and is observed in non-
or slow growing populations of bacteria and yeasts (5) subjected to
nonlethal stress.
Adaptive mutation is generally screened for by reversion of specific
mutations in genes that bring about an auxotrophy. It was shown that
adaptive mutation is a stress-inducible mechanism that involves
transient genome-wide hypermutation of a subpopulation of cells,
so-called mutators (6-9). Mutator strains are thought to be
DNA-mismatch repair-deficient strains (10) that generate mutations at
high frequency (11), creating diversity in a population and thereby
increasing the chance for survival under unfavorable conditions.
Most investigations that study spontaneous and adaptive mutations
employ reversion systems and thus exclude a possible role of insertion
sequence elements. However, these elements could provide an important
mechanism for swift genetic adaptation, because they move through the
genome (in-) activating genes and introducing genomic rearrangements
(12-14).
In 1983 Chao et al. (15) provided the first evidence that
transposable elements may act as mutator genes conferring evolutionary advantage under chemostat culturing conditions. In competition experiments using an E. coli strain with and without
transposon Tn10, it was found that the Tn10
strains win, if present at a starting ratio above 10 4.
Additionally, it was found that the winning Tn10 strains had a transposition to a new, undetermined site. It was concluded that
Tn10 conferred advantage by increasing the mutation rate of
the host bacterium. More recently it was shown that insertion sequence
elements play an important role in genetic adaptation of E. coli under starving conditions (16).
Here we address the role of a newly discovered insertion sequence in
genetic adaptation to sudden lethal solvent stress. It resides
naturally in the genome of the solvent-tolerant bacterium Pseudomonas putida S12.
Solvent-tolerant bacteria are quite extraordinary organisms able to
grow in the presence of a separate phase of solvents like toluene. In
normal bacteria these solvents accumulate within a few minutes (17) in
the membranes of cells to concentrations that destabilize the lipid
order and bilayer stability (18), thus destroying structural and
functional properties. In solvent-tolerant bacteria two major
adaptational responses have been found that counterbalance these
effects. The first mechanisms deal with structural changes of the
(outer) membranes (19-23) that bring about a less permeable barrier to
solvents. The second mechanism is an extrusion system that transports
solvents from the inner membrane out of the cell (17, 24-30). In
P. putida S12, the srpABC genes encode such a
solvent efflux pump responsible for the extrusion of uncharged lipophilic compounds like toluene (25).
Both adaptational responses occur after exposure to nonlethal inducing
amounts of toluene (pre-adaptation). In this way, all cells in the
population are prepared to survive even a separate phase of the solvent
(1% v/v). This solvent-tolerant phenotype is rapidly lost when
incubated in the absence of toluene. If toluene (1% v/v) is added
shock-wise to cells that are not pre-adapted, then lysis of cells
occurs. Surprisingly, a few cells in the population were consistently
found to survive such a shock (26, 31-33). These surviving individuals
eventually grew to a high density in the presence of a separate phase
of the solvent. Contrary to pre-adapted cells, such a population
maintained its toluene-tolerant phenotype after prolonged incubation
without toluene (32), suggesting a transition into a solvent-tolerant
genetic variant.
In this study we show that the insertion sequence ISS12 is
responsible for the emergence of this genetic variant. The dynamics of
transposition and the underlying mechanism of solvent tolerance is
uncovered, and the possible strategy of P. putida S12 to
employ ISS12 as a mutator element to maintain a
subpopulation of genetic variants preconditioned for extremely adverse
conditions is discussed.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Media, and Growth of Strains--
P.
putida S12 (34) is the wild-type strain and P. putida
S12PT is a variant of P. putida S12, growing after sudden
addition of 1% (v/v) toluene that carries one extra copy of insertion
sequence ISS12 in srpS. P. putida JK1 is
derived from P. putida S12 by transposon mutagenesis and
carries a kanamycin resistance cassette in its genomic DNA in a stable
fashion (25). P. putida S12 (pKRZ-srp) and P. putida S12PT (pKRZ-srp) are the respective transformants of
P. putida S12 and P. putida S12PT that carry the
pKRZ-srp promoter-probe plasmid. This plasmid contains the promoterless
lacZ gene downstream of the srp promoter (24).
P. putida JK1CAM is a chloramphenicol-resistant mutant of
P. putida S12 from which insertion sequence ISS12
was first isolated by PCR1
amplification. E. coli strain DH5 (supE44
lacU169 ( 80 lacZ M15) hsdR17 recA1 endA1 gyrA96
thi-1 relA1) was used for amplification of
recombinant plasmids according to standard methods (35).
