|
Originally published In Press as doi:10.1074/jbc.M104170200 on October 31, 2001
J. Biol. Chem., Vol. 277, Issue 1, 854-861, January 4, 2002
c-myc Is a Downstream Target of the Smad
Pathway*,
Ken
Yagi ,
Masao
Furuhashi ,
Hiromasa
Aoki ,
Daisuke
Goto ,
Hiroyuki
Kuwano§,
Kazuo
Sugamura¶,
Kohei
Miyazono , and
Mitsuyasu
Kato **
From the Department of Biochemistry, The Cancer
Institute of the Japanese Foundation for Cancer Research and Research
for the Future Program, Japan Society for the Promotion of Science,
1-37-1 Kami-ikebukuro, Toshima-ku, Tokyo 170-8455, Japan, the
§ First Department of Surgery, Gunma University School of
Medicine, 3-39-22 Schowa-machi, Maebashi, Gunma 371-8511, Japan, the
¶ Department of Microbiology, Tohoku University School of
Medicine, 2-1 Seiryo-machi Aoba-ku, Sendai 980-8575, Japan, and the
Department of Molecular Pathology, Graduate School of
Medicine, University of Tokyo, Tokyo 113-0033, Japan
Received for publication, May 9, 2001, and in revised form, September 24, 2001
 |
ABSTRACT |
c-Myc is one of the most potent regulators of
cell cycle progression in higher eukaryotes. Down-regulation of c-Myc
is a critical event for growth inhibition induced by transforming
growth factor- (TGF- ) and is frequently impaired in cancer cells.
We determined a Smad-responsive element in the c-myc
promoter. This element is a complex of the TGF- 1 inhibitory element
(TIE) originally identified in the transin/stromelysin promoter and an
E2F site responsible for transcriptional activation of the
c-myc promoter. Smad3 and E2F-4 directly bound to the
element (TIE/E2F), and substitution of two nucleotides in TIE/E2F
impaired binding of both Smad3 and E2F-4 as well as serum-induced
activation and TGF- -induced suppression of the c-myc
promoter activity. Smads bound TIE/E2F within 1 h after
stimulation with TGF- , before the suppression of
c-myc transcription, whereas binding of p130 to TIE/E2F
became augmented later than 12 h. TGF- signaling did not
compete with E2F-4 for binding to TIE/E2F, but reduced p300
co-immunoprecipitating with E2F-4. Therefore, TGF- signaling may
suppress c-myc promoter activity by dissociating p300 from
E2F-4.
 |
INTRODUCTION |
The transforming growth factor-
(TGF- )1 superfamily is a
group of multifunctional cytokines that affect cell growth, cell death,
differentiation, and morphogenesis. It consists of more than 40 family
members including TGF- s, activins, and bone morphogenetic proteins.
TGF- transduces signals via heteromeric complex formation of cognate
type II and type I serine/threonine kinase receptors. TGF- type II
receptor kinase phosphorylates serine and threonine residues in the
GS domain of TGF- type I receptor, which results in
activation of the type I receptor kinase. Then, activated type I
receptor transduces signals into cytoplasm through phosphorylation of
receptor-regulated Smads (R-Smad). Smad2 and Smad3 are the R-Smads
activated by the TGF- type I receptor. Activated R-Smads bind to
Smad4, which is a common partner Smad and translocate into the
nucleus, and this complex serves as a transcriptional regulator
(1-3).
TGF- inhibits the growth of many divergent cell types, and loss of
TGF- sensitivity has been implicated in tumorigenesis (4-6). Some
tumors acquire TGF- resistance following inactivation of TGF-
receptors (7, 8) and others by mutations in Smad genes
(9-12). However, such alterations cannot account for many cancers in
which TGF- responsiveness is lost. Identification of more components
essential for the TGF- signaling pathway leading to growth arrest
might therefore be required to identify genetic alterations responsible
for TGF- resistance in cancer cells.
c-myc was discovered as the cellular homologue of the
retroviral v-myc oncogene, and the c-myc
proto-oncogene was subsequently found to be activated in various animal
and human tumors. Amplification of the c-myc gene has been
described in ~15% of all human tumors (13). TGF- down-regulates
expression of c-myc in human endothelial cells, breast
carcinoma cell lines, a Balb/MK mouse keratinocyte cell line, and HaCaT
cells (14-17), and overexpression of c-myc abrogates the
growth inhibition of keratinocytes induced by TGF- (18, 19). Genetic
screening also showed that c-myc as well as NF-IX-1
sustained proliferation of Mv1Lu cells in the presence of TGF- (20).
Loss of TGF- -induced suppression of c-myc correlated well
with TGF- resistance in colon cancer (21), thyroid cancer (22), and
human squamous cell carcinoma cell lines (23, 24).
TGF- was shown to induce G1 arrest through its effects
on the Rb/E2F pathway (25-27), and the c-myc promoter is
also a target of the Rb/E2F pathway. However, dephosphorylation of Rb
family proteins requires more than several hours, whereas TGF-
rapidly down-regulates levels of c-myc mRNA beginning
within 1 h of its administration (28). Furthermore, Myc
down-regulation was shown to be required for activation of
p15ink4b (29, 30) and p21 CIP1 (19),
which precedes inactivation of G1
cyclin-dependent kinases and dephosphorylation of Rb family proteins. There thus must be a pathway through which TGF-
down-regulates c-myc early after TGF- -stimulation other
than that mediated by Rb family proteins.
To identify this pathway, we analyzed TGF- -responsive elements in
the human c-myc promoter and found that Smad proteins
directly bound to an element in the c-myc promoter and
suppressed c-myc promoter activity.
 |
EXPERIMENTAL PROCEDURES |
Cells--
HaCaT cells and the R mutant of Mv1Lu cells (clone
4-2) were provided by N. E. Fusenig (DKFZ, Heidelberg) and J. Massagué (Sloan-Kettering Cancer Center, New York), respectively.
Mv1Lu cells and COS-7 cells were obtained from the American Type
Culture Collection. These cells were cultured in Dulbecco's modified
Eagle's medium (Sigma) supplemented with 10% fetal bovine serum and
10 µg/ml gentamicin. Subclones of HaCaT cells were maintained in MCDB153 medium (Sigma) supplemented with 0.1 mM calcium
chloride, 10 ng/ml epidermal growth factor, 10 µg/ml gentamicin, and
5% dialyzed fetal bovine serum. These subclones were used for
experiments including DNA transfection. HaCaT cells stably expressing
FLAG-Smad3D407E were previously described (31).
DNA Constructs--
c-myc cDNA was excised from
pBS0/1 Myc (provided by B. Blackwood and R. N. Eisenman, Fred
Hutchinson Cancer Research Center, Seattle, WA) and subcloned into
pcDNA3 mammalian expression vector (Invitrogen). cDNA for E2F-1
and E2F-4 was provided by K. Helin (European Institute of Oncology,
Milan, Italy) and C. Sardet (Institut de Genetique Moleculaire,
Montpellier, France), respectively. AR3-lux was provided by L. Attisano
(University of Toronto, Toronto, Canada). pHXluc, a luciferase reporter
construct containing 2329/+510 of the human c-myc
promoter, was described previously (32). Deletion constructs
( 367/+16, 142/+16, 40/+16) of the c-myc promoter were
amplified using PCR and subcloned into
BglII/HindIII sites of pGL3-basic (Promega).
Mutants (m-GTCT, GC, m-CAGA, m-TIE, and m-E2F) of the
c-myc promoter ( 367/+16) were amplified by PCR using
mutant primers. Upper strand sequences of the mutant primers are
as follows: m-GTCT, TGCGAGGaTtTGGACGG; GC,
TGTGCTGCTCGCGG:GGGCCCCGGCCGT; m-CAGA, GGCTTCTtAaAGGCTTGG;
m-TIE, CAGAGGCcTaGCGGGAA; m-E2F, CTTGGCGttAAAAAGAACG. Luciferase
reporters containing 3× TIE/E2F and 3× m-TIE/E2F were constructed by
subcloning of
CCCGGG-(CAGAGGC(T/c)T(G/a)GCGGGAAAAA)3-CTCGAG into SmaI/XhoI sites of the
pGL3-c-myc core promoter ( 40/+16). All sequences were
confirmed by sequencing. Expression constructs coding
T R-I(TD), FLAG-Smad3, FLAG-Smad3D407E, glutathione
S-transferase (GST)-Smad3, HA-FAST-1, and p300-HA were
described previously (31, 33, 34).
Northern Blot Analysis--
Total cellular RNA was extracted
using Isogen (Nippongene, Tokyo, Japan) following the manufacturer's
recommendations. Twenty-µg aliquots were electrophoresed on 1%
agarose-formaldehyde gels and transferred to nylon membrane
(Biodyne A; Pall BioSupport Co.). The membranes were hybridized at
42 °C overnight with random primed DNA probes labeled with
[ -32P]dCTP in a hybridization buffer containing 5×
SSC, 25% formamide, 1% SDS, 5× Denhardt's solution, and 0.2 mg/ml
denatured salmon testis DNA. The membranes were washed to a final
stringency of 0.1× SSC, 0.1% SDS at 65 °C, and analyzed using a
Fuji BAS 2500 Bio-Image Analyzer (Fuji Photo Film, Tokyo, Japan) and autoradiography.
Immunoprecipitation and Immunoblotting--
Immunoprecipitation
and immunoblotting were performed as previously described (34). Cells
were solubilized in a buffer containing 20 mM Tris-HCl, pH
7.5, 150 mM NaCl, 1% Nonidet P-40, 1.5% aprotinin, and 1 mM phenylmethylsulfonyl fluoride. After clearing with
centrifugation, total cell lysates or immunoprecipitates obtained using
anti-HA (12CA5, Roche Molecular Biochemicals) or anti-p300 (Upstate
Biotechnology, Inc., Lake Placid, NY) were subjected to SDS-PAGE.
Proteins were electrotransferred to polyvinylidene difluoride membranes
(ProBlott; Applied Biosystems) and subjected to immunoblotting.
Anti-Myc (9E10; Calbiochem), anti-FLAG (M2; Sigma), anti-Smad2/3 (clone 18; Transduction Laboratories, Lexington, KY), anti-E2F-1 (KH95; Santa
Cruz Biotechnology, Inc., Santa Cruz, CA), anti-E2F-4 (C-20, Santa
Cruz), anti-p130 (C-20; Santa Cruz Biotechnology), anti-p107 (SD9; BD
PharMingen), anti-Rb (G3-245; BD PharMingen), anti-HA (3F10; Roche
Molecular Biochemicals), and anti-p300 (Upstate Biotechnology) antibodies were used as first antibodies for immunoblotting. Reacted antibodies were detected using an enhanced chemiluminescence detection system (Amersham Pharmacia Biotech). For reblotting, the membranes were
stripped following the manufacturer's protocol.
Growth Inhibition Assay--
Cells were seeded in 24-well plates
at a density of 5 × 104 cells/well and cultured for
24 h in the growth medium for each cell line. Then the culture
fluids were changed to growth medium containing various concentrations
of human TGF- . After 16-20 h of incubation, 0.25 µCi/well of
[3H]thymidine (Amersham Pharmacia Biotech) was added, and
the cells were incubated for an additional 1 h. The cells were
fixed in 5% ice-cold trichloroacetic acid for 1 h and solubilized
in 1 M NaOH. After neutralization with 1 M HCl,
3H radioactivity was measured with a Beckman LS 6500 liquid
scintillation counter.
DNA Transfection and Luciferase Assay--
Cells were
transfected using FuGENE6 transfection reagent (Roche Molecular
Biochemicals) following the manufacturer's recommendations. Stable
HaCaT clones transfected with pcDNA3-c-myc were selected and maintained in the presence of 300 µg/ml G418 (Invitrogen). Luciferase activity in the cell lysates was determined by a dual luciferase reporter assay system (Promega) using a luminometer (AutoLumat LB953; EG & G Berthold). Luciferase activities were normalized to either sea pansy luciferase activity of cotransfected pRL-TK (Promega) or -galactosidase activity of cotransfected pcDNA3.1/Hygro/lacZ (Invitrogen).
Electrophoretic Mobility Shift Assay
(EMSA)--
EMSA was performed as described previously (34). A GST
fusion protein was prepared as described (35). A c-myc
promoter DNA fragment ( 263/+16) was excised by
XbaI/SacI and end-labeled with
[ -32P]dATP using Klenow fragment of DNA polymerase.
The upper strand sequences of oligonucleotide probes were as
follows: TIE/E2F, GGG-(CAGAGGCTTGGCGGGAAAAA)3-C; m-TIE/E2F,
GGG-(CAGAGGCcTaGCGGGAAAAA)3-C. Binding reactions containing
whole cell extracts (34) or 400 ng of GST-Smad3 MH2 (Smad3 lacking
the MH2 domain (35)) and 2 ng of labeled oligonucleotides were
performed for 20 min at 37 °C in 18 µl of binding buffer.
Protein-DNA complexes were then resolved in 5% polyacrylamide gels
containing 0.5× Tris borate/EDTA electrophoresis buffer. Specificity
of binding was demonstrated by a competition assay using 2× TRE or 3×
TIE/E2F oligonucleotides as a cold probe; the upper strand sequence of
2× TRE was as follows: GATATGAGTC AGACACCTCT GGCTTTCTGG AAGGGATGAG
TCAGACACCT CTGGCTTTCT GGAAGGGAGC TTG. For supershift analysis,
anti-Smad2/3 (clone 18; Transduction Laboratories), anti-FLAG (M2;
Sigma), or anti-E2F-4 (C-20; Santa Cruz Biotechnology) were added to
the whole cell extracts or GST-fused proteins.
DNase I Footprinting Analysis--
GST-Smad3 MH2 was
preincubated for 10 min on ice in 50 µl of 20 mM
HEPES-KOH (pH 7.6), 20% glycerol, 100 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 50 µg/ml
poly(dI-dC), followed by a 30-min incubation in the presence of 20,000 cpm of asymmetrically 32P-labeled DNA probe. After the
addition of 50 µl of 10 mM MgCl2, 5 mM CaCl2, each reaction was treated with 2.5 or
5.0 µg/ml of DNase I (Amersham Biosciences, Inc.) for 5 min on ice
and then stopped by adding 100 µl of stop solution (1% SDS, 20 mM EDTA, 250 µg/ml yeast tRNA). The DNA was then
precipitated and subjected to electrophoresis.
DNA Affinity Precipitation (DNAP)--
Cell lysates prepared in
1% Nonidet P-40, 150 mM NaCl, 1 mM
phenylmethylsulfonyl fluoride, 1.5% aprotinin, 20 mM
Tris-HCl (pH 7.5) were precleared with streptavidin-agarose beads
(Sigma) and then incubated with 200 ng of biotinylated double-stranded oligonucleotides in the presence of 2 µg of poly(dI-dC) at 4 °C for 1 h. DNA-bound proteins were mixed with streptavidin-agarose (Sigma) for 1 h with end-over-end rotation, washed extensively with cell lysis buffer, and analyzed by SDS-PAGE and immunoblotting. The sequences of the upper strands of oligonucleotides were
three repeats of the following sequences: TIE/E2F,
CAGAGGCTTGGCGGGAAAAA; m-TIE/E2F, CAGAGGCcTaGCGGGAAAAA; m-CAGA,
tAaAGGCTTGGCGGGAAAAA; TIE/m-E2F, CAGAGGCTTGGCGttAAAAA.
 |
RESULTS |
c-myc Is an Early TGF- -responsive Gene and Must Be
Decreased for Growth Inhibition of HaCaT Cells--
Levels of
c-myc mRNA in exponentially growing HaCaT cells were
suppressed rapidly after TGF- -stimulation. c-myc mRNA
began to decrease within 1 h and reached less than 30% of the
control level within 6 h. The decrease was not affected by the
presence of cycloheximide, indicating that this response did not
require new protein synthesis (Fig.
1A). To elucidate whether the
c-myc is suppressed through the Smad pathway, we used HaCaT
cells stably expressing a dominant negative mutant of Smad3 (31). As
shown in Fig. 1B, Smad3D407E blocked down-regulation of
c-Myc in HaCaT cells both in mRNA and protein levels, suggesting
that c-myc is a downstream target of the Smad pathway. In
addition to dysregulation of c-myc, these cell lines lost
growth-inhibitory response to TGF- as previously reported (31).
Furthermore, we established HaCaT cells stably expressing exogenous
c-myc. Levels of c-Myc in these transfectants were not
suppressed by TGF- (Fig.
2A). Growth of these
transfectants was not affected by TGF- (Fig. 2B), as
previously shown for Balb/MK (18), Mv1Lu (20), and HaCaT cells
(19).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
c-myc is an immediate early
responsive gene downstream of the Smad pathway. A,
Northern blot analysis for c-myc. Exponentially growing
HaCaT cells were incubated with 100 pM TGF- for the
indicated periods in the absence or presence of cycloheximide
(CXH). Relative levels of c-myc expression were
determined by densitometry and normalized to glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) as an internal control. B,
TGF- does not down-regulate c-Myc in the presence of a
dominant-negative Smad3. Immunoblot (Blot) analysis for
FLAG-Smad3D407E in FLAG-Smad3D407E-transfected HaCaT cell lines (H3.3,
H3.4, and H3.9) is shown in the upper panel
(anti-FLAG). These cells were stimulated with TGF- (100 pM, 6 h) as indicated and subjected to Northern blot
analysis for c-myc and GAPDH and immunoblot
analysis for c-Myc, as indicated. GI (%), percentage
reduction of [3H]thymidine incorporation of each clone
after incubation with TGF- (100 pM, 24 h).
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2.
Down-regulation of c-Myc is required for
inhibition of growth of HaCaT cells by TGF-
signaling. A, establishment of HaCaT cells stably
expressing c-Myc. Immunoblot analysis for c-Myc in the absence or
presence of 100 pM TGF- in c-myc-transfected
HaCaT cell lines is shown. HaCaT, HaCaT cells;
Mock, a mock-transfected clone of HaCaT cells;
HaCaT-c-myc clone 1 and clone 2,
c-myc-transfected clones of HaCaT cells. B,
stable expression of c-myc confers resistance to
TGF- -induced growth inhibition. Effects of TGF- on
[3H]thymidine incorporation by
c-myc-transfected HaCaT cell lines (A) are shown.
, HaCaT; , HaCaT-Mock; ,
HaCaT-c-myc clone 1; , HaCaT-c-myc clone
2.
|
|
Identification of Smad3-binding Elements in the c-myc
Promoter--
We next mapped TGF- -responsive region(s) in the human
c-myc promoter (Fig.
3A). Within the 2329/+510
human c-myc promoter, the proximal 150 bp ( 142/+16) was
sufficient for serum-induced activation and
TGF- -dependent suppression of c-myc promoter
activity. The 367/+16 promoter stronger serum-induced activation and
repression by TGF- much stronger than the 2329/+510
reporter, suggesting the presence of negative regulatory element(s) in
2329/ 367 or +16/+510. We further examined whether Smad3 directly
bound the c-myc promoter. As shown in Fig. 3B,
purified GST-Smad3 MH2 (Smad3 lacking the MH2 domain) (35) directly
bound the c-myc promoter including 142/+16. The shift band
was diminished by the presence of an excess amount of a cold probe.
Smad binding elements in this DNA fragment were then identified by
DNase I footprinting analyses. There were three Smad3 binding elements
in this region: a GTCT element upstream of the P1 promoter, a GC-rich
element, and TIE overlapping with the E2F element (Fig. 3C,
a, b, and c, respectively).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 3.
Identification of Smad-responsive elements in
the c-myc promoter. A, the 142/+16
region of the human c-myc promoter is sufficient for
responsiveness to TGF- . Reporter constructs containing 5'-deleted
fragments of human c-myc promoter were transfected into
Mv1Lu cells. TGF- (100 pM) was added at 4 h after
transfection and incubated for another 24 h. Luciferase activity
was normalized to  galactosidase activity of cotransfected
pcDNA3.1/lacZ. B, EMSA showing that purified
GST-Smad3 MH2 (GST-Smad3) directly binds 263/+16 of the
c-myc promoter. Competitor, nonlabeled competitive
oligonucleotides (2× TRE, 20 pmol). C, DNase I footprinting
analysis showing that 263/+16 region of the c-myc promoter
has three Smad binding elements. Sequences blocked by GST-Smad3 MH2
binding (a, b, and c) are shown at the
bottom and underlined.
|
|
TIE/E2F Element Is Responsible for Repression by TGF- --
We
next mutated or deleted each Smad3-binding element in the 367/+16
c-myc promoter as shown in Fig.
4A. Loss of Smad binding to
these mutated elements was confirmed by DNase I footprinting analyses
(data not shown). Mutations in the GTCT element and deletion of the
GC-rich element affected neither control promoter activity nor
TGF- -responsiveness in growing Mv1Lu cells. Concerning the TIE/E2F
element, we created a TIE mutant (m-TIE) that did not change the
original E2F element (36) and a mutant in the E2F element (m-E2F) that
kept the intact TIE sequence (37) (Fig. 4A). Both of these
mutants considerably reduced serum-induced activation of the
c-myc promoter and completely abrogated
TGF- -dependent repression (Fig. 4, B and
C). TIE/E2F was indispensable for TGF- -induced suppression of the c-myc promoter activity, whereas
serum-responsive elements should exist besides TIE/E2F because m-TIE
still responded to serum (Fig. 4C). We next constructed a
reporter consisting of three tandem repeats of the TIE/E2F (3×
TIE/E2F) connected to the core P2 promoter ( 40/+16) of
c-myc. Serum stimulation clearly enhanced transcriptional
activity from the element, and this enhancement was totally blocked by
TGF- . These responses were completely lost with a TIE mutation (Fig.
4C). Therefore, the TIE/E2F element is involved in both
positive and negative regulation of c-myc promoter
activity.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 4.
Mutations in TIE/E2F but not other
Smad3-binding elements abrogate
TGF- -induced repression of c-myc
promoter activity. A, schematic presentation of
the human c-myc promoter, three Smad3 binding sites, and
their mutants. TCE, a TGF- control element
previously reported (42). B, mutational analysis of
c-myc promoter activity. Mv1Lu cells were transfected with
367/+16 c-myc promoter reporter constructs with mutations
shown in A. C, the TIE/E2F element mediates both
serum-induced activation and TGF- -induced suppression of
c-myc promoter activity. Mv1Lu cells were transfected with
367/+16(WT), 367/+16(m-TIE), 3× TIE/E2F, or 3× m-TIE/E2F reporter
constructs, starved for 24 h, and refed with 10% fetal bovine
serum with or without 100 pM TGF- , as indicated. After
another 24-h incubation, cells were subjected to luciferase
assay.
|
|
TIE/E2F Binds both Smads and E2F-4--
To examine whether Smad3
bound TIE/E2F in a TGF- -dependent manner, COS-7 cells
were transfected with FLAG-Smad3 in the absence or presence of
constitutively active form of TGF- type I receptor. Total cellular
lysates were subjected to DNAP analyses using a biotinylated TIE/E2F
oligonucleotide as a probe. Smad3 but not a dominant-negative mutant of
Smad3 bound TIE/E2F oligonucleotides in a TGF-
signaling-dependent manner (Fig.
5A). This binding was specific
to the sequence, since two-nucleotide substitution in the TIE element
(m-TIE/E2F) totally abrogated Smad binding to the DNA. E2F-1 and E2F-4
were also highly expressed in COS-7 cells upon transient DNA
transfection. In this condition, E2F-4, but not E2F-1, bound TIE/E2F
(Fig. 5B).

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5.
TIE/E2F in the c-myc
promoter binds Smads in a
TGF- -signal-dependent manner.
A, overexpressed FLAG-Smad3 binds TIE/E2F depending on the
presence of coexpressed constitutively active TGF- type I receptor.
FLAG-Smad3, a dominant negative mutant of Smad3 (FLAG-Smad3D407E) and
constitutively active TGF- type I receptor (T RI-TD) were
transfected into COS-7 cells as indicated. Total cell lysates were
incubated with biotinylated TIE/E2F or mutant oligonucleotides
(m-TIE/E2F) and precipitated by streptavidin-agarose beads (Sigma). DNA
affinity-purified precipitates (upper panel) or
aliquots of total cell lysates (lower panel) were
subjected to immunoblot analysis using anti-FLAG antibody.
B, E2F-4 but not E2F-1 binds TIE/E2F in the c-myc
promoter. COS-7 cells were transfected with E2F-1 (upper
panel) or E2F-4 (lower panel) as
indicated, and then cell lysates were subjected to SDS-PAGE either
directly (lanes 1 and 2 from the
left) or after DNAP using TIE/E2F oligonucleotides as a
probe (lanes 3 and 4 from the
left). After transfer, membranes were blotted for E2F-1
(upper panel) or E2F-4 (lower
panel) using specific antibodies. C, endogenous
Smad3 in HaCaT cells together with Smad2 binds TIE/E2F immediately
after stimulation with TGF- . HaCaT cells were incubated with TGF-
(20 pM, 1 h), lysed, and subjected to DNAP using
biotinylated TIE/E2F or mutant oligonucleotides. After SDS-PAGE and
transfer, the membranes were blotted with anti-Smad2/3 antibody
(upper panel) or anti-E2F-4 antibody
(lower panel). D, EMSA showing that
purified GST-Smad3 MH2 (GST-Smad3) directly binds 3× TIE/E2F but not
3× m-TIE/E2F. Antibody, anti-Smad2/3 (clone 18;
Transduction Laboratories). Competitor, nonlabeled
competitive oligonucleotides (3× TIE/E2F; 20 pmol). E, EMSA
showing that E2F-4 and FLAG-Smad3 independently bind 3× TIE/E2F. COS-7
cells were transfected with E2F-4, DP-1, FLAG-Smad3, and T RI(TD), as
indicated, and total cell lysates were subjected to EMSA using 3×
TIE/E2F or 3× m-TIE/E2F as probes in the absence or presence of the
indicated antibodies. Antibodies, anti-E2F-4 (C-20; Santa
Cruz Biotechnology), anti-FLAG (M2; Sigma).
|
|
Binding of endogenous Smad proteins and E2F in HaCaT cells was further
examined. Both of the TGF- receptor-regulated Smads, Smad2 and
Smad3, bound the TIE/E2F element at 1 h after TGF- stimulation
(Fig. 5C). Since Smad2 does not bind DNA directly, it may
bind through Smad3 or Smad4. Mutations either in the TIE element or in
the E2F element impaired Smad binding to this DNA fragment (Fig.
5C), while a CAGA mutation did not affect the binding, corresponding to the results of functional assay shown in Fig. 4.
Endogenous E2F-4 bound TIE/E2F regardless of the presence of TGF-
signaling. In addition, the E2F-4 binding and the Smad binding were
impaired by either the TIE mutation or the E2F mutation (Fig.
5C). Since TGF- -regulated Smads and E2F-4 bound the same TIE/E2F element, we further examined whether binding of these two was
mutually exclusive. However, binding of Smad did not affect E2F-4
binding to TIE/E2F, as shown in Fig. 5C (see also Fig.
6A). TGF- signaling thus is
not likely to repress c-myc promoter activity by competing
with E2F-4 for DNA binding.

View larger version (74K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of TGF-
signaling on the binding of E2F, Smads, and Rb family proteins to
the TIE/E2F element. A, binding of p130 to TIE/E2F
requires more than several hours after stimulation with TGF- ,
whereas binding of Smad is a quick event. HaCaT cells were stimulated
with TGF- (100 pM) for indicated periods, lysed, and
subjected to DNAP using biotinylated TIE/E2F as a probe. After SDS-PAGE
and transfer, the membranes were blotted with antibodies against E2F-4,
Smad2/3, p130, p107, or pRb, as indicated. B, TGF-
dissociates p300 from E2F-4. COS-7 cells were transfected with the
indicated expression plasmids, and cell lysates were subjected to
immunoprecipitation against p300 followed by immunoblotting for E2F-4
(top panel). Aliquots of the cell lysates were
directly subjected to immunoblotting using anti-E2F-4, anti-FLAG, and
anti-HA antibodies to detect levels of E2F-4, Smad3 and T R-I(TD),
and p300, as indicated. C, dissociation of p300 from E2F-4
depends on Smad3. COS-7 cells were transfected with indicated
expression plasmids, and cell lysates were subjected to
immunoprecipitation against p300 followed by immunoblotting for E2F-4
or Smad3, as indicated (upper panels). Aliquots
of the cell lysates were directly subjected to immunoblotting using
anti-E2F-4, anti-HA, and anti-FLAG antibodies to detect levels of
E2F-4, p300, Smad3, and T R-I(TD), as indicated. D,
transcriptional activation by E2F-4 and p300 via the TIE/E2F element is
blocked by TGF- signaling. Mv1Lu cells were transfected with 3×
TIE/E2F or 3× m-TIE/E2F reporter constructs together with E2F-4 and
p300 expression vectors as indicated and cultured for 4 h. Then,
cells were incubated with TGF- (100 pM) for another
24 h and subjected to luciferase analysis.
|
|
Since E2F mutation as well as TIE mutation abrogated Smad binding to
TIE/E2F, we confirmed whether GST-Smad3 MH2 directly bound TIE/E2F in
EMSA. GST-Smad3 MH2 directly bound TIE/E2F in the absence of E2F-4 in
a sequence-specific manner (Fig. 5D). Complexes of
FLAG-Smad3 and TIE/E2F in COS-7 cells were also analyzed by EMSA. E2F-4
made detectable complexes with TIE/E2F only in the presence of DP-1.
Anti-E2F-4 supershifted complexes of E2F-4 and TIE/E2F. In contrast,
shift bands containing FLAG-Smad3 were not affected so much by the
presence of anti-E2F-4 both in the absence and in the presence of
anti-FLAG antibody. These results suggest that Smad3 and E2F-4
independently bind TIE/E2F and that only a part of TIE/E2F binds both
Smad3 and E2F-4 (Fig. 5E).
Time Course of Binding of E2F, Smads, and Rb Family Proteins to
TIE/E2F after TGF- Stimulation--
We next examined the time
course of binding of E2F-4, Smads, and Rb family proteins to TIE/E2F
after administration of TGF- (Fig. 6A). HaCaT cells were
stimulated with TGF- for the indicated times, and total cell lysates
were subjected to DNAP analyses using 3× TIE/E2F as a probe. Binding
of E2F-4 and pRb was not affected by TGF- . Smad2/3 was induced to
bind TIE/E2F within 2 h and kept binding up to 24 h
(Fig. 6A). Binding of p130 became detectable at 6 h and
clearly enhanced after 12 h. Binding of p107 decreased after
6 h, inversely proportional to p130 (Fig. 6A).
TGF- Signaling Dissociates p300 from E2F-4--
We tried to
detect endogenous p300 in the precipitates after DNAP with 3× TIE/E2F,
but it was under detectable levels. Therefore, the effect of TGF-
signaling on the complex formation between E2F-4 and p300 was analyzed
using overexpressed proteins in COS-7 cells. Fig. 6B clearly
shows that TGF- blocked coprecipitation of p300 with E2F-4.
Complexes of E2F-4 and p300 decreased inverse proportionally with the
increase of p300-bound Smad3 in the presence of TGF- signaling (Fig.
6C). The effects of TGF- on the cooperation between E2F-4
and p300 were analyzed also by luciferase reporter assay. E2F-4
increased transcriptional activity via TIE/E2F elements, and p300
cooperatively enhanced the promoter activity. This cooperative effect
of p300 with E2F-4 was again blocked by TGF- signaling (Fig.
6C).
 |
DISCUSSION |
c-Myc is an essential regulator of cell cycle progression that is
required for activation of cyclin-dependent kinase
complexes (19, 29, 30, 38). Overexpression of c-myc
overcomes TGF- -induced cell cycle arrest, and c-myc is
frequently highly expressed in cancer cells. c-myc was also
identified as a target of the APC pathway (39) and of tumor-derived p53
mutants (40). The Ras/mitogen-activated protein kinase pathway was
shown to stabilize Myc protein (41). Furthermore, c-Myc was reported to
activate telomerase (42). All of these recent findings confirmed that
c-Myc plays essential roles in carcinogenesis.
We have shown in the present study that c-myc is an early
responsive gene required for TGF- -induced growth inhibition of HaCaT
cells. It was controlled downstream of the Smad pathway, and the
TIE/E2F element was responsible for both serum-induced activation and
TGF- -induced suppression of the c-myc promoter activity.
This element was previously reported as the cell
cycle-dependent element, including an E2F site (43).
The heteromeric E2F/DP transcription factors frequently act as
repressors in G0/early G1 because of their
association with the Rb family proteins. In late G1, the Rb
family proteins become hyperphosphorylated and dissociate from E2F,
leading to derepression of E2F-regulated genes (44, 45). Several cell
cycle-regulated genes, including B-myb (46, 47),
DHFR (48), and E2F1 (49, 50), are repressed
through an E2F-mediated mechanism in G0/G1 and
derepressed in late G1. In such cases, mutations in the E2F site up-regulate transcription of these genes in quiescent cells (46,
47, 51). However, in the case of the c-myc promoter, abrogation of E2F binding to this element decreased transcriptional activity of the promoter (Fig. 4, B and C),
suggesting that the E2F site in the human c-myc promoter
acts essentially as a positive regulatory element. In case of the genes
suppressed by the E2F element, the E2F site cooperates with a
contiguous corepressor element, termed the cell cycle genes homology
region (CHR). The CHR sequence was first identified in the
B-myb, cyclin A, cdc2, and cdc25C
genes (51). Identical CHR sequence was reported also in the
cdc25A gene (52). However, the c-myc gene does
not have such a CHR-like element.
A unique characteristic of the c-myc cell
cycle-dependent element is the presence of a TIE element,
GnnTTGGnG, and an ets binding element overlapping with the
E2F site (37, 53, 54). TIE was originally identified in the
transin/stromelysin gene (53). A similar sequence was also identified
as a TGF- -responsive element in the mouse tissue
transglutaminase gene (54) and a TGF- -inhibitory-response
element in the cdc25A promoter (52). In the present study,
we have shown that the TIE/E2F element is essential for the
transcriptional regulation of c-myc by both serum and
TGF- . We could not detect any complexes of E2F-4 and Smad3 either in
HaCaT cells or COS-7 cells transfected with E2F-4 and Smad3 (data not
shown), and EMSA suggested that E2F-4 and Smad3 independently bound the
TIE/E2F element (Fig. 5E). We expected that our TIE mutation
would not significantly affect E2F binding, since our TIE mutation did
not change any nucleotides in the originally reported E2F element
GCGGGAAA (36). However, either TIE mutation or E2F mutation abrogated
both Smad3 and E2F-4 binding to this element. It would be interesting
to determine whether any mutations impair binding of either Smad3 or
E2F alone.
Tumor necrosis factor and interferon- cooperatively repress
transcription from the c-myc promoter by reducing E2F
binding activity to the E2F element (55), but TGF- signaling
suppressed c-myc promoter activity without affecting E2F-4
binding (Figs. 5C and 6A). These results suggest
that some molecule(s) other than E2F-4 or acting together with E2F4
might be responsible for serum-induced transcriptional activation of
c-myc and that such molecule(s) might be competed by TGF-
signaling. Supporting this possibility, we have shown that TGF-
signaling dissociated p300 from E2F-4 (Fig. 6, B and
C). We could not detect binding of endogenous p300 through
E2F-4 to TIE/E2F, but the dissociation of p300 from E2F is a possible
mechanism of suppression of c-myc promoter activity induced
by TGF- . Further studies using more sensitive experiments such as
chromatin precipitation may give an answer for this possibility.
E2F has been shown to form a large complex including Rb
family members, cyclin A, Cdk2, and v-Abl (56, 57). These
molecules are expected to enhance transcriptional activity of E2F (56). CREG is a corepressor of E2F that inhibits E1A- and E2F-stimulated gene
expression (58). TRRAP binds to c-Myc and E2F and is essential for
transforming activity of c-Myc and E1A (59). Recently, TRRAP was shown
to recruit the histone acetyltransferase hGCN5 to c-Myc (60),
suggesting that TRRAP plays a role as a component of transcriptional cofactors for c-Myc and E2F. To get an overall view of how TGF- signaling affects transcriptional activity via the TIE/E2F element in
the c-myc promoter, these cofactors should be examined for whether they are affected by TGF- signaling in relation to
the time course of suppression of c-myc promoter activity.
We found that transcriptional regulation via TIE/E2F of the
c-myc promoter was selectively impaired in cancer cell
lines.2 We do not know the
mechanism of this selectivity. Recently, MCF-10A cells
double-transfected with c-Ha-ras (G12V) and
c-erbB2 were reported to selectively lose TIE-mediated
suppression of c-myc by TGF- signaling, suggesting that
defective regulation of c-myc via the TIE element might be a
rather common phenomenon in carcinogenesis (61). Since c-myc
plays essential roles in carcinogenesis, further studies to clarify
TGF- -induced transcriptional regulation via the TIE/E2F element
should yield important findings for the understanding of dysregulated
expression of c-myc and possibly for the autonomous growth
of cancer cells.
 |
ACKNOWLEDGEMENTS |
We thank N. E. Fusenig and J. Massagué for HaCaT cells and R mutant cells of Mv1Lu (clone 4-2),
respectively. We also thank B. Blackwood and R. N. Eisenman, K. Helin, C. Sardet, and L. Attisano for cDNAs of c-myc,
E2F-1, E2F-4, and AR3-lux reporter, respectively.
 |
FOOTNOTES |
*
This study was supported by grants-in-aid for Scientific
Research from the Ministry of Education, Science, Sports, Culture and
Technology of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The on-line version of this article (available at
http://www.jbc.org) contains additional figures.
**
To whom correspondence should be addressed: Dept. of Biochemistry,
The Cancer Institute of the Japanese Foundation for Cancer Research,
1-37-1 Kami-ikebukuro, Toshima-ku, Tokyo 170-8455, Japan. Tel.:
81-3-5394-3866; Fax: 81-3-3918-0342; E-mail:
mit-ind@umin.ac.jp.
Published, JBC Papers in Press, October 31, 2001, DOI 10.1074/jbc.M104170200
2
K. Yagi, K. Miyazono, and M. Kato,
unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
TGF- , transforming growth factor- ;
R-Smad, receptor-regulated Smad;
EMSA, electrophoretic mobility shift assay;
GST, glutathione
S-transferase;
TRE, 12-O-tetradecanoylphorbol-13-acetate-responsive element;
DNAP, DNA affinity precipitation;
TIE, TGF- 1 inhibitory element;
CHR, cell cycle genes homology region.
 |
REFERENCES |
| 1.
|
Massagué, J.,
and Wotton, D.
(2000)
EMBO J.
19,
1745-1754[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
ten Dijke, P.,
Miyazono, K.,
and Heldin, C.-H.
(2000)
Trends Biochem. Sci.
25,
64-70[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Miyazono, K.,
ten Dijke, P.,
and Heldin, C.-H.
(2000)
Adv. Immunol.
75,
115-157[Medline]
[Order article via Infotrieve]
|
| 4.
|
Fynan, T. M.,
and Reiss, M.
(1993)
Crit. Rev. Oncol.
4,
493-540
|
| 5.
|
Heldin, C.-H.,
Miyazono, K.,
and ten Dijke, P.
(1997)
Nature
390,
465-471[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Massagué, J.,
Blain, S. W.,
and Lo, R. S.
(2000)
Cell
103,
295-309[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Markowitz, S.,
Wang, J.,
Myeroff, L.,
Parsons, R.,
Sun, L.,
Lutterbaugh, J.,
Fan, R. S.,
Zborowska, E.,
Kinzler, K. W.,
Vogelstein, B.,
Brattain, M.,
and Wilson, J. K. V.
(1995)
Science
268,
1336-1338[Abstract/Free Full Text]
|
| 8.
|
Garrigue-Antar, L.,
Munoz-Antonia, T.,
Antonia, S. J.,
Gesmonde, J.,
Vellucci, V. F.,
and Reiss, M.
(1995)
Cancer Res.
55,
3982-3987[Abstract/Free Full Text]
|
| 9.
|
Hahn, S. A.,
Schutte, M.,
Hoque, A. T.,
Moskaluk, C. A.,
da Costa, L. T.,
Rozenblum, E.,
Weinstein, C. L.,
Fischer, A.,
Yeo, C. J.,
Hruban, R. H.,
and Kern, S. E.
(1996)
Science
271,
350-353[Abstract]
|
| 10.
|
Eppert, K.,
Scherer, S. W.,
Ozcelik, H.,
Pirone, R.,
Hoodless, P.,
Kim, H.,
Tsui, L. C.,
Bapat, B.,
Gallinger, S.,
Andrulis, I. L.,
Thomsen, G. H.,
Wrana, J. L.,
and Attisano, L.
(1996)
Cell
86,
543-552[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Riggins, G. J.,
Thiagalingam, S.,
Rozenblum, E.,
Weinstein, C. L.,
Kern, S. E.,
Hamilton, S. R.,
Willson, J. K.,
Markowitz, S. D.,
Kinzler, K. W.,
and Vogelstein, B.
(1996)
Nat. Genet.
13,
347-349[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Miyaki, M.,
Iijima, T.,
Konishi, M.,
Sakai, K.,
Ishii, A.,
Yasuno, M.,
Hishima, T.,
Koike, M.,
Shitara, N.,
Iwama, T.,
Utsunomiya, J.,
Kuroki, T.,
and Mori, T.
(1999)
Oncogene
18,
3098-3103[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Henriksson, M.,
and Luscher, B.
(1996)
Adv. Cancer Res.
68,
109-182[Medline]
[Order article via Infotrieve]
|
| 14.
|
Coffey, R. J., Jr.,
Bascom, C. C.,
Sipes, N. J.,
Graves-Deal, R.,
Weissman, B. E.,
and Moses, H. L.
(1988)
Mol. Cell. Biol.
8,
3088-3093[Abstract/Free Full Text]
|
| 15.
|
Takehara, K.,
LeRoy, E. C.,
and Grotendorst, G. R.
(1987)
Cell
49,
415-422[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Fernandez-Pol, J. A.,
Talkad, V. D.,
Klos, D. J.,
and Hamilton, P. D.
(1987)
Biochem. Biophys. Res. Commun.
144,
1197-1205[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Herzinger, T.,
Wolf, D. A.,
Eick, D.,
and Kind, P.
(1995)
Oncogene
10,
2079-2084[Medline]
[Order article via Infotrieve]
|
| 18.
|
Alexandrow, M. G.,
Kawabata, M.,
Aakre, M.,
and Moses, H. L.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
3239-3243[Abstract/Free Full Text]
|
| 19.
|
Claassen, G. F.,
and Hann, S. R.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
9498-9503[Abstract/Free Full Text]
|
| 20.
|
Sun, P.,
Dong, P.,
Dai, K.,
Hannon, G. J.,
and Beach, D.
(1998)
Science
282,
2270-2272[Abstract/Free Full Text]
|
| 21.
|
Mulder, K. M.,
Zhong, Q.,
Choi, H. G.,
Humphrey, L. E.,
and Brattain, M. G.
(1990)
Cancer Res.
50,
7581-7586[Abstract/Free Full Text]
|
| 22.
|
Usa, T.,
Tsukazaki, T.,
Namba, H.,
Ohtsuru, A.,
Kimura, H.,
Villadolid, M. C.,
Nagataki, S.,
and Yamashita, S.
(1994)
Endocrinology
135,
1378-1384[Abstract]
|
| 23.
|
Paterson, I. C.,
Patel, V.,
Sandy, J. R.,
Prime, S. S.,
and Yeudall, W. A.
(1995)
Br. J. Cancer
72,
922-927[Medline]
[Order article via Infotrieve]
|
| 24.
|
Malliri, A.,
Yeudall, W. A.,
Nikolic, M.,
Crouch, D. H.,
Parkinson, E. K.,
and Ozanne, B.
(1996)
Cell Growth Differ.
7,
1291-1304[Abstract]
|
| 25.
|
Laiho, M.,
DeCaprio, J. A.,
Ludlow, J. W.,
Livingston, D. M.,
and Massagué, J.
(1990)
Cell
62,
175-185[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Pietenpol, J. A.,
Stein, R. W.,
Moran, E.,
Yaciuk, P.,
Schlegel, R.,
Lyons, R. M.,
Pittelkow, M. R.,
Munger, K.,
Howley, P. M.,
and Moses, H. L.
(1990)
Cell
61,
777-785[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Schwarz, J. K.,
Bassing, C. H.,
Kovesdi, I.,
Datto, M. B.,
Blazing, M.,
George, S.,
Wang, X. F.,
and Nevins, J. R.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
483-487[Abstract/Free Full Text]
|
| 28.
|
Zentella, A.,
Weis, F. M.,
Ralph, D. A.,
Laiho, M.,
and Massagué, J.
(1991)
Mol. Cell. Biol.
11,
4952-4958[Abstract/Free Full Text]
|
| 29.
|
Warner, B. J.,
Blain, S. W.,
Seoane, J.,
and Massagué, J.
(1999)
Mol. Cell. Biol.
19,
5913-5922[Abstract/Free Full Text]
|
| 30.
|
Mateyak, M. K.,
Obaya, A. J.,
and Sedivy, J. M.
(1999)
Mol. Cell. Biol.
19,
4672-4683[Abstract/Free Full Text]
|
| 31.
|
Goto, D.,
Yagi, K.,
Inoue, H.,
Iwamoto, I.,
Kawabata, M.,
Miyazono, K.,
and Kato, M.
(1998)
FEBS Lett.
430,
201-204[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Takeshita, T.,
Arita, T.,
Higuchi, M.,
Asao, H.,
Endo, K.,
Kuroda, H.,
Tanaka, N.,
Murata, K.,
Ishii, N.,
and Sugamura, K.
(1997)
Immunity
6,
449-457[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Nishihara, A.,
Hanai, J. I.,
Okamoto, N.,
Yanagisawa, J.,
Kato, S.,
Miyazono, K.,
and Kawabata, M.
(1998)
Genes Cells
3,
613-623[Abstract]
|
| 34.
|
Yagi, K.,
Goto, D.,
Hamamoto, T.,
Takenoshita, S.,
Kato, M.,
and Miyazono, K.
(1999)
J. Biol. Chem.
274,
703-709[Abstract/Free Full Text]
|
| 35.
|
Dennler, S.,
Itoh, S.,
Vivien, D.,
ten Dijke, P.,
Huet, S.,
and Gauthier, J. M.
(1998)
EMBO J.
17,
3091-3100[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Hiebert, S. W.,
Lipp, M.,
and Nevins, J. R.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
3594-3598[Abstract/Free Full Text]
|
| 37.
|
Roussel, M. F.,
Davis, J. N.,
Cleveland, J. L.,
Ghysdael, J.,
and Hiebert, S. W.
(1994)
Oncogene
9,
405-415[Medline]
[Order article via Infotrieve]
|
| 38.
|
Steiner, P.,
Philipp, A.,
Lukas, J.,
Godden-Kent, D.,
Pagano, M.,
Mittnacht, S.,
Bartek, J.,
and Eilers, M.
(1995)
EMBO J.
14,
4814-4826[Medline]
[Order article via Infotrieve]
|
| 39.
|
He, T. C.,
Sparks, A. B.,
Rago, C.,
Hermeking, H.,
Zawel, L.,
da Costa, L. T.,
Morin, P. J.,
Vogelstein, B.,
and Kinzler, K. W.
(1998)
Science
281,
1509-1512[Abstract/Free Full Text]
|
| 40.
|
Frazier, M. W., He, X.,
Wang, J., Gu, Z.,
Cleveland, J. L.,
and Zambetti, G. P.
(1998)
Mol. Cell. Biol.
18,
3735-3743[Abstract/Free Full Text]
|
| 41.
|
Sears, R.,
Leone, G.,
DeGregori, J.,
and Nevins, J. R.
(1999)
Mol. Cell
3,
169-179[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Wang, J.,
Xie, L. Y.,
Allan, S.,
Beach, D.,
and Hannon, G. J.
(1998)
Genes Dev.
12,
1769-1774[Abstract/Free Full Text]
|
| 43.
|
Lucibello, F. C.,
Truss, M.,
Zwicker, J.,
Ehlert, F.,
Beato, M.,
and Müller, R.
(1995)
EMBO J.
14,
132-142[Medline]
[Order article via Infotrieve]
|
| 44.
|
Lam, E. W.,
Morris, J. D.,
Davies, R.,
Crook, T.,
Watson, R. J.,
and Vousden, K. H.
(1994)
EMBO J.
13,
871-878[Medline]
[Order article via Infotrieve]
|
| 45.
|
Zwicker, J.,
Liu, N.,
Engeland, K.,
Lucibello, F. C.,
and Müller, R.
(1996)
Science
271,
1595-1597[Abstract]
|
| 46.
|
Lam, E. W.,
and Watson, R. J.
(1993)
EMBO J.
12,
2705-2713[Medline]
[Order article via Infotrieve]
|
| 47.
|
Liu, N.,
Lucibello, F. C.,
Zwicker, J.,
Engeland, K.,
and Müller, R.
(1996)
Nucleic Acids Res.
24,
2905-2910[Abstract/Free Full Text]
|
| 48.
|
Means, A. L.,
Slansky, J. E.,
McMahon, S. L.,
Knuth, M. W.,
and Farnham, P. J.
(1992)
Mol. Cell. Biol.
12,
1054-1063[Abstract/Free Full Text]
|
| 49.
|
Hsiao, K. M.,
McMahon, S. L.,
and Farnham, P. J.
(1994)
Genes Dev.
8,
1526-1537[Abstract/Free Full Text]
|
| 50.
|
Johnson, D. G.,
Ohtani, K.,
and Nevins, J. R.
(1994)
Genes Dev.
8,
1514-1525[Abstract/Free Full Text]
|
| 51.
|
Zwicker, J.,
Lucibello, F. C.,
Wolfraim, L. A.,
Gross, C.,
Truss, M.,
Engeland, K.,
and Müller, R.
(1995)
EMBO J.
14,
4514-4522[Medline]
[Order article via Infotrieve]
|
| 52.
|
Iavarone, A.,
and Massagué, J.
(1999)
Mol. Cell. Biol.
19,
916-922[Abstract/Free Full Text]
|
| 53.
|
Kerr, L. D.,
Miller, D. B.,
and Matrisian, L. M.
(1990)
Cell
61,
267-278[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Ritter, S. J.,
and Davies, P. J.
(1998)
J. Biol. Chem.
273,
12798-12806[Abstract/Free Full Text]
|
| 55.
|
Carlberg, A. L.,
Moberg, K. H.,
and Hall, D. J.
(1999)
Int. J. Oncol.
15,
121-126[Medline]
[Order article via Infotrieve]
|
| 56.
|
Wong, K. K.,
Zou, X.,
Merrell, K. T.,
Patel, A. J.,
Marcu, K. B.,
Chellappan, S.,
and Calame, K.
(1995)
Mol. Cell. Biol.
15,
6535-6544[Abstract]
|
| 57.
|
Birchenall-Roberts, M. C.,
Kim, S. J.,
Bertolette, D. C., 3rd,
Turley, J. M., Fu, T.,
Bang, O. S.,
Kasper, J. J.,
Yoo, Y. D.,
and Ruscetti, F. W.
(1996)
Oncogene
13,
1499-1509[Medline]
[Order article via Infotrieve]
|
| 58.
|
Veal, E.,
Eisenstein, M.,
Tseng, Z. H.,
and Gill, G.
(1998)
Mol. Cell. Biol.
18,
5032-5041[Abstract/Free Full Text]
|
| 59.
|
McMahon, S. B.,
Van Buskirk, H. A.,
Dugan, K. A.,
Copeland, T. D.,
and Cole, M. D.
(1998)
Cell
94,
363-374[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
McMahon, S. B.,
Wood, M. A.,
and Cole, M. D.
(2000)
Mol. Cell. Biol.
20,
556-562[Abstract/Free Full Text]
|
| 61.
|
Chen, C. R.,
Kang, Y.,
and Massagué, J.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
992-999[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. B. Baughn, M. Di Liberto, R. Niesvizky, H. J. Cho, D. Jayabalan, J. Lane, F. Liu, and S. Chen-Kiang
CDK2 Phosphorylation of Smad2 Disrupts TGF-{beta} Transcriptional Regulation in Resistant Primary Bone Marrow Myeloma Cells
J. Immunol.,
February 15, 2009;
182(4):
1810 - 1817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Spender and G. J. Inman
TGF-{beta} Induces Growth Arrest in Burkitt Lymphoma Cells via Transcriptional Repression of E2F-1
J. Biol. Chem.,
January 16, 2009;
284(3):
1435 - 1442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Lohmann and J. J. Bieker
Activation of Eklf expression during hematopoiesis by Gata2 and Smad5 prior to erythroid commitment
Development,
June 15, 2008;
135(12):
2071 - 2082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Alvarez-Rodriguez, M. Barzi, J. Berenguer, and S. Pons
Bone Morphogenetic Protein 2 Opposes Shh-mediated Proliferation in Cerebellar Granule Cells through a TIEG-1-based Regulation of Nmyc
J. Biol. Chem.,
December 21, 2007;
282(51):
37170 - 37180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Xin, S. Ren, W. Eberhardt, J. Pfeilschifter, and A. Huwiler
Sphingosylphosphorylcholine acts in an anti-inflammatory manner in renal mesangial cells by reducing interleukin-1{beta}-induced prostaglandin E2 formation
J. Lipid Res.,
September 1, 2007;
48(9):
1985 - 1996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kobayashi, K. Goto, K. Horiguchi, M. Nagata, M. Kawata, K. Miyazawa, M. Saitoh, and K. Miyazono
c-Ski activates MyoD in the nucleus of myoblastic cells through suppression of histone deacetylases
Genes Cells,
March 1, 2007;
12(3):
375 - 385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Lim and F. M. Hoffmann
Smad4 cooperates with lymphoid enhancer-binding factor 1/T cell-specific factor to increase c-myc expression in the absence of TGF-beta signaling
PNAS,
December 5, 2006;
103(49):
18580 - 18585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Jungert, A. Buck, M. Buchholz, M. Wagner, G. Adler, T. M. Gress, and V. Ellenrieder
Smad-Sp1 complexes mediate TGF{beta}-induced early transcription of oncogenic Smad7 in pancreatic cancer cells
Carcinogenesis,
December 1, 2006;
27(12):
2392 - 2401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Buck, M. Buchholz, M. Wagner, G. Adler, T. Gress, and V. Ellenrieder
The Tumor Suppressor KLF11 Mediates a Novel Mechanism in Transforming Growth Factor {beta}-Induced Growth Inhibition That Is Inactivated in Pancreatic Cancer
Mol. Cancer Res.,
November 1, 2006;
4(11):
861 - 872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Fantozzi, O. Platoshyn, A. H. Wong, S. Zhang, C. V. Remillard, M. R. Furtado, O. V. Petrauskene, and J. X.-J. Yuan
Bone morphogenetic protein-2 upregulates expression and function of voltage-gated K+ channels in human pulmonary artery smooth muscle cells
Am J Physiol Lung Cell Mol Physiol,
November 1, 2006;
291(5):
L993 - L1004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. McMahon, M. Charbonneau, S. Grandmont, D. E. Richard, and C. M. Dubois
Transforming Growth Factor beta1 Induces Hypoxia-inducible Factor-1 Stabilization through Selective Inhibition of PHD2 Expression
J. Biol. Chem.,
August 25, 2006;
281(34):
24171 - 24181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Asano, H. Ihn, K. Yamane, M. Jinnin, and K. Tamaki
Increased Expression of Integrin {alpha}v{beta}5 Induces the Myofibroblastic Differentiation of Dermal Fibroblasts
Am. J. Pathol.,
February 1, 2006;
168(2):
499 - 510.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Jinnin, H. Ihn, and K. Tamaki
Characterization of SIS3, a Novel Specific Inhibitor of Smad3, and Its Effect on Transforming Growth Factor-beta1-Induced Extracellular Matrix Expression
Mol. Pharmacol.,
February 1, 2006;
69(2):
597 - 607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Kim, H.-A. Kim, H.-S. Jong, J.-H. Park, N. K. Kim, S. H. Hong, T.-Y. Kim, and Y.-J. Bang
The Endogenous Ratio of Smad2 and Smad3 Influences the Cytostatic Function of Smad3
Mol. Biol. Cell,
October 1, 2005;
16(10):
4672 - 4683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Jinnin, H. Ihn, Y. Mimura, Y. Asano, K. Yamane, and K. Tamaki
Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1
Nucleic Acids Res.,
June 21, 2005;
33(11):
3540 - 3549.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Edmiston, W. A. Yeudall, T. D. Chung, and D. A. Lebman
Inability of Transforming Growth Factor-{beta} to Cause SnoN Degradation Leads to Resistance to Transforming Growth Factor-{beta}-Induced Growth Arrest in Esophageal Cancer Cells
Cancer Res.,
June 1, 2005;
65(11):
4782 - 4788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. P. Sarker, S. M. Wilson, and S. Bonni
SnoN Is a Cell Type-specific Mediator of Transforming Growth Factor-{beta} Responses
J. Biol. Chem.,
April 1, 2005;
280(13):
13037 - 13046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Jinnin, H. Ihn, K. Yamane, Y. Mimura, Y. Asano, and K. Tamaki
{alpha}2(I) collagen gene regulation by protein kinase C signaling in human dermal fibroblasts
Nucleic Acids Res.,
March 1, 2005;
33(4):
1337 - 1351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Edlund, S. Y. Lee, S. Grimsby, S. Zhang, P. Aspenstrom, C.-H. Heldin, and M. Landstrom
Interaction between Smad7 and {beta}-Catenin: Importance for Transforming Growth Factor {beta}-Induced Apoptosis
Mol. Cell. Biol.,
February 15, 2005;
25(4):
1475 - 1488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Hu and N. D. Rosenblum
Smad1, {beta}-catenin and Tcf4 associate in a molecular complex with the Myc promoter in dysplastic renal tissue and cooperate to control Myc transcription
Development,
January 1, 2005;
132(1):
215 - 225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Asano, H. Ihn, K. Yamane, M. Jinnin, Y. Mimura, and K. Tamaki
Phosphatidylinositol 3-Kinase Is Involved in {alpha}2(I) Collagen Gene Expression in Normal and Scleroderma Fibroblasts
J. Immunol.,
June 1, 2004;
172(11):
7123 - 7135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Frederick, N. T. Liberati, D. S. Waddell, Y. Shi, and X.-F. Wang
Transforming Growth Factor {beta}-Mediated Transcriptional Repression of c-myc Is Dependent on Direct Binding of Smad3 to a Novel Repressive Smad Binding Element
Mol. Cell. Biol.,
March 15, 2004;
24(6):
2546 - 2559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Khanna
Concerted effect of transforming growth factor-{beta}, cyclin inhibitor p21, and c-myc on smooth muscle cell proliferation
Am J Physiol Heart Circ Physiol,
March 1, 2004;
286(3):
H1133 - H1140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Bhowmick, M. Ghiassi, M. Aakre, K. Brown, V. Singh, and H. L. Moses
From the Cover: TGF-{beta}-induced RhoA and p160ROCK activation is involved in the inhibition of Cdc25A with resultant cell-cycle arrest
PNAS,
December 23, 2003;
100(26):
15548 - 15553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. McConnell, N. Chevallier, W. Berkofsky-Fessler, J. M. Giltnane, R. B. Malani, L. M. Staudt, and J. D. Licht
Growth Suppression by Acute Promyelocytic Leukemia-Associated Protein PLZF Is Mediated by Repression of c-myc Expression
Mol. Cell. Biol.,
December 15, 2003;
23(24):
9375 - 9388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Matsuyama, M. Iwadate, M. Kondo, M. Saitoh, A. Hanyu, K. Shimizu, H. Aburatani, H. K. Mishima, T. Imamura, K. Miyazono, et al.
SB-431542 and Gleevec Inhibit Transforming Growth Factor-{beta}-Induced Proliferation of Human Osteosarcoma Cells
Cancer Res.,
November 15, 2003;
63(22):
7791 - 7798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rao and T. Kadesch
The Intracellular Form of Notch Blocks Transforming Growth Factor {beta}-Mediated Growth Arrest in Mv1Lu Epithelial Cells
Mol. Cell. Biol.,
September 15, 2003;
23(18):
6694 - 6701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Hu, Z. Wu, and S. H. Phan
Smad3 Mediates Transforming Growth Factor-{beta}-Induced {alpha}-Smooth Muscle Actin Expression
Am. J. Respir. Cell Mol. Biol.,
September 1, 2003;
29(3):
397 - 404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Park and L.-N. Wei
Regulation of c-myc Gene by Nitric Oxide via Inactivating NF-{kappa}B Complex in P19 Mouse Embryonal Carcinoma Cells
J. Biol. Chem.,
August 8, 2003;
278(32):
29776 - 29782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Horikawa and J. C. Barrett
Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms
Carcinogenesis,
July 1, 2003;
24(7):
1167 - 1176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Hu, T. D. Piscione, and N. D. Rosenblum
Elevated SMAD1/{beta}-catenin molecular complexes and renal medullary cystic dysplasia in ALK3 transgenic mice
Development,
June 15, 2003;
130(12):
2753 - 2766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. H. Nelson, T. P. Martyak, L. J. Thompson, J. J. Moon, and T. Wang
Uncoupling of Promitogenic and Antiapoptotic Functions of IL-2 by Smad-Dependent TGF-{beta} Signaling
J. Immunol.,
June 1, 2003;
170(11):
5563 - 5570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sharma, N. Fatma, E. Kubo, T. Shinohara, L. T. Chylack Jr., and D. P. Singh
Lens Epithelium-derived Growth Factor Relieves Transforming Growth Factor-{beta}1-induced Transcription Repression of Heat Shock Proteins in Human Lens Epithelial Cells
J. Biol. Chem.,
May 23, 2003;
278(22):
20037 - 20046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ungefroren, W. Lenschow, W.-B. Chen, F. Faendrich, and H. Kalthoff
Regulation of Biglycan Gene Expression by Transforming Growth Factor-beta Requires MKK6-p38 Mitogen-activated Protein Kinase Signaling Downstream of Smad Signaling
J. Biol. Chem.,
March 21, 2003;
278(13):
11041 - 11049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Baldwin, H. Tran, and B. Y. Karlan
Loss of c-myc Repression Coincides with Ovarian Cancer Resistance to Transforming Growth Factor {beta} Growth Arrest Independent of Transforming Growth Factor {beta}/Smad Signaling
Cancer Res.,
March 15, 2003;
63(6):
1413 - 1419.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. C. Reinhold, H. Kouros-Mehr, K. W. Kohn, A. K. Maunakea, S. Lababidi, A. Roschke, K. Stover, J. Alexander, P. Pantazis, L. Miller, et al.
Apoptotic Susceptibility of Cancer Cells Selected for Camptothecin Resistance: Gene Expression Profiling, Functional Analysis, and Molecular Interaction Mapping
Cancer Res.,
March 1, 2003;
63(5):
1000 - 1011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sasaki, H. Suzuki, K. Yagi, M. Furuhashi, R. Yao, S. Susa, T. Noda, Y. Arai, K. Miyazono, and M. Kato
Lymphoid Enhancer Factor 1 Makes Cells Resistant to Transforming Growth Factor {beta}-induced Repression of c-myc
Cancer Res.,
February 15, 2003;
63(4):
801 - 806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Paez-Pereda, D. Giacomini, D. Refojo, A. C. Nagashima, U. Hopfner, Y. Grubler, A. Chervin, V. Goldberg, R. Goya, S. T. Hentges, et al.
Involvement of bone morphogenetic protein 4 (BMP-4) in pituitary prolactinoma pathogenesis through a Smad/estrogen receptor crosstalk
PNAS,
February 4, 2003;
100(3):
1034 - 1039.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Strieder and W. Lutz
E2F Proteins Regulate MYCN Expression in Neuroblastomas
J. Biol. Chem.,
January 24, 2003;
278(5):
2983 - 2989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Law, A. Chytil, N. Dumont, E. G. Hamilton, M. E. Waltner-Law, M. E. Aakre, C. Covington, and H. L. Moses
Rapamycin Potentiates Transforming Growth Factor {beta}-Induced Growth Arrest in Nontransformed, Oncogene-Transformed, and Human Cancer Cells
Mol. Cell. Biol.,
December 1, 2002;
22(23):
8184 - 8198.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|