|
Originally published In Press as doi:10.1074/jbc.M009492200 on November 22, 2000
J. Biol. Chem., Vol. 276, Issue 8, 5739-5744, February 23, 2001
brp and blh Are Required for Synthesis of
the Retinal Cofactor of Bacteriorhodopsin in Halobacterium
salinarum*
Ronald F.
Peck ,
Carlos
Echavarri-Erasun§,
Eric A.
Johnson§¶,
Wailap Victor
Ng ,
Sean P.
Kennedy**,
Leroy
Hood ,
Shiladitya
DasSarma**, and
Mark P.
Krebs 
From the Department of Biomolecular Chemistry,
University of Wisconsin Medical School, Madison, Wisconsin 53706, § Department of Food Microbiology and Toxicology and
¶ Department of Bacteriology, University of Wisconsin, Madison,
Wisconsin 53706, ** Department of Microbiology, University of
Massachusetts, Amherst, Massachusetts 01003, and Institute
for Systems Biology, Seattle, Washington 98105
Received for publication, October 18, 2000, and in revised form, November 22, 2000
 |
ABSTRACT |
Bacteriorhodopsin, the light-driven proton
pump of Halobacterium salinarum, consists of the membrane
apoprotein bacterioopsin and a covalently bound retinal cofactor. The
mechanism by which retinal is synthesized and bound to bacterioopsin
in vivo is unknown. As a step toward identifying cellular
factors involved in this process, we constructed an in-frame deletion
of brp, a gene implicated in bacteriorhodopsin biogenesis.
In the brp strain, bacteriorhodopsin levels are
decreased ~4.0-fold compared with wild type, whereas bacterioopsin
levels are normal. The probable precursor of retinal, -carotene, is
increased ~3.8-fold, whereas retinal is decreased by ~3.7-fold.
These results suggest that brp is involved in retinal synthesis. Additional cellular factors may substitute for
brp function in the brp strain because
retinal production is not abolished. The in-frame deletion of
blh, a brp paralog identified by analysis of
the Halobacterium sp. NRC-1 genome, reduced
bacteriorhodopsin accumulation on solid medium but not in liquid.
However, deletion of both brp and blh abolished
bacteriorhodopsin and retinal production in liquid medium, again
without affecting bacterioopsin accumulation. The level of -carotene
increased ~5.3-fold. The simplest interpretation of these results is
that brp and blh encode similar proteins that catalyze or regulate the conversion of -carotene to retinal.
 |
INTRODUCTION |
Rhodopsins are integral membrane proteins containing seven
transmembrane -helices and a covalently bound molecule of retinal. Two distinct rhodopsin families are known: the visual rhodopsins, which
bind 11-cis retinal or related compounds and function as photoreceptors in vertebrates (1) and invertebrates (2), and the
archaeal rhodopsins, which bind all-trans-retinal and function as light-driven ion pumps and phototaxis receptors in archaea
(3). Archaeal rhodopsin orthologs have been found recently in bacteria
(4) and fungi (5), suggesting that retinal-based pigments are of
widespread significance. Despite their importance, the biogenesis of
these molecules is not fully understood. In particular, relatively
little is known about how retinal is assembled with the opsin
apoprotein in vivo. Thus, a goal in elucidating rhodopsin
biogenesis is to identify the cellular factors that mediate the
biosynthesis or uptake of retinal, the transport of retinal in the
cell, and the binding of retinal to the corresponding opsin.
To this end, we have studied the biogenesis of bacteriorhodopsin
(BR),1 a light-driven proton
pump in the archaeon Halobacterium salinarum. BR
consists of the membrane protein bacterioopsin (BO) and
all-trans-retinal. Under microaerobic conditions, BR is
induced ~50-fold (6) and forms a two-dimensional crystal known as the
purple membrane. This system has served as a model for studying key
steps in membrane protein biogenesis, including protein insertion into
the membrane (7, 8) and the assembly of protein-lipid complexes (9, 10). H. salinarum is genetically tractable, and the genome
sequence of a closely related organism, Halobacterium sp.
NRC-1, has been determined (11). Thus, the prospect of identifying the
cellular factors that mediate retinal assembly and other steps in BR
biogenesis in H. salinarum is excellent.
Retinal is synthesized de novo in H. salinarum
(12) and eventually binds BO to form BR. A pathway for retinal
biosynthesis has been proposed from studies of cell-free preparations
and by comparison with other carotenoid biosynthetic pathways (12). Intermediates in the pathway from the universal
C40-carotenoid precursor phytoene to -carotene have been
identified (12). -Carotene is thought to be the immediate precursor
of retinal, although there is no direct evidence for its conversion to
retinal in H. salinarum. Furthermore, the cellular factors
that catalyze this conversion are unknown. The addition of retinal to
BO to form BR has long been supposed to occur without the participation of cellular factors because BR can be regenerated from retinal and
purified BO in vitro (13, 14). However, cellular factors may
be required to prevent the photooxidation or photoisomerization of the
cofactor during its transport or binding to BO. These functions may be
mediated by a retinal-specific chaperone or by a multifunctional enzyme
that converts -carotene to retinal and transports or binds retinal
to BO.
