JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M009226200 on November 17, 2000

J. Biol. Chem., Vol. 276, Issue 9, 6566-6575, March 2, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/9/6566    most recent
M009226200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garami, A.
Right arrow Articles by Ilg, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garami, A.
Right arrow Articles by Ilg, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Role of Phosphomannose Isomerase in Leishmania mexicana Glycoconjugate Synthesis and Virulence*

Attila Garami and Thomas IlgDagger

From the Max-Planck-Institut für Biologie, Corrensstrasse 38, Tübingen 72076, Federal Republic of Germany

Received for publication, October 10, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Phosphomannose isomerase (PMI) catalyzes the reversible interconversion of fructose 6-phosphate and mannose 6-phosphate, which is the first step in the biosynthesis of activated mannose donors required for the biosynthesis of various glycoconjugates. Leishmania species synthesize copious amounts of mannose-containing glycolipids and glycoproteins, which are involved in virulence of these parasitic protozoa. To investigate the role of PMI for parasite glycoconjugate synthesis, we have cloned the PMI gene (lmexpmi) from Leishmania mexicana, generated gene deletion mutants (Delta lmexpmi), and analyzed their phenotype. Delta lmexpmi mutants lack completely the high PMI activity found in wild type parasites, but are, in contrast to fungi, able to grow in media deficient for free mannose. The mutants are unable to synthesize phosphoglycan repeats [-6-Galbeta 1-4Manalpha 1-PO4-] and mannose-containing glycoinositolphospholipids, and the surface expression of the glycosylphosphatidylinositol-anchored dominant surface glycoprotein leishmanolysin is strongly decreased, unless the parasite growth medium is supplemented with mannose. The Delta lmexpmi mutant is attenuated in infections of macrophages in vitro and of mice, suggesting that PMI may be a target for anti-Leishmania drug development. L. mexicana Delta lmexpmi provides the first conditional mannose-controlled system for parasite glycoconjugate assembly with potential applications for the investigation of their biosynthesis, intracellular sorting, and function.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Leishmania are protozoan parasites and the causative agents of a spectrum of animal and human diseases. Their life cycle includes flagellated promastigote stages that reside in the midgut lumen of the sandfly vector and a nonmotile amastigote stage that lives within the mammalian macrophage, where it colonizes the phagolysosomal compartment (1). Leishmania species synthesize large amounts of glycoconjugates that include the unusual glycoinositolphospholipids (GIPLs),1 the conserved protein-linked glycosylphosphatidylinositol (GPI) membrane anchors, glycoproteins with uncommon N-linked glycans, and a unique family of phosphoglycan-modified molecules that encompasses lipid-linked (lipophosphoglycan, LPG), protein-linked (proteophosphoglycans, PPGs), and unlinked forms (PG). It is believed that these are key molecules for the remarkable resistance of Leishmania parasites against the hostile habitats within their host organisms. The structure of these parasite glycoconjugates has been analyzed in extensive detail (2-4), and some information on their biosynthesis has been generated (4-6). The glycan backbones of these glycosylated Leishmania molecules consist predominantly of the monosaccharides Man and Gal, with smaller amounts of GlcNAc, GlcNH2, Glc, D-Ara, and myo-inositol present. It has been demonstrated that GDP-Man, Dol-P-Man, UDP-Gal, UDP-Glc, and GDP-D-Ara are used as monosaccharide donors for parasite glycoconjugate assembly (6-10). Given the high biosynthesis rates, a large and/or rapidly replenishable pool of these activated sugar precursors must exist. In particular the acquisition or biosynthesis as well as the activation of Man is predicted to be of prime importance to the parasites, as all classes of Leishmania glycoconjugates contain this hexose. In yeast and in mammalian cells the activated Man donors GDP-Man and Dol-P-Man are synthesized from Man-6-PO4 by the enzymes phosphomannomutase, GDP-Man pyrophosphorylase, and Dol-P-Man synthase (Fig. 1). Man-6-PO4 is a central metabolite in this pathway and may be synthesized in two different ways: exogenous Man, if available, is taken up by the cells into the cytosol by glucose transporters (11) or a more specific mannose transporter and then phosphorylated by hexokinase (Fig. 1) (12). Alternatively, Frc-6-PO4 is converted to Man-6-PO4 in a reaction catalyzed by phosphomannose isomerase (PMI) (Fig. 1) (13). Lack of the latter enzyme leads to a conditional lethal phenotype in yeast (14) and a severe metabolic disease in humans (15-17), which demonstrates the essential role of PMI for these organisms. By contrast, the mannose pathway in Leishmania is largely unexplored despite the fact that it is likely to be of central importance for the synthesis of most Leishmania glycoconjugates and that it may, therefore, be a promising target for the design of new anti-parasitic drugs.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   Putative pathways of mannose 6-phosphate and glycoconjugate biosynthesis in L. mexicana. Glc-T, glucose transporter; Man-T, mannose transporter; HK, hexokinase; PGI, phosphoglucose isomerase; PMI, phosphomannose isomerase. Glc-6-P, glucose 6-phosphate; Frc-6-P, fructose 6-phosphate; Man-6-P, mannose 6-phosphate. The indication of GDP-Man and Dol-P-Man as Man donors for Leishmania glycoconjugate synthesis is based on studies published earlier by others (6, 7, 43).

In this study, we report the cloning of the L. mexicana PMI gene (lmexpmi) and the generation of gene deletion mutants (Delta lmexpmi) that possess no PMI enzymatic activity. Lack of PMI leads to slowed growth in standard media, but in contrast to yeast, L. mexicana Delta lmexpmi mutants do not require the addition of Man to the growth medium for viability. L. mexicana Delta lmexpmi mutants are sensitive to high mannose concentrations, they show profound down-regulation of LPG, GIPL, and leishmanolysin (gp63) biosynthesis, and secrete underglycosylated acid phosphatase (SAP). Furthermore, L. mexicana Delta lmexpmi promastigotes are attenuated in their infectivity to macrophages and mice. All these effects can be partially or fully reversed by addition of low concentrations of Man to the growth medium and by lmexpmi gene addback. The results of this study suggest that PMI activity is not essential for L. mexicana, but these parasites require this enzyme to maintain their high rate of glycoconjugate synthesis and full virulence.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Parasite Culture and Experimental Infections of Mice and Peritoneal Macrophages-- Promastigotes of the L. mexicana wild type (WT) strain MNYC/BZ/62/M379 and derived mutants were grown at 27 °C in semi-defined medium 79 (SDM) supplemented with 4% heat-inactivated fetal calf serum (iFCS) as described previously (18). Infection of mice with 107 stationary phase promastigotes and infection of mouse peritoneal macrophages were performed as outlined earlier (19). Growth curves of L. mexicana WT and mutants were obtained by seeding SDM/4% iFCS supplemented with or without various concentrations of Man (2 µM to 10 mM) with 2 × 106 promastigotes and counting the parasite numbers at 8- to 24-h intervals. In some experiments, growth curves were determined in the presence or absence of 10 µM swainsonine in the standard growth medium.

