Originally published In Press as doi:10.1074/jbc.M009226200 on November 17, 2000
J. Biol. Chem., Vol. 276, Issue 9, 6566-6575, March 2, 2001
The Role of Phosphomannose Isomerase in Leishmania
mexicana Glycoconjugate Synthesis and Virulence*
Attila
Garami and
Thomas
Ilg
From the Max-Planck-Institut für Biologie, Corrensstrasse 38, Tübingen 72076, Federal Republic of Germany
Received for publication, October 10, 2000
 |
ABSTRACT |
Phosphomannose isomerase (PMI) catalyzes the
reversible interconversion of fructose 6-phosphate and mannose
6-phosphate, which is the first step in the biosynthesis of activated
mannose donors required for the biosynthesis of various
glycoconjugates. Leishmania species synthesize
copious amounts of mannose-containing glycolipids and glycoproteins,
which are involved in virulence of these parasitic protozoa. To
investigate the role of PMI for parasite glycoconjugate synthesis, we
have cloned the PMI gene (lmexpmi) from Leishmania mexicana, generated gene deletion mutants
(
lmexpmi), and analyzed their phenotype.
lmexpmi mutants lack completely the high PMI activity
found in wild type parasites, but are, in contrast to fungi, able to
grow in media deficient for free mannose. The mutants are unable to
synthesize phosphoglycan repeats
[-6-Gal
1-4Man
1-PO4-] and mannose-containing
glycoinositolphospholipids, and the surface expression of the
glycosylphosphatidylinositol-anchored dominant surface glycoprotein
leishmanolysin is strongly decreased, unless the parasite growth medium
is supplemented with mannose. The
lmexpmi mutant is
attenuated in infections of macrophages in vitro and of
mice, suggesting that PMI may be a target for
anti-Leishmania drug development. L. mexicana
lmexpmi provides the first conditional mannose-controlled system for parasite glycoconjugate assembly with
potential applications for the investigation of their biosynthesis, intracellular sorting, and function.
 |
INTRODUCTION |
Leishmania are protozoan parasites and the causative
agents of a spectrum of animal and human diseases. Their life cycle
includes flagellated promastigote stages that reside in the midgut
lumen of the sandfly vector and a nonmotile amastigote stage that lives within the mammalian macrophage, where it colonizes the phagolysosomal compartment (1). Leishmania species synthesize large
amounts of glycoconjugates that include the unusual
glycoinositolphospholipids (GIPLs),1 the conserved
protein-linked glycosylphosphatidylinositol (GPI) membrane anchors,
glycoproteins with uncommon N-linked glycans, and a unique
family of phosphoglycan-modified molecules that encompasses lipid-linked (lipophosphoglycan, LPG), protein-linked
(proteophosphoglycans, PPGs), and unlinked forms (PG). It is believed
that these are key molecules for the remarkable resistance of
Leishmania parasites against the hostile habitats within
their host organisms. The structure of these parasite glycoconjugates
has been analyzed in extensive detail (2-4), and some information on
their biosynthesis has been generated (4-6). The glycan backbones of
these glycosylated Leishmania molecules consist
predominantly of the monosaccharides Man and Gal, with smaller amounts
of GlcNAc, GlcNH2, Glc, D-Ara, and
myo-inositol present. It has been demonstrated that GDP-Man, Dol-P-Man, UDP-Gal, UDP-Glc, and GDP-D-Ara are used as
monosaccharide donors for parasite glycoconjugate assembly (6-10).
Given the high biosynthesis rates, a large and/or rapidly replenishable pool of these activated sugar precursors must exist. In particular the
acquisition or biosynthesis as well as the activation of Man is
predicted to be of prime importance to the parasites, as all classes of
Leishmania glycoconjugates contain this hexose. In yeast and
in mammalian cells the activated Man donors GDP-Man and Dol-P-Man are
synthesized from Man-6-PO4 by the enzymes
phosphomannomutase, GDP-Man pyrophosphorylase, and Dol-P-Man synthase
(Fig. 1). Man-6-PO4 is a central metabolite in this pathway
and may be synthesized in two different ways: exogenous Man, if
available, is taken up by the cells into the cytosol by glucose
transporters (11) or a more specific mannose transporter and then
phosphorylated by hexokinase (Fig. 1) (12). Alternatively,
Frc-6-PO4 is converted to Man-6-PO4 in a
reaction catalyzed by phosphomannose isomerase (PMI) (Fig.
1) (13). Lack of the latter enzyme leads
to a conditional lethal phenotype in yeast (14) and a severe metabolic
disease in humans (15-17), which demonstrates the essential role of
PMI for these organisms. By contrast, the mannose pathway in
Leishmania is largely unexplored despite the fact that it is
likely to be of central importance for the synthesis of most
Leishmania glycoconjugates and that it may, therefore, be a
promising target for the design of new anti-parasitic drugs.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Putative pathways of mannose 6-phosphate and
glycoconjugate biosynthesis in L. mexicana.
Glc-T, glucose transporter; Man-T, mannose
transporter; HK, hexokinase; PGI, phosphoglucose
isomerase; PMI, phosphomannose isomerase.
Glc-6-P, glucose 6-phosphate; Frc-6-P, fructose
6-phosphate; Man-6-P, mannose 6-phosphate. The indication of
GDP-Man and Dol-P-Man as Man donors for Leishmania
glycoconjugate synthesis is based on studies published earlier by
others (6, 7, 43).
|
|
In this study, we report the cloning of the L. mexicana PMI
gene (lmexpmi) and the generation of gene deletion mutants
(
lmexpmi) that possess no PMI enzymatic activity. Lack of
PMI leads to slowed growth in standard media, but in contrast to yeast,
L. mexicana
lmexpmi mutants do not require the
addition of Man to the growth medium for viability. L. mexicana
lmexpmi mutants are sensitive to high
mannose concentrations, they show profound down-regulation of LPG,
GIPL, and leishmanolysin (gp63) biosynthesis, and secrete underglycosylated acid phosphatase (SAP). Furthermore, L. mexicana
lmexpmi promastigotes are attenuated in
their infectivity to macrophages and mice. All these effects can be
partially or fully reversed by addition of low concentrations of Man to
the growth medium and by lmexpmi gene addback. The results
of this study suggest that PMI activity is not essential for L. mexicana, but these parasites require this enzyme to maintain
their high rate of glycoconjugate synthesis and full virulence.
 |
MATERIALS AND METHODS |
Parasite Culture and Experimental Infections of Mice and
Peritoneal Macrophages--
Promastigotes of the L. mexicana wild type (WT) strain MNYC/BZ/62/M379 and derived mutants
were grown at 27 °C in semi-defined medium 79 (SDM) supplemented
with 4% heat-inactivated fetal calf serum (iFCS) as described
previously (18). Infection of mice with 107 stationary
phase promastigotes and infection of mouse peritoneal macrophages were
performed as outlined earlier (19). Growth curves of L. mexicana WT and mutants were obtained by seeding SDM/4% iFCS
supplemented with or without various concentrations of Man (2 µM to 10 mM) with 2 × 106
promastigotes and counting the parasite numbers at 8- to 24-h intervals. In some experiments, growth curves were determined in the
presence or absence of 10 µM swainsonine in the standard growth medium.