LB broth (35) was used as complete medium. Solid media contained 2% of
agar. Ampicillin (50 µg/ml) was added to maintain all plasmids in
E. coli. Kanamycin (50 µg/ml) was added to maintain plasmid pKRZ-srp in P. putida strains, and gentamicin (10 µg/ml) was added to maintain plasmids pJWB1, pJWsrpS, and
pJWsrpRS in P. putida strains. E. coli
and P. putida strains were grown at 37 °C and 30 °C, respectively.
Incubations--
Incubations in the presence of toluene were
carried out in airtight Boston bottles equipped with Mininert valves
(Phase Separations) in a horizontally shaking water bath at 30 °C.
The survival frequency in the presence of toluene was determined by
measuring the amount of colony-forming units (cfu), before and after
incubating cells, that were in the early exponential growth phase (an
optical density of 0.5 cm 1 at 600 nm), for 0.5 h in
the presence of a separate phase of toluene (1% v/v). The cell
viability was determined by plating 0.1-ml suitable dilutions in 0.9%
(w/v) saline on LB agar plates. The agar plates were incubated for
20 h.
For induction experiments 3 mM toluene was added to
cultures in the early exponential phase (an optical density of 0.3 cm 1 at 600 nm). Cells were allowed to grow to an optical
density of 1.5 cm 1 at 600 nm. Subsequently,
-galactosidase activity was determined by the method of Miller
(36), using chloroform and sodium dodecyl sulfate to
permeabilize the cells.
DNA Techniques, Plasmid Construction, and PCR Primers--
Total
genomic DNA from P. putida strains was prepared by the
hexadecyl trimethyl ammonium bromide (CTAB) procedure (37). Insert sequences were isolated from 0.7% agarose gels using the QIAEXII gel extraction kit (Qiagen). DNA digestions and ligations were
carried out using enzymes purchased from Life Technologies and applied
according to the supplier's recommendations. Plasmid DNA was isolated
by the alkaline-sodium dodecyl sulfate lysis method of Birnboim and
Doly (38). For DNA hybridizations, total DNA of different P. putida strains was digested, separated by agarose gel
electrophoresis, and transferred to nylon filters according to standard
protocols (35). Hybridizations were done using the nonradioactive DIG
DNA labeling and detection kit (Roche Molecular Biochemicals) according
to the manufacturer's recommendations. PCR reaction for amplifying the
DNA region in P. putida JK1CAM containing insertion sequence
ISS12 was performed using Pwo DNA polymerase (Roche
Molecular Biochemicals) with high fidelity DNA synthesis. The DNA
amplification reaction was set up according to the manufacturer's
protocol, using primers 1 and 2 (see "PCR primers"). Sequencing of
purified double-stranded plasmid DNA was accomplished using AmpliTaq FS
DNA fluorescent dye terminator reactions (PerkinElmer Life Sciences) in
a Gene Amp PCR system 9600 (PerkinElmer Life Sciences). Sequencing
products were detected using an Applied Biosystems 373A
stretch-automated DNA sequencer (Applied Biosystems Inc.). Nucleotide
and protein sequence analysis was carried out with the National Center
for Biotechnology Information BLAST server (39). Plasmids pGEM-7Zf(+)
and pGEM-T Easy (Promega) were used as the cloning vector for genomic
DNA and PCR-amplified DNA, respectively. Plasmid pJWB1 is an E. coli-Pseudomonas shuttle vector obtained after
replacement of the lacZ portion of pUCP22 (40) by the
multiple cloning site from pGEM7-Zf(+) (Promega) flanked by a
restriction site of SfiI and NotI. PJWB1 was used for cloning srpS and srpRS as follows: DNA
fragments containing the srpS and srpRS genes,
including the 5'-noncoding region, were obtained after PCR
amplification of these regions from total P. putida S12 DNA
using primers 3 and 4 (srpS) and 3 and 5 (srpRS). Both PCR-amplified fragments were flanked by a restriction site of
KpnI and NotI and were ligated in pJWB1 cut with
KpnI and NotI to give rise to plasmids
pJWsrpS and pJWsrpRS. Plasmid DNA was introduced
in P. putida strains or E. coli DH5 by
electroporation (41) using a Gene Pulser (Bio-Rad Laboratories).
PCR primers (from 5' to 3'), with relevant restriction sites
underlined are: 1, CCCGGGTCAAGGAGGTGACTCATG; 2, CGCGGCCGCGATAATTCGCCACTTCAGTTCG; 3, GCGGGTACCGACGGGGGCTATTGCTGAATCG; 4, GCGGCGGCCGCCTAGGGAGCTTTCTTCGACGC; and 5, GCGGCGGCCGCTCACTCGAAGGATTTGACTTGC.
 |
RESULTS |
Characterization of ISS12--
ISS12 was isolated
from a chloramphenicol-resistant P. putida S12 mutant,
JK1CAM, that was shown to carry a 2.5-kb interruption of the gene
coding for the solvent-pump porin,
srpC.2 A 4-kb DNA
fragment containing the srpC gene with the interrupting DNA
was generated by PCR amplification with primers designed on both ends
of srpC.