Cloning of the L. mexicana lmexpmi Gene, Generation of Gene Knockout and Gene Addback Mutants, Heterologous Expression of PMI, and Generation of Antibodies-- DNA techniques were performed as described previously (20). A 300-bp fragment of the L. major pmi gene was obtained from L. major LRC-L137/V121 genomic DNA by polymerase chain reaction (PCR) using the degenerate primers TT(A/G)TGGATGGG(A/G/C/T)AC(A/G/C/T)CA(C/T)CC and GCCAT(C/T)TC(A/G/C/T)GG(C/T)TT(A/G)TT that were derived from the conserved Candida albicans and Homo sapiens PMI peptide sequences LWMGTHP and NHKPEMA. The PCR product was subcloned into pCR2.1 (Invitrogen) and sequenced. The digoxygenin-labeled PCR product was used to screen a lambda -DashII library (21) derived from genomic L. mexicana DNA. Positive clones were subcloned into pBSK+ (Stratagene) or pGEM-5z (Promega) and sequenced on both strands by the dideoxy chain termination method using an ALFexpress automated sequencer (Amersham Pharmacia Biotech) as described earlier (20). The open reading frame corresponding to lmexpmi was identified by homology to known PMI genes in the data base and by determination of the spliced leader site (20). Double-targeted gene replacement was performed by PCR amplification of the 5'-untranslated region (5'-UTR) of lmexpmi using the primers KO1 (AATGCGGCCGCATGCATCTTCTGTGCGTGTC) and KO2 (AGTACTAGTACAGACGTAGCGGAGTTGCTTG) and by amplification of the 3'-UTR of lmexpmi using the primers KO3 (AGTACTAGTGGATCCCCGAGTTTCCTTCAACATTG) and KO4 (CTTAAGCTTATGCATGCTCTCATCACGAGTG). The underlined sequences indicate introduced restriction sites. The NotI/SpeI-cut lmexpmi 5'-UTR PCR DNA fragment, the BamHI/HindIII-cut lmexpmi 3'-UTR PCR DNA fragment, and a SpeI/BamHI DNA fragment containing a hygromycin phosphotransferase gene (hyg) (21) were ligated consecutively into pBSK+. For the second lmexpmi gene replacement cassette, a SpeI/BamHI fragment encoding the phleomycin binding protein gene (phleo) was used (19). The hyg- and phleo-containing gene replacement cassettes were excised from the plasmids by NsiI digestion and transfected into L. mexicana promastigotes as previously described (20). Selection in 96-well microtiter plates and analysis of positive clones were performed as outlined earlier (19). lmexpmi 5'-UTR and open reading frame DNA probes were generated by PCR using a PCR-DIG labeling kit (Roche Molecular Biochemicals) using the primer pairs GAGGGGAAGATGGTGGTGAG/GCTCCACCTTCTCCCTGCTA and TTCACCTTGGCAGACCCCTC/GAAGTTTGCCGAGGAGCTGC, respectively. For gene addback and heterologous expression studies, the open reading frame of lmexpmi was amplified from a lmexpmi gene-containing plasmid using the primers CCATGGATCCATGTCTGAGCTCGTCAAGC and AATAGATCTAGATTACTTGTCGCTCAAGTC. Episomal gene addback was achieved by cloning the BamHI/XbaI-cut PCR fragment into pX (22) and transfection of L. mexicana Delta lmexpmi promastigotes with this construct as described earlier (20, 23). Transfectants were selected by growth in SDM/4% iFCS containing 10-50 µg/ml G418 (Roche Molecular Biochemicals). Alternatively, the lmexpmi gene was expressed under the control of the rRNA promoter, which is known to lead to high level expression not only in promastigotes but also in amastigotes (24). For the construction of an integration vector, pFW31 (25) was first linearized by digestion with AgeI. The purified DNA fragment (9347 bp) was then subjected to partial digestion with AflII generating digestion products with lengths of 7769, 6720, 2627, 1578, and 1049 bp. The largest fragment lacking the lmxmbap open reading frame, but preserving the following spliced leader addition and polyadenylation sites, was then ligated with the annealed primers CCGGTCTAGATCTGCGGCCGCGGCGCGCC and TTAAGGCGCGCCGCGGCCGCAGATCTAGA yielding pRIB. The gene-containing PCR product (see above) was digested with BglII and BamHI and ligated into BglII/BamHI-cut pRIB yielding pRIBlmexpmi. Correct orientation was checked by restriction enzyme digests. For chromosomal integration into the ribosomal locus of L. mexicana, the integration cassette was excised by digestion with PacI and PmeI (24, 25), gel-purified, and transfected into L. mexicana. Recombinant clones were isolated by limiting dilution on 96-well plates in SDM medium containing 20 µg/ml hygromycin, 2.5 µg/ml phleomycin, and 20 µM puromycin. The sequence data for the lmexpmi-containing DNA fragment has been submitted to the EMBL data base under accession number AJ300464.

High level expression of L. mexicana PMI in Escherichia coli M15 as inclusion bodies was achieved by cloning the BamHI/BglII-cut lmexpmi PCR fragment into pQE30 followed by transformation of the bacteria. The inclusion bodies were solubilized in 8 M urea, and denatured PMI was then purified by nickel-nitrilotriacetic acid-agarose chromatography as described by the manufacturer (Qiagen). Rabbits were immunized with 200 µg of purified recombinant protein, which was dissolved in 8 M urea, 50 mM NaH2PO4, pH 4.8, and emulsified with 50% (v/v) complete Freund's adjuvant for primary immunizations and with 50% incomplete Freund's adjuvant (v/v) for all subsequent booster immunizations. Serum was obtained 10-14 days after each booster immunization. The antiserum was affinity-purified on recombinant protein that had been electrotransferred to polyvinylidene difluoride membranes after SDS-polyacrylamide electrophoresis (PAGE) as described earlier (20).