Cloning of the L. mexicana lmexpmi Gene, Generation of Gene
Knockout and Gene Addback Mutants, Heterologous Expression of PMI, and
Generation of Antibodies--
DNA techniques were performed as
described previously (20). A 300-bp fragment of the L. major
pmi gene was obtained from L. major LRC-L137/V121
genomic DNA by polymerase chain reaction (PCR) using the
degenerate primers TT(A/G)TGGATGGG(A/G/C/T)AC(A/G/C/T)CA(C/T)CC and
GCCAT(C/T)TC(A/G/C/T)GG(C/T)TT(A/G)TT that were derived from the
conserved Candida albicans and Homo sapiens PMI
peptide sequences LWMGTHP and NHKPEMA. The PCR product was subcloned
into pCR2.1 (Invitrogen) and sequenced. The digoxygenin-labeled PCR
product was used to screen a
-DashII library (21) derived
from genomic L. mexicana DNA. Positive clones were subcloned
into pBSK+ (Stratagene) or pGEM-5z (Promega) and sequenced
on both strands by the dideoxy chain termination method using an
ALFexpress automated sequencer (Amersham Pharmacia Biotech) as
described earlier (20). The open reading frame corresponding to
lmexpmi was identified by homology to known PMI genes in the
data base and by determination of the spliced leader site (20).
Double-targeted gene replacement was performed by PCR amplification of
the 5'-untranslated region (5'-UTR) of lmexpmi using the
primers KO1 (AATGCGGCCGCATGCATCTTCTGTGCGTGTC) and
KO2 (AGTACTAGTACAGACGTAGCGGAGTTGCTTG) and by amplification of the 3'-UTR of lmexpmi using the primers KO3
(AGTACTAGTGGATCCCCGAGTTTCCTTCAACATTG) and KO4
(CTTAAGCTTATGCATGCTCTCATCACGAGTG). The underlined sequences indicate introduced restriction sites. The
NotI/SpeI-cut lmexpmi 5'-UTR PCR DNA
fragment, the BamHI/HindIII-cut
lmexpmi 3'-UTR PCR DNA fragment, and a
SpeI/BamHI DNA fragment containing a hygromycin phosphotransferase gene (hyg) (21) were ligated
consecutively into pBSK+. For the second lmexpmi
gene replacement cassette, a SpeI/BamHI fragment
encoding the phleomycin binding protein gene (phleo) was
used (19). The hyg- and phleo-containing gene
replacement cassettes were excised from the plasmids by NsiI
digestion and transfected into L. mexicana
promastigotes as previously described (20). Selection in 96-well
microtiter plates and analysis of positive clones were performed as
outlined earlier (19). lmexpmi 5'-UTR and open reading frame
DNA probes were generated by PCR using a PCR-DIG labeling kit (Roche
Molecular Biochemicals) using the primer pairs
GAGGGGAAGATGGTGGTGAG/GCTCCACCTTCTCCCTGCTA and TTCACCTTGGCAGACCCCTC/GAAGTTTGCCGAGGAGCTGC, respectively. For gene addback and heterologous expression studies, the open reading frame of
lmexpmi was amplified from a lmexpmi
gene-containing plasmid using the primers
CCATGGATCCATGTCTGAGCTCGTCAAGC and
AATAGATCTAGATTACTTGTCGCTCAAGTC. Episomal gene addback was
achieved by cloning the BamHI/XbaI-cut PCR
fragment into pX (22) and transfection of L. mexicana
lmexpmi promastigotes with this construct as described
earlier (20, 23). Transfectants were selected by growth in SDM/4%
iFCS containing 10-50 µg/ml G418 (Roche Molecular Biochemicals).
Alternatively, the lmexpmi gene was expressed under the
control of the rRNA promoter, which is known to lead to high level
expression not only in promastigotes but also in amastigotes
(24). For the construction of an integration vector, pFW31 (25)
was first linearized by digestion with AgeI. The purified
DNA fragment (9347 bp) was then subjected to partial digestion with
AflII generating digestion products with lengths of 7769, 6720, 2627, 1578, and 1049 bp. The largest fragment lacking the
lmxmbap open reading frame, but preserving the following
spliced leader addition and polyadenylation sites, was then ligated
with the annealed primers CCGGTCTAGATCTGCGGCCGCGGCGCGCC and
TTAAGGCGCGCCGCGGCCGCAGATCTAGA yielding pRIB. The gene-containing
PCR product (see above) was digested with BglII and
BamHI and ligated into BglII/BamHI-cut pRIB yielding pRIBlmexpmi. Correct orientation was checked
by restriction enzyme digests. For chromosomal integration into the ribosomal locus of L. mexicana, the integration cassette was
excised by digestion with PacI and PmeI (24, 25),
gel-purified, and transfected into L. mexicana. Recombinant
clones were isolated by limiting dilution on 96-well plates in SDM
medium containing 20 µg/ml hygromycin, 2.5 µg/ml phleomycin, and 20 µM puromycin. The sequence data for the
lmexpmi-containing DNA fragment has been submitted to the
EMBL data base under accession number AJ300464.
High level expression of L. mexicana PMI in
Escherichia coli M15 as inclusion bodies was achieved by
cloning the BamHI/BglII-cut lmexpmi
PCR fragment into pQE30 followed by transformation of the bacteria. The
inclusion bodies were solubilized in 8 M urea, and
denatured PMI was then purified by nickel-nitrilotriacetic acid-agarose
chromatography as described by the manufacturer (Qiagen). Rabbits were
immunized with 200 µg of purified recombinant protein, which was
dissolved in 8 M urea, 50 mM
NaH2PO4, pH 4.8, and emulsified with 50% (v/v)
complete Freund's adjuvant for primary immunizations and with 50%
incomplete Freund's adjuvant (v/v) for all subsequent booster
immunizations. Serum was obtained 10-14 days after each booster
immunization. The antiserum was affinity-purified on recombinant protein that had been electrotransferred to polyvinylidene difluoride membranes after SDS-polyacrylamide electrophoresis (PAGE) as described earlier (20).