The nucleotide sequence analysis of the interrupting DNA revealed a
2598-bp sequence with typical characteristics of an insertion sequence
(IS) element (Fig. 1). This sequence has
been submitted to the GenBankTM/EBI database (accession number
AF292393). The element was delimited by two perfect matching inverted
repeats of 14 bp (IR-L1/IR-R1) and 18 bp (IR-L2/IR-R2). Furthermore,
two open reading frames were found, orf1 and
orf2, that putatively encode proteins of 509 amino
acids (58,175 Da) and 251 amino acids (28,528 Da), respectively. These
amino acid sequences have extensive homology with those deduced from
orf1 and orf2 of IS1491,
isolated from Pseudomonas alcaligenes NCIB 9867 (Table
I) (42). Less, but significant homology
is observed with other IS elements that, like IS1491, belong
to the IS21 family of insertion sequences. In addition,
structural characteristics of ISS12 also reveal relationship with IS21 (Fig. 1) (14, 43). The reading frame of
orf2 is located in a relative reading phase of 1
compared with orf1, and both orfs are separated
by only 17 bp. Furthermore, orf1 reveals two motifs typical
of insertion sequences. The N terminus contains 25 amino acids that
have high probability of forming a helix-turn-helix configuration
capable of DNA binding and a so-called DDE triad. DDE motifs are found
in the catalytic domains of transposases of many bacterial elements and
integrases of retroviruses (45). The putative protein encoded by
orf2 contains well conserved potential nucleoside
triphosphate binding domains A and B (45).

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 1.
Nucleotide sequence of ISS12
from P. putida S12. The deduced amino acid
sequences of the encoded proteins are shown below the
nucleotide sequence. Left and right inverted repeat sequences
(IR-L, IR-R) are boxed, putative
ribosome-binding sites (RBS), are underlined,
putative RNA polymerase-binding sites ( 35 and 10
boxes) are in boldface and indicated with an
arrow, termination codons are indicated with an
asterisk, the Orf1 N-terminal amino acids, which form a
potential helix-turn-helix motif, are underlined by a
single line, the conserved DDE catalytic triad in Orf1 is
indicated with dots, and the nucleoside triphosphate binding
domains A and B in Orf2 are underlined by
double lines.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Identities and similarities of the putative proteins encoded by orf1
and orf2 from ISS12 with homologous proteins from most
related insertion sequences
|
|
Distribution of ISS12 in a P. putida S12 Population and the Effect
of a Solvent Shock--
The distribution of ISS12 over the
genome of P. putida S12 was determined, and the effect of a
toluene shock hereon was studied. For this purpose, chromosomal DNA was
isolated from an aliquot of P. putida S12 cells cultured in
LB to an optical density at 600 nm (A600)
of 0.5. Subsequently, 1% (v/v) toluene was added to the remainder of
the culture, killing approximately 99.99% of the cells within 30 min.
After 24-48 h, a culture had grown up and total DNA was isolated from
this population, designated as P. putida S12PT
(post-toluene). Both DNAs were digested with KpnI, which
does not cut in the DNA of ISS12. After separation by
agarose gel electrophoresis, the DNAs were transferred to nylon filters
and hybridized with an internal 650-bp DNA probe from ISS12
(Fig. 2). Lane 1 shows the
hybridization pattern of DNA from P. putida S12 cells before
the toluene shock. Here seven distinct hybridizing DNA fragment ranging
from 3.5 to 10 kb are visible, indicating that at least seven copies of
ISS12 are dispersed over the genome of P. putida
S12. In lane 2 the result with P. putida S12PT
DNA is shown. Here an extra hybridizing DNA fragment of approximately 9 kb is visible, indicating transposition of ISS12.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Analysis of total DNA from P. putida S12 growing before and after a 1% (v/v) toluene
shock. Both DNAs were isolated from the culture, digested with
KpnI and analyzed by Southern hybridization with a 0.7-kb
DNA fragment from ISS12 as the probe. Lanes 1 and
2 show the hybridization patterns of P. putida
S12 before and after the toluene shock, respectively.
|
|
This result strongly suggested that individuals of a P. putida S12 population that carry an extra copy of ISS12
in a particular location in the genome are more tolerant of a toluene shock.
To investigate this, exponentially growing unadapted P. putida S12 cells were exposed for 30 min to 1% toluene and
subsequently an aliquot was spread on LB agar. Only 0.004% of the
plated cells had survived to form colonies. DNA was isolated from 15 individual colonies and analyzed for the distribution of
ISS12 as described for P. putida S12 and S12PT.