Analytical Procedures-- Production of SDS-cell lysates, discontinuous SDS-PAGE, immunoblotting using the monoclonal antibodies (mAbs) LT6 and L7.25 (directed against [PO4-6Galbeta 1-4Manalpha 1-]x (x = unknown) and [Manalpha 1-2]0-2Manalpha 1-PO4, respectively) (18), affinity-purified rabbit anti-L. mexicana SAP antibodies (26) and affinity-purified rabbit anti-L. mexicana PMI antibodies, as well as acid phosphatase enzyme assays (27) were performed as described earlier (19). Total lipids from washed L. mexicana promastigotes were obtained by two extractions with chloroform/methanol/water (4:8:3, v/v). High performance thin layer chromatography (HPTLC, Silica Gel 60, Merck, Darmstadt, Germany) of total lipids was performed as described by McConville et al. (28) using the solvent chlorofom/methanol/1 M NH4OH (10:10:3, v/v). Glycolipids on HPTLC plates were selectively stained by orcinol/H2SO4 spraying. L. mexicana promastigotes were metabolically labeled by incubating 5 × 107 cells/ml overnight at 27 °C with 10 µCi/ml myo-[3H]inositol, 20 µCi/ml [3H]GlcNH2, or 50 µCi/ml [2-3H]Man (Hartmann Analytics) in myo-inositol- or Glc/GlcNH2- or Glc/Man-free SDM medium, respectively. In labelings with myo-[3H]inositol and [3H]GlcNH2, the lipid extracts were further purified by 1-butanol/H2O phase separation (28). Radioactively labeled lipids of the 1-butanol phase were separated by HPTLC and detected by spraying with 3H-ENHANCE (Dupont) followed by fluorography. Delipidated cells labeled with myo-[3H]inositol or [2-3H]Man were incubated with benzonuclease to cleave nucleic acids (20) and then separated by SDS-PAGE. Labeled compounds in acrylamide gels were detected by immersion of the polyacrylamide gel in Amplify (Amersham Pharmacia Biotech), followed by drying and fluorography.

To generate L. mexicana total cell lysates, 5 × 109 promastigotes were resuspended in cold homogenization buffer (50 mM triethylamine/HCl, pH 7.0, 0.1 mM EDTA, 2.5 mM MgCl2 containing 20 µg/ml leupeptin and 0.5 mM phenylmethylsulfonyl fluoride), sonicated on ice, and centrifuged at 13,000 × g for 30 min. The pellet was resuspended in the same volume homogenization buffer. Enzyme assays were performed in 50 mM triethylamine/HCl, pH 7.0, 0.1 mM EDTA, 2.5 mM MgCl2 at 25 °C with 0.1% bovine serum albumin. For PMI assays, this buffer was supplemented with 0.5 mM NADP+ (Roche Molecular Biochemicals), 2.5 mM Man-6-PO4 (Merck, Darmstadt, Germany), 2 units/ml phosphoglucose isomerase (Roche Molecular Biochemicals) and 2 units/ml glucose-6-phosphate dehydrogenase (Roche Molecular Biochemicals). Hexokinase was measured in assay buffer with addition of 5 mM glucose, 1 mM ATP, and 2 units/ml glucose-6-phosphate dehydrogenase, whereas the phosphoglucomutase assay required the addition of 2 mM glucose 1-phosphate and 2 units/ml glucose-6-phosphate dehydrogenase. Enzyme assays were started by the addition of 5-10 µl of cell lysate, ultracentrifugation supernatants, or resuspended pellets, and the absorbance at 340 nm was recorded over 2.5-10 min. One unit of enzyme activity is defined as the amount of enzyme converting 1 µmol of substrate/min into the respective product. Total protein of cell lysates was estimated according to Peterson (29).

Immunofluorescence Microscopy and FACS of Leishmania Promastigotes and Infected Macrophages-- Immunofluorescence microscopy and fluorescence-activated cell sorting (FACS) studies on Leishmania promastigotes and infected macrophages were performed as described previously (19) using the mAbs (18) LT6, L7.25, LT17 (most likely directed against [PO4-6(Glcbeta 1-3)Galbeta 1-4Manalpha 1-]x, x = unknown), mAb L3.8 (directed against a polypeptide epitope of L. mexicana leishmanolysin/gp63), and the biotinylated lectin concanavalin A (Sigma). The mAbs were diluted 1:2 to 1:10 (hybridoma supernatant) or 1:500 to 1:2000 (ascites fluid), and the lectin was used at 10 µg/ml. Bound mAbs and the biotinylated lectin were detected by incubation with Cy3-labeled goat anti-mouse IgG/IgM (Dianova, 1:500) and fluorescein isothiocyanate-labeled streptavidin (Sigma, 1:250), respectively.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Isolation of the L. mexicana lmexpmi Gene and Generation of Gene Deletion Mutants by Targeted Gene Replacement-- For the cloning of the Leishmania PMI gene, a degenerate PCR primer pair was constructed from the peptide sequences LWMGTHP and NHKPEMA, which are conserved in C. albicans and H. sapiens PMI (Fig. 2). PCR was performed using L. mexicana, L. donovani, and L. major genomic DNA as templates. Only L. major DNA yielded a PCR product of the expected size (270-300 bp), and sequencing of this DNA fragment revealed an open reading frame with high homology to known PMIs (data not shown). The DIG-labeled PCR fragment was used to screen a lambda -DashII library of genomic L. mexicana DNA. Sequencing of a lmexpmi gene-containing DNA fragment revealed an open reading frame of 1266 bp encoding a protein of 46.5 kDa, which showed 40-42% identity to the Saccharomyces cerevisiae, C. albicans, and H. sapiens PMI polypeptide sequences. Complete conservation was observed for the amino acids that have been shown to serve as a ligand for a Zn2+ cation in the active site and for amino acids lining the substrate binding pocket (Fig. 2) (30). The predicted involvement of Zn2+ in the catalytic activity of L. mexicana PMI was corroborated by its complete inhibition by 5 mM o-phenanthroline (data not shown). Southern blots of L. mexicana genomic DNA indicated the presence of a single gene copy (Fig. 3B and data not shown). Gene replacement cassettes containing the resistance markers phleo and hyg were constructed, and two rounds of targeted gene replacement were performed (Fig. 3A). Plating of transfected cells on SDM medium with or without additional Man (0.5 mM) yielded about the same number of clones that lacked the lmexpmi open reading frame (Fig. 3B). This result was remarkable, because deletion of the PMI gene in yeast led to a Man-dependent phenotype (14).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2.   Alignment of L. mexicana PMI with various PMI amino acid sequences. S. cerevisiae (S. cer., accession number m85238 (14)), C. albicans (C. alb., accession number X82024 (39)), and H. sapiens (H. sap., accession number X76057 (36)). Amino acids conserved in PMI of all four species are indicated by stars. Amino acids involved in the formation of the active site pocket (30) are marked by arrows, those forming the coordination sphere of the active site Zn2+ ion are indicated by black bars.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3.   Targeted gene replacement of the lmexpmi alleles. A, restriction map of the lmexpmi locus. The resistance genes phleo and hyg and the primer binding sites (KO1-4) for the construction of gene deletion cassettes are indicated. B, Southern blot analysis of PstI restriction enzyme-digested chromosomal DNA (5 µg) from L. mexicana wild type (lanes 1) and a Delta lmexpmi mutant (lanes 2). DNA was separated on an ethidium bromide-containing 0.7% agarose gel (right panel), blotted onto a nylon membrane, and incubated with either a DIG-labeled lmexpmi open reading frame (ORF) probe (middle panel) or a DIG-labeled lmexpmi 5'-untranslated region (UTR) probe (left panel). The sizes of DNA standards are indicated in kilobases.