As a first step to identify cellular factors that mediate these
processes, we chose to study the brp gene, which encodes a putative membrane protein (Brp) implicated in BR biogenesis (15-18). The brp gene is part of a gene cluster (Fig. 1) that
includes bop, which encodes BO; bat, which
encodes a trans-acting factor (Bat) that contains a region homologous
to the PAS domain of the oxygen sensor NifL (19, 20) and activates
bop expression under microaerobic conditions (21, 22); and
blp, a gene of unknown function (23). Insertions in
brp greatly decrease BR and bop mRNA levels
(15-18). This result can be interpreted to imply that Brp modulates
bop expression (18, 21). However, it has also been
recognized that the effect of brp insertions may be
attributable to an indirect effect on bat expression (18,
21). The bat gene is immediately downstream of
brp, and the termination and initiation codons of the two
genes overlap (Fig. 1). Northern blot analysis of brp
and bat mRNAs was interpreted as evidence for separate
transcripts, although cotranscription of the two genes was not excluded
(21). Thus, brp and bat may constitute an operon,
and insertions in brp may reduce bop expression
indirectly by a polar effect on bat transcription. In this
case, Brp may play a role in BR biogenesis other than regulating
bop expression, such as the biosynthesis, transport, or
binding of the retinal cofactor of BR.
To examine the role of Brp, we created an in-frame deletion of
brp using a recently developed ura3-based gene
knockout strategy (24). Analysis of BR, BO, and carotenoid accumulation
in the deletion strain suggests that Brp is essential for the
production of BR but not BO. Instead, brp appears to be
required for the synthesis of retinal from -carotene. Parallel
studies with blh, a paralog of brp identified
from the Halobacterium sp. NRC-1 genome sequence (11),
indicate that the blh gene product partially substitutes for
Brp. The implications of these findings for BR biogenesis and retinal
biosynthesis in H. salinarum are discussed.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Oligonucleotides were obtained from Operon
(Alameda, CA), Taq polymerase was obtained from Promega
(Madison, WI), and restriction endonucleases and ligase were obtained
from New England Biolabs (Beverly, MA). All other reagents were
obtained from Sigma.
Plasmid Construction--
Plasmids were propagated in the
Escherichia coli strain DH5 except where noted. A
two-step polymerase chain reaction (PCR) was performed to construct the
brp plasmid containing DNA homologous to brp
with an in-frame deletion of codons 33-308 and an 18-bp insertion at
the deletion site. In the first step, reactions were carried out
with the primer pairs GTGACGGACTTCACGGTTG and
CTGCTCGATCTCGATCTCAAGCGCGAGCAGTGACAG or
GAGATCGAGATCGAGCAGGTGCTCTGGCTGCTGTCC and GTGCGGCTACGAAATCAC using
Halobacterium sp. NRC-1 genomic DNA as template. The PCR products were used as a template in a second PCR step with the primers
GTGACGGACTTCACGGTTG and GTGCGGCTACGAAATCAC. The 293-bp BamHI fragment of the PCR product was combined with the
4.3-kbp BamHI fragment of pMPK414, which was constructed by
combining the 2.4-kbp KpnI-PstI fragment
containing brp from pMPK14 (25) with the 2.8-kbp
KpnI-PstI fragment of Litmus 28 (New England Biolabs). The resulting plasmid, pMPK417, contains the
brp construct with 0.6-kbp 5'-flanking DNA and 1.0-kbp
3'-flanking DNA. The 1.8-kbp KpnI-PstI fragment
of pMPK417 was combined with the 5.1-kbp KpnI-HindIII fragment of pMPK85 (9) and the
1.4-kbp NsiI-HindIII ura3 cassette
fragment of pMPK408 (24) to make pMPK421, which contains a
mevinolin-resistance determinant, the ura3 cassette, and the brp deletion.
To create a complementation strain containing brp at
the ura3 locus, the oligonucleotides TCTAGAGTAGATCT and
AGATCTACTCTAGA were annealed to create a duplex linker containing
XbaI and BglII restriction sites. The linker was
ligated into a partial PshAI digest of the
ura3 plasmid pMPK404 (24) to make pMPK423. The 2.0-kbp
AgeI-EcoRI fragment of pMPK423 was combined with
the 5.1-kbp HindIII-XmaI fragment of pMPK85 and
the 1.4-kbp HindIII-EcoRI fragment of pMPK408 to
make pMPK424, which contains the XbaI-BglII linker in place of ura3, the mevinolin-resistance
determinant and the ura3 cassette. The primers
TCTAGATCTAGAGTGACGGACTTCACGGTTG and
AGATCTAGATCTAAAAGCCGCGCCGGTTCATGGGACGTACCAGATGCC were used to
make a PCR product containing XbaI and BglII
restriction sites flanking brp. This PCR product was
digested with XbaI and BglII and ligated into the
XbaI-BglII fragment of pMPK424 (prepared from the
strain CSH26 dam ) to make pMPK425. In addition
to the brp open reading frame, pMPK425 contains 186 bp of
the brp upstream region to allow possible regulation similar
to the native locus and a 21-bp sequence derived from the
bop transcription terminator (26) to ensure the
transcription termination of brp.
The blh plasmid was constructed using the same PCR
strategy as described for making the brp deletion,
except that the primer pairs GTCGACGCGACGTTCTACAT and
CTGCTCGATCTCGATCTCACCGAGCACGAGGTAGAGG or
GAGATCGAGATCGAGCAGGTGCTGTGGTGGGCGGTA and GCCCATGATGTTCATCGACT were used with MPK1 genomic DNA as a template. The resulting PCR products were used as a template in PCR with the primer pair
GTCGACGCGACGTTCTACAT and GCCCATGATGTTCATCGACT. The 0.8-kbp
BamHI-NcoI fragment of the blh PCR
was combined with the 5.1-kbp BamHI-EcoRI
fragment of pMPK85 and the 1.2-kbp EcoRI-NcoI
fragment of pMPK408 to make pMPK427, which contains the
blh construct, the mevinolin-resistance determinant, and
the ura3 cassette.