Analytical Procedures--
Production of SDS-cell lysates,
discontinuous SDS-PAGE, immunoblotting using the monoclonal antibodies
(mAbs) LT6 and L7.25 (directed against
[PO4-6Gal
1-4Man
1-]x (x = unknown) and [Man
1-2]0-2Man
1-PO4,
respectively) (18), affinity-purified rabbit anti-L.
mexicana SAP antibodies (26) and affinity-purified rabbit
anti-L. mexicana PMI antibodies, as well as acid phosphatase enzyme assays (27) were performed as described earlier (19). Total
lipids from washed L. mexicana promastigotes were obtained by two extractions with chloroform/methanol/water (4:8:3, v/v). High
performance thin layer chromatography (HPTLC, Silica Gel 60, Merck,
Darmstadt, Germany) of total lipids was performed as described by McConville et al. (28) using the
solvent chlorofom/methanol/1 M NH4OH (10:10:3,
v/v). Glycolipids on HPTLC plates were selectively stained by
orcinol/H2SO4 spraying. L. mexicana
promastigotes were metabolically labeled by incubating 5 × 107 cells/ml overnight at 27 °C with 10 µCi/ml
myo-[3H]inositol, 20 µCi/ml
[3H]GlcNH2, or 50 µCi/ml
[2-3H]Man (Hartmann Analytics) in
myo-inositol- or Glc/GlcNH2- or Glc/Man-free SDM
medium, respectively. In labelings with
myo-[3H]inositol and
[3H]GlcNH2, the lipid extracts were further
purified by 1-butanol/H2O phase separation (28).
Radioactively labeled lipids of the 1-butanol phase were separated by
HPTLC and detected by spraying with 3H-ENHANCE (Dupont)
followed by fluorography. Delipidated cells labeled with
myo-[3H]inositol or [2-3H]Man
were incubated with benzonuclease to cleave nucleic acids (20) and then
separated by SDS-PAGE. Labeled compounds in acrylamide gels were
detected by immersion of the polyacrylamide gel in Amplify (Amersham
Pharmacia Biotech), followed by drying and fluorography.
To generate L. mexicana total cell lysates, 5 × 109 promastigotes were resuspended in cold homogenization
buffer (50 mM triethylamine/HCl, pH 7.0, 0.1 mM
EDTA, 2.5 mM MgCl2 containing 20 µg/ml
leupeptin and 0.5 mM phenylmethylsulfonyl fluoride),
sonicated on ice, and centrifuged at 13,000 × g for 30 min. The pellet was resuspended in the same volume homogenization
buffer. Enzyme assays were performed in 50 mM
triethylamine/HCl, pH 7.0, 0.1 mM EDTA, 2.5 mM
MgCl2 at 25 °C with 0.1% bovine serum albumin.
For PMI assays, this buffer was supplemented with 0.5 mM
NADP+ (Roche Molecular Biochemicals), 2.5 mM
Man-6-PO4 (Merck, Darmstadt, Germany), 2 units/ml
phosphoglucose isomerase (Roche Molecular Biochemicals) and 2 units/ml
glucose-6-phosphate dehydrogenase (Roche Molecular Biochemicals).
Hexokinase was measured in assay buffer with addition of 5 mM glucose, 1 mM ATP, and 2 units/ml glucose-6-phosphate dehydrogenase, whereas the phosphoglucomutase assay
required the addition of 2 mM glucose 1-phosphate
and 2 units/ml glucose-6-phosphate dehydrogenase. Enzyme assays were started by the addition of 5-10 µl of cell lysate,
ultracentrifugation supernatants, or resuspended pellets, and the
absorbance at 340 nm was recorded over 2.5-10 min. One unit of enzyme
activity is defined as the amount of enzyme converting 1 µmol of
substrate/min into the respective product. Total protein of cell
lysates was estimated according to Peterson (29).
Immunofluorescence Microscopy and FACS of Leishmania
Promastigotes and Infected Macrophages--
Immunofluorescence
microscopy and fluorescence-activated cell sorting (FACS) studies on
Leishmania promastigotes and infected macrophages were
performed as described previously (19) using the mAbs (18) LT6, L7.25,
LT17 (most likely directed against [PO4-6(Glc
1-3)Gal
1-4Man
1-]x,
x = unknown), mAb L3.8 (directed against a polypeptide
epitope of L. mexicana leishmanolysin/gp63), and the
biotinylated lectin concanavalin A (Sigma). The mAbs were diluted 1:2
to 1:10 (hybridoma supernatant) or 1:500 to 1:2000 (ascites fluid), and
the lectin was used at 10 µg/ml. Bound mAbs and the biotinylated
lectin were detected by incubation with Cy3-labeled goat anti-mouse
IgG/IgM (Dianova, 1:500) and fluorescein isothiocyanate-labeled streptavidin (Sigma, 1:250), respectively.
 |
RESULTS |
Isolation of the L. mexicana lmexpmi Gene and Generation of Gene
Deletion Mutants by Targeted Gene Replacement--
For the cloning of
the Leishmania PMI gene, a degenerate PCR primer pair was
constructed from the peptide sequences LWMGTHP and NHKPEMA, which are
conserved in C. albicans and H. sapiens PMI (Fig.
2). PCR was performed using L. mexicana, L. donovani, and L. major genomic
DNA as templates. Only L. major DNA yielded a PCR product of
the expected size (270-300 bp), and sequencing of this DNA fragment
revealed an open reading frame with high homology to known PMIs (data
not shown). The DIG-labeled PCR fragment was used to screen a
-DashII library of genomic L. mexicana DNA. Sequencing of
a lmexpmi gene-containing DNA fragment revealed an open
reading frame of 1266 bp encoding a protein of 46.5 kDa, which showed
40-42% identity to the Saccharomyces cerevisiae, C. albicans, and H. sapiens PMI polypeptide sequences.
Complete conservation was observed for the amino acids that have been
shown to serve as a ligand for a Zn2+ cation in the active
site and for amino acids lining the substrate binding pocket (Fig. 2)
(30). The predicted involvement of Zn2+ in the catalytic
activity of L. mexicana PMI was corroborated by its complete
inhibition by 5 mM o-phenanthroline (data not shown). Southern blots of L. mexicana genomic DNA indicated
the presence of a single gene copy (Fig.
3B and data not shown). Gene replacement cassettes containing the resistance markers
phleo and hyg were constructed, and two rounds of
targeted gene replacement were performed (Fig. 3A). Plating
of transfected cells on SDM medium with or without additional Man (0.5 mM) yielded about the same number of clones that lacked the
lmexpmi open reading frame (Fig. 3B). This result
was remarkable, because deletion of the PMI gene in yeast led to a
Man-dependent phenotype (14).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 2.
Alignment of L. mexicana PMI
with various PMI amino acid sequences. S. cerevisiae
(S. cer., accession number m85238 (14)), C. albicans (C. alb., accession number X82024 (39)), and
H. sapiens (H. sap., accession number X76057
(36)). Amino acids conserved in PMI of all four species are
indicated by stars. Amino acids involved in the formation of
the active site pocket (30) are marked by arrows, those
forming the coordination sphere of the active site Zn2+ ion
are indicated by black bars.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Targeted gene replacement of the
lmexpmi alleles. A, restriction map of
the lmexpmi locus. The resistance genes phleo and
hyg and the primer binding sites (KO1-4) for the
construction of gene deletion cassettes are indicated. B,
Southern blot analysis of PstI restriction enzyme-digested
chromosomal DNA (5 µg) from L. mexicana wild type
(lanes 1) and a lmexpmi mutant
(lanes 2). DNA was separated on an ethidium
bromide-containing 0.7% agarose gel (right panel), blotted
onto a nylon membrane, and incubated with either a DIG-labeled
lmexpmi open reading frame (ORF) probe
(middle panel) or a DIG-labeled lmexpmi
5'-untranslated region (UTR) probe (left panel).
The sizes of DNA standards are indicated in kilobases.
|
|
L. mexicana
lmexpmi Mutants Are Deficient in PMI Activity and
Exhibit a Growth Defect That Can Be Both Reversed and Exacerbated by
Man Complementation--
Immunoblots of L. mexicana
promastigote and amastigote total cell lysates probed with
affinity-purified antibodies raised against Escherichia
coli-expressed L. mexicana PMI revealed that PMI was
expressed at very similar levels in both parasite life stages (Fig.
4A). Ultracentrifugation
experiments on sonicated cell lysates demonstrated that >95% of
L. mexicana PMI activity is soluble (data not shown). The
PMI protein band was completely absent in overexposed immunoblots of
L. mexicana
lmexpmi mutants (Fig.
4B), and PMI enzyme assays revealed that these mutants were completely deficient in PMI activity, whereas the activities of other
metabolic enzymes like phosphoglucomutase or hexokinase showed little
change or were even elevated (Fig. 4C). L. mexicana
lmexpmi mutant promastigotes exhibited slowed growth
in standard SDM medium (Fig.
5B) compared with wild type
parasites (Fig. 5A). This growth defect could be overcome
partially by the addition of 20 µM (not shown) or fully
by the addition of 200 µM Man to the medium (Fig.
5B), but 2 mM Man led again to slow growth and a
bloated shape of the cells, whereas 10 mM Man inhibited
growth and ultimately killed most of the parasites (Fig.
5B). In contrast, neither growth nor cell shape of L. mexicana wild type cells and of
lmexpmi
mutant promastigotes carrying episomal copies of the lmexpmi
gene were affected by high Man concentrations (Fig. 5C).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of PMI in L. mexicana
wild type (WT) and a
lmexpmi mutant. A,
SDS-PAGE/immunoblot of total cell lysates of L. mexicana
promastigotes (lane 1, 2.5 × 106
parasites, corresponding to ~10 µg of protein) and lesion-derived
amastigotes (lane 2, 2.5 × 106 parasites,
corresponding to ~3.5 µg of protein, and lane 3, 7 × 106 parasites, corresponding to ~10 µg of protein).
The blots were probed with affinity-purified rabbit
anti-L. mexicana PMI antibodies. B,
SDS-PAGE/immunoblot of total cell lysates (2.5 × 106
promastigotes) of L. mexicana WT (lane 1) and a
lmexpmi mutant (lane 2). C,
enzymatic activity of PMI, phosphoglucomutase (PGM), and
hexokinase (HK) in freeze/thaw/sonication lysates of
L. mexicana WT and of L. mexicana
lmexpmi.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
Influence of Man on the growth curves of
L. mexicana WT (A), L. mexicana lmexpmi
(B), and L. mexicana
lmexpmi + pXlmexpmi
(C). The standard error of each
quadruplicate count is indicated.
|
|
L. mexicana
lmexpmi Mutant Promastigotes Show Impaired Synthesis
of Glycoconjugates That Can Be Reversed by Man Complementation of the
Growth Medium--
Immunoblots of L. mexicana WT total cell
lysates probed with the anti-PO4-6Gal
1-4Man
1-repeat
mAb LT6 showed a strong signal in the low molecular weight range that
corresponds to LPG, and a weaker signal in the stacking gel and the top
of the separating gel due to the presence of membrane-bound
proteophosphoglycan (mPPG (20, 31)) (Fig.
6A, lane 1). The
L. mexicana
lmexlpg1, which is specifically
defective in LPG synthesis (19), showed only the signal for mPPG (Fig.
6A, lane 6). In contrast, none of the four
L. mexicana
lmexpmi null mutants investigated
showed any reaction with mAb LT6 on immunoblots. This result was
confirmed by FACS analysis of live promastigotes, where the
lmexpmi mutant clones examined showed only negligible
surface fluorescence, in contrast to
lmexlpg1
promastigotes, which displayed at least some LT6 epitopes on their
surface, most likely due to mPPG expression (Fig.
7A). Likewise, surface binding
sites for LT17, an mAb most likely recognizing glucosylated
disaccharide phosphate repeats (20), were down-regulated by a factor of
10-20 (data not shown). The binding of the
anti-[Man
1-2]0-2Man
1-PO4 cap mAb
L7.25 on blots to proteins of L. mexicana
lmexpmi promastigote total cell lysates was only slightly
affected compared with wild type parasite lysates, but a shift of all
antibody-recognized proteins to lower apparent molecular mass was
clearly visible, which may indicate decreased glycosylation (Fig.
6C). A lower level of glycosylation on surface molecules in
L. mexicana
lmexpmi was also detected in FACS
analyses with the lectin concanavalin A, where a strongly decreased
signal intensity was observed compared with wild type parasites (Fig.
7C). This decrease in concanavalin A labeling was not due to
the loss of LPG and mPPG in
lmexpmi mutants, as L. mexicana
lmexlpg2 promastigotes, which lack both
molecules on the surface display more binding sites for this lectin
than wild type parasites (32). The surface binding of mAb L3.8 (33, 34)
directed against the GPI-anchored metalloproteinase leishmanolysin/gp63 was decreased on
lmexpmi mutants by a factor of 10 (Fig.
7D), despite the fact that the absence of LPG in general
increases accessibility of this surface glycoprotein, as shown by
analysis of
lmexlpg1 and
lmexlpg2 mutants
(19, 32) (Fig. 7D). The absence or decrease of LT6, LT17,
L3.8, and concanavalin A binding sites on L. mexicana
pmi mutants was corroborated by immunofluorescence labels
on fixed promastigotes (Fig. 8, B, F,
N, and R), and
close inspection of the mutant promastigotes revealed a shorter,
rounded cell shape in comparison to wild type controls (Fig. 8,
I and J). Finally, the two subunits of SAP, which
are N-glycosylated and O-phosphoglycosylated
glycoproteins, showed strong mobility shifts in immunoblot studies for
the L. mexicana
lmexpmi mutant compared with
the wild type, which is indicative of underglycosylation (Fig.
6D). The biosynthesis and surface display of LPG and mPPG (Figs. 6B, 7B, 8D, and 8H),
the surface expression of leishmanolysin/gp63 and concanavalin A
binding sites (Fig. 8, P and T), the
glycosylation of SAP (Fig. 6D), and normal cell shape (Fig.
8, I-L) could be reconstituted in the mutants by episomal
expression of lmexpmi from pX or by chromosomal integration
of lmexpmi into the ribosomal locus, which demonstrated that
the observed defects were due to the loss of the lmexpmi
gene. Furthermore, LPG and mPPG synthesis in the lmexpmi
mutants could also be reconstituted by addition of Man into the medium.
At 20 µM mannose, synthesis of LPG and mPPG could be
detected in mutant promastigotes and at 200 µM Man, almost wild type levels of these molecules were found in immunoblots (Fig. 6B), FACS analysis (Fig. 7B), and
immunofluorescence microscopy (not shown). Similarly, the
electrophoretic mobility of SAP decreased upon medium complementation
with 20 µM Man and was indistinguishable from wild type
SAP when 200 µM Man was added. Higher concentrations of
this sugar did not lead to a further increase in PG synthesis, most
likely due to its toxic effects (see above).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 6.
SDS-PAGE/immunoblots. A,
total cell lysates of promastigotes (1 × 107) from
L. mexicana WT (lane 1), four different
lmexpmi mutant clones (lanes 2-5), and
L. mexicana lmexlpg1 (lane 6).
B, total cell lysates of promastigotes (2.5 × 107) from L. mexicana lmexpmi
(lane 1), L. mexicana lmexpmi + pRIBlmexpmi (lane 2), L. mexicana WT
(lane 3), and L. mexicana lmexpmi
grown in the absence (lane 4) and the presence of Man
(lane 5, 20 µM; lane 6, 200 µM). The blots in A and
B were probed with mAb LT6. C, total cell lysates
of promastigotes (1 × 107) from L. mexicana WT (lane 1) and a lmexpmi mutant
(lane 2) probed with mAb L7.25. D, L. mexicana promastigote culture supernatant containing 20 milliunits
of SAP. Lanes 1, 3-5, and 9, L. mexicana WT; lanes 2, 6-8, and
10, L. mexicana lmexpmi. Parasite
cultures for lanes 3 and 6 were grown in the
absence, lanes 4 and 7 in the presence of 20 µM, and lanes 5 and 8 in the
presence of 200 µM Man. Lanes 1-8 were probed
with affinity-purified anti-SAP polypeptide antibodies, lanes
9 and 10 with mAb L7.25. The borders between stacking
gels and separating gels are indicated by arrows. The
positions of SAP1 and SAP2 are marked by asterisks.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 7.
FACS analysis of live L. mexicana
WT and different mutant promastigotes. A and
B, mAb LT6 directed against
[-6Gal 1-4Man 1-PO4] repeats; C,
concanavalin A; D, mAb L3.8 directed against a polypeptide
epitope of leishmanolysin (gp63).
|
|

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 8.
Immunofluorescence and light microscopy of
L. mexicana wild type and PMI-deficient mutant
promastigotes. L. mexicana WT (A,
E, I, M, Q); L. mexicana lmexpmi (B, C,
F, G, J, N, O,
R, S); L. mexicana lmexpmi
+ pRIBlmexpmi (D, H,
L, P, T); L. mexicana
lmexpmi + pXlmexpmi (K). mAb LT6
(A, B, D); mAb LT17 (E,
F, H); mAb L7.25 (I--L);
mAb L3.8 (M, N, P); concanavalin A
(Q, R, T); light microscopy
(C, G) as corresponding controls for B
and F, respectively; 4,6-diamidino-2-phenylindol staining
(O, S). The exposure times within rows
are identical.
|
|
HPTLC analysis of a total lipid fraction of the L. mexicana
lmexpmi mutant showed the absence of
orcinol/H2SO4-stainable GIPLs, whereas the main
L. mexicana GIPLs iM2, iM3, and iM4 (28) could be easily
detected by this method in wild type parasites (Fig. 9A). Likewise, these GIPLs
were largely absent from the total lipid fraction of
[3H]GlcNH2-labeled lmexpmi mutant
parasites (Fig. 9B). Instead, three new major labeled
glycolipid species not present in the wild type parasites were
observed, which migrated faster on the TLC indicative of a less
hydrophilic nature (Fig. 9B). Like LPG and mPPG synthesis,
GIPL synthesis could also be partially reconstituted by Man
complementation of the growth medium, although, even at 200 µM, synthesis of the largest GIPL species iM4 was not
observed (Fig. 9C).

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 9.
Silica gel 60 HPTLC analysis of the
predominant promastigote glycolipids of L. mexicana. A, total lipids from 2 × 108 L. mexicana WT or lmexpmi
promastigotes were loaded onto an HPTLC plate. After chromatography,
glycolipids were visualized by orcinol/H2SO4
spraying. B, total lipids from 5 × 106
[3H]GlcNH2-labeled promastigotes (~100,000
cpm) were loaded onto an HPTLC plate. After chromatography, glycolipids
were visualized by fluorography. C, total lipids from 2 × 108 L. mexicana lmexpmi
promastigotes grown in the absence or presence of 2-200
µM mannose were loaded onto an HPTLC plate, and
glycolipids were visualized by orcinol/H2SO4
spraying. D, total lipids from 107
[3H]Man-labeled L. mexicana WT and
lmexpmi promastigotes (~20,000 and 400,000 cpm,
respectively) were loaded onto an HPTLC plate. After chromatography,
glycolipids were visualized by fluorography. The positions of the
abundant L. mexicana GIPLs are indicated by the
bars, the start and front of the TLCs are marked by
S and F, respectively. Asterisks mark
new [3H]glucosamine-labeled compounds accumulating in
lmexpmi mutants.
|
|
[3H]Man Labeling and Swainsonine Treatment of L. mexicana Promastigotes--
In [3H]Man labels of
L. mexicana wild type promastigotes, only about 2-3% of
the offered radiolabel was incorporated in overnight labeling of
parasites and could be detected in cellular and secreted macromolecules
like PPGs, leishmanolysin/gp63 and SAP (Fig.
10, A-C) and in GIPLs (Fig.
9D). This low incorporation rate was independent of the
presence or absence of 1 mM glucose in the labeling medium (Fig. 10A). By contrast, L. mexicana lmexpmi
mutants increased Man incorporation 20- to 30-fold compared with wild
type parasites, and more than 60% of the offered radiolabel was found
in cellular and secreted macromolecules (Fig. 10, A-C),
GIPLs, and uncharacterized compounds in the lipid fraction, most likely
intermediates of GIPL, LPG, and GPI synthesis (Fig. 9D).
This dramatic increase in metabolic labeling efficiency is specific for
[3H]Man, because radioactivity incorporation rates of
[3H]GlcNH2 and
myo-[3H]inositol labels are very similar in
the wild type and the
lmexpmi mutant.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 10.
Metabolic labeling of L. mexicana
WT and lmexpmi
promastigotes. A, incorporation of
[3H]Man, [3H]GlcNH2, and
myo-[3H]inositol into the cells and secreted
macromolecules, which had been separated from low molecular weight
compounds by Centricon 3 ultrafiltration. Cells were exposed to the
radioactive compound for 20 h in Glc-free SDM. In some
experiments, 1 mM Glc was added to the labeling medium
(+Glc). B and C, SDS-PAGE of
[3H]Man-labeled promastigotes (2.5 × 107, B) and macromolecules from their culture
supernatant (C). Lanes 1, L. mexicana
WT; lanes 2, L. mexicana
lmexpmi.
|
|
Swainsonine is a potent and specific inhibitor of lysosomal
-mannosidase of various eukaryotes (35). This enzyme is essential for the degradation of glycoprotein N-glycans. The addition
of 10 µM swainsonine had little effect on the growth of
wild type promastigotes, whereas the growth of L. mexicana
lmexpmi is retarded by about 50% (Fig.
11). This result is an indication that,
under limiting Man supply, Leishmania may rely partially on
the degradation of glycoproteins to acquire this hexose.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 11.
Growth curves of L. mexicana
WT and lmexpmi in the
presence and absence of the -mannosidase
inhibitor swainsonine.
|
|
L. mexicana
lmexpmi Mutants Are Attenuated but Remain Infectious
to Macrophages and Mice--
L. mexicana
lmexpmi was less efficient in establishing and
maintaining an infection in mouse peritoneal macrophages than the
parental wild type strain (Fig.
12A). Addback of the
lmexpmi gene to the mutant, either on an episome or by
insertion into the chromosome at the ribosomal locus, led to increased
infectivity that did not, however, reach wild type levels.
Phosphoglycan synthesis of intracellular parasites in infected
macrophages was down-regulated in L. mexicana
lmexpmi mutants compared with wild type parasites, but
both LT6 and LT17 epitopes could be clearly detected (Fig. 13, compare A-D with
E-H). This result is remarkable, because cultured promastigotes exhibit no LT6 and very low levels of LT17 epitopes (Fig.
8, B and F). Wild type levels of parasite PG
repeat expression in infected macrophages was observed when
lmexpmi mutants with episomal copies of
lmexpmi were used for infection experiments (Fig. 13,
I-L). In mouse infection experiments, L. mexicana
lmexpmi led to much smaller lesions
compared with wild type parasites, but, surprisingly, this mutant was
infectious to these mammals (Fig. 12, B and C).
Complementation of
lmexpmi by episomal gene copies or by
integration of lmexpmi into the ribosomal locus led to
markedly increased virulence, as indicated by accelerated lesion growth in infected BALB/c mice (Fig. 12, B and
C).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 12.
Analysis of macrophage and mouse infection
by L. mexicana WT,
lmexpmi, and lmexpmi
gene addback mutants. A, infection of peritoneal
macrophages by L. mexicana wild type, lmexpmi,
lmexpmi + pXlmexpmi, lmexpmi + pRIBlmexpmi. Peritoneal macrophages were infected at a ratio
of 2 stationary phase promastigotes per cell. The percentage of
infected macrophages was counted 6 days after the infection.
B and C, infection of Balb/c mice with L. mexicana WT, lmexpmi, and lmexpmi gene
addback mutants. Mice were challenged with 107 L. mexicana promastigotes in the right hind footpad. The swelling
caused by L. mexicana wild type, lmexpmi,
lmexpmi + pXlmexpmi, lmexpmi + pRIBlmexpmi are shown in B and C,
respectively. The infection experiments were performed in triplicate,
and the standard error is indicated.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 13.
Immunofluorescence of saponin-permeabilized
peritoneal macrophages infected with five L. mexicana
WT (A-D), lmexpmi
(E-H), or lmexpmi + pXlmexpmi (I-L)
promastigotes per host cell. Infected macrophages were labeled
after 3 days in culture with the mAbs LT6 (A, E,
I), LT17 (B, F, J).
Counterstaining of the same specimen for DNA was performed with
4,6-diamidino-2-phenylindol (C, D, G,
H, K, L).
Leishmania-infected macrophages that can be recognized by
the intracellular spot-like 4,6-diamidino-2-phenylindol signals of the
parasite kinetoplasts are marked by arrows, whereas
uninfected cells are marked by asterisks. The exposure times
are identical for specimens stained with the same antibody.
|
|
 |
DISCUSSION |
In all eukaryotes investigated so far, the reversible
isomerization of Frc-6-PO4 and Man-6-PO4
catalyzed by PMI is the first step in the biosynthesis of the activated
Man donors GDP-Man and Dol-P-Man (Fig. 1), which are required for the
biosynthesis of many glycoproteins, glycolipids, and, in the case of
fungi, cell wall components.
In this study, we have cloned, sequenced, and functionally
characterized the PMI of the parasitic protozoon L. mexicana
as a first step in the investigation of the Leishmania Man
pathway. L. mexicana promastigotes express high levels of
PMI (~40 milliunits/mg of protein, assay at 25 °C), which exceed
the average enzyme activity in mammalian tissue more than 15-fold (2.6 milliunits/mg of protein, assay at 37 °C) (36). Similarly, high PMI
activity as in L. mexicana is found in the pathogenic yeast
C. albicans (75 milliunits/mg of protein, assay at 37 °C)
(37). L. mexicana PMI is a soluble enzyme that is equally
expressed at the protein level in insect stage promastigotes and
mammalian stage amastigotes. Immunofluorescence studies on
permeabilized promastigotes suggest a cytoplasmic localization, as
indicated by a diffuse fluorescence signal throughout the cell body
(data not shown). The gene encoding L. mexicana PMI,
lmexpmi, was isolated by a PCR approach using degenerate
oligonucleotide primers, and its primary structure is ~40% identical
to that of S. cerevisiae, C. albicans, or human
PMI protein sequences. Two rounds of targeted gene replacement led to
lmexpmi null mutants (
lmexpmi) lacking
detectable PMI activity. These mutants were able to multiply in
standard growth medium, even when iFCS had been dialyzed extensively to
remove possible traces of Man (data not shown). This lack of dependence
on exogenous free Man is surprising and in contrast to S. cerevisiae, Aspergillus nidulans, and C. albicans, where loss of PMI activity is lethal, even in complex media, unless Man is provided (14, 38, 39). In humans, the hereditary
disease congenital disorder of glycosylation (CDG) type Ib has its
basis in PMI deficiency, but although the tissues of patients contain
less enzyme than that of healthy controls, complete absence of PMI has
never been observed and may be incompatible with life (40).
Furthermore, there are no reports about vertebrate cell lines that lack
PMI activity. A possible explanation for the unexpected viability of
L. mexicana
lmexpmi in the absence of Man
could be the degradation of serum glycoproteins by the parasites as a
source of Man. Our observation that swainsonine, a potent inhibitor of
lysosomal
-mannosidase (35), inhibits the growth of
lmexpmi markedly, although affecting the growth of wild
type cells only marginally, supports this view. Alternatively, L. mexicana may not need Man for viability in culture.
However, although PMI is not essential, the absence of this enzyme has
several severe consequences for L. mexicana. First, growth
of L. mexicana
lmexpmi promastigotes in
standard medium is slower compared with wild type parasites and the
cells show a distinctive rounded shape. Both the growth defect and the
change in morphology can be corrected by the addition of 200 µM Man to the growth medium or by genetic
complementation. Remarkably, addition of 2 mM Man leads
again to a growth defect, and 10 mM Man completely inhibits
growth and ultimately kills the cells. By contrast, wild type parasites
or
lmexpmi gene addback mutants are unaffected by
additions of high Man concentrations to the medium. This observation is
reminiscent of the toxicity of nutritional Man to apidae, the so-called
honey bee syndrome. It has been suggested that an imbalance between
high hexokinase and low PMI activities in honey bees, which leads to an
accumulation of potentially toxic Man-6-PO4 and, possibly,
to ATP depletion, is the cause of this syndrome (41).
Second, lack of PMI activity leads to drastic down-regulation of
glycoconjugate synthesis in L. mexicana promastigotes: A combination of immunoblot, FACS, and immunofluorescence
microscopy studies suggest that
lmexpmi
promastigotes grown in standard medium are unable to synthesize
phosphoglycan repeat-modified LPG and PPGs. Furthermore, a decrease in
surface binding sites for concanavalin A as well as mobility shifts in
SDS-PAGE of many cellular proteins and the dominant secreted
glycoprotein SAP suggest a general underglycosylation of glycoproteins
in these mutants. Finally, the synthesis of the dominant promastigote
GIPLs iM2, iM3, iM4, and EPiM3 (28) is down-regulated to such an extent that they could not be detected by the methods employed in this study.
It has been suggested that Man-containing GIPLs are essential for
L. mexicana viability (42). The results of this study
demonstrate, however, that their biosynthesis can be down-regulated to
undetectable levels without affecting parasite viability in culture.
Metabolic [3H]GlcNH2 labeling revealed new,
more hydrophobic GIPL species in the
lmexpmi mutants,
which are not present in wild type parasites. It is likely that they
represent GIPL precursors like GlcNH2-phosphatidylinositol or GlcNAc-phosphatidylinositol species, although this suggestion requires proof by structure analysis. The defect in glycoconjugate synthesis can be partially or fully restored by lmexpmi gene
addback or by the addition of 200 µM Man to the growth
medium. In metabolic labeling experiments with [3H]Man,
lmexpmi promastigotes incorporate about 30 times more radioactivity into their glycoconjugates than wild type parasites, which use this hexose very inefficiently for biosynthesis. This result
suggests that, under normal culture conditions, the majority of
Man-6-PO4 in L. mexicana originates from the
Glc-6-PO4/Frc-6-PO4 pool (Fig. 1) of the
promastigote and not from Man. Whether this hexosemonophosphate pool is
fed by exogenous Glc or by gluconeogenesis, or both, remains unclear.
This is in contrast to the situation in humans, where, in most tissues,
the bulk of Man-6-PO4 utilized for glycoprotein synthesis
is not derived from Glc-6-PO4 but originates from Man in
serum, where its concentration is around 50 µM. A specific Man transporter, which is only weakly affected by the large
excess of Glc in serum (~5 mM), ensures efficient uptake of this hexose (12, 42). Our finding that [3H]Man
labeling of L. mexicana promastigotes is also only
marginally affected by a more than 10,000-fold excess of Glc over
[3H]Man suggests that the parasites may also possess a
similarly efficient and specific Man uptake system.
A third consequence of the lack of PMI for the parasites is a marked
decrease in virulence. In macrophage infection studies,
lmexpmi parasites are less successful in colonizing host
cells than the parental wild type line, and in mouse infections, lesion growth is much slower. Episomal and, in particular, chromosomal integration addback of the lmexpmi gene to
lmexpmi mutants improves their ability to persist and
multiply within macrophages and leads to increased virulence to
BALB/c mice. The fact that the
lmexpmi mutants,
although severely attenuated, are still infectious to macrophages and
mice is at first unexpected, because the general impairment of
glycoconjugate synthesis (2), in particular the defect of GIPL assembly
(43), should preclude virulence completely. However, those
lmexpmi promastigotes that survive within macrophages transform into amastigotes and, remarkably, synthesize glycoconjugates displaying mAb LT6 and LT17 epitopes, although at lower levels than
either wild type or lmexpmi gene addback mutants. Because L. mexicana
lmexpmi promastigotes in culture
need exogenous Man added to their medium to regain this biosynthetic
ability, this result suggests that amastigotes have access to some
macrophage-derived Man within the parasitophorous vacuole.
PMI of the pathogenic fungus C. albicans is currently being
investigated as a target to combat fungal infections (30). Our results
suggest that the inhibition of this enzyme in Leishmania amastigotes colonizing a human lesion may lead to drastically slowed
parasite growth, which may enable the immune system to eradicate the
infection. Therefore, L. mexicana PMI may be a valid target
for the development of new anti-Leishmania drugs. The
lmexpmi mutant generated in this study provides the first
Man-dependent conditional system for the synthesis of
Leishmania phosphoglycans, GIPLs, and possibly GPI anchors
and N-glycans, which could be exploited for the
investigation of biosynthesis, intracellular transport, and biological
functions of these parasite glycoconjugates.
 |
ACKNOWLEDGEMENTS |
We thank Dorothee Harbecke and Monika
Demar for excellent technical assistance and Suzanne Gokool
and Peter Overath for helpful comments on the manuscript.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ300464.
To whom correspondence should be addressed: Tel.: 49-7071-601-238;
Fax: 49-7071-601-235; E-mail: thomas.ilg@tuebingen.mpg.de.
Published, JBC Papers in Press, November 17, 2000, DOI 10.1074/jbc.M009226200
 |
ABBREVIATIONS |
The abbreviations used are:
GIPL, glycoinositolphospholipid;
PG, unlinked phosphoglycan;
LPG, lipophosphoglycan;
PPG, proteophosphoglycan;
mPPG, membrane-bound PPG;
GPI, glycosylphosphatidylinositol;
DIG, digoxygenin;
PCR, polymerase
chain reaction;
PAGE, polyacrylamide gel electrophoresis;
Dol-P-Man, dolicholphosphate-mannose;
Man-6-PO4, mannose
6-phosphate;
PMI, phosphomannose isomerase;
SAP, underglycosylated acid
phosphatase;
WT, wild type;
SDM, semi-defined medium 79;
iFCS, heat-inactivated fetal calf serum;
bp, base pair(s);
UTR, untranslated
repeat;
mAb, monoclonal antibody;
HPTLC, high performance thin layer
chromatography;
FACS, fluorescence-activated cell sorting;
D-Ara, D-arabinose.
 |
REFERENCES |
| 1.
|
Alexander, J.,
and Russell, D. G.
(1992)
Adv. Parasitol.
31,
175-254
|
| 2.
|
Descoteaux, A.,
and Turco, S. J.
(1999)
Biochim. Biophys. Acta
1455,
341-352
|
| 3.
|
McConville, M. J.,
and Ferguson, M. A. J.
(1993)
Biochem. J.
294,
305-324
|
| 4.
|
Ilg, T.
(2000)
Parasitol. Today
16,
489-497
|
| 5.
|
Beverley, S. M.,
and Turco, S. J.
(1998)
Trends Microbiol.
6,
35-40
|
| 6.
|
Ralton, J. E.,
and McConville, M. J.
(1998)
J. Biol. Chem.
273,
4245-4257
|
| 7.
|
Carver, M. A.,
and Turco, S. J.
(1991)
J. Biol. Chem.
266,
10974-10981
|
| 8.
|
Schneider, P.,
McConville, M. J.,
and Ferguson, M. A. J.
(1994)
J. Biol. Chem.
269,
18332-18337
|
| 9.
|
Moss, J. M.,
Reid, G.,
Mullin, K. A.,
Zawadzki, J. L.,
Simpson, R. J.,
and McConville, M. J.
(1999)
J. Biol. Chem.
274,
6678-6688
|
| 10.
|
Mahoney, A. B.,
and Turco, S. J.
(1999)
Arch. Biochem. Biophys.
372,
367-374
|
| 11.
|
Gould, G. W.,
and Holman, G. D.
(1993)
Biochem. J.
295,
329-341
|
| 12.
|
Panneerselvam, K.,
and Freeze, H. H.
(1996)
J. Biol. Chem.
271,
9417-9421
|
| 13.
|
Gracy, R. W.,
and Noltmann, E. A.
(1969)
J. Biol. Chem.
243,
3161-3168
|
| 14.
|
Smith, D. J.,
Proudfoot, A.,
Friedli, L.,
Klig, L. S.,
Paravic, G.,
and Payton, M. A.
(1992)
Mol. Cell. Biol.
12,
2924-2930
|
| 15.
|
de Koning, T. J.,
Dorland, L.,
van Diggelen, O. P.,
Boonman, A. M. C.,
de Jong, G. J.,
van Noort, W. L.,
De Schryver, J.,
Duran, M.,
van den Berg, I. E. T.,
Gerwig, G. J.,
Berger, R.,
and Poll-The, B. T.
(1998)
Biochem. Biophys. Res. Commun.
245,
38-42
|
| 16.
|
Niehues, R.,
Hasilik, M.,
Alton, G.,
Körner, C.,
Schiebe-Sukumar, M.,
Koch, H. G.,
Zimmer, K.-P.,
Wu, R.,
Harms, E.,
Reiter, K.,
von Figura, K.,
Freeze, H. H.,
Harms, H. K.,
and Marquardt, T.
(1998)
J. Clin. Invest.
7,
1414-1420
|
| 17.
|
Jaeken, J.,
Matthijs, G.,
Saudubray, J.-M.,
Dionisi-Vici, C.,
Bertini, E.,
de Lonlay, P.,
Henri, H.,
Carchon, H.,
Schollen, E.,
and van Schaftingen, E.
(1998)
Am. J. Hum. Genet.
62,
1535-1539
|
| 18.
|
Ilg, T.,
Harbecke, D.,
Wiese, M.,
and Overath, P.
(1993b)
Eur. J. Biochem.
217,
603-615
|
| 19.
|
Ilg, T.
(2000)
EMBO J.
19,
1-11
|
| 20.
|
Ilg, T.,
Montgomory, J.,
Stierhof, Y.-D.,
and Handman, E.
(1999)
J. Biol. Chem.
274,
31410-31420
|
| 21.
|
Wiese, M.,
Ilg, T.,
Lottspeich, F.,
and Overath, P.
(1995)
EMBO J.
14,
1067-1074
|
| 22.
|
Cruz, A.,
Coburn, C. M.,
and Beverley, S. M.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
89,
7170-7174
|
| 23.
|
LeBowitz, J. H.,
Coburn, C. M.,
McMahon-Pratt, D.,
and Beverley, S. M.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
9736-9740
|
| 24.
|
Misslitz, A.,
Mottram, J. C.,
Overath, P.,
and Aebischer, T.
(2000)
Mol. Biochem. Parasitol.
107,
251-261
|
| 25.
|
Benzel, I.,
Wiese, F.,
and Wiese, M.
(2000)
Mol. Biochem. Parasitol.
111,
77-86
|
| 26.
|
Stierhof, Y.-D.,
Wiese, M.,
Ilg, T.,
Overath, P.,
Häner, M.,
and Aebi, U.
(1998)
J. Mol. Biol.
282,
137-148
|
| 27.
|
Ilg, T.,
Stierhof, Y. D.,
Etges, R.,
Adrian, M.,
Harbecke, D.,
and Overath, P.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
8774-8778
|
| 28.
|
McConville, M. J.,
Collidge, T. A.,
Ferguson, M. A. J.,
and Schneider, P.
(1993)
J. Biol. Chem.
268,
15595-15604
|
| 29.
|
Peterson, G. L.
(1983)
Methods Enzymol.
91,
95-119
|
| 30.
|
Cleasby, A.,
Wonacott, A.,
Skarzynski, T.,
Hubbard, R. E.,
Davies, G. J.,
Proudfoot, A. E. I.,
Bernard, A. R.,
Payton, M. A.,
and Wells, T. N. C.
(1996)
Nat. Struct. Biol.
3,
470-479
|
| 31.
|
Piani, A.,
Ilg, T.,
Elefanty, E. G.,
Curtis, J.,
and Handman, E.
(1999)
Microbes Infect.
1,
589-599
|
| 32.
|
Ilg, T.,
Demar, M.,
and Harbecke, D.
(2001)
J. Biol. Chem.
276,
4988-4997
|
| 33.
|
Russell, D. G.
(1987)
Eur. J. Biochem.
164,
213-221
|
| 34.
|
Ilg, T.,
Harbecke, D.,
and Overath, P.
(1993a)
FEBS Lett.
327,
103-107
|
| 35.
|
Elbein, A. D.
(1991)
FASEB. J.
5,
3055-3063
|
| 36.
|
Proudfoot, A. E. I.,
Turcatti, G.,
Wells, T. N. C.,
Payton, M. A.,
and Smith, D. J.
(1994)
Eur. J. Biochem.
219,
415-423
|
| 37.
|
Proudfoot, A. E. I.,
Payton, M. A.,
and Wells, T. N. C.
(1994)
J. Prot. Chem.
13,
619-627
|
| 38.
|
Smith, D. J.,
and Payton, M. A.
(1994)
Mol. Cell. Biol.
14,
6030-6038
|
| 39.
|
Smith, D. J.,
Proudfoot, A. E. I.,
Detiani, M.,
Wells, T. N. C.,
and Payton, M. A.
(1995)
Yeast
11,
301-310
|
| 40.
|
Freeze, H. H.,
and Aebi, M.
(1999)
Biochim. Biophys. Acta
1455,
167-178
|
| 41.
|
Sols, A.,
Cadenas, E.,
and Alvarado, F.
(1960)
Science
131,
297-298
|
| 42.
|
Panneerselvam, K.,
Etchinson, J. R.,
and Freeze, H. H.
(1997)
J. Biol. Chem.
272,
23123-23129
|
| 43.
|
Ilgoutz, S. C.,
Zawadzki, J. C.,
Ralton, J. E.,
and McConville, M. J.
(1999)
EMBO J.
18,
2746-2755
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg