![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 9, 6807-6816, March 2, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
¶,
,
,
,

From
INSERM U528, Institut Curie-Recherche, 26 rue
d'Ulm, 75248 Paris, Cedex 05, France
Received for publication, August 14, 2000, and in revised form, November 7, 2000
| |
ABSTRACT |
|---|
|
|
|---|
The TLS/FUS gene
is involved in a recurrent chromosomal translocation in human myxoid
liposarcomas. We previously reported that TLS is a
potential splicing regulator able to modulate the 5'-splice site
selection in an E1A pre-mRNA. Using an in vitro selection procedure, we investigated whether TLS exhibits a specificity with regard to RNA recognition. The RNAs selected by TLS share a common
GGUG motif. Mutation of a G or U residue within this motif abolishes
the interaction of TLS with the selected RNAs. We showed that TLS can
bind GGUG-containing RNAs with a 250 nM affinity. By UV
cross-linking/competition and immunoprecipitation experiments, we
demonstrated that TLS recognizes a GGUG-containing RNA in nuclear
extracts. Each one of the RNA binding domains (the three RGG boxes and
the RNA recognition motif) contributes to the specificity of the
TLS·RNA interaction, whereas only RRM and RGG2-3 participate to the
E1A alternative splicing in vivo. The specificity of the
TLS·RNA interaction was also observed using as natural pre-mRNA,
the G-rich IVSB7 intron of the TLS (Translocated in
LipoSarcoma)1 or
FUS has been first characterized as a rearranged gene in
chromosomal translocations specific of human myxoid liposarcoma (1, 2).
The resulting fusion protein contains the N-terminal part of TLS fused
to a transcription factor of the CAAT/enhancer-binding protein family
of proteins: CHOP. In an acute myeloid leukemia, TLS is also
involved in a chromosomal breakpoint that juxtaposes the same
N-terminal region of TLS to a transcription factor of the ETS proteins
family: ERG-1 (3, 4). TLS is highly similar to
EWS, a gene implicated in chromosomal translocations that
are specific of the tumors of the Ewing family (5, 6). In most of these
sarcoma, the N-terminal region of EWS is fused to the DNA binding
domain of either ERG-1 or FLI-1, which are two closely related ETS proteins.
Both TLS and EWS have in common a similar structural organization.
Their C terminus part contains multiple domains that are involved in
RNA·protein interactions: an RNA recognition motif (RRM) flanked by
two regions rich in Arg-Gly-Gly repeats (RGG domains) and a
C2C2 zinc finger. In their N terminus domain,
they contain a glutamine-, serine-, and tyrosine-rich region that
functions as a transcriptional activation domain when fused to a
heterologous DNA binding domain (7-9). In oncogenic chimera, the
adjunction of this N-terminal region of TLS or EWS to the
transcriptional regulators CHOP, FLI-1, or ERG-1 generates
proteins with transcriptional activities that differ from those of the
wild-type counterpart (8, 10). From these data it has been proposed
that the oncogenic fusion proteins disturb the expression of genes that
are regulated by CHOP, FLI-1, or ERG-1. However, no cellular targets
for these oncoproteins have yet been identified. Moreover, the
N-terminal region of TLS or EWS in chimeric proteins could have a
dominant negative effect on the function of the germ-line TLS and EWS
as suggested from the recent identification of oncogenic determinants in the N-terminal domain of TLS (11). The biological activity of TLS is
still not clearly understood. Indeed, analysis of TLS-deficient mice
suggests a possible role of TLS in both repairing DNA damage (12) and
maintaining genomic integrity (13). According to these biological data,
various biochemical studies identified TLS as a protein involved in
pairing DNA sequences during homologous recombination (14, 15).
Other data argue for a role of TLS in regulation of gene
transcription. TLS as EWS and the highly similar factor hTAFII
68 have been purified in distinct TFIID complexes associated
with the RNA polymerase II (16, 17). In that way, they may function as
basal transcriptional regulators participating in the recognition of
transcriptional promoter and initiation of gene transcription. Moreover, TLS is able to behave as a DNA binding protein (18), and
several cellular partners of TLS that have been identified are
transcription factors. These are the nuclear receptors of the thyroid
and steroid hormones (19) and the ETS transcription factor Spi-1/PU.1
(20).
TLS is also presumed to play a role in splicing process. TLS is the
high nuclear ribonucleoprotein (hnRNP) p2 that has been identified in a
protein complex assembled on adenovirus pre-mRNA (21). TLS is
engaged in a complex with the hnRNPs A1 and C1/C2 (9) and associates
with several spliceosomal small nuclear ribonucleoproteins (22). TLS is
complexed to RNA polymerase II transcripts in UV-irradiated HeLa cell
extracts (23), which are consistent with the location of the
Drosophila homologue of TLS (SARFH/CAZ) (24, 25) on
actively transcribed regions in the polytene chromosomes of salivary
glands. In addition, RNA polymerase II inhibitors induce relocation of
TLS from the nucleus to the cytoplasm, and this TLS shuttling depends
on its C-terminal RNA binding domain (9) (26). Thus, TLS has an RNA
binding activity, presents an alternative nucleocytoplasmic location, and associates with hnRNP complexes; all of these properties are hallmarks of hnRNPs. Moreover, TLS was found to be associated with the
AG dinucleotide during the 3'-splice site recognition step (27), and it
takes part to the selection of alternative splice sites in an E1A
pre-mRNA splicing assay (20). In addition, TLS can recruit, by its
C terminus RGG-rich region (28, 29), two splicing regulators of the
serine/arginine-rich protein (SR) family. Altogether, these data
strongly suggest that TLS might function as a splicing factor.
These various functions, describing TLS as a protein participating
either in transcription or splicing processes, may involve, at a given
time, an interaction of TLS with DNA and/or RNA. Indeed, it has been
reported that TLS is capable of binding RNA (8, 23, 30) as well as both
single- and double-stranded DNA (18). In particular, TLS targets a zinc
finger consensus sequence in DNA and, in so doing, could participate in
the transcriptional regulation of some cytokine receptors in myeloid
cells (18). Some proteins that contain RRM motifs such as hnRNP A1 (31) and the SR proteins such as SC35 and ASF/SF2 (32) have been shown to
target specific mRNA short motifs involved in pre-RNA splicing.
However, little is known about the RNA recognition specificity of TLS,
and whether the role of TLS in RNA splicing depends on its RNA binding
specificity is an opened question. To gain further insight into
RNA·TLS interaction, we performed a selection/amplification of RNAs
from pools of random sequence RNAs. Here we show that TLS is able to
target specifically RNAs containing a GGUG motif both in
vitro and in vivo. We also determined that the
specificity of RNA recognition depends on the cooperation of the three
RNA binding domains of TLS.
Expression Plasmids--
The bacterial expression vectors for
the fusion proteins GST-TLS, GST-AD, GST-AD-RGG1, GST-RGG2-3, GST-RRM,
and GST-Spi-1 as well as the purification of the proteins have been
described previously (20, 33). The eukaryotic pCS3-nMT expression
vector contains the simian cytomegalovirus IE94 promoter-enhancer, the SV40 nuclear localization signal, and six copies of the 9E10-Myc epitope. pCS3-nMT-TLS, pCS3-nMT-AD-RGG1, pCS3-nMT-RRM, and
pCS3-nMT-RGG2-3 encode fusion proteins between the nuclear
localization signal-Myc epitope and TLS amino acids 1-526, 1-271,
271-392, and 392-526, respectively. pCS3-MT-E1A has already been
described (20).
In Vitro Homoribopolymer Binding Assay--
In vitro
translated proteins were synthesized using TnT-coupled reticulocyte
lysates (Promega) and 35S-labeled methionine. Radiolabeled
proteins were incubated with homoribopolymers prebound to agarose beads
(Amersham Pharmacia Biotech) 10 min at 4 °C in a buffer (10 mM Tris-HCl, pH 7.4, 2.5 mM MgCl2,
0.5% Triton X-100, 100 mM NaCl, 200 µg/ml yeast
tARN) and washed extensively with the same buffer. Finally, the
bound proteins were analyzed by electrophoresis on a 10% SDS-PAGE and visualized by fluorography.
SELEX--
A library was generated by PCR amplification from a
pool of chemically synthesized oligonucleotides
(5'-CCGCGGATCCTAATACGACTCACTATAGGGGCCACCAACGACATTGAGTCGACCAATGCAAGCTT(N25)GTTGATATCAATAGTGCCCATGAATGCGCGGAATTCGGG-3') in which (N25) is a 25-nucleotide randomized
sequence. This oligonucleotide library was amplified by PCR with 2 units of ampli-Taq polymerase (PerkinElmer Life Sciences) in
50 µl of buffer (2 mM MgCl2, 40 pmol of the
primers 5'-BH I (5'-CCGCGGATCCTAATACGACT-3') and rev-ER I
(5'-CCCGAATTCCGCGCATTCAT-3') and 400 µM dXTP for 30 cycles under the following conditions: denaturation (95 °C, 1 min),
annealing (54 °C, 30 s), and elongation (72 °C, 1 min). The
resulting DNA was digested with BamHI and EcoRI
and purified in 1.5% agarose gel. From this oligonucleotide pool (500 ng), corresponding RNAs (sample unselected) were synthesized and
capped in vitro with 20 units of T7 RNA polymerase (Promega)
from the T7 promoter contained in the 5'-end of the random
oligonucleotides in the presence of 0.5 mM rXTP, 40 units
of RNasin (Promega) at 37 °C for 1 h. Following transcription,
the DNA template was degraded by 50 units of RNase-free DNase (Roche
Molecular Biochemicals) at 37 °C for 30 min. The full-length
transcripts were selected on 6% polyacrylamide gels in 8 M
urea, eluted from gel in buffer containing 0.5 M ammonium acetate, 2 mM EDTA, and 0.2% sodium dodecyl sulfate. After
phenol:chloroform extraction and ethanol precipitation, the RNAs were
resuspended in water and quantified spectrophotometrically.
For the first round of selection, the resulting RNA library
(unselected RNAs: 10 µg) was incubated for 30 min on ice with GST-TLS fusion protein (50 pmol) prebound to glutathione-Sepharose in
200 µl of binding buffer (200 mM KCl, 20 mM
Hepes, pH 7.5, 2 mM MgCl2, 100 µg/ml yeast
tRNA, and 40 units of RNasin). After extensive washing in the binding
buffer, the RNAs bound with GST-TLS were treated with Proteinase K
(Roche Molecular Biochemicals) 30 min at 55 °C, phenol:chloroform
was extracted, and ethanol was precipitated. This new pool of RNAs was
retrotranscribed with 200 units of SuperScript II reverse transcriptase
(Life Technologies, Inc.) in the presence of 10 mM DTT, 0.5 mM dNTP, and 40 pmol of rev-ERI primer. Then a tenth
of the cDNA was amplified by PCR with the ampli-Taq
polymerase and the primers rev-ERI and T7-PCR (5'-CCGCGGATCCTAATACGACTCACTATAGGGGCCACCAACGACATTGAGTCGACCAATGCAAGCTT-3'), which contains a T7 promoter sequence. The amplified DNA was digested with BamHI and EcoRI and purified before
beginning the next round of transcription, selection, and amplification.
When the selection was carried out by electrophoretic mobility shift
assay (EMSA), 500 ng of DNA was used for in vitro
transcription with T7 RNA polymerase (60 units), 10 mM DTT,
0.5 mM ATP, CTP, and UTP, 50 µM GTP, and 10 µCi of [
After the last round of selection, the resultant
BamHI-EcoRI DNA was cloned into pBluescript SK+
vector (Stratagene) and sequenced.
RNA Probes--
The hnRNP A1 target pre-mRNA was transcribed
by T7 polymerase from DNA template amplified by PCR with the primer A1
5'ER1, 5'-GAAGAATTCATTAATACGAC-3', and the primer rev5'BH1ex6B. The
Electrophoretic Mobility Shift Assay--
For the assays
determining the affinity of GST-TLS to ggugRNA and the binding of
GST-TLS, GST-AD, GST-AD-RGG1, GST-RRM, and GST-RGG2-3 to various RNA
probes, EMSAs were made as described above with 5 pmol of protein and 1 pmol of RNA. For competition experiments, the 32P-labeled
probe was incubated 15 min on ice with protein before addition of RNA
competitors. The RNA·TLS complexes were migrated on 6%
polyacrylamide gels in 0.5× TBE buffer, run at 100 V, and autoradiographed.
UV Cross-linking Assay--
For UV cross-linking experiments,
RNAs were labeled with both 10 µCi of [ In Vivo Splicing Assay--
IW1-32 cells (a murine
erythroleukemic cell line) (36) were cultured in TLS Binds Poly(G) and Poly(U)--
We first analyzed the ability
of TLS to bind homoribopolymers. We also looked for the RNA binding
activity of the N- and C-truncated TLS proteins to assess the
respective role of the RRM and RGG domains in RNA binding. The
35S-radiolabeled proteins were synthesized with
reticulocyte lysate, then bound on polyribonucleotidic agarose beads.
Bound proteins were analyzed by SDS-PAGE (Fig.
1A). Under conditions in which full-length TLS binds well both poly(G) and poly(U), the RRM alone interacts with any one of the homoribopolymers. Moreover, the TLS
N-terminal protein (AD-RGG1) binds exclusively poly(U), whereas the
C-terminal part (RGG2-3) binds poly(G) much more efficiently than
poly(U). None of these proteins bind poly(A) and poly(C). Thus, the RGG
boxes appear as the regions involved in RNA binding. However, because
they present a differential binding to poly(G) and poly(U), we
hypothesize that the specificity of full-length TLS RNA binding results
from the cooperation of RNA binding activities of the different RGG
boxes.
TLS Binds RNA with Sequence Specificity--
To further
characterize the binding of TLS to RNA, we performed a SELEX
(systematic evolution of ligands by exponential enrichment) experiment
using the recombinant fusion protein GST-TLS (glutathione S-transferase-TLS). The selection was initiated from a
library of degenerated RNAs containing a 25-nucleotide random sequence. Four rounds of RNA selection by a GST-TLS affinity chromatography followed by 3 rounds of RNA selection by EMSA were carried out. The
selection procedure was monitored by the ability of TLS to form a
complex with the RNA pools derived from each round of selection in EMSA
as compared with the shifted complex observed with the initial RNA
pool. Finally, the selected RNAs were retrotranscribed, amplified by
PCR, and cloned. Seventy-two clones were sequenced. All of them
contained a different 25-nt sequence motif. These sequences were mainly
G/U-rich (35.6% G and 28.2% U versus 19% A and 18% C),
which is consistent with the preferential binding of TLS to
homoribopolymers poly(G) and poly(U) observed above. Moreover,
comparative analysis of individual selected sequences revealed that 39 among the 72 sequences (54%) had in common a GGUG motif (Fig.
2A). Sequence analysis of the
33 other clones did not reveal any common motif, although they
contained G-rich or U-rich sequence elements that could account for
their selection by TLS (data not shown). RNA were produced from seven
different clones with a GGUG core motif and used as probes to compare
their respective binding to TLS in EMSA. A complex corresponding to RNA·TLS was easily observed with each one of these RNAs (Fig. 2B) in contrast to the hard detection of the complex of TLS
with the initial unselected random RNAs pool (Fig.
3A, lane 1).
Further investigation was pursued with RNA transcribed from clone 9, because it induced TLS with the more strongly shifted band (Fig.
2B). This RNA will be referred as ggugRNA below.
To examine further the importance of the common GGUG motif in TLS·RNA
interaction, we compared binding of TLS to the ggugRNA and to a set of
RNAs mutated inside this motif or in surrounding positions by EMSA
(Fig. 3A). The triple mutation that converts GGUG in CCUC
(ccucRNA) as well as single mutations that change GGUG in GCUG (c2RNA)
or GGCG (c3RNA) completely abolished the interaction with TLS.
Mutations localized next to the GGUG motif, i.e.
substitution of A to C (c5RNA), double mutation of U to C (ccRNA), and
UAG deletion (
The specificity of TLS·RNA binding was ascertained using competition
assays (Fig. 3B). 32P-Labeled ggugRNA was
incubated with a 50- to 500-fold molar excess of unlabeled ggugRNA.
Cold ggugRNA was capable of compete binding of the labeled RNA in a
dose-dependent manner (Fig. 3B, lanes 2-4). In contrast, the ccucRNA was inactive as competitor at even the highest concentration (500-fold) (Fig. 3B, lane
5). These results provide strong evidence that TLS recognizes
in vitro an RNA in a manner dependent upon sequence specificity.
The binding affinity of the ggugRNA to TLS was determined using EMSA
with increasing concentrations of GST-TLS protein and a constant amount
of ggugRNA (Fig. 4). This experiment was
repeated with three different protein batches. The ratio of bound
versus unbound RNA amounts was determined by quantification
with a PhosphorImager. The apparent dissociation constant
(Kd) was calculated from the TLS quantity, which
binds half of the radiolabeled RNA probe. TLS binds ggugRNA with a
Kd of 250 nM. We also calculated the
apparent dissociation constant of complexes formed between TLS and six
other GGUG-containing RNAs identified during SELEX and used as probes
in EMSA (data not shown). Each one presented a lower binding affinity
than ggugRNA with Kd values ranging from 300 to 600 nM.
Cooperation of RRM and RGG Domains Determines the RNA Binding
Specificity of TLS--
We further investigated the regions of TLS
that contribute to the RNA binding specificity by comparing the
behavior of recombinant TLS and various mutant recombinant proteins
with regard to the ggugRNA or to the mutant ccucRNA, ccRNA, and
TLS and hnRNP A1 Exhibit Different RNA Binding
Specificities--
The hnRNP A1 has been shown to give some
preferences for RNA ligands with a consensus motif UAGGG(A/U)
(31). Moreover, we observed that TLS took part in alternative splicing
events involving 5'-splice site selection in a similar way than hnRNPA1
(20). It was of interest to determine whether TLS and A1 could bind and
compete for the same RNA binding sites. We tested whether TLS was
capable of discriminating the A1 binding site from ggugRNA. Fig.
6A shows that TLS did not bind
the A1 target RNA (lane 6) in conditions where its binding
to ggugRNA was specific (lane 2 for ggugRNA, lane
4 for ccucRNA). Conversely, we analyzed the ability of the
purified recombinant GST-A1 to interact with ggugRNA (lane
1) and its mutated form (lane 3). hnRNP A1 did not
exhibit any binding specificities for both ggugRNA and ccucRNAs,
whereas it recognizes its consensus site with the expected efficiency (lane 7) (31). Therefore, TLS and hnRNP A1 present different RNA binding as determined by EMSA.
Binding of TLS to a Natural Pre-mRNA Sequence--
The intron
IVSB7 of the chicken TLS Binds to ggugRNA in HeLa Nuclear Extracts--
Because all
experiments described above were done with a purified recombinant
protein, we decided to analyze whether TLS from nuclear extracts could
interact with the ggugRNA in UV light-induced cross-linking
experiments. The radiolabeled ggugRNA was incubated with HeLa nuclear
extracts and subjected to UV cross-linking. After an RNase digestion,
cross-linked proteins were analyzed by SDS-PAGE. The ggugRNA appears
able to be cross-linked with several proteins (Fig.
7A, lane 2),
whereas no proteins were detected when nuclear extracts were not
UV-irradiated (Fig. 7A, lane 1). To determine
whether TLS is one of these nuclear proteins, HeLa nuclear extracts
were UV-cross-linked to ggugRNA before to be immunoprecipitated with an
affinity-purified anti-TLS antibody (Fig. 7B). To check the
specificity for TLS·RNA interaction, the same experiment was done
with a TLS Interferes in Vivo on Splicing of Pre-mRNAs through Its RNA
Binding Domains--
We previously demonstrated that TLS favors the
selection of the distal 5'-splice site during E1A pre-mRNA splicing
in vivo (20). Because data described above show that TLS
binds RNA by its RGG and RRM domains, we sought to determine whether
these domains were involved in mediating the functional interference of
TLS with alternative splicing. We have cloned the cDNAs encoding the Myc-tagged deletion mutants of TLS in eukaryotic expression vectors
containing a nuclear localization signal. In all transfection experiments, expression of the transfected vectors was ascertained by
RT-PCR with primers that discriminate exogenous genes from endogenous
genes (Fig. 8D). Given that
E1A pre-mRNA contains three alternative 5'-splice sites (Fig.
8B), three primary isoforms of mRNAs (13 S, 12 S, and 9 S) can be detected when expressed in IW1-32 erythroid cells (Fig.
8A, lane 1). By monitoring the appearance of the
three mRNA isoforms in an RT-PCR assay performed with 5'- and
3'-exonic E1A primers, we observed that the ratio of 9 S changes
according to the expression of TLS domains in transfected cells.
Wild-type TLS favors the use of the 5'-splice site in the IW1-32 cells
(Fig. 8, A, lane 5, and C). The
expression of AD-RGG1-TLS mutant with the E1A minigene in IW1-32 cells
did not change the ratio of the various E1A mRNAs (Fig. 8,
A, lane 2, and C). Thus, the
transcriptional activation domain rich in glutamine residues followed
by RGG1 did not participate to the functional interference of TLS with
in vivo splicing. The RGG2-3 provoked an increase in the 9 S expression, although this effect was reduced compared with the
wild-type TLS (Fig. 8, A, lane 4, and
C). Concerning the RRM, a faint increase of the ratio for
the 9 S isoform can be detected (Fig. 8, A, lane
3, and C). These effects were reproducibly observed in
independent transfection assays. Thus, both the RRM and RGG2-3 were
able to interfere with in vivo splicing of the E1A minigene
by promoting the preferential utilization of the distal 5'-splice site.
However, these interferences appear restrained as compared with entire
TLS, suggesting that the full splicing activity of TLS depends on the
cooperation of both RRM and RGG2-3 domains. Overall, these results
demonstrate that two of the RNA binding domains of TLS are responsible
for the functional interference of TLS with in vivo
splicing.
The present studies were undertaken to determine whether TLS
presented a specificity of RNA recognition. We have demonstrated that
TLS presents an RNA binding specificity related to its ability to
recognize a GGUG motif. Our initial observation that TLS was capable of
interacting with homoribopolymers with a preference for poly(G) and
poly(U), was already indicative of the RNA binding activity of TLS.
Although an interaction of TLS with homoribopolymers has been
previously described as restricted to poly(G) recognition (8), our data
agree with the poly(G) poly(U) binding of the 69-kDa mRNP-associated
protein identified later as TLS (30). EWS, which harbors an RNA binding
domain very similar to the TLS one, presents also a strong binding
activity to both poly(U) and poly(G)
(38).2 Thus, TLS and EWS
behave similarly toward recognition of both poly(U) and poly(G),
suggesting that their common structure could account for their
identical RNA binding activity.
To further investigate whether TLS binds RNA in a sequence-specific
manner, we analyzed the RNAs selected in vitro from a randomized sequence RNAs pool by a purified recombinant TLS.
Seventy-two selected RNA sequences were identified and compared.
Fifty-seven percent of them contained a GGUG core sequence. This motif
was held as the major determinant of TLS·RNA binding specificity, because a point mutation G to C or U to C within this GGUG element is
sufficient to abolish binding of TLS to RNA. However, modifications of
nucleotides bordering GGUG core reduced also the TLS·RNA interaction. In particular, the change A to C of the 5'-nucleotide to the GGUG motif
of ggugRNA and U to C of the 3'-nucleotide to the GGUG motif prevented
the TLS binding. These data suggest that nucleotides surrounding the
GGUG motif modulate TLS interaction with RNA either directly or by
contributing to a suitable structural conformation of the RNA. TLS
contains three domains potentially implicated in RNA binding. The RRM
is a 90-amino acid residue domain involved in sequence-specific RNA
recognition by many RRM-containing proteins. Most frequently the RRM is
present as multiple copies that contribute together to the RNA binding
specificity of the protein as described for the hnRNP A1 (39), the
Drosophila sex-lethal protein (40), U2AF, ASF/SF2 (41), and
nucleolin (42). TLS contains also two RGG-rich regions, a domain known
to harbor an RNA binding activity (43). When we investigated the
behavior of these domains regarding the ggugRNA recognition, we
observed that each one was able to bind RNA. In particular, the RNA
binding activity of RRM was not foreseeable, because it did not
interact with any of the homoribopolymers. The differences in the
nature and the secondary structures of RNAs could account for the
apparent discrepancy between the behavior of RRM with regard to its
interaction with either a ribonucleotidic sequence RNA or
homoribopolymers. It has to be pointed out that RRMs and RGGs seem to
have similar abilities to discriminate ggugRNA from its mutated forms
as does the entire TLS molecule.
The mechanism involved in RNA recognition by TLS is still unknown.
Secondary structure of the RNA is an important component of the
RNA·protein interaction. A search for a secondary structure in
selected RNA molecules did not make possible a prediction of a common
structural conformation for the selected
sequences.3 In addition, the
selected motifs have neither a bipartite structure as identified in the
RNA binding consensus motif for hnRNP A1 (31) nor an inverted repeat or
intramolecular base pairing that would form a stem-loop secondary
structure as reported for nucleolin (42).
The selected sequences are bound by TLS with affinities ranging from
250 to 600 nM, the highest apparent Kd
being 250 nM for the ggugRNA·TLS complex. Thus, TLS seems
to be a protein showing a moderate affinity for its RNA ligand. Indeed,
an overview of the dissociation constants that characterize the
interaction of some RNA binding proteins with their respective ligands
gives a Kd value from 1 nM, for the
interaction of hnRNP A1 with its RNA binding site identified by SELEX
(31), to 600 nM, for the interaction of branchpoint
bridging protein, with the branchpoint sequence (44). We cannot
rule out that the Kd of the complex TLS·ggugRNA
determined in vitro is distantly related to the
Kd of a complex RNA·protein in a splicing context. However, a weak affinity of a splicing factor for its target RNA sequence may be one compatible condition with a successful spliceosome assembly that proceeds through exchange and replacement of multiple abundant proteins on a pre-mRNA substrate.
Our previous studies suggested that TLS played a similar role to hnRNP
A1 in modulating the 5'-splicing site selection during transient
splicing assay of the E1A minigene (20). Our present data show that
hnRNP A1 and TLS differ in their RNA binding specificity. TLS is not
able to bind the hnRNP A1 target RNA identified by SELEX (31), and
reciprocally, hnRNP A1 is not able to bind the TLS-selected RNA in
EMSA. In addition, hnRNP A1 targets its RNA binding site with a much
greater affinity (Kd of 1 nM) than TLS
does. Thus, it seems unlikely that these two proteins perform
competitive function in pre-mRNA splicing.
From the RNA competition experiments in nuclear extracts we conclude
that the binding of TLS to RNA is specific for RNA containing the GGUG
core. The fact that TLS recognizes RNA ligands in a
sequence-dependent manner strongly argues for a role of
RNA·TLS interaction in vivo. We have previously shown that
TLS interferes with the selection of alternative 5'-splice sites during
processing of the E1A pre-mRNA in vivo (20). Our present
data indicate that RRM and RGG2-3 are involved in the modulation of
this splicing model, although with a reduced efficiency as compared
with the effect of wild-type TLS. In contrast to their similar
behaviors with regard to specific RNA recognition, RGG1, RRM, and
RGG2-3 act in different ways in regulation of alternative splicing.
Strikingly, the RGG2-3, which displays most of the splicing activity,
has been shown to recruit members of the serine-arginine family of
splicing factors such as SC35 and TASR (28). The authors report that
association of these SR proteins to TLS alters the influence of TLS on
E1A pre-mRNA splicing. SR proteins function both in constitutive
and alternative pre-mRNA splicing, and RNA binding sites have been
identified for several of them (45). It is noteworthy that the RGG2-3
region in TLS appears involved at the same time, in specific RNA
recognition, in alternative splice site selection, and in recruiting
splicing factors. Whether the activity of TLS in splicing is linked to its ability to identify intronic or exonic RNA elements remains to be determined.
The nature and the function of the RNA sequences targeted by TLS is
also an opened question. Sequences as short as GGAAG (46), (A/U)GGG
(37), or G triplets (47) can act, respectively, either as exonic or
intronic splicing enhancers to improve splice site selectivity. The
biological relevance of the GGUG consensus motif in a splicing process
remains to be determined. The GGUG motif did not make possible a search
for a statistically significant matching in the data bases that would
be informative regarding the location of the selected RNA sequences
within pre-mRNAs or the nature of the RNAs bound by TLS in
vivo. It was intriguing to observe the repeated presence of the
GGUG motif in the RNA sequences selected by the U2AF35
splicing factor which recognizes the 3'-splice site AG
dinucleotide (48). Such an interaction of TLS with the 3'-splice
site has already been suggested when it was identified as the factor
cross-linked to the AG dinucleotide at the 3'-splice site of an
adenovirus major late pre-mRNA substrate (27). However, no
selection with regard to the presence of an A upstream of the GGUG
motif could be deduced from the TLS-selected RNA sequences excluding
that a potential 3'-splice site was directly recognized by TLS.
Nevertheless, we tested the consequences of the addition of an excess
of the ggugRNA in an in vitro splicing assay using a
Hence, TLS appears as an RNA binding protein that recognizes a GGUG
motif. It remains unclear whether the role of TLS in splicing is
determined by its ability to target specific RNA elements within pre-mRNA or small nuclear RNAs. Other investigations will be
required to identify both the role of TLS and the possible function of such a GGUG motif in splicing of a pre-mRNA.
-tropomyosin pre-mRNA. Moreover,
we determined that RNA binding specificities of TLS and high nuclear
ribonucleoprotein A1 were different. Hence, our results help define the
role of the specific interaction of TLS with RNA during the
splicing process of a pre-mRNA.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]GTP (3000 Ci/mmol) (PerkinElmer Life
Sciences). Radiolabeled RNAs were treated with 50 units of DNase I
(Roche Molecular Biochemicals) 30 min at 37 °C and electrophoresed
in 6% acrylamide-8 M urea gels. Visualized by
autoradiography, the RNAs were extracted from gel slice in buffer
containing 0.5 M ammonium acetate, 2 mM EDTA, 0.2% sodium dodecyl sulfate, and ethanol-precipitated. The
32P-labeled RNAs were incubated with purified protein (0.5 µg) in 20 µl of RNA binding buffer containing 50 mM
KCl, 20 mM Hepes, pH 7.5, 50% glycerol, and 100 µg/ml
tRNA, for 30 min on ice. The mixture was loaded on 6% polyacrylamide
gels in 0.5× TBE buffer (0.089 M Tris borate, pH 8, 0.01 mM EDTA) and run at 100 volts for 2 h. The shifted
RNA·protein complex was excised from the gel, eluted with buffer
containing 0.5 M ammonium acetate, 2 mM EDTA,
0.2% sodium dodecyl sulfate, and precipitated. This RNA was used for
reverse transcription, and the resulting cDNA was amplified by PCR
to start the next cycle of selection.
-tropo IVSB7 RNA was transcribed by T7 polymerase from DNA template
amplified by PCR from pSma plasmid (34) with the primers 5'T7tro,
5'-AATTAATACGACTCACTATAGGGTATGACCTGGTGGAGC-3', and REVtro,
5'-TTCACCCCAGTGAAGGACCC-3'. The mutated
-tropo IVSB7 RNA was
transcribed by T7 polymerase from the pSma1,2,3 plasmid (34) with the
primers 5'T7tro and REVtromut 5'-TTCAGGTGAGTGAAGGAGAG-3'. The
-globin minigene from exon 1 to exon 2 was transcribed with SP6 RNA polymerase from the BamHI-linearized plasmid pSP64
(35) and purified as described above. For each probe, 100 ng of the template was transcribed in the presence of 5 µCi of
[
-32P]UTP (3000 Ci/mmol).
-32P]GTP
and 10 µCi of [
-32P]UTP. 32P-Labeled
purified RNAs (500fmol) were incubated with 8 µl of HeLa cell nuclear
extracts (Computer Cell Culture Center, Belgium) in 22 µl of splicing
mixture containing 3.2 mM MgCl2, 0.5 mM ATP, 20 mM creatine phosphate, 3% (w/v)
polyvinyl alcohol, 4 mM DTT for 15 min at room temperature.
For competition experiments, unlabeled RNAs were incubated for 30 min
before addition of the probe. The reaction mixtures were transferred to
a microtiter plate and exposed to UV light (100 mJ/cm2) at
a distance of 4 cm from UV light source (254 nm) for 15 min on ice
using a UV cross-linker (Stratalinker, Amersham Pharmacia Biotech). Samples were treated with RNase A (1 mg/ml) and RNase T1 (2.5 units/µl) (Sigma) 30 min at 37 °C, subjected to an 8% SDS-PAGE,
and autoradiographed. Immunoprecipitation experiments were performed
with the affinity-purified anti-TLS antibody (20) prebound to protein
A-Sepharose beads (Amersham Pharmacia Biotech). Cross-linked samples
were added in radioimmune precipitation buffer (150 mM
NaCl, 50 mM Tris, pH 8, 1% Nonidet P-40, 0.5% DOC, 0.1% SDS) and incubated 2 h at 4 °C. The immunoprecipitates were
washed twice with 500 mM NaCl, 10 mM Tris, pH
7.5, 1% DOC, 0.1% SDS, and twice with 10 mM Tris, pH 7.5, 0.5% DOC, 0.1% SDS. Finally, the Sepharose bead pellets were boiled 5 min in 2× Laemmli buffer before loading onto a SDS-8% polyacrylamide
gel. 10% of the total cross-linked extracts and all of the
immunoprecipitated proteins were loaded.
-modified Eagle's
medium (Life Technologies, Inc.) supplemented with 10% fetal calf
serum. 2 × 106 cells were transfected with 0.3 µg
of the E1A reporter vector pCS3-MT-E1A and 3 µg of the various
expression vectors pCS3-nMT-TLS, pCS3-nMT-AD-RGG1, pCS3-nMT-RRM,
pCS3-nMT-RGG2-3, and pCS3-nMT as control. The DNAs were mixed with a
LipofectAMINE and LipofectAMINE plus mixture (Life Technologies, Inc.)
according to the manufacturer's instructions. Cells were harvested
20 h post-transfection. Transfection efficiencies were normalized
by cotransfection of a pCMV-Luciferase reporter vector (1 µg). Total
RNAs were purified and treated with DNase I as previously described
(20). The E1A splicing products were analyzed by RT-PCR. 1 µg of RNA
was retrotranscribed with Moloney murine leukemia virus Superscript II
reverse transcriptase (Life Technologies, Inc.). The PCR amplification
was performed with Taq DNA polymerase (PerkinElmer Life
Sciences) in the presence of a 5'-E1A primer, which was previously
5'-end-labeled with T4 polynucleotide kinase (Roche Molecular
Biochemicals) and [
-32P]ATP (Amersham Pharmacia
Biotech) as described elsewhere (20). The cycle numbers were kept to a
minimum (18-22 cycles) to detect signals in the linear range. Negative
control reactions for RT-PCR contained an RNA template that had not
undergone reverse transcription. E1A RT-PCR products were resolved on
6% polyacrylamide/urea gels, detected by autoradiography, and
quantified by a PhosphorImager (Molecular Dynamics). Expressions of
transfected TLS and TLS deletion mutants were detected by RT-PCR using
reverse primers specific to each of the TLS protein-encoding cDNAs
and a forward primer specific for the Myc epitope. All transfection
experiments were repeated four times at least with various vector batches.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (24K):
[in a new window]
Fig. 1.
A, TLS binds preferentially the
homoribopolymers poly(G) and poly(U). Radiolabeled proteins were
synthesized in reticulocyte lysate programmed with cDNAs encoding
TLS and the TLS deletion mutants AD-RGG1, RRM, and RGG2-3 in the
presence of [35S]methionine. Labeled proteins bound to
the indicated homoribopolymers (lanes A, C,
G, U) were analyzed by 10% SDS-polyacrylamide
gel followed by fluorography. Input corresponds to half of
the protein amount used for polymer interaction test. B,
schematic representation of TLS and the deletion mutants constructed to
map the RNA binding specificity of each one of the RNA binding domains.
The numbers refer to the amino acid of the protein.
AD, transcriptional activation domain; RRM, RNA
recognition motif; RGG, Arg-Gly-Gly-rich motif;
ZnF, zinc finger.

View larger version (42K):
[in a new window]
Fig. 2.
A, alignment of RNA sequences selected
by TLS using the SELEX strategy. RNA sequences were aligned with regard
to the presence of the GGUG motif indicated in boldface.
Numbers at the left of the RNA sequences refer to
the corresponding cDNA clone number. Capital letters
represent nucleotides in the 25-nucleotide random sequence.
Lowercase letters represent the nucleotides from the primer
sequences used for amplification. *, clones used for further RNA
binding analysis. B, EMSA used to screen clones obtained
from the SELEX procedure. Inserts from individual clones were amplified
by PCR and transcribed in vitro. Following gel purification,
RNA species were used in EMSA with recombinant TLS and resolved on a
6% polyacrylamide gel. The RNA species number is indicated above
the panel. The RNA transcribed from clone 9 (ggugRNA) was selected
for further characterization.

View larger version (32K):
[in a new window]
Fig. 3.
Sequence specificity of TLS RNA binding.
A, mutational analysis: EMSA was performed with GST-TLS and
either 32P-labeled ggugRNA (lane 2) or various
mutant forms of ggugRNA (lanes 3-8). The RNAs used as probe
were indicated above each lane and their sequences were
given below. In lane 1, the unselected
(uns) RNA was synthesized from the unselected RNAs pool used for
SELEX. The RNA·protein complexes were resolved by a 6%
polyacrylamide gel electrophoresis and visualized by autoradiography.
B, competition analysis: EMSA was performed with GST-TLS and
32P-labeled ggugRNA probe in the absence (lane
1) or in the presence of increasing concentrations (50-, 100-, and
500-fold molar excess) of cold ggugRNA (lanes 2-4) or cold
mutated ccucRNA (500-fold molar excess) (lane 5) used as
competitors.
uagRNA), was less efficient in impairing the TLS
binding. These data support the hypothesis that the GGUG motif
is a TLS recognition site and also reveal that additional ribonucleotidic elements proximal to this motif contribute to an
efficient interaction between RNA and TLS.

View larger version (54K):
[in a new window]
Fig. 4.
Affinity of TLS for binding ggugRNA.
Increasing amounts of recombinant TLS (lane 1, 0 µg;
lane 2, 0.1 µg; lane 3, 0.2 µg; lane
4, 0.3 µg; lane 5, 0.4 µg; lane 6, 0.5 µg; lane 7, 1 µg; lane 8, 2 µg) were added
to the 32P-labeled ggugRNA probe. RNA·protein complexes
were resolved by EMSA and quantification of both RNA·protein complex
and unbound RNA was done by PhosphorImager (Molecular Dynamics). The
Kd value determined with ggugRNA was calculated from
the concentration of protein that binds 50% of this RNA.
uagRNA. As expected, the protein containing only the transactivation
domain of TLS (AD) bound any of the RNAs (Fig.
5, lanes 13-16). In contrast, RGG1 (lanes 1-4) as well as RRM (lanes 5-8) and
RGG2-3 (lanes 9-12) were able to interact with the ggugRNA
in EMSA. Compared with the ggugRNA, a significant difference in the
ability of the various TLS regions to bind RNA was observed when
mutations were introduced in the GGUG motif (ccucRNA) or near this
motif (ccRNA and
uagRNA). As already observed for TLS (Fig.
3A), the triple mutation G to C in the GGUG core prevented
most of the interaction between TLS domains and RNA (Fig. 5,
lanes 2, 6, and 10). These data
demonstrate that the RGG domains and the RRM region interact independently with RNA and are able to discriminate between two RNA
sequences.

View larger version (32K):
[in a new window]
Fig. 5.
RNA binding specificities of RGG1, RRM, and
RGG2-3 domains. The abilities of the recombinant proteins
AD-RGG1, RRM, RGG2-3, and AD to bind either ggugRNA (lanes
1, 5, 9, 13) or ccucRNA
(lanes 2, 6, 10, 14), ccRNA
(lanes 3, 7, 11, 15) and
uag (lanes 4, 8, 12, 16)
were analyzed by EMSA. The RNA·protein complexes were resolved by 6%
polyacrylamide gel electrophoresis and visualized by
autoradiography.

View larger version (26K):
[in a new window]
Fig. 6.
A, comparison of the RNA binding
activities of TLS and hnRNP A1: EMSA was performed with GST-A1
(lanes 1, 3, 7) or GST-TLS
(lanes 2, 4, 6) and the ggugRNA
(lanes 1, 2) or the ccucRNA (lanes 3,
4) or the hnRNP A1 RNA binding motif (lanes
5-7). As control, the binding of GST protein (C) to A1
RNA was tested (lane 5). The sequence of the RNA containing
the hnRNP A1 binding site was
5'-GAAGAAUUCAUUAAUACGACUCACUAUAGGGAGAUAUGAUAGGGACUUAGGGUGAUCAAUUCGGAUCCUUAAGUUU-3'.
The duplicated consensus A1 binding sites are underlined.
The RNA·protein complexes were resolved by 6% polyacrylamide gel
electrophoresis and visualized by autoradiography. B,
binding of TLS to the
-tropomyosin IVSB7 pre-mRNA. EMSA was
performed with GST-TLS and 32P-labeled RNA IVSB7
mRNA-rich in G repeats (lanes 2-4) or its mutated form
(lane 1). Cold ggugRNA (lane 3) and ccucRNA
(lane 4) were used as competitors (500-fold molar excess).
The RNA·protein complexes were resolved by 6% polyacrylamide gel
electrophoresis and visualized by autoradiography. The wild-type IVSB7
RNA sequence was
GGCGAAUUCGCUGGGGCUGGGCAGAGCGCGCAGGGUUGAGGGGAGCAGGGUCCUUCACUGGGGUGAA.
The G-rich motifs are underlined. The mutated IVS B7 RNA
sequence was
GGCGAAUUCGCUUCAUCUCACCAGAGCGCGCUCACUUGAGUUCAGCUCUCUCCUUCACUCACCUGAA.
The mutated G-rich motifs are underlined.
-tropomyosin pre-mRNA contains several
repeats of guanosines similar to the TLS binding motif characterized by
SELEX. The intron IVSB7 is either spliced or not during maturation of
the
-tropomyosin pre-mRNA according to the cell type. Three
groups of G repeats (RG1, RG2, and RG3; sequences are indicated in Fig.
6 legends) cooperate to control the efficiency of splicing of this
intron (37). In particular, elimination of all the G repeats abolishes
the intron excision. First, we analyzed by EMSA whether TLS could bind
the IVSB7 RNA (Fig. 6B). The recombinant protein formed a
complex with the wild type IVSB7 RNA (lane 2). In contrast,
no complex was observed when the RNA-carrying mutations in the G-rich
regions were used as a probe (lane 1). This suggests that
formation of the RNA·TLS complex involved the G repeats in IVSB7 RNA.
The formation of this complex is abolished when tested in the presence
of a 500-fold excess of ggugRNA (lane 3), whereas
competition with 500-fold excess ccucRNA (lane 4) failed to
prevent IVSB7·TLS interaction. Similar results were obtained in a
reciprocal experiment in which wild-type or mutated IVSB7RNA were used
as RNA competitors during the formation of a TLS·ggugRNA complex in
EMSA (data not shown). Only an excess of IVSB7 RNA impeded detection of
TLS·ggugRNA interaction. These data establish that TLS is able to
bind a natural RNA sequence included in an intron of the
-tropomyosin pre-mRNA and that this interaction involved the G
repeats known to play a role in intron excision. Moreover, the ggugRNA
but not the ccucRNA competed the formation of the TLS·IVSB7 complex.
This cross competition of ggugRNA and IVSB7 for TLS binding is relevant
with regard to the specificity of TLS interaction with both the ggugRNA
and G repeats.
-globin mRNA that contains 52% G+U without significant
G-rich elements. As observed in Fig. 7B (panel
IP), the immunoprecipitation of the cross-linked mixture containing HeLa nuclear extracts and 32P-labeled ggugRNA
with an anti-TLS antibody yielded a radiolabeled 69-kDa protein
(lane 1). Such a protein was not visible when a 32P-labeled
-globin RNA was used in cross-linking
(lane 6). Thus, endogenous TLS appeared able to distinguish
the ggugRNA from an RNA that was irrelevant with regard to the RNA
sequences characterized during SELEX. To address further the RNA
binding specificity of TLS in HeLa nuclear extracts, a competition
assay in which the UV cross-linking was done in the presence of
increasing amounts of unlabeled ggugRNA (15× molar and 50× molar
excess) (lanes 2 and 3). The ggugRNA competitor
reduced detection of immunoprecipitated radiolabeled TLS in a
dose-dependent manner. By contrast, unlabeled ccucRNA or
-globin used as competitors in 50-fold molar excess were not able to
compete with ggugRNA for TLS binding (lanes 4 and
5). The presence of identical TLS amounts in
immunoprecipitates was controlled by Western blotting with the anti-TLS
antibody (20) (Fig. 7B, panel WB). These
competition experiments established that endogenous TLS interacts
specifically with ggugRNA in HeLa nuclear extracts.

View larger version (28K):
[in a new window]
Fig. 7.
TLS binds ggugRNA in HeLa cell nuclear
extracts. A, 32P-labeled ggugRNA was incubated
in HeLa cell nuclear extracts and UV cross-linked (lane 2)
or not (lane 1). After RNase treatment, proteins were
resolved by 10% SDS-PAGE, transferred to nitrocellulose and
autoradiographed. Next, TLS was identified by immunoblotting the
nitrocellulose with an anti-TLS antibody (lanes 3,
4). Western blot reveals results of chemiluminescence
(panel WB). The arrow points to TLS.
B, 32P-labeled ggugRNA was incubated in HeLa
cell nuclear extracts and cross-linked with UV light. After RNase
treatment, TLS was immunoprecipitated with an anti-TLS antibody
(lane 1). Immunoprecipitates were resolved by 10% SDS-PAGE,
transferred to nitrocellulose, and autoradiographed (panel
IP). As competitor for TLS binding, cold ggugRNA (lane
2, 15-fold molar excess; lane 3, 50-fold molar excess)
or cold ccucRNA (lane 4, 50-fold molar excess) were added in
HeLa nuclear extracts before cross-linking. Cold
-globin RNA
(lane 5, 50-fold molar excess) was used as an irrelevant
competitor. The binding of 32P-labeled
-globin RNA
(
glo) to TLS was tested as control (lane
6). Then, the comparable levels of TLS in samples was assessed by
immunoblotting the membrane with an anti-TLS antibody (panel
WB).

View larger version (31K):
[in a new window]
Fig. 8.
A, RRM and RGG2-3 affect the
alternative 5'-splice sites selection in vivo. IW1-32
erythroid cells were transiently transfected with the E1A expression
vector either alone (lane 1) or with 3 µg of expression
vectors for TLS (lane 5), AD-RGG1 (lane 2), RRM
(lane 3), and RGG2-3 (lane 4). Positions of the
13 S, 12 S, and 9 S E1A isoforms as the pre-mRNA are indicated.
B, schematic representation of the E1A minigene. The
proximal splice sites (prox site), which generate the 13 S
and 12 S mRNAs and the distal splice site (dist site),
which generates the 9 S mRNA are indicated. The arrows
below exons represent the oligonucleotides used for RT-PCR
amplification of E1A. C, PhosphorImager quantification of
the E1A mRNA isoforms. Percentages of 13 S, 12 S, and 9 S isoforms
are represented. D, transcription of the Myc-tagged TLS and
Myc-tagged TLS deletion constructs in transfected cells. Total RNAs
were amplified by RT-PCR (+), and the RT-PCR products were visualized
by electrophoresis. For each sample, a PCR reaction was carried out in
the absence of reverse transcriptase (
) to control that no
amplification occurred from transfected DNA plasmids.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-globin minigene model to determine whether this RNA could impede
pre-mRNA maturation. We could not observe any modifications of the
pre-mRNA splicing that would suggest a capacity of the ggugRNA
sequence to titrate some splicing factors involved in splice site
selection (data not shown). However, it seems obvious from the
cross-linking experiment without immunoprecipitation that many other
proteins besides TLS bind ggugRNA in nuclear extracts and subsequently
are able to titrate the ggugRNA. They may explain the inability of the
ggugRNA to compete for recognition of the splice sites by splicing factors.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Dr. D. Bouthinon, Université Paris XIII, for his expertise in predictive analysis of the RNA secondary structures. We thank Nicole Denis for her excellent technical assistance. We also thank Stephane Barnache and Christel Guillouf for helpful discussions and critical reading of the manuscript, and Jean de Gunzburg and Jacques Camonis for valuable comments. We thank Julianna Smith for English correction of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by grants from INSERM, the Association pour la Recherche sur la Cancer, the Ligue Nationale de Recherche contre le Cancer and the Institut Curie (Paris, France).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by a poste vert from INSERM and a grant from the Fondation pour la Recherche Médicale.
Supported by a fellowship from the Association pour la
Recherche sur la Cancer.
¶ Present address: INSERM U474, Maternité Port Royal, 123 Bd. Port Royal, 75014 Paris, France.
** Present address: CGM, CNRS, Av. de la Terrasse - 91190 Gif-sur-Yvette - France.

To whom correspondence should be addressed: Tel.:
33-1-42-34-66-52; Fax: 33-1-42-34-66-50; E-mail:
framoreau@curie.fr.
Published, JBC Papers in Press, November 29, 2000, DOI 10.1074/jbc.M008304200
2 A. Lerga, M. Hallier, L. Delva, C. Orvain, I. Gallais, J. Marie, and F. Moreau-Gachelin, unpublished data.
3 D. Bouthinon, personal communication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: TLS, Translocated in LipoSarcoma; RRM, RNA recognition motif; RGG domain, Arg-Gly-Gly repeats; hnRNP, high nuclear ribonucleoprotein; GST, glutathione S-transferase; PAGE, polyacrylamide gel electrophoresis; RT, reverse transcriptase; PCR, polymerase chain reaction; DTT, dithiothreitol; EMSA, electrophoretic mobility shift assay; DOC, Na deoxycholate; SELEX, systematic evolution of ligands by exponential enrichment.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Crozat, A., Aman, P., Mandahl, N., and Ron, D. (1993) Nature 363, 640-644 |
| 2. | Rabbitts, T. H., Forster, A., Larson, R., and Nathan, P. (1993) Nat. Genet. 4, 175-180 |
| 3. | Ichikawa, H., Shimizu, K., Hayashi, Y., and Ohki, M. (1994) Cancer Res. 54, 2865-2868 |
| 4. | Panagopoulos, I., Aman, P., Fioretos, T., Hoglund, M., Johansson, B., Mandahl, N., Heim, S., Behrendtz, M., and Mitelman, F. (1994) Genes Chromosomes Cancer 11, 256-262 |
| 5. | Delattre, O., Zucman, J., Plougastel, B., Desmaze, C., Melot, T., Peter, M., Kovar, H., Joubert, I., De Jong, P., Rouleau, G., Aurias, A., and Thomas, G. (1992) Nature 359, 162-165 |
| 6. | Zucman, J., Melot, T., Desmaze, C., Ghysdael, J., Plougastel, B., Peter, M., Zucker, J.-M., Triche, J. T., Sheer, D., Turc-Carel, C., Ambros, P., Combaret, V., Lenoir, G., Aurias, A., Thomas, G., and Delattre, O. (1993) EMBO J. 12, 4481-4487 |
| 7. | May, W. A., Lessnick, S. L., Braun, B. S., Klemsz, M., Lewis, B. C., Lunsford, L. B., Hromas, R., and Denny, C. T. (1993) Mol. Cell. Biol. 13, 7393-7398 |
| 8. | Prasad, D. D. K., Ouchida, M., Lee, L., Rao, V. N., and Reddy, E. S. P. (1994) Oncogene 9, 3717-3729 |
| 9. | Zinszner, H., Albalat, R., and Ron, D. (1994) Genes Dev. 8, 2513-2526 |
| 10. | Bailly, R. A., Bosselut, R., Zucman, J., Cormier, F., Delattre, O., Roussel, M., Thomas, G., and Ghysdael, J. (1994) Mol. Cell. Biol. 14, 3230-3241 |
| 11. | Ichikawa, H., Shimizu, K., Katsu, R., and Ohki, M. (1999) Mol. Cell. Biol. 19, 7639-7650 |
| 12. | Kuroda, M., Sok, J., Webb, L., Baechtold, H., Urano, F., Yin, Y., Chung, P., de Rooij, D. G., Akhmedov, A., Ashley, T., and Ron, D. (2000) EMBO J. 19, 453-462 |
| 13. | Hicks, G. G., Singh, N., Nashabi, A., Mai, S., Bozek, G., Klewes, L., Arapovic, D., White, E. K., Koury, M. J., Oltz, E. M., Van Kaer, L., and Ruley, H. E. (2000) Nat. Genet. 24, 175-179 |
| 14. | Bertrand, P., Akhmedov, A. T., Delacote, F., Durrbach, A., and Lopez, B. S. (1999) Oncogene 18, 4515-4521 |
| 15. | Baechtold, H., Kuroda, M., Sok, J., Ron, D., Lopez, B. S., and Akhmedov, A. T. (1999) J. Biol. Chem. 274, 34337-34342 |
| 16. | Bertolotti, A., Lutz, Y., Heard, D. J., Chambon, P., and Tora, L. (1996) EMBO J. 15, 5022-5031 |
| 17. | Bertolotti, A., Melot, T., Acker, J., Vigneron, M., Delattre, O., and Tora, L. (1998) Mol. Cell. Biol. 18, 1489-1497 |
| 18. | Perrotti, D., Bonatti, S., Trotta, R., Martinez, R., Skorski, T., Salomoni, P., Grassilli, E., Iozzo, R. V., Cooper, D. R., and Calabretta, B. (1998) EMBO J. 17, 4442-4455 |
| 19. | Powers, C. A., Mathur, M., Raaka, B. M., Ron, D., and Samuels, H. H. (1998) Mol. Endocrinol. 12, 4-18 |
| 20. | Hallier, M., Lerga, A., Barnache, S., Tavitian, A., and MoreauGachelin, F. (1998) J. Biol. Chem. 273, 4838-4842 |
| 21. | Calvio, C., Neubauer, G., Mann, M., and Lamond, A. I. (1995) RNA (N. Y.) 1, 724-733 |
| 22. | Hackl, W., Fischer, U., and Lührmann, R. (1994) J. Cell Biol. 124, 261-272 |
| 23. | Zinszner, H., Sok, J., Immanuel, D., Yin, Y., and Ron, D. (1997) J. Cell Sci. 110, 1741-1750 |
| 24. | Immanuel, D., Zinszner, H., and Ron, D. (1995) Mol. Cell. Biol. 15, 4562-4571 |
| 25. | Stolow, D. T., and Haynes, R. H. (1995) Nucleic Acids Res. 23, 835-843 |
| 26. | Pinol-Roma, S., and Dreyfuss, G. (1992) Nature 355, 730-732 |
| 27. | Wu, S. P., and Green, M. R. (1997) EMBO J. 16, 4421-4432 |
| 28. | Yang, L., Embree, L. J., Tsai, S., and Hickstein, D. D. (1998) J. Biol. Chem. 273, 27761-27764 |
| 29. | Yang, L., Embree, L. J., and Hickstein, D. D. (2000) Mol. Cell. Biol. 20, 3345-3354 |
| 30. | Hackl, W., and Luhrmann, R. (1996) J. Mol. Biol. 264, 843-851 |
| 31. | Burd, C. G., and Dreyfuss, G. (1994) EMBO J. 13, 1197-1204 |
| 32. | Tacke, R., and Manley, J. L. (1995) EMBO J. 14, 3540-3551 |
| 33. | Hallier, M., Tavitian, A., and Moreau-Gachelin, F. (1996) J. Biol. Chem. 271, 11177-11181 |
| 34. | Clouet d'Orval, B., d'Aubenton Carafa, Y., Sirand-Pugnet, P., Gallego, M., Brody, E., and Marie, J. (1991) Science 252, 1823-1828 |
| 35. | Krainer, A. R., Maniatis, T., Ruskin, B., and Green, M. R. (1984) Cell 36, 993-1005 |
| 36. | Tambourin, P., Casadevall, N., Choppin, J., Lacombe, C., Heard, J. M., Fichelson, S., Wendling, F., Hankins, W. D., and Varet, B. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 6269-6273 |
| 37. | Sirand-Pugnet, P., Durosay, P., Brody, E., and Marie, J. (1995) Nucleic Acids Res. 23, 3501-3507 |
| 38. | Ohno, T., Ouchida, M., Lee, L., Gatalica, Z., Rao, V. N., and Reddy, E. S. P. (1994) Oncogene 9, 3087-3097 |
| 39. | Xu, R. M., Jokhan, L., Cheng, X. D., Mayeda, A., and Krainer, A. R. (1997) Structure 5, 559-570 |
| 40. | Handa, N., Nureki, O., Kurimoto, K., Kim, I., Sakamoto, H., Shimura, Y., Muto, Y., and Yokoyama, S. (1999) Nature 398, 579-585 |
| 41. | Chandler, S. D., Mayeda, A., Yeakley, J. M., Krainer, A. R., and Fu, X. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3596-3601 |
| 42. | Ghisolfi-Nieto, L., Joseph, G., Puvion-Dutilleul, F., Amalric, F., and Bouvet, P. (1996) J. Mol. Biol. 260, 34-53 |
| 43. | Kiledjian, M., and Dreyfuss, G. (1992) EMBO J. 11, 2655-2664 |
| 44. | Berglund, J. A., Chua, K., Abovich, N., Reed, R., and Rosbash, M. (1997) Cell 89, 781-787 |
| 45. | Tacke, R., and Manley, J. L. (1999) Curr. Opin. Cell Biol. 11, 358-362 |
| 46. | Dirksen, W. P., Hampson, R. K., Sun, Q., and Rottman, F. M. (1994) J. Biol. Chem. 269, 6431-6436 |
| 47. | McCullough, A. J., and Berget, S. M. (1997) Mol. Cell. Biol. 17, 4562-4571 |
| 48. | Wu, S., Romfo, C. M., Nilsen, T. W., and Green, M. R. (1999) Nature 402, 832-835 |
This article has been cited by other articles:
![]() |
H. K. Lee and S. Jeong {beta}-Catenin stabilizes Cyclooxygenase-2 mRNA by interacting with AU-rich elements of 3'-UTR Nucleic Acids Res., November 14, 2006; 34(19): 5705 - 5714. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guillouf, I. Gallais, and F. Moreau-Gachelin Spi-1/PU.1 Oncoprotein Affects Splicing Decisions in a Promoter Binding-dependent Manner J. Biol. Chem., July 14, 2006; 281(28): 19145 - 19155. [Abstract] [Full Text] [PDF] |
||||
![]() |