H. salinarum Strain Construction--
The
brp::ISH27 strain (MPK8) is a spontaneous
mutant derived from MPK1 (6) on the basis of the loss of the purple
colony color, which was detected by illuminating colonies with 40-watt daylight fluorescent lamps for 2-3 days. All other H. salinarum strains were derived by using the ura3-based
gene replacement method (24). Briefly, strains were transformed as
described (6) with the plasmids described above and mevinolin-resistant transformants were replated on media containing 5-fluoroorotic acid to
obtain recombinants. Colonies resistant to 5-fluoroorotic acid
were screened by PCR to identify the desired recombinants. The
brp strain MPK417 was isolated by transforming pMPK421
into the ura3 strain MPK407 (24), the brp
complementation strain MPK420 was isolated by transforming pMPK425 into
MPK417, the blh strain MPK424 was isolated by
transforming MPK407 with pMPK427, and the
brp blh strain MPK423 was isolated by
transforming MPK417 with pMPK427. The structures of the brp,
blh, and ura3 loci were confirmed in all strains
by PCR and Southern blot analysis as described (6). The
sequences of the entire brp open reading frame and at least
120 bp of the flanking sequence of the brp strain MPK417
and the blh locus of the blh strain MPK424
were confirmed by ABI PRISM Big Dye Primer Cycle sequencing
(Applied Biosystems, Inc., Foster City, CA) using the primers
GTGACGGACTTCACGGTTG and GTGCGGCTACGAAATCAC plus GTCGACGCGACGTTCTACAT
and GCCCATGATGTTCATCGACT, respect-ively. Sequencing reactions
were analyzed with a 337XL automated DNA sequencer (Applied Biosystems,
Inc.) at the University of Wisconsin Biotechnology Center.
Induction and Preparation of Cell Lysates--
To induce BR
synthesis, 120 ml of peptone medium (27) in a 125-ml Erlenmeyer flask
were inoculated with 1.2 ml of saturated H. salinarum
culture and grown in the dark at 40 °C with shaking at 250 rpm for
96-100 h. Where noted, 30 µl of 10 mM retinal in isopropyl alcohol were added at ~14, 24, 38, 48, 62, and
72 h after culturing. At an OD660 of 0.70-0.85, the
cultures were harvested by centrifuging at 8000 × g
for 30 min at 4 °C. The cell pellet was resuspended in 100 ml of
basal salts and centrifuged again at 8000 × g for 30 min, followed by a brief spin to remove all traces of the supernatant.
Cells were lysed in 3.5 ml of 4 µg of DNase/ml, 0.5 mM
phenylmethylsulfonyl fluoride, and 0.025% sodium azide in water and
shaken for ~1 h at room temperature. Samples were purged with
nitrogen gas to minimize carotenoid oxidation.
Quantification of BR and BO--
To assess BR levels, cell
lysates were diluted 1:4 in 30 mM sodium phosphate buffer
(pH 6.9) containing 0.1% sodium azide and scanned in a Perkin-Elmer
2 spectrophotometer. The BR levels were determined by light-dark
difference spectroscopy as described (6) with a standard curve obtained
with purified BR added to a lysate from the bop strain
MPK412 (24). The BR levels were expressed as a percentage of total cell
protein as measured by the BCA assay (Pierce). The BO levels were
determined by immunoblotting with BR-114 monoclonal antibody generously
provided by Dr. H. G. Khorana. The blots were subsequently incubated
with fluorescein-conjugated -mouse IgG secondary antibody (Amersham
Pharmacia Biotech), and the BO levels were quantified on a Hitachi
FMBIOII Multi-View Fluoroimager. Purified BR was used to generate a
standard curve.
Extraction and Characterization of Carotenoids--
Total
carotenoid was extracted from cell lysates as described (28). Lysates
were illuminated for 3 min with a >520-nm light prior to extraction to
convert all retinal to the all-trans isomer. The extracts
were evaporated to dryness under nitrogen gas. To identify the major
carotenoid in brp strains, the extracts were fractionated
by HPLC on an HPLX solvent delivery system (Rainin Instrument Co.,
Inc., Emeryville, CA) coupled with a reverse phase Econosphere
C18 column (250 × 4.6 mm, 5-µm particle size) (Alltech Associates, Inc., Deerfield, IL) and an Alltech Econosphere C18 5-µm
guard column. The mobile phase was a gradient of solvent A (95%
methanol, 5% water) and solvent B (dichloromethane) eluting at 1 ml/min. The solvent change over a 25-min sample run was programmed as
follows: elution with 100% solvent A, 3 min; gradient to 32% solvent
B, 6 min; isocratic elution with 32% solvent B, 11 min; gradient to
100% solvent A, 1 min; and re-equilibration with 100% solvent A, 4 min. The eluate was monitored at 474 nm with a Dynamax UV-1 variable
wavelength UV/visible absorbance detector (Rainin Instrument Co.,
Inc.). HPLC fractions eluting at ~18 min were collected and
evaporated under nitrogen gas. The sample was resuspended in acetone to
a -carotene concentration of 10 µM. Mass spectrometry was performed at the University of Wisconsin Biotechnology Center on a
Bruker Biflex III MALDI-TOF instrument (Bruker Analytical Systems,
Billerica, MA) using 2,5-dihydroxybenzoic acid as a matrix.
For simultaneous measurement of -carotene and retinal, an identical
HPLC system was employed except that an Alltech Altima C18
column (250 × 4.6 mm, 5-µm particle size) was used and
the mobile phase consisted of a gradient of solvent A (95%
acetonitrile, 5% methanol) and solvent B (dichloromethane). The
solvent change over a 21-min sample run was programmed as follows:
elution with 100% solvent A, 8 min; gradient to 65% solvent B, 1 min;
isocratic elution at 65% solvent B, 7 min; gradient to 100% solvent
A, 1 min; and re-equilibration with 100% solvent A, 4 min. The eluate was monitored at 380 nm for the first 12 min and at 450 nm for the
remainder of each run. Standard curves were generated with commercial
-carotene and all-trans-retinal.
 |
RESULTS |
An Insertion in brp Eliminates BO Expression--
Earlier studies
of brp function relied on spontaneous insertions in
brp (Fig. 1). Because
insertions in brp might reduce bop expression
indirectly through a polar effect on bat, we reexamined the
role of brp in BR biogenesis. As a first step, we confirmed the phenotype of brp insertions by isolating a spontaneous
mutant from a laboratory strain of H. salinarum, MPK1 (6).
Unlike MPK1, which forms purple colonies, the mutant strain yielded
pale yellow colonies. PCR, Southern blot, and DNA sequence
analysis of the mutant strain (data not shown) revealed the presence of the insertion element ISH27 (16) at the third nucleotide position of
codon 177 in the brp open reading frame (Fig. 1). This
strain was designated brp::ISH27.

View larger version (6K):
[in this window]
[in a new window]
|
Fig. 1.
Structure of the bop gene
cluster. The bop, brp, bat, and blp open
reading frames are shown. Arrows indicate the direction of
transcription. The open reading frames of brp and
bat overlap as indicated. Closed triangles,
location of spontaneous insertions within the brp open
reading frame that abolish BR accumulation (15). Open
triangle, location of ISH27 in the brp::ISH27
strain.
|
|
To quantify the effects of the brp insertion on BR
accumulation, MPK1 and brp::ISH27 were grown
microaerobically to induce BR synthesis (27). Cells were grown in the
dark to prevent the differences in BR levels from affecting cell energy
states. Cell lysates from brp::ISH27 were
defective in the accumulation of BR, as evidenced by the loss of the
570 nm peak corresponding to BR (Fig.
2A). As quantified by
light-dark difference spectroscopy (6), BR was ~4% of the total cell
protein in the wild-type strain but was undetectable in the
brp::ISH27 strain (Fig. 2B). Immunoblotting of cell lysates with a BO C-terminal antibody revealed that brp::ISH27 lacked BO (Fig. 2, inset,
lane 2), indicating that the loss of BR was attributable to the
absence of BO. These results are consistent with the earlier findings
that insertions in brp abolish BR and bop
mRNA production (15, 16, 21). As acknowledged previously (21),
insertions in brp may prematurely abort an mRNA
transcript that encodes both Brp and Bat, thereby reducing
bat transcription and preventing bop
transcriptional activation.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
A, UV/visible spectra of cell lysates
from wild-type (dotted line) and
brp::ISH27 (solid line) strains. The
peak at 570 nm corresponds to BR. Cells were grown to stationary phase
to induce BR synthesis. Spectra of lysates were obtained at a total
cell protein concentration of ~3 mg/ml and normalized for slight
differences in protein concentration. B, light-dark
difference spectroscopy of wild-type (dotted line) and
brp::ISH27 (solid line) lysates.
Spectra were obtained from lysates dark-adapted for 12 h or
light-adapted for 5 min. A light-dark difference spectrum was
calculated, and the BR level was determined from the value at 587 nm.
Inset, immunoblot of wild-type (lane 1) and
brp::ISH27 (lane 2) cell lysates. Equal
amounts of total cell protein (4.0 µg) were electrophoresed and
immunoblotted with the C-terminal BR antibody, BR-114. The blot was
analyzed by incubating with a fluorescein-conjugated secondary antibody
and scanning with a fluoroimager.
|
|
In-frame Deletion of brp Reduces BR but Not BO--
To study
brp without the polar effects on bat, a strain
containing an in-frame deletion of brp was constructed. The
brp strain lacks codons 33-308 of the brp
open reading frame, which encodes a polypeptide of 359 amino acids.
After incubation under lights, brp colonies had a dark
orange color that was distinct from the purple color of wild type and
the pale yellow color of brp::ISH27. This result
suggested that the in-frame deletion reduced but did not abolish BR
accumulation. The UV/visible spectrum of cell lysates from the
brp strain revealed a reduced peak at 570 nm, confirming that BR levels are decreased compared with wild type (Fig.
3, solid and dotted
lines). By light-dark difference spectroscopy, the BR levels were
found to be ~4.0-fold lower than in the wild type (Fig.
4, samples 1 and
2). Unlike the brp::ISH27 strain, however, the brp strain had normal BO levels as
determined by quantitative immunoblotting (Fig. 3, inset,
lanes 1 and 2, and Fig. 4, samples 1 and 2). These results suggest that Brp does not regulate
bop expression and is instead involved in BR biogenesis at a
step between BO synthesis and BR formation, such as retinal biosynthesis, transport, or binding.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
UV/visible spectra of cell lysates from
wild-type (dotted line),
brp (solid line),
and brp ura3::brp complementation
strains (dashed line). The spectra shown are
normalized to total cell protein. Inset, immunoblot of
wild-type (lane 1), brp (lane 2),
and brp ura3::brp (lane
3) cell lysates. Equal amounts of total cell protein (4.0 µg)
were electrophoresed and immunoblotted with BR-114 antibody. The blot
was analyzed as described in Fig. 2.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Comparison of BR, BO,
-carotene, and retinal levels in wild-type
(sample 1), brp
(sample 2), brp
ura3::brp (sample
3), blh (sample
4), and
brp blh
(sample 5) strains. Cells were grown under
conditions to induce BR, and BR, BO, -carotene, and retinal levels
were determined as described in Experimental Procedures. All values are
an average of three independent determinations, and the error
bars indicate 1 S.D.
|
|
brp Deletion Increases -Carotene and Decreases Retinal
Levels--
In addition to the reduced peak at 570 nm, the
UV/visible spectra of brp cell lysates revealed three
prominent peaks between 400 and 500 nm that were absent from the wild
type (Fig. 3, solid and dotted lines). This
suggested that brp had higher levels of -carotene,
which is thought to be the precursor of retinal in H. salinarum (12). To test this possibility, carotenoid was extracted
from the wild-type and brp cell lysates using a method that recovers >80% of the retinal bound to BR (28). The extracts were
fractionated with HPLC to quantify -carotene and retinal (Fig.
5). The species eluting at 15 min
comigrated with commercial -carotene and was present at ~3.8-fold
higher levels in the brp strain than in the wild type
(Fig. 4, samples 1 and 2, and Fig. 5,
traces 1 and 2). Independent experiments were
carried out to confirm that the major carotenoid from the
brp strain is -carotene. Under different HPLC
conditions (see "Experimental Procedures"), the brp
extract and commercial -carotene yielded both a prominent species
absorbing at 474 nm that eluted at 17.5 min and a minor species that
eluted at 17.8 min, presumably attributable to cis-isomers of -carotene (data not shown). The HPLC peak fractions obtained from
the brp extract and commercial -carotene had mass ion
values of 536.441 and 536.437 Da and similar UV/visible spectra
with absorption maxima at 449 and 451 nm, respectively (data not
shown). The slight difference in absorption maximum may be attributable to a difference in the ratio of -carotene isomers (29). Thus, the
major carotenoid that accumulates in the brp strain is
-carotene.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 5.
Comparison of
-carotene and retinal accumulation in the wild-type
(trace 1), brp
(trace 2), and brp
ura3::brp (trace 3) strains.
Carotenoids were extracted from cells as described (28) and analyzed by
reverse-phase HPLC as described in Experimental Procedures. At the time
indicated by the arrow, the detector was switched from 380 nm, the wavelength at which retinal was quantified, to 450 nm to
quantify -carotene. Traces are shown normalized to total cell
protein and offset an equal distance along both axes for clarity.
|
|
The ~3.8-fold increase in -carotene accumulation in the
brp strain was accompanied by a corresponding ~3.7-fold
decrease in retinal accumulation (Fig. 4, samples 1 and
2, and Fig. 5, traces 1 and 2). The
simplest interpretation of these results is that Brp catalyzes or
regulates the conversion of -carotene to retinal.
brp Is Complemented by an Intact Copy of brp--
A
complementation strain was constructed to confirm that the
brp phenotype is caused by the loss of brp and
not by a reduction in bat expression or a second-site
mutation in an unknown gene. The brp open reading frame,
flanked by 186 bp of the upstream sequence to allow normal expression
of the gene, was integrated at the ura3 locus. The resulting
complementation strain, brp ura3::brp, yielded purple colonies identical
to the wild type. When this strain was grown under BR induction
conditions, BR, -carotene, and retinal levels were restored to the
wild-type levels (Fig. 3, dashed line, Fig. 4, sample
3, and Fig. 5, trace 3). These results confirm that the
brp phenotype is caused solely by the loss of
brp and that the in-frame deletion of brp has no detectable effect on bat expression.
A brp Paralog May Function Similarly to brp--
The
brp mutation reduced BR levels by ~4.0-fold but did not
completely eliminate BR synthesis, raising the possibility that other
factors partially substitute for brp in BR biogenesis. To examine this possibility, the Halobacterium sp. NRC-1 genome
sequence (11) was searched for genes encoding proteins homologous to Brp, and a single gene, blh, was identified. The
blh open reading frame begins with a GUG start codon and
encodes a putative 345-amino acid integral membrane protein (Blh) with
28% identity to Brp over its entire length. (blh was
initially predicted to encode a 284-amino acid protein (11). However,
our analysis suggests that the protein may be 61 amino acids longer at
the N terminus based on GC bias in the third position of codons and a
better match of the length and predicted topography of the
blh and brp gene products.)
To determine whether Blh plays a role in BR biogenesis, an in-frame
deletion of blh was constructed in the wild-type and
brp backgrounds. Codons 97-300 of the blh
open reading frame were deleted. The blh colonies had a
dark orange color similar to the brp colonies, but the
brp blh colonies had a yellow color, suggesting an accumulation of -carotene without the expression of
BR. When grown microaerobically in liquid media to induce BR expression, the blh strain had wild-type levels of BR,
-carotene, and retinal (Fig. 4, sample 4, and Fig.
6, dashed line). Given that
blh colonies were clearly altered, the lack of an
observable effect under liquid growth conditions in the dark is
surprising but suggests that blh function or expression is
sensitive to growth conditions. Significantly, in the
brp blh strain, no BR or retinal was
detected, and -carotene levels were ~5.3-fold higher than wild
type (Fig. 4, sample 5, and Fig. 6, solid line).
The BO levels were normal in both blh and
brp blh (Fig. 4, samples 4 and
5, and Fig. 6, inset). These results suggest that
Blh acts similarly to Brp in converting -carotene to retinal.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Spectra of wild-type (dotted
line), blh (dashed
line), and
brp blh
(solid line) cell lysates. Spectra are
shown normalized to total cell protein. Inset, immunoblot of
wild-type (lane 1), blh (lane 2),
and brp blh (lane 3) cell
lysates. Immunoblotting was performed as described in Fig. 2.
|
|
Addition of Retinal in Vivo Restores BR Accumulation in brp and
brp blh Strains--
One model for Brp and Blh function is that
they aid BO folding to permit retinal binding. To test this
possibility, retinal was added periodically to cultures of the
brp and brp blh strains during
growth under conditions to induce BR. The addition of
all-trans-retinal restored BR accumulation to the wild-type
levels (Fig. 7), confirming that the BO
produced by these strains is competent to bind retinal and suggesting
that Brp and Blh are not required for the correct folding of BO.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of BR levels in wild-type
(sample 1), brp
(sample 2), and
brp blh
(sample 3) grown in the presence (+) or absence
( ) of all-trans-retinal. Cells were grown as in
previous experiments, except that, where noted, retinal was added
periodically during growth to a final concentration of 15 µM. BR levels were determined as described in Fig. 2.
Samples grown without retinal addition are identical to those shown in
Fig. 4.
|
|
 |
DISCUSSION |
We have identified two related H. salinarum genes,
brp and blh, that are required for BR biogenesis.
The in-frame deletion of brp alone results in decreased BR
and retinal levels and a corresponding increase in -carotene levels.
These effects are enhanced by the deletion of both brp and
blh. The deletion of these genes has no significant effect
on BO levels. These results indicate that brp and
blh are not involved in regulating bop gene expression. Instead, the genes are needed for the synthesis of the
retinal cofactor of BR or for its transport or binding to BO.
The simplest model of brp and blh function is
that they encode the proteins that catalyze or regulate the catalysis
of the conversion of -carotene to retinal. The concomitant decrease in retinal and increase in -carotene levels in the brp
strain strongly support this model. Furthermore, the only defect in
strains lacking brp and blh is the
inability to synthesize retinal, because exogenous retinal
restores BR levels. However, Brp and Blh have no obvious primary
structural features that indicate they catalyze the conversion of
-carotene to retinal. Significantly, Brp and Blh are
unrelated to the recently described 15,15'- -carotene dioxygenase of
Drosophila melanogaster (30), a soluble protein that
catalyzes the oxidative cleavage of -carotene to two molecules of
retinal. Because we have been unable to find orthologs of this enzyme
in the Halobacterium sp. NRC-1 proteome, Brp and Blh may be
part of a novel retinal biosynthetic pathway unique to haloarchaea.
An alternative model is that Brp and Blh are involved in the transport
of retinal in the cell or the binding of retinal to BO. If the proteins
were involved exclusively in transport or binding, at least low levels
of retinal would be expected to accumulate in the
brp blh strain. The failure to detect
retinal in this strain argues against a role of the proteins in retinal
transport or binding. However, we cannot exclude the possibility that
the proteins are multifunctional enzymes that catalyze the conversion of -carotene to retinal and also mediate retinal transport and binding.
Another model is that Brp and Blh encode proteins that regulate the
expression of enzymes that convert -carotene to retinal. Although
the proteins lack features typical of transcriptional regulators, they
may interact with transcriptional regulators to modulate transcription.
This type of regulation was suggested previously in a model whereby the
brp gene product acts as a light sensor (31) and activates
Bat to modulate bop transcription. We showed that
brp has important functions without light because the
differences in BR and carotenoid levels between wild-type and deletion
strains were observed in cultures grown in the dark. Moreover, Brp does
not appear to regulate bop transcription because BO levels
were normal in the brp strain grown either in the dark or
in the light (Fig. 4).2 Thus,
Brp is unlikely to be a light-sensing regulator of Bat. Nevertheless, Brp may modulate the activity of Bat at genes other than
bop, such as those that are required for retinal metabolism.
Our results support the pathway of retinal synthesis in H. salinarum proposed previously (12). This pathway was based on the
in vitro reconstitution of -carotene formation from
mevalonate (32) and on the accumulation of C40-isoprenoid
intermediates in colorless mutant strains that lacked -carotene and
retinal (33). However, direct biochemical or genetic evidence for the conversion of -carotene to retinal has not been obtained. In our experiments, we have shown that the deletion of a single gene (brp) simultaneously results in decreased retinal
accumulation and increased -carotene accumulation. When
brp and blh are both deleted, -carotene
accumulation increases further and no retinal is detectable. Thus,
-carotene is likely to be the precursor to retinal in H. salinarum and is not converted spontaneously to retinal.
Brp and Blh appear to have redundant functions. The redundancy may be
needed to allow retinal production under both aerobic and anaerobic
growth conditions. Of the four rhodopsins produced by H. salinarum, three are induced microaerobically (BR, halorhodopsin, and sensory rhodopsin I), whereas the fourth (sensory rhodopsin II) is
suppressed under these conditions (34). The immunoblotting of cell
lysates with an antibody directed against epitope-tagged Brp indicates
that Brp is present only in cells grown
microaerobically.3 This
finding is consistent with a model in which Brp is induced microaerobically to provide the retinal needed for the formation of BR,
halorhodopsin, and sensory rhodopsin I, and Blh is expressed aerobically to provide retinal to sensory rhodopsin II.
The results presented here have implications for the regulation of BR
biogenesis. BR biogenesis is regulated partly by bat, which
is required for bop and brp expression as shown
by the virtual absence of bop and brp mRNAs
in bat deletion or insertion strains (18, 21). If Brp is
required for retinal synthesis, as suggested by our data, then Bat may
be responsible for the coordinate regulation of polypeptide and
cofactor synthesis. Our results also suggest that a further level of
control may occur because of the cotranscription of brp and
bat. These genes were previously suggested to yield separate
mRNA transcripts by Northern blot analysis (21). However, we
demonstrated that a spontaneous insertion in brp eliminates BO synthesis, whereas an in-frame brp deletion has no
effect. These results indicate that brp insertions have a
polar effect on bat expression and suggest that
brp and bat are cotranscribed. Thus, Bat may
positively regulate its own synthesis as well as that of Brp and BO.
This positive feedback may account for the rapid increase in the levels
of both BO and retinal that are required for BR biogenesis.
The factors identified in this study play a key role in the synthesis
of the retinal cofactor that is essential for the biogenesis of BR in
H. salinarum. Further studies are needed to confirm that Brp
and Blh catalyze the conversion of -carotene to retinal and to test
whether these proteins play a role in transporting retinal or in
binding retinal to BO. It will also be important to determine whether
other cellular factors participate in these processes. Such factors may
be identified by using the Halobacterium sp. NRC-1 genome
sequence (11) and the ura3-based reverse genetics approach
as we have demonstrated for brp and blh.
 |
ACKNOWLEDGEMENTS |
We thank P. Kiley, H. Dale, and T. Isenbarger
for comments on the manuscript and T. Bergsbaken for technical assistance.
 |
FOOTNOTES |
*
This work was supported by National Science Foundation Grant
MCB-9983120 (to M. P. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 608-265-5491;
Fax: 608-262-5253; E-mail: mpkrebs@facstaff.wisc.edu.
Published, JBC Papers in Press, November 22, 2000, DOI 10.1074/jbc.M009492200
2
R. F. Peck and M. P. Krebs, unpublished data.
3
R. F. Peck and M. P. Krebs, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
BR, bacteriorhodopsin;
BO, bacterioopsin;
PCR, polymerase chain reaction;
bp, base pair(s);
kbp, kilobase pair(s);
HPLC, high pressure liquid
chromatography.
 |
REFERENCES |
| 1.
|
Yokoyama, S.
(1997)
Annu. Rev. Genet.
31,
315-336
|
| 2.
|
Gärtner, W.,
and Towner, P.
(1995)
Photochem. Photobiol.
62,
1-16
|
| 3.
|
Oesterhelt, D.
(1998)
Curr. Opin. Struct. Biol.
8,
489-500
|
| 4.
|
Béjà, O.,
Aravind, L.,
Koonin, E. V.,
Suzuki, M. T.,
Hadd, A.,
Nguyen, L. P.,
Jovanovich, S. B.,
Gates, C. M.,
Feldman, R. A.,
Spudich, J. L.,
Spudich, E. N.,
and DeLong, E. F.
(2000)
Science
289,
1902-1906
|
| 5.
|
Bieszke, J. A.,
Braun, E. L.,
Bean, L. E.,
Kang, S.,
Natvig, D. O.,
and Borkovich, K. A.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
8034-8049
|
| 6.
|
Krebs, M. P.,
Hauss, T.,
Heyn, M. P.,
RajBhandary, U. L.,
and Khorana, H. G.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
859-863
|
| 7.
|
Dale, H.,
Angevine, C. M.,
and Krebs, M. P.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
7847-7852
|
| 8.
|
Dale, H.,
and Krebs, M. P.
(1999)
J. Biol. Chem.
274,
22693-22698
|
| 9.
|
Isenbarger, T. A.,
and Krebs, M. P.
(1999)
Biochemistry
38,
9023-9030
|
| 10.
|
Krebs, M. P.,
and Isenbarger, T. A.
(2000)
Biochim. Biophys. Acta
1460,
15-26
|
| 11.
|
Ng, W. V.,
Kennedy, S. P.,
Mahairas, G. G.,
Berquist, B.,
Pan, M.,
et al..
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
12176-12181
|
| 12.
|
Kamekura, M.,
and Kates, M.
(1988)
in
Halophilic Bacteria
(Rodriguez-Valera, F., ed), Vol. II
, pp. 25-54, CRC Press, Inc., Boca Raton, FL
|
| 13.
|
Huang, K. S.,
Bayley, H.,
Liao, M. J.,
London, E.,
and Khorana, H. G.
(1981)
J. Biol. Chem.
256,
3802-3809
|
| 14.
|
Oesterhelt, D.,
and Schuhmann, L.
(1974)
FEBS Lett.
44,
262-265
|
| 15.
|
Betlach, M.,
Friedman, J.,
Boyer, H. W.,
and Pfeifer, F.
(1984)
Nucleic Acids Res.
12,
7949-7959
|
| 16.
|
Pfeifer, F. A.,
Boyer, H. W.,
and Betlach, M. C.
(1985)
J. Bacteriol.
164,
414-420
|
| 17.
|
Leong, D.,
Pfeifer, F.,
Boyer, H.,
and Betlach, M.
(1988)
J. Bacteriol.
170,
4903-4909
|
| 18.
|
Yang, C. F.,
Kim, J. M.,
Molinari, E.,
and DasSarma, S.
(1996)
J. Bacteriol.
178,
840-845
|
| 19.
|
Yang, C. F.,
and DasSarma, S.
(1990)
J. Bacteriol.
172,
4118-4121
|
| 20.
|
Zhulin, I. B.,
Taylor, B. L.,
and Dixon, R.
(1997)
Trends Biochem. Sci.
22,
331-333
|
| 21.
|
Leong, D.,
Boyer, H.,
and Betlach, M.
(1988)
J. Bacteriol.
170,
4910-4915
|
| 22.
|
Gropp, F.,
and Betlach, M. C.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5475-5479
|
| 23.
|
Gropp, F.,
Gropp, R.,
and Betlach, M. C.
(1994)
Syst. Appl. Microbiol.
16,
716-724
|
| 24.
|
Peck, R. F.,
DasSarma, S.,
and Krebs, M. P.
(2000)
Mol. Microbiol.
35,
667-676
|
| 25.
|
Krebs, M. P.,
Mollaaghababa, R.,
and Khorana, H. G.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1987-1991
|
| 26.
|
DasSarma, S.,
RajBhandary, U. L.,
and Khorana, H. G.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
125-129
|
| 27.
|
Oesterhelt, D.,
and Stoeckenius, W.
(1974)
Methods Enzymol.
31,
667-678
|
| 28.
|
Deshpande, A.,
and Sonar, S.
(1999)
J. Biol. Chem.
274,
23535-23540
|
| 29.
|
Stahl, W.,
and Sies, H.
(1994)
Methods Enzymol.
234,
388-400
|
| 30.
|
von Lintig, J.,
and Vogt, K.
(2000)
J. Biol. Chem.
275,
11915-11920
|
| 31.
|
Shand, R. F.,
and Betlach, M. C.
(1991)
J. Bacteriol.
173,
4692-4699
|
| 32.
|
Kushwaha, S. C.,
Kates, M.,
and Porter, J. W.
(1976)
Can. J. Biochem.
54,
816-823
|
| 33.
|
Kushwaha, S. C.,
Kates, M.,
and Weber, H. J.
(1980)
Can. J. Microbiol.
26,
1011-1014
|
| 34.
|
Hoff, W. D.,
Jung, K. H.,
and Spudich, J. L.
(1997)
Annu. Rev. Biophys. Biomol. Struct.
26,
223-258
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y.-S. Kim, N.-H. Kim, S.-J. Yeom, S.-W. Kim, and D.-K. Oh
In Vitro Characterization of a Recombinant Blh Protein from an Uncultured Marine Bacterium as a {beta}-Carotene 15,15'-Dioxygenase
J. Biol. Chem.,
June 5, 2009;
284(23):
15781 - 15793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Santangelo, L. Cubonova, R. Matsumi, H. Atomi, T. Imanaka, and J. N. Reeve
Polarity in Archaeal Operon Transcription in Thermococcus kodakaraensis
J. Bacteriol.,
March 15, 2008;
190(6):
2244 - 2248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. F. Mongodin, K. E. Nelson, S. Daugherty, R. T. DeBoy, J. Wister, H. Khouri, J. Weidman, D. A. Walsh, R. T. Papke, G. Sanchez Perez, et al.
The genome of Salinibacter ruber: Convergence and gene exchange among hyperhalophilic bacteria and archaea
PNAS,
December 13, 2005;
102(50):
18147 - 18152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Woodson, A. A. Reynolds, and J. C. Escalante-Semerena
ABC Transporter for Corrinoids in Halobacterium sp. Strain NRC-1
J. Bacteriol.,
September 1, 2005;
187(17):
5901 - 5909.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Wang, S. P. Kennedy, S. Fasiludeen, C. Rensing, and S. DasSarma
Arsenic Resistance in Halobacterium sp. Strain NRC-1 Examined by Using an Improved Gene Knockout System
J. Bacteriol.,
May 15, 2004;
186(10):
3187 - 3194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Woodson, C. L. Zayas, and J. C. Escalante-Semerena
A New Pathway for Salvaging the Coenzyme B12 Precursor Cobinamide in Archaea Requires Cobinamide-Phosphate Synthase (CbiB) Enzyme Activity
J. Bacteriol.,
December 15, 2003;
185(24):
7193 - 7201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Woodson, R. F. Peck, M. P. Krebs, and J. C. Escalante-Semerena
The cobY Gene of the Archaeon Halobacterium sp. Strain NRC-1 Is Required for De Novo Cobamide Synthesis
J. Bacteriol.,
January 1, 2003;
185(1):
311 - 316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.D. WESTON, N.S. BALIGA, R. BONNEAU, and L. HOOD
Systems Approaches Applied to the Study of Saccharomyces cerevisiae and Halobacterium sp.
Cold Spring Harb Symp Quant Biol,
January 1, 2003;
68(0):
345 - 358.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
N. S. Baliga, M. Pan, Y. A. Goo, E. C. Yi, D. R. Goodlett, K. Dimitrov, P. Shannon, R. Aebersold, W. V. Ng, and L. Hood
Coordinate regulation of energy transduction modules in Halobacterium sp. analyzed by a global systems approach
PNAS,
November 12, 2002;
99(23):
14913 - 14918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. F. Peck, E. A. Johnson, and M. P. Krebs
Identification of a Lycopene {beta}-Cyclase Required for Bacteriorhodopsin Biogenesis in the Archaeon Halobacterium salinarum
J. Bacteriol.,
June 1, 2002;
184(11):
2889 - 2897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Kennedy, W. V. Ng, S. L. Salzberg, L. Hood, and S. DasSarma
Understanding the Adaptation of Halobacterium Species NRC-1 to Its Extreme Environment through Computational Analysis of Its Genome Sequence
Genome Res.,
October 1, 2001;
11(10):
1641 - 1650.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|