The hybridization pattern of 1 DNA resembled that of the wild-type
P. putida S12, whereas the pattern of 14 DNAs was identical
to P. putida S12PT DNA (data not shown).
We further tested the correlation between transposition and solvent
tolerance by comparing the survival frequency of both P. putida S12 and S12PT after sudden addition of 1% (v/v)
toluene. It was found that approximately 0.004% of the P. putida S12 and 5% of the P. putida S12PT cells
survived the shock, a 1000-fold increase of survival frequency.
Phenotypic and Genotypic Dynamics of the P. putida S12PT
Population--
The stability of both genotype and phenotype of a
P. putida S12PT population was tested during prolonged
cultivation in LB medium in two different ways. In the first approach
the growth experiment was started with an inoculum from P. putida S12PT that had emerged from wild-type P. putida
S12 after a toluene shock. This P. putida S12PT population
was possibly not genetically homogeneous, because there was a chance
that wild-type cells were also present. DNA was isolated from the
culture after 13, 26, 39, 52, 65, 78, 91, and 104 generations of growth
after inoculation. Southern hybridization on these DNAs was performed
with an ISS12-derived probe after digestion with
KpnI (Fig. 3A).
After 91 generations the extra ISS12 insertion could no
longer be detected and the hybridization pattern resembled that of
wild-type P. putida S12. In addition, the tolerance for a
toluene shock decreased to wild-type levels after 104 generations (data
not shown).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Genetic stability of P. putida
S12PT. Southern analysis of total DNA obtained from cultures
inoculated with an aliquot of P. putida S12PT population
growing after a solvent shock (A) or a pure P. putida S12PT colony (B). Both cultures were submitted
to prolonged cultivation in the absence of toluene by repeated transfer
into fresh medium. Total DNA was isolated at several instances during
cultivation, digested with KpnI, and hybridized with a
0.7-kb DNA fragment from ISS12 as the probe. Numbers
above the lanes indicate generations of growth after inoculation.
Arrows indicate the extra ISS12 insertion.
|
|
In the second approach we started the growth experiment with a pure
P. putida S12PT clone (genetically homogeneous) and
monitored the presence of the extra ISS12 copy during ~104
generations of cultivation (Fig. 3B). Now we found that the
extra copy remained present in the population and the tolerance for a
toluene shock remained high (data not shown). This result indicated
that the extra ISS12 insertion is not readily lost from the
genome, suggesting that the disappearance of the P. putida
S12PT genotype in the first approach was due to out-competition by
wild-type P. putida S12 cells that most probably were
initially present as a minority in the starting culture.
It was further investigated if wild-type P. putida S12 has a
selective advantage over P. putida S12PT in competition
experiments. To facilitate discrimination between the different strains
P. putida S12 containing a kanamycin marker, P. putida JK1 (25), was employed as the reference. Exponentially
growing cells of both P. putida JK1 and P. putida
S12PT were mixed and allowed to grow for 100 generations. Both the
starting and end ratios of the two different strains were determined by
plating suitable dilutions of the mixtures on LB agar with and without
kanamycin and comparing the cfu counts on both plates. P. putida JK1 and P. putida S12PT were mixed to a starting
ratio of 1 (P. putida JK1:P. putida S12PT, 1:1).
In this mixture P. putida JK1 had overgrown P. putida S12PT, because no significant differences were found in cfu
counts between both types of plates. To obtain a more accurate measure
of the competition advantage of P. putida JK1, a starting ratio of 0.001 (P. putida JK1:P. putida S12PT,
1:1000) was chosen. Here it was found that the share of P. putida JK1 in the cell mixture had increased 50-fold. In a control
experiment a mixture of P. putida S12 and P. putida JK1 was also tested. Here both strains were mixed to a
starting ratio of 1. The end ratio showed that the share of P. putida JK1 had declined by a factor 7, indicating a competitive
advantage of the wild-type P. putida S12 over the reference strain.
These results clearly indicate that P. putida S12 has a
competitive advantage over P. putida S12PT under these
nonselective conditions.
Nucleotide Sequence Analysis of the Region Adjacent to the Extra
ISS12 Copy in P. putida S12PT--
The exact location of integration
of the extra ISS12 copy in P. putida S12PT was
determined (Fig. 4). For this purpose
this copy was isolated from BglII-digested total DNA from
P. putida S12PT on a 9-kb DNA fragment and cloned. The
nucleotide sequence of the DNA-region flanking ISS12 was
determined using primers specific for either end of ISS12.
Screening for similar nucleotide sequences in the GenBankTM/EBI
database revealed a 100% match with the gene srpS
(GenBankTM/EBI accession number AF061937), which is located 223 bp
upstream of the genes for the solvent resistance pump
srpABC. srpS forms a gene cluster,
srpRS, with the downstream-located srpR (Fig. 4).
Sequence similarity studies revealed that both genes putatively encode
regulatory proteins involved in control of srpABC expression
(not shown).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Schematic representation of insertion of
ISS12 in the srpS gene in P. putida S12PT. Nucleotide sequences adjacent to the left
and right terminal IR-L1 and IR-R1 are boxed.
|
|
Two nucleotides adjacent to the left inverted repeat IR-L and six
nucleotides adjacent to IR-R could not be assigned to either ISS12 or srpS.
To verify that the extra insertion of ISS12 in the 14 toluene shock-surviving individuals was also confined to this gene. Southern analysis was performed on their DNAs. The DNAs were digested with PstI and SacI, which cut at either end of
the srpS gene (Fig. 4) and do not cut ISS12.
Hybridization with an internal DNA probe from ISS12 yielded
a 3.4-kb hybridizing band, which was absent in wild-type P. putida S12 (result not shown), reflecting integration of the
insertion element (2.6 kb) in srpS (0.8 kb).
srpABC Promoter Activity in P. putida S12PT--
We
anticipated that the direct cause for increased solvent
tolerance in P. putida S12PT was the disruption of the
putative pump regulator srpS. To support this hypothesis, we
introduced promoter probe vector pKRZ-srp (24) into P. putida S12 and S12PT. In this plasmid, the promoter region of
srpABC is fused to the promoterless lacZ gene.
Both strains were cultivated either in the presence or absence of 3 mM toluene to the late exponential phase. We chose to use 3 mM toluene, because it was shown previously that this
amount induced the expression of the lacZ gene in
pKRZ-srp significantly, without affecting the growth of
P. putida S12 (24). It was shown that -galactosidase
activity in P. putida S12PT transformant was approximately
7-fold higher than in the P. putida S12 transformant in the
absence of toluene. If grown in the presence of toluene,
-galactosidase activity had increased 10-fold in the P. putida S12 transformant and 1.5-fold in P. putida S12PT transformant reaching comparable levels in both strains (Table II). These results show that the basal
level of srp promoter activity is markedly higher in
P. putida S12PT and can only be matched in the wild-type
strain after toluene induction. This finding suggests that the
tolerance of P. putida S12 PT for a sudden toluene shock is
based on constitutive, relatively high expression of the solvent pump
and that, the other way around, the sensitivity of the wild-type strain
is due to a lack of pump in the membrane at the instant of exposure. To
test this hypothesis, the survival frequency of toluene-induced
P. putida S12 was determined. Cells were grown to an
A600 of 0.5 in the presence of 3 mM
toluene and subsequently diluted 1 to 5 into medium with 5 mM toluene. At an A600 of 0.5, 1%
(v/v) toluene was added and dilutions of the culture were spread on LB
agar. Approximately 5% of the cells survived to form colonies, which
is comparable to the survival frequency observed with "uninduced"
P. putida S12PT. The DNAs of 15 surviving colonies were
analyzed for distribution of ISS12. It was found that none
contained an extra insertion (data not shown) and that toluene
tolerance was lost within 10 generations of nonselective growth.
View this table:
[in this window]
[in a new window]
|
Table II
Induction of -galactosidase expression in P. putida S12 (pKRZ-srp)
and P. putida S12PT (pKRZ-srp) cultured in the presence or absence of
toluene
|
|
Complementation of P. putida S12PT--
The increased level of
solvent pump-promoter activity in P. putida S12PT suggested
that the most plausible explanation for toluene tolerance of this
strain is the interruption of srpS. This would imply that
complementation with the intact regulatory region would result in an
increased sensitivity. To prove this, P. putida S12PT was
transformed with plasmids pJWsrpS and pJWsrpRS, containing srpS and srpRS, respectively. The
latter plasmid was also tested, because transcription of
srpR is also likely to be impeded by the ISS12
insertion as srpS and R share a mutual upstream nontranslated region. The tolerance of transformants for a sudden shock
of toluene was compared with P. putida S12PT transformed with empty plasmid pJWB1 (Table III). It
was shown that sensitivity was dramatically increased in P. putida S12PT only if complemented with both srpR and
S.
 |
DISCUSSION |
Insertion sequences have been shown to be important for genomic
plasticity of certain bacteria. Over 500 bacterial insertion sequences
have been characterized at the nucleotide sequence level (14), and in
the literature many examples of insertion sequences can be found that
are involved in activation of neighboring genes, inactivation of genes
by interruption, and rearrangement of their hosts genome (12-14).
However, the role of these elements in genetic adaptation and the
dynamics of transposition in changing environments have hardly
been studied.
We show here that P. putida S12 under sudden lethal
conditions is able to produce a genetic variant, by means of
ISS12, enabling the bacterium to survive. In the variant
P. putida S12PT, the underlying mechanism of toluene shock
survival appears to be the up-regulation of the srpABC
genes. This would imply that the region in which ISS12 is
inserted is involved in repression of srpABC. It could still
be argued that the structural change of the DNA upstream of the
srpABC genes resulting from the ISS12 insertion also influences the expression accounting for (part of) the toluene tolerance. However, complementation with intact srpRS genes
showed a dramatic decrease of toluene tolerance, proving that
structural factors did not play an important role. Because
complementation with srpS alone did not result in a
decreased tolerance, we propose that both srpR and
S are needed for effective repression of the srpABC genes. It goes without saying that more detailed
experiments concerning these genes and possibly other are needed for a
complete picture of the regulation of the solvent pump genes.
We showed that in P. putida S12PT, activation of the
srp promoter is up-regulated in the absence of toxic
solvents and we hypothesize for this reason that the high survival
frequency of this variant is due to the fact that it is already
prepared to deal with sudden solvent stress. Isken and De Bont (17)
measured accumulation of 14C-labeled toluene in the
membrane of P. putida S12. Using 4 mM of the
solvent, which is below the saturating concentration (6 mM)
but toxic to the cells, they found maximum accumulation in the membrane
within 10 min of incubation. More recently, Kieboom et al.
(24) found that maximum activation of the srp promoter in
P. putida S12 by toluene occurred 200 min after addition of the solvent. After ~60 min, activation reached 50% of the maximum. These findings indicate that a lack of time to engage the principal defense mechanism against sudden solvent stress is the main reason that
over 99.99% of a P. putida S12 population is killed upon a
toluene shock. The solvent shock tolerant nature of this species lies
in the presence of the extra copy of ISS12 in the
srpS gene in a small minority of its population.
It is highly unlikely that transposition of ISS12 occurs in
response to the toluene shock. This is simply because the
toluene will have had its killing effect before the SrpABC pump
is in operation. Indeed, we found that pre-adaptation to nonlethal
amounts of toluene led to a high survival frequency of P. putida S12 after subsequent addition of 1% of the solvent,
without ISS12 transposition. From the above it follows that
the variant, to survive, must be present before the toluene shock.
Thus, under normal conditions P. putida S12 always maintains
a subpopulation, accounting for at least 0.004% of the whole
population, that carries ISS12 inserted in
srpS.
From our results it also becomes clear that mutation by
ISS12 is a more important mechanism than other
growth-dependent mutations, like point mutations,
frameshifts, deletions, or others, that could lead to inactivation of
srpS and subsequent toluene shock survival. This suggests
that ISS12 is a mutator element that is employed by the
bacterium to maintain subpopulations of preconditioned cells.
 |
ACKNOWLEDGEMENTS |
We thank Harald Ruijssenaars for helpful
discussions and Jim Field for comments on the manuscript.
 |
FOOTNOTES |
*
Supported by Grant BIO4-CT97-2270 from the European
Commission.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF292393.
¶
Present address: Dept. of Molecular Cell Physiology, Faculty
of Biology, Free University, De Boelelaan 1087, NL-1081 HV Amsterdam, The Netherlands.
Present address: Friesland Coberco Dairy Foods, Corporate
Research, P. O. Box 87, 7400 AB Deventer, The Netherlands.
§
To whom correspondence should be addressed: Present address:
Friesland Coberco Dairy Foods, Corporate Research, P. O. Box 87, 7400 AB Deventer, The Netherlands. Tel.: 31-317-484-980; Fax: 31-317-484-978; E-mail j.wery@fcdf.nl.
Published, JBC Papers in Press, November 27, 2000, DOI 10.1074/jbc.M007687200
2
J. Wery, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
PCR, polymerase
chain reaction;
cfu, colony-forming unit(s);
kb, kilobase(s);
IS, insertion sequence;
bp, base pair(s).
 |
REFERENCES |
| 1.
|
Luria, S. E.,
and Delbrück, M.
(1943)
Genetics
28,
491-511
|
| 2.
|
Cairns, J.,
Overbaugh, J.,
and Miller, S.
(1988)
Nature
335,
142-145
|
| 3.
|
Foster, P. L.
(1993)
Annu. Rev. Microbiol.
47,
467-504
|
| 4.
|
Rosenberg, S. M.,
Thulin, C.,
and Harris, R. S.
(1998)
Genetics
148,
1559-1566
|
| 5.
|
Hall, B. G.
(1998)
Genetica
102/103,
109-125
|
| 6.
|
Hall, B. G.
(1990)
Genetics
126,
5-16
|
| 7.
|
Torkelson, J.,
Harris, R. S.,
Lombardo, M.-J.,
Nagendran, J.,
Thulin, C.,
and Rosenberg, S. M.
(1997)
EMBO J.
16,
3303-3311
|
| 8.
|
Rosche, W. A.,
and Foster, P. L.
(1999)
Proc. Natl. Acad Sci. U. S. A.
96,
6862-6867
|
| 9.
|
McKenzie, G. J.,
Harris, R. S.,
Lee, P. L.,
and Rosenberg, S. M.
(2000)
Proc. Natl. Acad Sci. U. S. A.
97,
6646-6651
|
| 10.
|
Harris, R. S.,
Feng, G.,
Ross, K. J.,
Sidhu, R.,
Thulin, C.,
Longerich, S.,
Szigety, S. K.,
Winkler, M. E.,
and Rosenberg, S. M.
(1997)
Genes Dev.
11,
2426-2437
|
| 11.
|
Longerich, S.,
Galloway, A. M.,
Harris, R. S.,
Wong, C.,
and Rosenberg, S. M.
(1995)
Proc. Natl. Acad Sci. U. S. A.
92,
12017-12020
|
| 12.
|
Gala, D. J.,
and Chandler, M.
(1989)
in
Mobile DNA
(Berg, D. E.
, and Howe, M. M., eds)
, pp. 109-162, American Society for Microbiology, Washington, DC
|
| 13.
|
Kleckner, N.,
Chalmers, R. M.,
Kwon, D.,
Sakai, J.,
and Bolland, S.
(1996)
in
Transposable Elements
(Saedler, H.
, and Gierl, A., eds)
, pp. 49-82, Springer-Verlag KG, Heidelberg, Germany
|
| 14.
|
Mahillon, J.,
and Chandler, M.
(1998)
Microbiol. Mol. Biol. Rev.
62,
725-774
|
| 15.
|
Chao, L.,
Vargas, C.,
Spear, B. B.,
and Cox, E. C.
(1983)
Nature
303,
633-635
|
| 16.
|
Hall, B. G.
(1999)
J. Bacteriol.
181,
1149-1155
|
| 17.
|
Isken, S.,
and De Bont, J. A. M.
(1996)
J. Bacteriol.
178,
6056-6058
|
| 18.
|
Weber, F. J.,
and De Bont, J. A. M.
(1996)
Biochim. Biophys. Acta
1286,
225-245
|
| 19.
|
Heipieper, H.-J.,
Weber, F. J.,
Sikkema, J.,
Keweloh, H.,
and De Bont, J. A. M.
(1994)
Trends Biotechnol.
12,
409-415
|
| 20.
|
Sikkema, J.,
De Bont, J. A. M.,
and Poolman, B.
(1995)
Microbiol. Rev.
59,
201-222
|
| 21.
|
Li, L.,
Komatsu, T.,
Inoue, A.,
and Horikoshi, K.
(1995)
Biosci. Biotechnol. Biochem.
59,
2358-2359
|
| 22.
|
Pinkart, H. C.,
Wolfram, J. W.,
Rogers, R.,
and White, D. C.
(1996)
Appl. Environ. Microbiol.
62,
1129-1132
|
| 23.
|
Ramos, J.-L.,
Duque, E.,
Rodriguez-Herva, J. J.,
Godoy, P.,
Haïdour, A.,
Reyes, F.,
and Fernandez-Barrero, A.
(1997)
J. Biol. Chem.
272,
3887-3890
|
| 24.
|
Kieboom, J.,
Dennis, J. J.,
Zylstra, G. J.,
and De Bont, J. A. M.
(1998)
J. Bacteriol.
180,
6769-6772
|
| 25.
|
Kieboom, J.,
Dennis, J. J.,
De Bont, J. A. M.,
and Zylstra, G. J.
(1998)
J. Biol. Chem.
273,
85-91
|
| 26.
|
Kim, K.,
Lee, L.,
Lee, K.,
and Lim, D.
(1998)
J. Bacteriol.
180,
3692-3696
|
| 27.
|
Li, X.-Z.,
Zhang, L.,
and Poole, K.
(1998)
J. Bacteriol.
180,
2987-2991
|
| 28.
|
Ramos, J. L.,
Duque, E.,
Godoy, P.,
and Segura, A.
(1998)
J. Bacteriol.
180,
3323-3329
|
| 29.
|
Fukumori, F.,
Hirayama, H.,
Takami, H.,
Inoue, A.,
and Horikoshi, K.
(1998)
Extremophiles
2,
395-400
|
| 30.
|
Mosqueda, G.,
and Ramos, J.-L.
(2000)
J. Bacteriol.
182,
937-943
|
| 31.
|
Cruden, D. L.,
Wolfram, J. H.,
Rogers, R. D.,
and Gibson, D. T.
(1992)
Appl. Environ. Microbiol.
58,
2723-2729
|
| 32.
|
Weber, F. J.,
Ooijkaas, L. P.,
Schemen, R. M. W.,
Hartmans, S.,
and De Bont, J. A. M.
(1993)
Appl. Environ. Microbiol.
59,
3502-3504
|
| 33.
|
Huertas, M.-J.,
Duque, E.,
Marques, S.,
and Ramos, J.-L.
(1998)
Appl. Environ. Microbiol.
64,
38-42
|
| 34.
|
Hartmans, S.,
Van der Werf, M. J.,
and De Bont, J. A. M.
(1990)
Appl. Environ. Microbiol.
56,
1347-1351
|
| 35.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 36.
|
Miller, J. H.
(1972)
Experiments in Molecular Genetics
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 37.
|
Ausubel, F. M.,
Brent, R.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1991)
Current Protocols in Molecular Biology
, Greene Publishing Associates, New York
|
| 38.
|
Birnboim, H. C.,
and Doly, J.
(1979)
Nucleic Acids Res.
7,
1513-1523
|
| 39.
|
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410
|
| 40.
|
West, S. E. H.,
Schweizer, H. P.,
Dall, C.,
Sample, A. K.,
and Runyen-Janecky, L. J.
(1994)
Gene
128,
81-86
|
| 41.
|
Dennis, J. J.,
and Sokol, P. A.
(1995)
Methods Mol. Biol.
47,
125-133
|
| 42.
|
Yeo, C. C.,
Wong, D. T. S.,
and Poh, C. L.
(1998)
Plasmid
89,
187-195
|
| 43.
|
Haas, D.,
Berger, B.,
Schmid, S.,
Seitz, T.,
and Reihmann, C.
(1996)
in
Molecular Biology of Pseudomonads
(Nakazawa, T., ed)
, pp. 238-249, ASM Press, Washington, DC
|
| 44.
|
Katz, R. A.,
and Skalka, A. M.
(1994)
Annu. Rev. Biochem.
63,
133-173
|
| 45.
|
Solinas, F.,
Marconi, A. M.,
Ruzzi, M.,
and Zennaro, E.
(1995)
Gene
155,
77-82
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J.-P. Meijnen, J. H. de Winde, and H. J. Ruijssenaars
Engineering Pseudomonas putida S12 for Efficient Utilization of D-Xylose and L-Arabinose
Appl. Envir. Microbiol.,
August 15, 2008;
74(16):
5031 - 5037.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. H. Moonen, N. M. Kamerbeek, A. H. Westphal, S. A. Boeren, D. B. Janssen, M. W. Fraaije, and W. J. H. van Berkel
Elucidation of the 4-Hydroxyacetophenone Catabolic Pathway in Pseudomonas fluorescens ACB
J. Bacteriol.,
August 1, 2008;
190(15):
5190 - 5198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. P. Wierckx, H. Ballerstedt, J. A. M. de Bont, J. H. de Winde, H. J. Ruijssenaars, and J. Wery
Transcriptome Analysis of a Phenol-Producing Pseudomonas putida S12 Construct: Genetic and Physiological Basis for Improved Production
J. Bacteriol.,
April 15, 2008;
190(8):
2822 - 2830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Tourasse, F. B. Stabell, L. Reiter, and A.-B. Kolsto
Unusual Group II Introns in Bacteria of the Bacillus cereus Group
J. Bacteriol.,
August 1, 2005;
187(15):
5437 - 5451.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Ramos, M. Martinez-Bueno, A. J. Molina-Henares, W. Teran, K. Watanabe, X. Zhang, M. T. Gallegos, R. Brennan, and R. Tobes
The TetR Family of Transcriptional Repressors
Microbiol. Mol. Biol. Rev.,
June 1, 2005;
69(2):
326 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rojas, A. Segura, M. E. Guazzaroni, W. Teran, A. Hurtado, M. T. Gallegos, and J. L. Ramos
In Vivo and In Vitro Evidence that TtgV Is the Specific Regulator of the TtgGHI Multidrug and Solvent Efflux Pump of Pseudomonas putida
J. Bacteriol.,
August 15, 2003;
185(16):
4755 - 4763.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rojas, E. Duque, G. Mosqueda, G. Golden, A. Hurtado, J. L. Ramos, and A. Segura
Three Efflux Pumps Are Required To Provide Efficient Tolerance to Toluene in Pseudomonas putida DOT-T1E
J. Bacteriol.,
July 1, 2001;
183(13):
3967 - 3973.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|