JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M008304200 on November 29, 2000

J. Biol. Chem., Vol. 276, Issue 9, 6807-6816, March 2, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/9/6807    most recent
M008304200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lerga, A.
Right arrow Articles by Moreau-Gachelin, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lerga, A.
Right arrow Articles by Moreau-Gachelin, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification of an RNA Binding Specificity for the Potential Splicing Factor TLS*

Ana LergaDagger §, Marc HallierDagger , Laurent DelvaDagger ||, Christophe OrvainDagger , Isabelle GallaisDagger , Joëlle Marie**, and Françoise Moreau-GachelinDagger DaggerDagger

From Dagger  INSERM U528, Institut Curie-Recherche, 26 rue d'Ulm, 75248 Paris, Cedex 05, France

Received for publication, August 14, 2000, and in revised form, November 7, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The TLS/FUS gene is involved in a recurrent chromosomal translocation in human myxoid liposarcomas. We previously reported that TLS is a potential splicing regulator able to modulate the 5'-splice site selection in an E1A pre-mRNA. Using an in vitro selection procedure, we investigated whether TLS exhibits a specificity with regard to RNA recognition. The RNAs selected by TLS share a common GGUG motif. Mutation of a G or U residue within this motif abolishes the interaction of TLS with the selected RNAs. We showed that TLS can bind GGUG-containing RNAs with a 250 nM affinity. By UV cross-linking/competition and immunoprecipitation experiments, we demonstrated that TLS recognizes a GGUG-containing RNA in nuclear extracts. Each one of the RNA binding domains (the three RGG boxes and the RNA recognition motif) contributes to the specificity of the TLS·RNA interaction, whereas only RRM and RGG2-3 participate to the E1A alternative splicing in vivo. The specificity of the TLS·RNA interaction was also observed using as natural pre-mRNA, the G-rich IVSB7 intron of the beta -tropomyosin pre-mRNA. Moreover, we determined that RNA binding specificities of TLS and high nuclear ribonucleoprotein A1 were different. Hence, our results help define the role of the specific interaction of TLS with RNA during the splicing process of a pre-mRNA.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

TLS (Translocated in LipoSarcoma)1 or FUS has been first characterized as a rearranged gene in chromosomal translocations specific of human myxoid liposarcoma (1, 2). The resulting fusion protein contains the N-terminal part of TLS fused to a transcription factor of the CAAT/enhancer-binding protein family of proteins: CHOP. In an acute myeloid leukemia, TLS is also involved in a chromosomal breakpoint that juxtaposes the same N-terminal region of TLS to a transcription factor of the ETS proteins family: ERG-1 (3, 4). TLS is highly similar to EWS, a gene implicated in chromosomal translocations that are specific of the tumors of the Ewing family (5, 6). In most of these sarcoma, the N-terminal region of EWS is fused to the DNA binding domain of either ERG-1 or FLI-1, which are two closely related ETS proteins.

Both TLS and EWS have in common a similar structural organization. Their C terminus part contains multiple domains that are involved in RNA·protein interactions: an RNA recognition motif (RRM) flanked by two regions rich in Arg-Gly-Gly repeats (RGG domains) and a C2C2 zinc finger. In their N terminus domain, they contain a glutamine-, serine-, and tyrosine-rich region that functions as a transcriptional activation domain when fused to a heterologous DNA binding domain (7-9). In oncogenic chimera, the adjunction of this N-terminal region of TLS or EWS to the transcriptional regulators CHOP, FLI-1, or ERG-1 generates proteins with transcriptional activities that differ from those of the wild-type counterpart (8, 10). From these data it has been proposed that the oncogenic fusion proteins disturb the expression of genes that are regulated by CHOP, FLI-1, or ERG-1. However, no cellular targets for these oncoproteins have yet been identified. Moreover, the N-terminal region of TLS or EWS in chimeric proteins could have a dominant negative effect on the function of the germ-line TLS and EWS as suggested from the recent identification of oncogenic determinants in the N-terminal domain of TLS (11). The biological activity of TLS is still not clearly understood. Indeed, analysis of TLS-deficient mice suggests a possible role of TLS in both repairing DNA damage (12) and maintaining genomic integrity (13). According to these biological data, various biochemical studies identified TLS as a protein involved in pairing DNA sequences during homologous recombination (14, 15).

Other data argue for a role of TLS in regulation of gene transcription. TLS as EWS and the highly similar factor hTAFII 68 have been purified in distinct TFIID complexes associated with the RNA polymerase II (16, 17). In that way, they may function as basal transcriptional regulators participating in the recognition of transcriptional promoter and initiation of gene transcription. Moreover, TLS is able to behave as a DNA binding protein (18), and several cellular partners of TLS that have been identified are transcription factors. These are the nuclear receptors of the thyroid and steroid hormones (19) and the ETS transcription factor Spi-1/PU.1 (20).

TLS is also presumed to play a role in splicing process. TLS is the high nuclear ribonucleoprotein (hnRNP) p2 that has been identified in a protein complex assembled on adenovirus pre-mRNA (21). TLS is engaged in a complex with the hnRNPs A1 and C1/C2 (9) and associates with several spliceosomal small nuclear ribonucleoproteins (22). TLS is complexed to RNA polymerase II transcripts in UV-irradiated HeLa cell extracts (23), which are consistent with the location of the Drosophila homologue of TLS (SARFH/CAZ) (24, 25) on actively transcribed regions in the polytene chromosomes of salivary glands. In addition, RNA polymerase II inhibitors induce relocation of TLS from the nucleus to the cytoplasm, and this TLS shuttling depends on its C-terminal RNA binding domain (9) (26). Thus, TLS has an RNA binding activity, presents an alternative nucleocytoplasmic location, and associates with hnRNP complexes; all of these properties are hallmarks of hnRNPs. Moreover, TLS was found to be associated with the AG dinucleotide during the 3'-splice site recognition step (27), and it takes part to the selection of alternative splice sites in an E1A pre-mRNA splicing assay (20). In addition, TLS can recruit, by its C terminus RGG-rich region (28, 29), two splicing regulators of the serine/arginine-rich protein (SR) family. Altogether, these data strongly suggest that TLS might function as a splicing factor.

These various functions, describing TLS as a protein participating either in transcription or splicing processes, may involve, at a given time, an interaction of TLS with DNA and/or RNA. Indeed, it has been reported that TLS is capable of binding RNA (8, 23, 30) as well as both single- and double-stranded DNA (18). In particular, TLS targets a zinc finger consensus sequence in DNA and, in so doing, could participate in the transcriptional regulation of some cytokine receptors in myeloid cells (18). Some proteins that contain RRM motifs such as hnRNP A1 (31) and the SR proteins such as SC35 and ASF/SF2 (32) have been shown to target specific mRNA short motifs involved in pre-RNA splicing. However, little is known about the RNA recognition specificity of TLS, and whether the role of TLS in RNA splicing depends on its RNA binding specificity is an opened question. To gain further insight into RNA·TLS interaction, we performed a selection/amplification of RNAs from pools of random sequence RNAs. Here we show that TLS is able to target specifically RNAs containing a GGUG motif both in vitro and in vivo. We also determined that the specificity of RNA recognition depends on the cooperation of the three RNA binding domains of TLS.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression Plasmids-- The bacterial expression vectors for the fusion proteins GST-TLS, GST-AD, GST-AD-RGG1, GST-RGG2-3, GST-RRM, and GST-Spi-1 as well as the purification of the proteins have been described previously (20, 33). The eukaryotic pCS3-nMT expression vector contains the simian cytomegalovirus IE94 promoter-enhancer, the SV40 nuclear localization signal, and six copies of the 9E10-Myc epitope. pCS3-nMT-TLS, pCS3-nMT-AD-RGG1, pCS3-nMT-RRM, and pCS3-nMT-RGG2-3 encode fusion proteins between the nuclear localization signal-Myc epitope and TLS amino acids 1-526, 1-271, 271-392, and 392-526, respectively. pCS3-MT-E1A has already been described (20).

In Vitro Homoribopolymer Binding Assay-- In vitro translated proteins were synthesized using TnT-coupled reticulocyte lysates (Promega) and 35S-labeled methionine. Radiolabeled proteins were incubated with homoribopolymers prebound to agarose beads (Amersham Pharmacia Biotech) 10 min at 4 °C in a buffer (10 mM Tris-HCl, pH 7.4, 2.5 mM MgCl2, 0.5% Triton X-100, 100 mM NaCl, 200 µg/ml yeast tARN) and washed extensively with the same buffer. Finally, the bound proteins were analyzed by electrophoresis on a 10% SDS-PAGE and visualized by fluorography.

SELEX-- A library was generated by PCR amplification from a pool of chemically synthesized oligonucleotides (5'-CCGCGGATCCTAATACGACTCACTATAGGGGCCACCAACGACATTGAGTCGACCAATGCAAGCTT(N25)GTTGATATCAATAGTGCCCATGAATGCGCGGAATTCGGG-3') in which (N25) is a 25-nucleotide randomized sequence. This oligonucleotide library was amplified by PCR with 2 units of ampli-Taq polymerase (PerkinElmer Life Sciences) in 50 µl of buffer (2 mM MgCl2, 40 pmol of the primers 5'-BH I (5'-CCGCGGATCCTAATACGACT-3') and rev-ER I (5'-CCCGAATTCCGCGCATTCAT-3') and 400 µM dXTP for 30 cycles under the following conditions: denaturation (95 °C, 1 min), annealing (54 °C, 30 s), and elongation (72 °C, 1 min). The resulting DNA was digested with BamHI and EcoRI and purified in 1.5% agarose gel. From this oligonucleotide pool (500 ng), corresponding RNAs (sample unselected) were synthesized and capped in vitro with 20 units of T7 RNA polymerase (Promega) from the T7 promoter contained in the 5'-end of the random oligonucleotides in the presence of 0.5 mM rXTP, 40 units of RNasin (Promega) at 37 °C for 1 h. Following transcription, the DNA template was degraded by 50 units of RNase-free DNase (Roche Molecular Biochemicals) at 37 °C for 30 min. The full-length transcripts were selected on 6% polyacrylamide gels in 8 M urea, eluted from gel in buffer containing 0.5 M ammonium acetate, 2 mM EDTA, and 0.2% sodium dodecyl sulfate. After phenol:chloroform extraction and ethanol precipitation, the RNAs were resuspended in water and quantified spectrophotometrically.

For the first round of selection, the resulting RNA library (unselected RNAs: 10 µg) was incubated for 30 min on ice with GST-TLS fusion protein (50 pmol) prebound to glutathione-Sepharose in 200 µl of binding buffer (200 mM KCl, 20 mM Hepes, pH 7.5, 2 mM MgCl2, 100 µg/ml yeast tRNA, and 40 units of RNasin). After extensive washing in the binding buffer, the RNAs bound with GST-TLS were treated with Proteinase K (Roche Molecular Biochemicals) 30 min at 55 °C, phenol:chloroform was extracted, and ethanol was precipitated. This new pool of RNAs was retrotranscribed with 200 units of SuperScript II reverse transcriptase (Life Technologies, Inc.) in the presence of 10 mM DTT, 0.5 mM dNTP, and 40 pmol of rev-ERI primer. Then a tenth of the cDNA was amplified by PCR with the ampli-Taq polymerase and the primers rev-ERI and T7-PCR (5'-CCGCGGATCCTAATACGACTCACTATAGGGGCCACCAACGACATTGAGTCGACCAATGCAAGCTT-3'), which contains a T7 promoter sequence. The amplified DNA was digested with BamHI and EcoRI and purified before beginning the next round of transcription, selection, and amplification.

When the selection was carried out by electrophoretic mobility shift assay (EMSA), 500 ng of DNA was used for in vitro transcription with T7 RNA polymerase (60 units), 10 mM DTT, 0.5 mM ATP, CTP, and UTP, 50 µM GTP, and 10 µCi of [alpha -32P]GTP (3000 Ci/mmol) (PerkinElmer Life Sciences). Radiolabeled RNAs were treated with 50 units of DNase I (Roche Molecular Biochemicals) 30 min at 37 °C and electrophoresed in 6% acrylamide-8 M urea gels. Visualized by autoradiography, the RNAs were extracted from gel slice in buffer containing 0.5 M ammonium acetate, 2 mM EDTA, 0.2% sodium dodecyl sulfate, and ethanol-precipitated. The 32P-labeled RNAs were incubated with purified protein (0.5 µg) in 20 µl of RNA binding buffer containing 50 mM KCl, 20 mM Hepes, pH 7.5, 50% glycerol, and 100 µg/ml tRNA, for 30 min on ice. The mixture was loaded on 6% polyacrylamide gels in 0.5× TBE buffer (0.089 M Tris borate, pH 8, 0.01 mM EDTA) and run at 100 volts for 2 h. The shifted RNA·protein complex was excised from the gel, eluted with buffer containing 0.5 M ammonium acetate, 2 mM EDTA, 0.2% sodium dodecyl sulfate, and precipitated. This RNA was used for reverse transcription, and the resulting cDNA was amplified by PCR to start the next cycle of selection.

After the last round of selection, the resultant BamHI-EcoRI DNA was cloned into pBluescript SK+ vector (Stratagene) and sequenced.

RNA Probes-- The hnRNP A1 target pre-mRNA was transcribed by T7 polymerase from DNA template amplified by PCR with the primer A1 5'ER1, 5'-GAAGAATTCATTAATACGAC-3', and the primer rev5'BH1ex6B. The beta -tropo IVSB7 RNA was transcribed by T7 polymerase from DNA template amplified by PCR from pSma plasmid (34) with the primers 5'T7tro, 5'-AATTAATACGACTCACTATAGGGTATGACCTGGTGGAGC-3', and REVtro, 5'-TTCACCCCAGTGAAGGACCC-3'. The mutated beta -tropo IVSB7 RNA was transcribed by T7 polymerase from the pSma1,2,3 plasmid (34) with the primers 5'T7tro and REVtromut 5'-TTCAGGTGAGTGAAGGAGAG-3'. The beta -globin minigene from exon 1 to exon 2 was transcribed with SP6 RNA polymerase from the BamHI-linearized plasmid pSP64 (35) and purified as described above. For each probe, 100 ng of the template was transcribed in the presence of 5 µCi of [alpha -32P]UTP (3000 Ci/mmol).

Electrophoretic Mobility Shift Assay-- For the assays determining the affinity of GST-TLS to ggugRNA and the binding of GST-TLS, GST-AD, GST-AD-RGG1, GST-RRM, and GST-RGG2-3 to various RNA probes, EMSAs were made as described above with 5 pmol of protein and 1 pmol of RNA. For competition experiments, the 32P-labeled probe was incubated 15 min on ice with protein before addition of RNA competitors. The RNA·TLS complexes were migrated on 6% polyacrylamide gels in 0.5× TBE buffer, run at 100 V, and autoradiographed.

UV Cross-linking Assay-- For UV cross-linking experiments, RNAs were labeled with both 10 µCi of [alpha -32P]GTP and 10 µCi of [alpha -32P]UTP. 32P-Labeled purified RNAs (500fmol) were incubated with 8 µl of HeLa cell nuclear extracts (Computer Cell Culture Center, Belgium) in 22 µl of splicing mixture containing 3.2 mM MgCl2, 0.5 mM ATP, 20 mM creatine phosphate, 3% (w/v) polyvinyl alcohol, 4 mM DTT for 15 min at room temperature. For competition experiments, unlabeled RNAs were incubated for 30 min before addition of the probe. The reaction mixtures were transferred to a microtiter plate and exposed to UV light (100 mJ/cm2) at a distance of 4 cm from UV light source (254 nm) for 15 min on ice using a UV cross-linker (Stratalinker, Amersham Pharmacia Biotech). Samples were treated with RNase A (1 mg/ml) and RNase T1 (2.5 units/µl) (Sigma) 30 min at 37 °C, subjected to an 8% SDS-PAGE, and autoradiographed. Immunoprecipitation experiments were performed with the affinity-purified anti-TLS antibody (20) prebound to protein A-Sepharose beads (Amersham Pharmacia Biotech). Cross-linked samples were added in radioimmune precipitation buffer (150 mM NaCl, 50 mM Tris, pH 8, 1% Nonidet P-40, 0.5% DOC, 0.1% SDS) and incubated 2 h at 4 °C. The immunoprecipitates were washed twice with 500 mM NaCl, 10 mM Tris, pH 7.5, 1% DOC, 0.1% SDS, and twice with 10 mM Tris, pH 7.5, 0.5% DOC, 0.1% SDS. Finally, the Sepharose bead pellets were boiled 5 min in 2× Laemmli buffer before loading onto a SDS-8% polyacrylamide gel. 10% of the total cross-linked extracts and all of the immunoprecipitated proteins were loaded.

In Vivo Splicing Assay-- IW1-32 cells (a murine erythroleukemic cell line) (36) were cultured in alpha -modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum. 2 × 106 cells were transfected with 0.3 µg of the E1A reporter vector pCS3-MT-E1A and 3 µg of the various expression vectors pCS3-nMT-TLS, pCS3-nMT-AD-RGG1, pCS3-nMT-RRM, pCS3-nMT-RGG2-3, and pCS3-nMT as control. The DNAs were mixed with a LipofectAMINE and LipofectAMINE plus mixture (Life Technologies, Inc.) according to the manufacturer's instructions. Cells were harvested 20 h post-transfection. Transfection efficiencies were normalized by cotransfection of a pCMV-Luciferase reporter vector (1 µg). Total RNAs were purified and treated with DNase I as previously described (20). The E1A splicing products were analyzed by RT-PCR. 1 µg of RNA was retrotranscribed with Moloney murine leukemia virus Superscript II reverse transcriptase (Life Technologies, Inc.). The PCR amplification was performed with Taq DNA polymerase (PerkinElmer Life Sciences) in the presence of a 5'-E1A primer, which was previously 5'-end-labeled with T4 polynucleotide kinase (Roche Molecular Biochemicals) and [gamma -32P]ATP (Amersham Pharmacia Biotech) as described elsewhere (20). The cycle numbers were kept to a minimum (18-22 cycles) to detect signals in the linear range. Negative control reactions for RT-PCR contained an RNA template that had not undergone reverse transcription. E1A RT-PCR products were resolved on 6% polyacrylamide/urea gels, detected by autoradiography, and quantified by a PhosphorImager (Molecular Dynamics). Expressions of transfected TLS and TLS deletion mutants were detected by RT-PCR using reverse primers specific to each of the TLS protein-encoding cDNAs and a forward primer specific for the Myc epitope. All transfection experiments were repeated four times at least with various vector batches.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

TLS Binds Poly(G) and Poly(U)-- We first analyzed the ability of TLS to bind homoribopolymers. We also looked for the RNA binding activity of the N- and C-truncated TLS proteins to assess the respective role of the RRM and RGG domains in RNA binding. The 35S-radiolabeled proteins were synthesized with reticulocyte lysate, then bound on polyribonucleotidic agarose beads. Bound proteins were analyzed by SDS-PAGE (Fig. 1A). Under conditions in which full-length TLS binds well both poly(G) and poly(U), the RRM alone interacts with any one of the homoribopolymers. Moreover, the TLS N-terminal protein (AD-RGG1) binds exclusively poly(U), whereas the C-terminal part (RGG2-3) binds poly(G) much more efficiently than poly(U). None of these proteins bind poly(A) and poly(C). Thus, the RGG boxes appear as the regions involved in RNA binding. However, because they present a differential binding to poly(G) and poly(U), we hypothesize that the specificity of full-length TLS RNA binding results from the cooperation of RNA binding activities of the different RGG boxes.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   A, TLS binds preferentially the homoribopolymers poly(G) and poly(U). Radiolabeled proteins were synthesized in reticulocyte lysate programmed with cDNAs encoding TLS and the TLS deletion mutants AD-RGG1, RRM, and RGG2-3 in the presence of [35S]methionine. Labeled proteins bound to the indicated homoribopolymers (lanes A, C, G, U) were analyzed by 10% SDS-polyacrylamide gel followed by fluorography. Input corresponds to half of the protein amount used for polymer interaction test. B, schematic representation of TLS and the deletion mutants constructed to map the RNA binding specificity of each one of the RNA binding domains. The numbers refer to the amino acid of the protein. AD, transcriptional activation domain; RRM, RNA recognition motif; RGG, Arg-Gly-Gly-rich motif; ZnF, zinc finger.

TLS Binds RNA with Sequence Specificity-- To further characterize the binding of TLS to RNA, we performed a SELEX (systematic evolution of ligands by exponential enrichment) experiment using the recombinant fusion protein GST-TLS (glutathione S-transferase-TLS). The selection was initiated from a library of degenerated RNAs containing a 25-nucleotide random sequence. Four rounds of RNA selection by a GST-TLS affinity chromatography followed by 3 rounds of RNA selection by EMSA were carried out. The selection procedure was monitored by the ability of TLS to form a complex with the RNA pools derived from each round of selection in EMSA as compared with the shifted complex observed with the initial RNA pool. Finally, the selected RNAs were retrotranscribed, amplified by PCR, and cloned. Seventy-two clones were sequenced. All of them contained a different 25-nt sequence motif. These sequences were mainly G/U-rich (35.6% G and 28.2% U versus 19% A and 18% C), which is consistent with the preferential binding of TLS to homoribopolymers poly(G) and poly(U) observed above. Moreover, comparative analysis of individual selected sequences revealed that 39 among the 72 sequences (54%) had in common a GGUG motif (Fig. 2A). Sequence analysis of the 33 other clones did not reveal any common motif, although they contained G-rich or U-rich sequence elements that could account for their selection by TLS (data not shown). RNA were produced from seven different clones with a GGUG core motif and used as probes to compare their respective binding to TLS in EMSA. A complex corresponding to RNA·TLS was easily observed with each one of these RNAs (Fig. 2B) in contrast to the hard detection of the complex of TLS with the initial unselected random RNAs pool (Fig. 3A, lane 1). Further investigation was pursued with RNA transcribed from clone 9, because it induced TLS with the more strongly shifted band (Fig. 2B). This RNA will be referred as ggugRNA below.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   A, alignment of RNA sequences selected by TLS using the SELEX strategy. RNA sequences were aligned with regard to the presence of the GGUG motif indicated in boldface. Numbers at the left of the RNA sequences refer to the corresponding cDNA clone number. Capital letters represent nucleotides in the 25-nucleotide random sequence. Lowercase letters represent the nucleotides from the primer sequences used for amplification. *, clones used for further RNA binding analysis. B, EMSA used to screen clones obtained from the SELEX procedure. Inserts from individual clones were amplified by PCR and transcribed in vitro. Following gel purification, RNA species were used in EMSA with recombinant TLS and resolved on a 6% polyacrylamide gel. The RNA species number is indicated above the panel. The RNA transcribed from clone 9 (ggugRNA) was selected for further characterization.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3.   Sequence specificity of TLS RNA binding. A, mutational analysis: EMSA was performed with GST-TLS and either 32P-labeled ggugRNA (lane 2) or various mutant forms of ggugRNA (lanes 3-8). The RNAs used as probe were indicated above each lane and their sequences were given below. In lane 1, the unselected (uns) RNA was synthesized from the unselected RNAs pool used for SELEX. The RNA·protein complexes were resolved by a 6% polyacrylamide gel electrophoresis and visualized by autoradiography. B, competition analysis: EMSA was performed with GST-TLS and 32P-labeled ggugRNA probe in the absence (lane 1) or in the presence of increasing concentrations (50-, 100-, and 500-fold molar excess) of cold ggugRNA (lanes 2-4) or cold mutated ccucRNA (500-fold molar excess) (lane 5) used as competitors.

To examine further the importance of the common GGUG motif in TLS·RNA interaction, we compared binding of TLS to the ggugRNA and to a set of RNAs mutated inside this motif or in surrounding positions by EMSA (Fig. 3A). The triple mutation that converts GGUG in CCUC (ccucRNA) as well as single mutations that change GGUG in GCUG (c2RNA) or GGCG (c3RNA) completely abolished the interaction with TLS. Mutations localized next to the GGUG motif, i.e. substitution of A to C (c5RNA), double mutation of U to C (ccRNA), and UAG deletion (Delta uagRNA), was less efficient in impairing the TLS binding. These data support the hypothesis that the GGUG motif is a TLS recognition site and also reveal that additional ribonucleotidic elements proximal to this motif contribute to an efficient interaction between RNA and TLS.

The specificity of TLS·RNA binding was ascertained using competition assays (Fig. 3B). 32P-Labeled ggugRNA was incubated with a 50- to 500-fold molar excess of unlabeled ggugRNA. Cold ggugRNA was capable of compete binding of the labeled RNA in a dose-dependent manner (Fig. 3B, lanes 2-4). In contrast, the ccucRNA was inactive as competitor at even the highest concentration (500-fold) (Fig. 3B, lane 5). These results provide strong evidence that TLS recognizes in vitro an RNA in a manner dependent upon sequence specificity.

The binding affinity of the ggugRNA to TLS was determined using EMSA with increasing concentrations of GST-TLS protein and a constant amount of ggugRNA (Fig. 4). This experiment was repeated with three different protein batches. The ratio of bound versus unbound RNA amounts was determined by quantification with a PhosphorImager. The apparent dissociation constant (Kd) was calculated from the TLS quantity, which binds half of the radiolabeled RNA probe. TLS binds ggugRNA with a Kd of 250 nM. We also calculated the apparent dissociation constant of complexes formed between TLS and six other GGUG-containing RNAs identified during SELEX and used as probes in EMSA (data not shown). Each one presented a lower binding affinity than ggugRNA with Kd values ranging from 300 to 600 nM.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 4.   Affinity of TLS for binding ggugRNA. Increasing amounts of recombinant TLS (lane 1, 0 µg; lane 2, 0.1 µg; lane 3, 0.2 µg; lane 4, 0.3 µg; lane 5, 0.4 µg; lane 6, 0.5 µg; lane 7, 1 µg; lane 8, 2 µg) were added to the 32P-labeled ggugRNA probe. RNA·protein complexes were resolved by EMSA and quantification of both RNA·protein complex and unbound RNA was done by PhosphorImager (Molecular Dynamics). The Kd value determined with ggugRNA was calculated from the concentration of protein that binds 50% of this RNA.

Cooperation of RRM and RGG Domains Determines the RNA Binding Specificity of TLS-- We further investigated the regions of TLS that contribute to the RNA binding specificity by comparing the behavior of recombinant TLS and various mutant recombinant proteins with regard to the ggugRNA or to the mutant ccucRNA, ccRNA, and Delta uagRNA. As expected, the protein containing only the transactivation domain of TLS (AD) bound any of the RNAs (Fig. 5, lanes 13-16). In contrast, RGG1 (lanes 1-4) as well as RRM (lanes 5-8) and RGG2-3 (lanes 9-12) were able to interact with the ggugRNA in EMSA. Compared with the ggugRNA, a significant difference in the ability of the various TLS regions to bind RNA was observed when mutations were introduced in the GGUG motif (ccucRNA) or near this motif (ccRNA and Delta uagRNA). As already observed for TLS (Fig. 3A), the triple mutation G to C in the GGUG core prevented most of the interaction between TLS domains and RNA (Fig. 5, lanes 2, 6, and 10). These data demonstrate that the RGG domains and the RRM region interact independently with RNA and are able to discriminate between two RNA sequences.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5.   RNA binding specificities of RGG1, RRM, and RGG2-3 domains. The abilities of the recombinant proteins AD-RGG1, RRM, RGG2-3, and AD to bind either ggugRNA (lanes 1, 5, 9, 13) or ccucRNA (lanes 2, 6, 10, 14), ccRNA (lanes 3, 7, 11, 15) and Delta uag (lanes 4, 8, 12, 16) were analyzed by EMSA. The RNA·protein complexes were resolved by 6% polyacrylamide gel electrophoresis and visualized by autoradiography.

TLS and hnRNP A1 Exhibit Different RNA Binding Specificities-- The hnRNP A1 has been shown to give some preferences for RNA ligands with a consensus motif UAGGG(A/U) (31). Moreover, we observed that TLS took part in alternative splicing events involving 5'-splice site selection in a similar way than hnRNPA1 (20). It was of interest to determine whether TLS and A1 could bind and compete for the same RNA binding sites. We tested whether TLS was capable of discriminating the A1 binding site from ggugRNA. Fig. 6A shows that TLS did not bind the A1 target RNA (lane 6) in conditions where its binding to ggugRNA was specific (lane 2 for ggugRNA, lane 4 for ccucRNA). Conversely, we analyzed the ability of the purified recombinant GST-A1 to interact with ggugRNA (lane 1) and its mutated form (lane 3). hnRNP A1 did not exhibit any binding specificities for both ggugRNA and ccucRNAs, whereas it recognizes its consensus site with the expected efficiency (lane 7) (31). Therefore, TLS and hnRNP A1 present different RNA binding as determined by EMSA.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   A, comparison of the RNA binding activities of TLS and hnRNP A1: EMSA was performed with GST-A1 (lanes 1, 3, 7) or GST-TLS (lanes 2, 4, 6) and the ggugRNA (lanes 1, 2) or the ccucRNA (lanes 3, 4) or the hnRNP A1 RNA binding motif (lanes 5-7). As control, the binding of GST protein (C) to A1 RNA was tested (lane 5). The sequence of the RNA containing the hnRNP A1 binding site was 5'-GAAGAAUUCAUUAAUACGACUCACUAUAGGGAGAUAUGAUAGGGACUUAGGGUGAUCAAUUCGGAUCCUUAAGUUU-3'. The duplicated consensus A1 binding sites are underlined. The RNA·protein complexes were resolved by 6% polyacrylamide gel electrophoresis and visualized by autoradiography. B, binding of TLS to the beta -tropomyosin IVSB7 pre-mRNA. EMSA was performed with GST-TLS and 32P-labeled RNA IVSB7 mRNA-rich in G repeats (lanes 2-4) or its mutated form (lane 1). Cold ggugRNA (lane 3) and ccucRNA (lane 4) were used as competitors (500-fold molar excess). The RNA·protein complexes were resolved by 6% polyacrylamide gel electrophoresis and visualized by autoradiography. The wild-type IVSB7 RNA sequence was GGCGAAUUCGCUGGGGCUGGGCAGAGCGCGCAGGGUUGAGGGGAGCAGGGUCCUUCACUGGGGUGAA. The G-rich motifs are underlined. The mutated IVS B7 RNA sequence was GGCGAAUUCGCUUCAUCUCACCAGAGCGCGCUCACUUGAGUUCAGCUCUCUCCUUCACUCACCUGAA. The mutated G-rich motifs are underlined.

Binding of TLS to a Natural Pre-mRNA Sequence-- The intron IVSB7 of the chicken beta -tropomyosin pre-mRNA contains several repeats of guanosines similar to the TLS binding motif characterized by SELEX. The intron IVSB7 is either spliced or not during maturation of the beta -tropomyosin pre-mRNA according to the cell type. Three groups of G repeats (RG1, RG2, and RG3; sequences are indicated in Fig. 6 legends) cooperate to control the efficiency of splicing of this intron (37). In particular, elimination of all the G repeats abolishes the intron excision. First, we analyzed by EMSA whether TLS could bind the IVSB7 RNA (Fig. 6B). The recombinant protein formed a complex with the wild type IVSB7 RNA (lane 2). In contrast, no complex was observed when the RNA-carrying mutations in the G-rich regions were used as a probe (lane 1). This suggests that formation of the RNA·TLS complex involved the G repeats in IVSB7 RNA. The formation of this complex is abolished when tested in the presence of a 500-fold excess of ggugRNA (lane 3), whereas competition with 500-fold excess ccucRNA (lane 4) failed to prevent IVSB7·TLS interaction. Similar results were obtained in a reciprocal experiment in which wild-type or mutated IVSB7RNA were used as RNA competitors during the formation of a TLS·ggugRNA complex in EMSA (data not shown). Only an excess of IVSB7 RNA impeded detection of TLS·ggugRNA interaction. These data establish that TLS is able to bind a natural RNA sequence included in an intron of the beta -tropomyosin pre-mRNA and that this interaction involved the G repeats known to play a role in intron excision. Moreover, the ggugRNA but not the ccucRNA competed the formation of the TLS·IVSB7 complex. This cross competition of ggugRNA and IVSB7 for TLS binding is relevant with regard to the specificity of TLS interaction with both the ggugRNA and G repeats.

TLS Binds to ggugRNA in HeLa Nuclear Extracts-- Because all experiments described above were done with a purified recombinant protein, we decided to analyze whether TLS from nuclear extracts could interact with the ggugRNA in UV light-induced cross-linking experiments. The radiolabeled ggugRNA was incubated with HeLa nuclear extracts and subjected to UV cross-linking. After an RNase digestion, cross-linked proteins were analyzed by SDS-PAGE. The ggugRNA appears able to be cross-linked with several proteins (Fig. 7A, lane 2), whereas no proteins were detected when nuclear extracts were not UV-irradiated (Fig. 7A, lane 1). To determine whether TLS is one of these nuclear proteins, HeLa nuclear extracts were UV-cross-linked to ggugRNA before to be immunoprecipitated with an affinity-purified anti-TLS antibody (Fig. 7B). To check the specificity for TLS·RNA interaction, the same experiment was done with a beta -globin mRNA that contains 52% G+U without significant G-rich elements. As observed in Fig. 7B (panel IP), the immunoprecipitation of the cross-linked mixture containing HeLa nuclear extracts and 32P-labeled ggugRNA with an anti-TLS antibody yielded a radiolabeled 69-kDa protein (lane 1). Such a protein was not visible when a 32P-labeled beta -globin RNA was used in cross-linking (lane 6). Thus, endogenous TLS appeared able to distinguish the ggugRNA from an RNA that was irrelevant with regard to the RNA sequences characterized during SELEX. To address further the RNA binding specificity of TLS in HeLa nuclear extracts, a competition assay in which the UV cross-linking was done in the presence of increasing amounts of unlabeled ggugRNA (15× molar and 50× molar excess) (lanes 2 and 3). The ggugRNA competitor reduced detection of immunoprecipitated radiolabeled TLS in a dose-dependent manner. By contrast, unlabeled ccucRNA or beta -globin used as competitors in 50-fold molar excess were not able to compete with ggugRNA for TLS binding (lanes 4 and 5). The presence of identical TLS amounts in immunoprecipitates was controlled by Western blotting with the anti-TLS antibody (20) (Fig. 7B, panel WB). These competition experiments established that endogenous TLS interacts specifically with ggugRNA in HeLa nuclear extracts.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   TLS binds ggugRNA in HeLa cell nuclear extracts. A, 32P-labeled ggugRNA was incubated in HeLa cell nuclear extracts and UV cross-linked (lane 2) or not (lane 1). After RNase treatment, proteins were resolved by 10% SDS-PAGE, transferred to nitrocellulose and autoradiographed. Next, TLS was identified by immunoblotting the nitrocellulose with an anti-TLS antibody (lanes 3, 4). Western blot reveals results of chemiluminescence (panel WB). The arrow points to TLS. B, 32P-labeled ggugRNA was incubated in HeLa cell nuclear extracts and cross-linked with UV light. After RNase treatment, TLS was immunoprecipitated with an anti-TLS antibody (lane 1). Immunoprecipitates were resolved by 10% SDS-PAGE, transferred to nitrocellulose, and autoradiographed (panel IP). As competitor for TLS binding, cold ggugRNA (lane 2, 15-fold molar excess; lane 3, 50-fold molar excess) or cold ccucRNA (lane 4, 50-fold molar excess) were added in HeLa nuclear extracts before cross-linking. Cold beta -globin RNA (lane 5, 50-fold molar excess) was used as an irrelevant competitor. The binding of 32P-labeled beta -globin RNA (beta glo) to TLS was tested as control (lane 6). Then, the comparable levels of TLS in samples was assessed by immunoblotting the membrane with an anti-TLS antibody (panel WB).

TLS Interferes in Vivo on Splicing of Pre-mRNAs through Its RNA Binding Domains-- We previously demonstrated that TLS favors the selection of the distal 5'-splice site during E1A pre-mRNA splicing in vivo (20). Because data described above show that TLS binds RNA by its RGG and RRM domains, we sought to determine whether these domains were involved in mediating the functional interference of TLS with alternative splicing. We have cloned the cDNAs encoding the Myc-tagged deletion mutants of TLS in eukaryotic expression vectors containing a nuclear localization signal. In all transfection experiments, expression of the transfected vectors was ascertained by RT-PCR with primers that discriminate exogenous genes from endogenous genes (Fig. 8D). Given that E1A pre-mRNA contains three alternative 5'-splice sites (Fig. 8B), three primary isoforms of mRNAs (13 S, 12 S, and 9 S) can be detected when expressed in IW1-32 erythroid cells (Fig. 8A, lane 1). By monitoring the appearance of the three mRNA isoforms in an RT-PCR assay performed with 5'- and 3'-exonic E1A primers, we observed that the ratio of 9 S changes according to the expression of TLS domains in transfected cells. Wild-type TLS favors the use of the 5'-splice site in the IW1-32 cells (Fig. 8, A, lane 5, and C). The expression of AD-RGG1-TLS mutant with the E1A minigene in IW1-32 cells did not change the ratio of the various E1A mRNAs (Fig. 8, A, lane 2, and C). Thus, the transcriptional activation domain rich in glutamine residues followed by RGG1 did not participate to the functional interference of TLS with in vivo splicing. The RGG2-3 provoked an increase in the 9 S expression, although this effect was reduced compared with the wild-type TLS (Fig. 8, A, lane 4, and C). Concerning the RRM, a faint increase of the ratio for the 9 S isoform can be detected (Fig. 8, A, lane 3, and C). These effects were reproducibly observed in independent transfection assays. Thus, both the RRM and RGG2-3 were able to interfere with in vivo splicing of the E1A minigene by promoting the preferential utilization of the distal 5'-splice site. However, these interferences appear restrained as compared with entire TLS, suggesting that the full splicing activity of TLS depends on the cooperation of both RRM and RGG2-3 domains. Overall, these results demonstrate that two of the RNA binding domains of TLS are responsible for the functional interference of TLS with in vivo splicing.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 8.   A, RRM and RGG2-3 affect the alternative 5'-splice sites selection in vivo. IW1-32 erythroid cells were transiently transfected with the E1A expression vector either alone (lane 1) or with 3 µg of expression vectors for TLS (lane 5), AD-RGG1 (lane 2), RRM (lane 3), and RGG2-3 (lane 4). Positions of the 13 S, 12 S, and 9 S E1A isoforms as the pre-mRNA are indicated. B, schematic representation of the E1A minigene. The proximal splice sites (prox site), which generate the 13 S and 12 S mRNAs and the distal splice site (dist site), which generates the 9 S mRNA are indicated. The arrows below exons represent the oligonucleotides used for RT-PCR amplification of E1A. C, PhosphorImager quantification of the E1A mRNA isoforms. Percentages of 13 S, 12 S, and 9 S isoforms are represented. D, transcription of the Myc-tagged TLS and Myc-tagged TLS deletion constructs in transfected cells. Total RNAs were amplified by RT-PCR (+), and the RT-PCR products were visualized by electrophoresis. For each sample, a PCR reaction was carried out in the absence of reverse transcriptase (-) to control that no amplification occurred from transfected DNA plasmids.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present studies were undertaken to determine whether TLS presented a specificity of RNA recognition. We have demonstrated that TLS presents an RNA binding specificity related to its ability to recognize a GGUG motif. Our initial observation that TLS was capable of interacting with homoribopolymers with a preference for poly(G) and poly(U), was already indicative of the RNA binding activity of TLS. Although an interaction of TLS with homoribopolymers has been previously described as restricted to poly(G) recognition (8), our data agree with the poly(G) poly(U) binding of the 69-kDa mRNP-associated protein identified later as TLS (30). EWS, which harbors an RNA binding domain very similar to the TLS one, presents also a strong binding activity to both poly(U) and poly(G) (38).2 Thus, TLS and EWS behave similarly toward recognition of both poly(U) and poly(G), suggesting that their common structure could account for their identical RNA binding activity.

To further investigate whether TLS binds RNA in a sequence-specific manner, we analyzed the RNAs selected in vitro from a randomized sequence RNAs pool by a purified recombinant TLS. Seventy-two selected RNA sequences were identified and compared. Fifty-seven percent of them contained a GGUG core sequence. This motif was held as the major determinant of TLS·RNA binding specificity, because a point mutation G to C or U to C within this GGUG element is sufficient to abolish binding of TLS to RNA. However, modifications of nucleotides bordering GGUG core reduced also the TLS·RNA interaction. In particular, the change A to C of the 5'-nucleotide to the GGUG motif of ggugRNA and U to C of the 3'-nucleotide to the GGUG motif prevented the TLS binding. These data suggest that nucleotides surrounding the GGUG motif modulate TLS interaction with RNA either directly or by contributing to a suitable structural conformation of the RNA. TLS contains three domains potentially implicated in RNA binding. The RRM is a 90-amino acid residue domain involved in sequence-specific RNA recognition by many RRM-containing proteins. Most frequently the RRM is present as multiple copies that contribute together to the RNA binding specificity of the protein as described for the hnRNP A1 (39), the Drosophila sex-lethal protein (40), U2AF, ASF/SF2 (41), and nucleolin (42). TLS contains also two RGG-rich regions, a domain known to harbor an RNA binding activity (43). When we investigated the behavior of these domains regarding the ggugRNA recognition, we observed that each one was able to bind RNA. In particular, the RNA binding activity of RRM was not foreseeable, because it did not interact with any of the homoribopolymers. The differences in the nature and the secondary structures of RNAs could account for the apparent discrepancy between the behavior of RRM with regard to its interaction with either a ribonucleotidic sequence RNA or homoribopolymers. It has to be pointed out that RRMs and RGGs seem to have similar abilities to discriminate ggugRNA from its mutated forms as does the entire TLS molecule.

The mechanism involved in RNA recognition by TLS is still unknown. Secondary structure of the RNA is an important component of the RNA·protein interaction. A search for a secondary structure in selected RNA molecules did not make possible a prediction of a common structural conformation for the selected sequences.3 In addition, the selected motifs have neither a bipartite structure as identified in the RNA binding consensus motif for hnRNP A1 (31) nor an inverted repeat or intramolecular base pairing that would form a stem-loop secondary structure as reported for nucleolin (42).

The selected sequences are bound by TLS with affinities ranging from 250 to 600 nM, the highest apparent Kd being 250 nM for the ggugRNA·TLS complex. Thus, TLS seems to be a protein showing a moderate affinity for its RNA ligand. Indeed, an overview of the dissociation constants that characterize the interaction of some RNA binding proteins with their respective ligands gives a Kd value from 1 nM, for the interaction of hnRNP A1 with its RNA binding site identified by SELEX (31), to 600 nM, for the interaction of branchpoint bridging protein, with the branchpoint sequence (44). We cannot rule out that the Kd of the complex TLS·ggugRNA determined in vitro is distantly related to the Kd of a complex RNA·protein in a splicing context. However, a weak affinity of a splicing factor for its target RNA sequence may be one compatible condition with a successful spliceosome assembly that proceeds through exchange and replacement of multiple abundant proteins on a pre-mRNA substrate.

Our previous studies suggested that TLS played a similar role to hnRNP A1 in modulating the 5'-splicing site selection during transient splicing assay of the E1A minigene (20). Our present data show that hnRNP A1 and TLS differ in their RNA binding specificity. TLS is not able to bind the hnRNP A1 target RNA identified by SELEX (31), and reciprocally, hnRNP A1 is not able to bind the TLS-selected RNA in EMSA. In addition, hnRNP A1 targets its RNA binding site with a much greater affinity (Kd of 1 nM) than TLS does. Thus, it seems unlikely that these two proteins perform competitive function in pre-mRNA splicing.

From the RNA competition experiments in nuclear extracts we conclude that the binding of TLS to RNA is specific for RNA containing the GGUG core. The fact that TLS recognizes RNA ligands in a sequence-dependent manner strongly argues for a role of RNA·TLS interaction in vivo. We have previously shown that TLS interferes with the selection of alternative 5'-splice sites during processing of the E1A pre-mRNA in vivo (20). Our present data indicate that RRM and RGG2-3 are involved in the modulation of this splicing model, although with a reduced efficiency as compared with the effect of wild-type TLS. In contrast to their similar behaviors with regard to specific RNA recognition, RGG1, RRM, and RGG2-3 act in different ways in regulation of alternative splicing. Strikingly, the RGG2-3, which displays most of the splicing activity, has been shown to recruit members of the serine-arginine family of splicing factors such as SC35 and TASR (28). The authors report that association of these SR proteins to TLS alters the influence of TLS on E1A pre-mRNA splicing. SR proteins function both in constitutive and alternative pre-mRNA splicing, and RNA binding sites have been identified for several of them (45). It is noteworthy that the RGG2-3 region in TLS appears involved at the same time, in specific RNA recognition, in alternative splice site selection, and in recruiting splicing factors. Whether the activity of TLS in splicing is linked to its ability to identify intronic or exonic RNA elements remains to be determined.

The nature and the function of the RNA sequences targeted by TLS is also an opened question. Sequences as short as GGAAG (46), (A/U)GGG (37), or G triplets (47) can act, respectively, either as exonic or intronic splicing enhancers to improve splice site selectivity. The biological relevance of the GGUG consensus motif in a splicing process remains to be determined. The GGUG motif did not make possible a search for a statistically significant matching in the data bases that would be informative regarding the location of the selected RNA sequences within pre-mRNAs or the nature of the RNAs bound by TLS in vivo. It was intriguing to observe the repeated presence of the GGUG motif in the RNA sequences selected by the U2AF35 splicing factor which recognizes the 3'-splice site AG dinucleotide (48). Such an interaction of TLS with the 3'-splice site has already been suggested when it was identified as the factor cross-linked to the AG dinucleotide at the 3'-splice site of an adenovirus major late pre-mRNA substrate (27). However, no selection with regard to the presence of an A upstream of the GGUG motif could be deduced from the TLS-selected RNA sequences excluding that a potential 3'-splice site was directly recognized by TLS. Nevertheless, we tested the consequences of the addition of an excess of the ggugRNA in an in vitro splicing assay using a beta -globin minigene model to determine whether this RNA could impede pre-mRNA maturation. We could not observe any modifications of the pre-mRNA splicing that would suggest a capacity of the ggugRNA sequence to titrate some splicing factors involved in splice site selection (data not shown). However, it seems obvious from the cross-linking experiment without immunoprecipitation that many other proteins besides TLS bind ggugRNA in nuclear extracts and subsequently are able to titrate the ggugRNA. They may explain the inability of the ggugRNA to compete for recognition of the splice sites by splicing factors.

Hence, TLS appears as an RNA binding protein that recognizes a GGUG motif. It remains unclear whether the role of TLS in splicing is determined by its ability to target specific RNA elements within pre-mRNA or small nuclear RNAs. Other investigations will be required to identify both the role of TLS and the possible function of such a GGUG motif in splicing of a pre-mRNA.


    ACKNOWLEDGEMENTS

We are grateful to Dr. D. Bouthinon, Université Paris XIII, for his expertise in predictive analysis of the RNA secondary structures. We thank Nicole Denis for her excellent technical assistance. We also thank Stephane Barnache and Christel Guillouf for helpful discussions and critical reading of the manuscript, and Jean de Gunzburg and Jacques Camonis for valuable comments. We thank Julianna Smith for English correction of the manuscript.


    FOOTNOTES

* This work was supported in part by grants from INSERM, the Association pour la Recherche sur la Cancer, the Ligue Nationale de Recherche contre le Cancer and the Institut Curie (Paris, France).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by a poste vert from INSERM and a grant from the Fondation pour la Recherche Médicale.

|| Supported by a fellowship from the Association pour la Recherche sur la Cancer.

Present address: INSERM U474, Maternité Port Royal, 123 Bd. Port Royal, 75014 Paris, France.

** Present address: CGM, CNRS, Av. de la Terrasse - 91190 Gif-sur-Yvette - France.

Dagger Dagger To whom correspondence should be addressed: Tel.: 33-1-42-34-66-52; Fax: 33-1-42-34-66-50; E-mail: framoreau@curie.fr.

Published, JBC Papers in Press, November 29, 2000, DOI 10.1074/jbc.M008304200

2 A. Lerga, M. Hallier, L. Delva, C. Orvain, I. Gallais, J. Marie, and F. Moreau-Gachelin, unpublished data.

3 D. Bouthinon, personal communication.


    ABBREVIATIONS

The abbreviations used are: TLS, Translocated in LipoSarcoma; RRM, RNA recognition motif; RGG domain, Arg-Gly-Gly repeats; hnRNP, high nuclear ribonucleoprotein; GST, glutathione S-transferase; PAGE, polyacrylamide gel electrophoresis; RT, reverse transcriptase; PCR, polymerase chain reaction; DTT, dithiothreitol; EMSA, electrophoretic mobility shift assay; DOC, Na deoxycholate; SELEX, systematic evolution of ligands by exponential enrichment.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Crozat, A., Aman, P., Mandahl, N., and Ron, D. (1993) Nature 363, 640-644
2. Rabbitts, T. H., Forster, A., Larson, R., and Nathan, P. (1993) Nat. Genet. 4, 175-180
3. Ichikawa, H., Shimizu, K., Hayashi, Y., and Ohki, M. (1994) Cancer Res. 54, 2865-2868
4. Panagopoulos, I., Aman, P., Fioretos, T., Hoglund, M., Johansson, B., Mandahl, N., Heim, S., Behrendtz, M., and Mitelman, F. (1994) Genes Chromosomes Cancer 11, 256-262
5. Delattre, O., Zucman, J., Plougastel, B., Desmaze, C., Melot, T., Peter, M., Kovar, H., Joubert, I., De Jong, P., Rouleau, G., Aurias, A., and Thomas, G. (1992) Nature 359, 162-165
6. Zucman, J., Melot, T., Desmaze, C., Ghysdael, J., Plougastel, B., Peter, M., Zucker, J.-M., Triche, J. T., Sheer, D., Turc-Carel, C., Ambros, P., Combaret, V., Lenoir, G., Aurias, A., Thomas, G., and Delattre, O. (1993) EMBO J. 12, 4481-4487
7. May, W. A., Lessnick, S. L., Braun, B. S., Klemsz, M., Lewis, B. C., Lunsford, L. B., Hromas, R., and Denny, C. T. (1993) Mol. Cell. Biol. 13, 7393-7398
8. Prasad, D. D. K., Ouchida, M., Lee, L., Rao, V. N., and Reddy, E. S. P. (1994) Oncogene 9, 3717-3729
9. Zinszner, H., Albalat, R., and Ron, D. (1994) Genes Dev. 8, 2513-2526
10. Bailly, R. A., Bosselut, R., Zucman, J., Cormier, F., Delattre, O., Roussel, M., Thomas, G., and Ghysdael, J. (1994) Mol. Cell. Biol. 14, 3230-3241
11. Ichikawa, H., Shimizu, K., Katsu, R., and Ohki, M. (1999) Mol. Cell. Biol. 19, 7639-7650
12. Kuroda, M., Sok, J., Webb, L., Baechtold, H., Urano, F., Yin, Y., Chung, P., de Rooij, D. G., Akhmedov, A., Ashley, T., and Ron, D. (2000) EMBO J. 19, 453-462
13. Hicks, G. G., Singh, N., Nashabi, A., Mai, S., Bozek, G., Klewes, L., Arapovic, D., White, E. K., Koury, M. J., Oltz, E. M., Van Kaer, L., and Ruley, H. E. (2000) Nat. Genet. 24, 175-179
14. Bertrand, P., Akhmedov, A. T., Delacote, F., Durrbach, A., and Lopez, B. S. (1999) Oncogene 18, 4515-4521
15. Baechtold, H., Kuroda, M., Sok, J., Ron, D., Lopez, B. S., and Akhmedov, A. T. (1999) J. Biol. Chem. 274, 34337-34342
16. Bertolotti, A., Lutz, Y., Heard, D. J., Chambon, P., and Tora, L. (1996) EMBO J. 15, 5022-5031
17. Bertolotti, A., Melot, T., Acker, J., Vigneron, M., Delattre, O., and Tora, L. (1998) Mol. Cell. Biol. 18, 1489-1497
18. Perrotti, D., Bonatti, S., Trotta, R., Martinez, R., Skorski, T., Salomoni, P., Grassilli, E., Iozzo, R. V., Cooper, D. R., and Calabretta, B. (1998) EMBO J. 17, 4442-4455
19. Powers, C. A., Mathur, M., Raaka, B. M., Ron, D., and Samuels, H. H. (1998) Mol. Endocrinol. 12, 4-18
20. Hallier, M., Lerga, A., Barnache, S., Tavitian, A., and MoreauGachelin, F. (1998) J. Biol. Chem. 273, 4838-4842
21. Calvio, C., Neubauer, G., Mann, M., and Lamond, A. I. (1995) RNA (N. Y.) 1, 724-733
22. Hackl, W., Fischer, U., and Lührmann, R. (1994) J. Cell Biol. 124, 261-272
23. Zinszner, H., Sok, J., Immanuel, D., Yin, Y., and Ron, D. (1997) J. Cell Sci. 110, 1741-1750
24. Immanuel, D., Zinszner, H., and Ron, D. (1995) Mol. Cell. Biol. 15, 4562-4571
25. Stolow, D. T., and Haynes, R. H. (1995) Nucleic Acids Res. 23, 835-843
26. Pinol-Roma, S., and Dreyfuss, G. (1992) Nature 355, 730-732
27. Wu, S. P., and Green, M. R. (1997) EMBO J. 16, 4421-4432
28. Yang, L., Embree, L. J., Tsai, S., and Hickstein, D. D. (1998) J. Biol. Chem. 273, 27761-27764
29. Yang, L., Embree, L. J., and Hickstein, D. D. (2000) Mol. Cell. Biol. 20, 3345-3354
30. Hackl, W., and Luhrmann, R. (1996) J. Mol. Biol. 264, 843-851
31. Burd, C. G., and Dreyfuss, G. (1994) EMBO J. 13, 1197-1204
32. Tacke, R., and Manley, J. L. (1995) EMBO J. 14, 3540-3551
33. Hallier, M., Tavitian, A., and Moreau-Gachelin, F. (1996) J. Biol. Chem. 271, 11177-11181
34. Clouet d'Orval, B., d'Aubenton Carafa, Y., Sirand-Pugnet, P., Gallego, M., Brody, E., and Marie, J. (1991) Science 252, 1823-1828
35. Krainer, A. R., Maniatis, T., Ruskin, B., and Green, M. R. (1984) Cell 36, 993-1005
36. Tambourin, P., Casadevall, N., Choppin, J., Lacombe, C., Heard, J. M., Fichelson, S., Wendling, F., Hankins, W. D., and Varet, B. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 6269-6273
37. Sirand-Pugnet, P., Durosay, P., Brody, E., and Marie, J. (1995) Nucleic Acids Res. 23, 3501-3507
38. Ohno, T., Ouchida, M., Lee, L., Gatalica, Z., Rao, V. N., and Reddy, E. S. P. (1994) Oncogene 9, 3087-3097
39. Xu, R. M., Jokhan, L., Cheng, X. D., Mayeda, A., and Krainer, A. R. (1997) Structure 5, 559-570
40. Handa, N., Nureki, O., Kurimoto, K., Kim, I., Sakamoto, H., Shimura, Y., Muto, Y., and Yokoyama, S. (1999) Nature 398, 579-585
41. Chandler, S. D., Mayeda, A., Yeakley, J. M., Krainer, A. R., and Fu, X. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3596-3601
42. Ghisolfi-Nieto, L., Joseph, G., Puvion-Dutilleul, F., Amalric, F., and Bouvet, P. (1996) J. Mol. Biol. 260, 34-53
43. Kiledjian, M., and Dreyfuss, G. (1992) EMBO J. 11, 2655-2664
44. Berglund, J. A., Chua, K., Abovich, N., Reed, R., and Rosbash, M. (1997) Cell 89, 781-787
45. Tacke, R., and Manley, J. L. (1999) Curr. Opin. Cell Biol. 11, 358-362
46. Dirksen, W. P., Hampson, R. K., Sun, Q., and Rottman, F. M. (1994) J. Biol. Chem. 269, 6431-6436
47. McCullough, A. J., and Berget, S. M. (1997) Mol. Cell. Biol. 17, 4562-4571
48. Wu, S., Romfo, C. M., Nilsen, T. W., and Green, M. R. (1999) Nature 402, 832-835


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
H. K. Lee and S. Jeong
{beta}-Catenin stabilizes Cyclooxygenase-2 mRNA by interacting with AU-rich elements of 3'-UTR
Nucleic Acids Res., November 14, 2006; 34(19): 5705 - 5714.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Guillouf, I. Gallais, and F. Moreau-Gachelin
Spi-1/PU.1 Oncoprotein Affects Splicing Decisions in a Promoter Binding-dependent Manner
J. Biol. Chem., July 14, 2006; 281(28): 19145 - 19155.
[Abstract] [Full Text] [PDF]


Home page