L. mexicana Delta lmexpmi Mutants Are Deficient in PMI Activity and Exhibit a Growth Defect That Can Be Both Reversed and Exacerbated by Man Complementation-- Immunoblots of L. mexicana promastigote and amastigote total cell lysates probed with affinity-purified antibodies raised against Escherichia coli-expressed L. mexicana PMI revealed that PMI was expressed at very similar levels in both parasite life stages (Fig. 4A). Ultracentrifugation experiments on sonicated cell lysates demonstrated that >95% of L. mexicana PMI activity is soluble (data not shown). The PMI protein band was completely absent in overexposed immunoblots of L. mexicana Delta lmexpmi mutants (Fig. 4B), and PMI enzyme assays revealed that these mutants were completely deficient in PMI activity, whereas the activities of other metabolic enzymes like phosphoglucomutase or hexokinase showed little change or were even elevated (Fig. 4C). L. mexicana Delta lmexpmi mutant promastigotes exhibited slowed growth in standard SDM medium (Fig. 5B) compared with wild type parasites (Fig. 5A). This growth defect could be overcome partially by the addition of 20 µM (not shown) or fully by the addition of 200 µM Man to the medium (Fig. 5B), but 2 mM Man led again to slow growth and a bloated shape of the cells, whereas 10 mM Man inhibited growth and ultimately killed most of the parasites (Fig. 5B). In contrast, neither growth nor cell shape of L. mexicana wild type cells and of Delta lmexpmi mutant promastigotes carrying episomal copies of the lmexpmi gene were affected by high Man concentrations (Fig. 5C).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Analysis of PMI in L. mexicana wild type (WT) and a Delta lmexpmi mutant. A, SDS-PAGE/immunoblot of total cell lysates of L. mexicana promastigotes (lane 1, 2.5 × 106 parasites, corresponding to ~10 µg of protein) and lesion-derived amastigotes (lane 2, 2.5 × 106 parasites, corresponding to ~3.5 µg of protein, and lane 3, 7 × 106 parasites, corresponding to ~10 µg of protein). The blots were probed with affinity-purified rabbit anti-L. mexicana PMI antibodies. B, SDS-PAGE/immunoblot of total cell lysates (2.5 × 106 promastigotes) of L. mexicana WT (lane 1) and a Delta lmexpmi mutant (lane 2). C, enzymatic activity of PMI, phosphoglucomutase (PGM), and hexokinase (HK) in freeze/thaw/sonication lysates of L. mexicana WT and of L. mexicana Delta lmexpmi.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   Influence of Man on the growth curves of L. mexicana WT (A), L. mexicana Delta lmexpmi (B), and L. mexicana Delta lmexpmi + pXlmexpmi (C). The standard error of each quadruplicate count is indicated.

L. mexicana Delta lmexpmi Mutant Promastigotes Show Impaired Synthesis of Glycoconjugates That Can Be Reversed by Man Complementation of the Growth Medium-- Immunoblots of L. mexicana WT total cell lysates probed with the anti-PO4-6Galbeta 1-4Manalpha 1-repeat mAb LT6 showed a strong signal in the low molecular weight range that corresponds to LPG, and a weaker signal in the stacking gel and the top of the separating gel due to the presence of membrane-bound proteophosphoglycan (mPPG (20, 31)) (Fig. 6A, lane 1). The L. mexicana Delta lmexlpg1, which is specifically defective in LPG synthesis (19), showed only the signal for mPPG (Fig. 6A, lane 6). In contrast, none of the four L. mexicana Delta lmexpmi null mutants investigated showed any reaction with mAb LT6 on immunoblots. This result was confirmed by FACS analysis of live promastigotes, where the Delta lmexpmi mutant clones examined showed only negligible surface fluorescence, in contrast to Delta lmexlpg1 promastigotes, which displayed at least some LT6 epitopes on their surface, most likely due to mPPG expression (Fig. 7A). Likewise, surface binding sites for LT17, an mAb most likely recognizing glucosylated disaccharide phosphate repeats (20), were down-regulated by a factor of 10-20 (data not shown). The binding of the anti-[Manalpha 1-2]0-2Manalpha 1-PO4 cap mAb L7.25 on blots to proteins of L. mexicana Delta lmexpmi promastigote total cell lysates was only slightly affected compared with wild type parasite lysates, but a shift of all antibody-recognized proteins to lower apparent molecular mass was clearly visible, which may indicate decreased glycosylation (Fig. 6C). A lower level of glycosylation on surface molecules in L. mexicana Delta lmexpmi was also detected in FACS analyses with the lectin concanavalin A, where a strongly decreased signal intensity was observed compared with wild type parasites (Fig. 7C). This decrease in concanavalin A labeling was not due to the loss of LPG and mPPG in Delta lmexpmi mutants, as L. mexicana Delta lmexlpg2 promastigotes, which lack both molecules on the surface display more binding sites for this lectin than wild type parasites (32). The surface binding of mAb L3.8 (33, 34) directed against the GPI-anchored metalloproteinase leishmanolysin/gp63 was decreased on Delta lmexpmi mutants by a factor of 10 (Fig. 7D), despite the fact that the absence of LPG in general increases accessibility of this surface glycoprotein, as shown by analysis of Delta lmexlpg1 and Delta lmexlpg2 mutants (19, 32) (Fig. 7D). The absence or decrease of LT6, LT17, L3.8, and concanavalin A binding sites on L. mexicana Delta pmi mutants was corroborated by immunofluorescence labels on fixed promastigotes (Fig. 8, B, F, N, and R), and close inspection of the mutant promastigotes revealed a shorter, rounded cell shape in comparison to wild type controls (Fig. 8, I and J). Finally, the two subunits of SAP, which are N-glycosylated and O-phosphoglycosylated glycoproteins, showed strong mobility shifts in immunoblot studies for the L. mexicana Delta lmexpmi mutant compared with the wild type, which is indicative of underglycosylation (Fig. 6D). The biosynthesis and surface display of LPG and mPPG (Figs. 6B, 7B, 8D, and 8H), the surface expression of leishmanolysin/gp63 and concanavalin A binding sites (Fig. 8, P and T), the glycosylation of SAP (Fig. 6D), and normal cell shape (Fig. 8, I-L) could be reconstituted in the mutants by episomal expression of lmexpmi from pX or by chromosomal integration of lmexpmi into the ribosomal locus, which demonstrated that the observed defects were due to the loss of the lmexpmi gene. Furthermore, LPG and mPPG synthesis in the lmexpmi mutants could also be reconstituted by addition of Man into the medium. At 20 µM mannose, synthesis of LPG and mPPG could be detected in mutant promastigotes and at 200 µM Man, almost wild type levels of these molecules were found in immunoblots (Fig. 6B), FACS analysis (Fig. 7B), and immunofluorescence microscopy (not shown). Similarly, the electrophoretic mobility of SAP decreased upon medium complementation with 20 µM Man and was indistinguishable from wild type SAP when 200 µM Man was added. Higher concentrations of this sugar did not lead to a further increase in PG synthesis, most likely due to its toxic effects (see above).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6.   SDS-PAGE/immunoblots. A, total cell lysates of promastigotes (1 × 107) from L. mexicana WT (lane 1), four different Delta lmexpmi mutant clones (lanes 2-5), and L. mexicana Delta lmexlpg1 (lane 6). B, total cell lysates of promastigotes (2.5 × 107) from L. mexicana Delta lmexpmi (lane 1), L. mexicana Delta lmexpmi + pRIBlmexpmi (lane 2), L. mexicana WT (lane 3), and L. mexicana Delta lmexpmi grown in the absence (lane 4) and the presence of Man (lane 5, 20 µM; lane 6, 200 µM). The blots in A and B were probed with mAb LT6. C, total cell lysates of promastigotes (1 × 107) from L. mexicana WT (lane 1) and a Delta lmexpmi mutant (lane 2) probed with mAb L7.25. D, L. mexicana promastigote culture supernatant containing 20 milliunits of SAP. Lanes 1, 3-5, and 9, L. mexicana WT; lanes 2, 6-8, and 10, L. mexicana Delta lmexpmi. Parasite cultures for lanes 3 and 6 were grown in the absence, lanes 4 and 7 in the presence of 20 µM, and lanes 5 and 8 in the presence of 200 µM Man. Lanes 1-8 were probed with affinity-purified anti-SAP polypeptide antibodies, lanes 9 and 10 with mAb L7.25. The borders between stacking gels and separating gels are indicated by arrows. The positions of SAP1 and SAP2 are marked by asterisks.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7.   FACS analysis of live L. mexicana WT and different mutant promastigotes. A and B, mAb LT6 directed against [-6Galbeta 1-4Manalpha 1-PO4] repeats; C, concanavalin A; D, mAb L3.8 directed against a polypeptide epitope of leishmanolysin (gp63).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 8.   Immunofluorescence and light microscopy of L. mexicana wild type and PMI-deficient mutant promastigotes. L. mexicana WT (A, E, I, M, Q); L. mexicana Delta lmexpmi (B, C, F, G, J, N, O, R, S); L. mexicana Delta lmexpmi + pRIBlmexpmi (D, H, L, P, T); L. mexicana Delta lmexpmi + pXlmexpmi (K). mAb LT6 (A, B, D); mAb LT17 (E, F, H); mAb L7.25 (I--L); mAb L3.8 (M, N, P); concanavalin A (Q, R, T); light microscopy (C, G) as corresponding controls for B and F, respectively; 4,6-diamidino-2-phenylindol staining (O, S). The exposure times within rows are identical.

HPTLC analysis of a total lipid fraction of the L. mexicana lmexpmi mutant showed the absence of orcinol/H2SO4-stainable GIPLs, whereas the main L. mexicana GIPLs iM2, iM3, and iM4 (28) could be easily detected by this method in wild type parasites (Fig. 9A). Likewise, these GIPLs were largely absent from the total lipid fraction of [3H]GlcNH2-labeled lmexpmi mutant parasites (Fig. 9B). Instead, three new major labeled glycolipid species not present in the wild type parasites were observed, which migrated faster on the TLC indicative of a less hydrophilic nature (Fig. 9B). Like LPG and mPPG synthesis, GIPL synthesis could also be partially reconstituted by Man complementation of the growth medium, although, even at 200 µM, synthesis of the largest GIPL species iM4 was not observed (Fig. 9C).



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 9.   Silica gel 60 HPTLC analysis of the predominant promastigote glycolipids of L. mexicana. A, total lipids from 2 × 108 L. mexicana WT or Delta lmexpmi promastigotes were loaded onto an HPTLC plate. After chromatography, glycolipids were visualized by orcinol/H2SO4 spraying. B, total lipids from 5 × 106 [3H]GlcNH2-labeled promastigotes (~100,000 cpm) were loaded onto an HPTLC plate. After chromatography, glycolipids were visualized by fluorography. C, total lipids from 2 × 108 L. mexicana Delta lmexpmi promastigotes grown in the absence or presence of 2-200 µM mannose were loaded onto an HPTLC plate, and glycolipids were visualized by orcinol/H2SO4 spraying. D, total lipids from 107 [3H]Man-labeled L. mexicana WT and Delta lmexpmi promastigotes (~20,000 and 400,000 cpm, respectively) were loaded onto an HPTLC plate. After chromatography, glycolipids were visualized by fluorography. The positions of the abundant L. mexicana GIPLs are indicated by the bars, the start and front of the TLCs are marked by S and F, respectively. Asterisks mark new [3H]glucosamine-labeled compounds accumulating in Delta lmexpmi mutants.

[3H]Man Labeling and Swainsonine Treatment of L. mexicana Promastigotes-- In [3H]Man labels of L. mexicana wild type promastigotes, only about 2-3% of the offered radiolabel was incorporated in overnight labeling of parasites and could be detected in cellular and secreted macromolecules like PPGs, leishmanolysin/gp63 and SAP (Fig. 10, A-C) and in GIPLs (Fig. 9D). This low incorporation rate was independent of the presence or absence of 1 mM glucose in the labeling medium (Fig. 10A). By contrast, L. mexicana lmexpmi mutants increased Man incorporation 20- to 30-fold compared with wild type parasites, and more than 60% of the offered radiolabel was found in cellular and secreted macromolecules (Fig. 10, A-C), GIPLs, and uncharacterized compounds in the lipid fraction, most likely intermediates of GIPL, LPG, and GPI synthesis (Fig. 9D). This dramatic increase in metabolic labeling efficiency is specific for [3H]Man, because radioactivity incorporation rates of [3H]GlcNH2 and myo-[3H]inositol labels are very similar in the wild type and the Delta lmexpmi mutant.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 10.   Metabolic labeling of L. mexicana WT and Delta lmexpmi promastigotes. A, incorporation of [3H]Man, [3H]GlcNH2, and myo-[3H]inositol into the cells and secreted macromolecules, which had been separated from low molecular weight compounds by Centricon 3 ultrafiltration. Cells were exposed to the radioactive compound for 20 h in Glc-free SDM. In some experiments, 1 mM Glc was added to the labeling medium (+Glc). B and C, SDS-PAGE of [3H]Man-labeled promastigotes (2.5 × 107, B) and macromolecules from their culture supernatant (C). Lanes 1, L. mexicana WT; lanes 2, L. mexicana Delta lmexpmi.

Swainsonine is a potent and specific inhibitor of lysosomal alpha -mannosidase of various eukaryotes (35). This enzyme is essential for the degradation of glycoprotein N-glycans. The addition of 10 µM swainsonine had little effect on the growth of wild type promastigotes, whereas the growth of L. mexicana Delta lmexpmi is retarded by about 50% (Fig. 11). This result is an indication that, under limiting Man supply, Leishmania may rely partially on the degradation of glycoproteins to acquire this hexose.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 11.   Growth curves of L. mexicana WT and Delta lmexpmi in the presence and absence of the alpha -mannosidase inhibitor swainsonine.

L. mexicana Delta lmexpmi Mutants Are Attenuated but Remain Infectious to Macrophages and Mice-- L. mexicana Delta lmexpmi was less efficient in establishing and maintaining an infection in mouse peritoneal macrophages than the parental wild type strain (Fig. 12A). Addback of the lmexpmi gene to the mutant, either on an episome or by insertion into the chromosome at the ribosomal locus, led to increased infectivity that did not, however, reach wild type levels. Phosphoglycan synthesis of intracellular parasites in infected macrophages was down-regulated in L. mexicana Delta lmexpmi mutants compared with wild type parasites, but both LT6 and LT17 epitopes could be clearly detected (Fig. 13, compare A-D with E-H). This result is remarkable, because cultured promastigotes exhibit no LT6 and very low levels of LT17 epitopes (Fig. 8, B and F). Wild type levels of parasite PG repeat expression in infected macrophages was observed when Delta lmexpmi mutants with episomal copies of lmexpmi were used for infection experiments (Fig. 13, I-L). In mouse infection experiments, L. mexicana Delta lmexpmi led to much smaller lesions compared with wild type parasites, but, surprisingly, this mutant was infectious to these mammals (Fig. 12, B and C). Complementation of Delta lmexpmi by episomal gene copies or by integration of lmexpmi into the ribosomal locus led to markedly increased virulence, as indicated by accelerated lesion growth in infected BALB/c mice (Fig. 12, B and C).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 12.   Analysis of macrophage and mouse infection by L. mexicana WT, Delta lmexpmi, and lmexpmi gene addback mutants. A, infection of peritoneal macrophages by L. mexicana wild type, Delta lmexpmi, Delta lmexpmi + pXlmexpmi, Delta lmexpmi + pRIBlmexpmi. Peritoneal macrophages were infected at a ratio of 2 stationary phase promastigotes per cell. The percentage of infected macrophages was counted 6 days after the infection. B and C, infection of Balb/c mice with L. mexicana WT, Delta lmexpmi, and lmexpmi gene addback mutants. Mice were challenged with 107 L. mexicana promastigotes in the right hind footpad. The swelling caused by L. mexicana wild type, Delta lmexpmi, Delta lmexpmi + pXlmexpmi, Delta lmexpmi + pRIBlmexpmi are shown in B and C, respectively. The infection experiments were performed in triplicate, and the standard error is indicated.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 13.   Immunofluorescence of saponin-permeabilized peritoneal macrophages infected with five L. mexicana WT (A-D), Delta lmexpmi (E-H), or Delta lmexpmi + pXlmexpmi (I-L) promastigotes per host cell. Infected macrophages were labeled after 3 days in culture with the mAbs LT6 (A, E, I), LT17 (B, F, J). Counterstaining of the same specimen for DNA was performed with 4,6-diamidino-2-phenylindol (C, D, G, H, K, L). Leishmania-infected macrophages that can be recognized by the intracellular spot-like 4,6-diamidino-2-phenylindol signals of the parasite kinetoplasts are marked by arrows, whereas uninfected cells are marked by asterisks. The exposure times are identical for specimens stained with the same antibody.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In all eukaryotes investigated so far, the reversible isomerization of Frc-6-PO4 and Man-6-PO4 catalyzed by PMI is the first step in the biosynthesis of the activated Man donors GDP-Man and Dol-P-Man (Fig. 1), which are required for the biosynthesis of many glycoproteins, glycolipids, and, in the case of fungi, cell wall components.

In this study, we have cloned, sequenced, and functionally characterized the PMI of the parasitic protozoon L. mexicana as a first step in the investigation of the Leishmania Man pathway. L. mexicana promastigotes express high levels of PMI (~40 milliunits/mg of protein, assay at 25 °C), which exceed the average enzyme activity in mammalian tissue more than 15-fold (2.6 milliunits/mg of protein, assay at 37 °C) (36). Similarly, high PMI activity as in L. mexicana is found in the pathogenic yeast C. albicans (75 milliunits/mg of protein, assay at 37 °C) (37). L. mexicana PMI is a soluble enzyme that is equally expressed at the protein level in insect stage promastigotes and mammalian stage amastigotes. Immunofluorescence studies on permeabilized promastigotes suggest a cytoplasmic localization, as indicated by a diffuse fluorescence signal throughout the cell body (data not shown). The gene encoding L. mexicana PMI, lmexpmi, was isolated by a PCR approach using degenerate oligonucleotide primers, and its primary structure is ~40% identical to that of S. cerevisiae, C. albicans, or human PMI protein sequences. Two rounds of targeted gene replacement led to lmexpmi null mutants (Delta lmexpmi) lacking detectable PMI activity. These mutants were able to multiply in standard growth medium, even when iFCS had been dialyzed extensively to remove possible traces of Man (data not shown). This lack of dependence on exogenous free Man is surprising and in contrast to S. cerevisiae, Aspergillus nidulans, and C. albicans, where loss of PMI activity is lethal, even in complex media, unless Man is provided (14, 38, 39). In humans, the hereditary disease congenital disorder of glycosylation (CDG) type Ib has its basis in PMI deficiency, but although the tissues of patients contain less enzyme than that of healthy controls, complete absence of PMI has never been observed and may be incompatible with life (40). Furthermore, there are no reports about vertebrate cell lines that lack PMI activity. A possible explanation for the unexpected viability of L. mexicana Delta lmexpmi in the absence of Man could be the degradation of serum glycoproteins by the parasites as a source of Man. Our observation that swainsonine, a potent inhibitor of lysosomal alpha -mannosidase (35), inhibits the growth of Delta lmexpmi markedly, although affecting the growth of wild type cells only marginally, supports this view. Alternatively, L. mexicana may not need Man for viability in culture.

However, although PMI is not essential, the absence of this enzyme has several severe consequences for L. mexicana. First, growth of L. mexicana Delta lmexpmi promastigotes in standard medium is slower compared with wild type parasites and the cells show a distinctive rounded shape. Both the growth defect and the change in morphology can be corrected by the addition of 200 µM Man to the growth medium or by genetic complementation. Remarkably, addition of 2 mM Man leads again to a growth defect, and 10 mM Man completely inhibits growth and ultimately kills the cells. By contrast, wild type parasites or Delta lmexpmi gene addback mutants are unaffected by additions of high Man concentrations to the medium. This observation is reminiscent of the toxicity of nutritional Man to apidae, the so-called honey bee syndrome. It has been suggested that an imbalance between high hexokinase and low PMI activities in honey bees, which leads to an accumulation of potentially toxic Man-6-PO4 and, possibly, to ATP depletion, is the cause of this syndrome (41).

Second, lack of PMI activity leads to drastic down-regulation of glycoconjugate synthesis in L. mexicana promastigotes: A combination of immunoblot, FACS, and immunofluorescence microscopy studies suggest that Delta lmexpmi promastigotes grown in standard medium are unable to synthesize phosphoglycan repeat-modified LPG and PPGs. Furthermore, a decrease in surface binding sites for concanavalin A as well as mobility shifts in SDS-PAGE of many cellular proteins and the dominant secreted glycoprotein SAP suggest a general underglycosylation of glycoproteins in these mutants. Finally, the synthesis of the dominant promastigote GIPLs iM2, iM3, iM4, and EPiM3 (28) is down-regulated to such an extent that they could not be detected by the methods employed in this study. It has been suggested that Man-containing GIPLs are essential for L. mexicana viability (42). The results of this study demonstrate, however, that their biosynthesis can be down-regulated to undetectable levels without affecting parasite viability in culture. Metabolic [3H]GlcNH2 labeling revealed new, more hydrophobic GIPL species in the Delta lmexpmi mutants, which are not present in wild type parasites. It is likely that they represent GIPL precursors like GlcNH2-phosphatidylinositol or GlcNAc-phosphatidylinositol species, although this suggestion requires proof by structure analysis. The defect in glycoconjugate synthesis can be partially or fully restored by lmexpmi gene addback or by the addition of 200 µM Man to the growth medium. In metabolic labeling experiments with [3H]Man, Delta lmexpmi promastigotes incorporate about 30 times more radioactivity into their glycoconjugates than wild type parasites, which use this hexose very inefficiently for biosynthesis. This result suggests that, under normal culture conditions, the majority of Man-6-PO4 in L. mexicana originates from the Glc-6-PO4/Frc-6-PO4 pool (Fig. 1) of the promastigote and not from Man. Whether this hexosemonophosphate pool is fed by exogenous Glc or by gluconeogenesis, or both, remains unclear. This is in contrast to the situation in humans, where, in most tissues, the bulk of Man-6-PO4 utilized for glycoprotein synthesis is not derived from Glc-6-PO4 but originates from Man in serum, where its concentration is around 50 µM. A specific Man transporter, which is only weakly affected by the large excess of Glc in serum (~5 mM), ensures efficient uptake of this hexose (12, 42). Our finding that [3H]Man labeling of L. mexicana promastigotes is also only marginally affected by a more than 10,000-fold excess of Glc over [3H]Man suggests that the parasites may also possess a similarly efficient and specific Man uptake system.

A third consequence of the lack of PMI for the parasites is a marked decrease in virulence. In macrophage infection studies, Delta lmexpmi parasites are less successful in colonizing host cells than the parental wild type line, and in mouse infections, lesion growth is much slower. Episomal and, in particular, chromosomal integration addback of the lmexpmi gene to Delta lmexpmi mutants improves their ability to persist and multiply within macrophages and leads to increased virulence to BALB/c mice. The fact that the Delta lmexpmi mutants, although severely attenuated, are still infectious to macrophages and mice is at first unexpected, because the general impairment of glycoconjugate synthesis (2), in particular the defect of GIPL assembly (43), should preclude virulence completely. However, those Delta lmexpmi promastigotes that survive within macrophages transform into amastigotes and, remarkably, synthesize glycoconjugates displaying mAb LT6 and LT17 epitopes, although at lower levels than either wild type or lmexpmi gene addback mutants. Because L. mexicana Delta lmexpmi promastigotes in culture need exogenous Man added to their medium to regain this biosynthetic ability, this result suggests that amastigotes have access to some macrophage-derived Man within the parasitophorous vacuole.

PMI of the pathogenic fungus C. albicans is currently being investigated as a target to combat fungal infections (30). Our results suggest that the inhibition of this enzyme in Leishmania amastigotes colonizing a human lesion may lead to drastically slowed parasite growth, which may enable the immune system to eradicate the infection. Therefore, L. mexicana PMI may be a valid target for the development of new anti-Leishmania drugs. The Delta lmexpmi mutant generated in this study provides the first Man-dependent conditional system for the synthesis of Leishmania phosphoglycans, GIPLs, and possibly GPI anchors and N-glycans, which could be exploited for the investigation of biosynthesis, intracellular transport, and biological functions of these parasite glycoconjugates.


    ACKNOWLEDGEMENTS

We thank Dorothee Harbecke and Monika Demar for excellent technical assistance and Suzanne Gokool and Peter Overath for helpful comments on the manuscript.


    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ300464.

Dagger To whom correspondence should be addressed: Tel.: 49-7071-601-238; Fax: 49-7071-601-235; E-mail: thomas.ilg@tuebingen.mpg.de.

Published, JBC Papers in Press, November 17, 2000, DOI 10.1074/jbc.M009226200


    ABBREVIATIONS

The abbreviations used are: GIPL, glycoinositolphospholipid; PG, unlinked phosphoglycan; LPG, lipophosphoglycan; PPG, proteophosphoglycan; mPPG, membrane-bound PPG; GPI, glycosylphosphatidylinositol; DIG, digoxygenin; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; Dol-P-Man, dolicholphosphate-mannose; Man-6-PO4, mannose 6-phosphate; PMI, phosphomannose isomerase; SAP, underglycosylated acid phosphatase; WT, wild type; SDM, semi-defined medium 79; iFCS, heat-inactivated fetal calf serum; bp, base pair(s); UTR, untranslated repeat; mAb, monoclonal antibody; HPTLC, high performance thin layer chromatography; FACS, fluorescence-activated cell sorting; D-Ara, D-arabinose.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


1. Alexander, J., and Russell, D. G. (1992) Adv. Parasitol. 31, 175-254
2. Descoteaux, A., and Turco, S. J. (1999) Biochim. Biophys. Acta 1455, 341-352
3. McConville, M. J., and Ferguson, M. A. J. (1993) Biochem. J. 294, 305-324
4. Ilg, T. (2000) Parasitol. Today 16, 489-497
5. Beverley, S. M., and Turco, S. J. (1998) Trends Microbiol. 6, 35-40
6. Ralton, J. E., and McConville, M. J. (1998) J. Biol. Chem. 273, 4245-4257
7. Carver, M. A., and Turco, S. J. (1991) J. Biol. Chem. 266, 10974-10981
8. Schneider, P., McConville, M. J., and Ferguson, M. A. J. (1994) J. Biol. Chem. 269, 18332-18337
9. Moss, J. M., Reid, G., Mullin, K. A., Zawadzki, J. L., Simpson, R. J., and McConville, M. J. (1999) J. Biol. Chem. 274, 6678-6688
10. Mahoney, A. B., and Turco, S. J. (1999) Arch. Biochem. Biophys. 372, 367-374
11. Gould, G. W., and Holman, G. D. (1993) Biochem. J. 295, 329-341
12. Panneerselvam, K., and Freeze, H. H. (1996) J. Biol. Chem. 271, 9417-9421
13. Gracy, R. W., and Noltmann, E. A. (1969) J. Biol. Chem. 243, 3161-3168
14. Smith, D. J., Proudfoot, A., Friedli, L., Klig, L. S., Paravic, G., and Payton, M. A. (1992) Mol. Cell. Biol. 12, 2924-2930
15. de Koning, T. J., Dorland, L., van Diggelen, O. P., Boonman, A. M. C., de Jong, G. J., van Noort, W. L., De Schryver, J., Duran, M., van den Berg, I. E. T., Gerwig, G. J., Berger, R., and Poll-The, B. T. (1998) Biochem. Biophys. Res. Commun. 245, 38-42
16. Niehues, R., Hasilik, M., Alton, G., Körner, C., Schiebe-Sukumar, M., Koch, H. G., Zimmer, K.-P., Wu, R., Harms, E., Reiter, K., von Figura, K., Freeze, H. H., Harms, H. K., and Marquardt, T. (1998) J. Clin. Invest. 7, 1414-1420
17. Jaeken, J., Matthijs, G., Saudubray, J.-M., Dionisi-Vici, C., Bertini, E., de Lonlay, P., Henri, H., Carchon, H., Schollen, E., and van Schaftingen, E. (1998) Am. J. Hum. Genet. 62, 1535-1539
18. Ilg, T., Harbecke, D., Wiese, M., and Overath, P. (1993b) Eur. J. Biochem. 217, 603-615
19. Ilg, T. (2000) EMBO J. 19, 1-11
20. Ilg, T., Montgomory, J., Stierhof, Y.-D., and Handman, E. (1999) J. Biol. Chem. 274, 31410-31420
21. Wiese, M., Ilg, T., Lottspeich, F., and Overath, P. (1995) EMBO J. 14, 1067-1074
22. Cruz, A., Coburn, C. M., and Beverley, S. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 89, 7170-7174
23. LeBowitz, J. H., Coburn, C. M., McMahon-Pratt, D., and Beverley, S. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9736-9740
24. Misslitz, A., Mottram, J. C., Overath, P., and Aebischer, T. (2000) Mol. Biochem. Parasitol. 107, 251-261
25. Benzel, I., Wiese, F., and Wiese, M. (2000) Mol. Biochem. Parasitol. 111, 77-86
26. Stierhof, Y.-D., Wiese, M., Ilg, T., Overath, P., Häner, M., and Aebi, U. (1998) J. Mol. Biol. 282, 137-148
27. Ilg, T., Stierhof, Y. D., Etges, R., Adrian, M., Harbecke, D., and Overath, P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8774-8778
28. McConville, M. J., Collidge, T. A., Ferguson, M. A. J., and Schneider, P. (1993) J. Biol. Chem. 268, 15595-15604
29. Peterson, G. L. (1983) Methods Enzymol. 91, 95-119
30. Cleasby, A., Wonacott, A., Skarzynski, T., Hubbard, R. E., Davies, G. J., Proudfoot, A. E. I., Bernard, A. R., Payton, M. A., and Wells, T. N. C. (1996) Nat. Struct. Biol. 3, 470-479
31. Piani, A., Ilg, T., Elefanty, E. G., Curtis, J., and Handman, E. (1999) Microbes Infect. 1, 589-599
32. Ilg, T., Demar, M., and Harbecke, D. (2001) J. Biol. Chem. 276, 4988-4997
33. Russell, D. G. (1987) Eur. J. Biochem. 164, 213-221
34. Ilg, T., Harbecke, D., and Overath, P. (1993a) FEBS Lett. 327, 103-107
35. Elbein, A. D. (1991) FASEB. J. 5, 3055-3063
36. Proudfoot, A. E. I., Turcatti, G., Wells, T. N. C., Payton, M. A., and Smith, D. J. (1994) Eur. J. Biochem. 219, 415-423
37. Proudfoot, A. E. I., Payton, M. A., and Wells, T. N. C. (1994) J. Prot. Chem. 13, 619-627
38. Smith, D. J., and Payton, M. A. (1994) Mol. Cell. Biol. 14, 6030-6038
39. Smith, D. J., Proudfoot, A. E. I., Detiani, M., Wells, T. N. C., and Payton, M. A. (1995) Yeast 11, 301-310
40. Freeze, H. H., and Aebi, M. (1999) Biochim. Biophys. Acta 1455, 167-178
41. Sols, A., Cadenas, E., and Alvarado, F. (1960) Science 131, 297-298
42. Panneerselvam, K., Etchinson, J. R., and Freeze, H. H. (1997) J. Biol. Chem. 272, 23123-23129
43. Ilgoutz, S. C., Zawadzki, J. C., Ralton, J. E., and McConville, M. J. (1999) EMBO J. 18, 2746-2755


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg