HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 1, 854-861, January 4, 2002

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 277/1/854    most recent M104170200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yagi, K. Articles by Kato, M. Search for Related Content PubMed PubMed Citation Articles by Yagi, K. Articles by Kato, M. Social Bookmarking                      What's this?

c-myc Is a Downstream Target of the Smad Pathway^*,

Ken Yagi, Masao Furuhashi, Hiromasa Aoki, Daisuke Goto, Hiroyuki Kuwano^§, Kazuo Sugamura^¶, Kohei Miyazono, and Mitsuyasu Kato^**

From the  Department of Biochemistry, The Cancer Institute of the Japanese Foundation for Cancer Research and Research for the Future Program, Japan Society for the Promotion of Science, 1-37-1 Kami-ikebukuro, Toshima-ku, Tokyo 170-8455, Japan, the ^§ First Department of Surgery, Gunma University School of Medicine, 3-39-22 Schowa-machi, Maebashi, Gunma 371-8511, Japan, the ^¶ Department of Microbiology, Tohoku University School of Medicine, 2-1 Seiryo-machi Aoba-ku, Sendai 980-8575, Japan, and the  Department of Molecular Pathology, Graduate School of Medicine, University of Tokyo, Tokyo 113-0033, Japan

Received for publication, May 9, 2001, and in revised form, September 24, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

c-Myc is one of the most potent regulators of cell cycle progression in higher eukaryotes. Down-regulation of c-Myc is a critical event for growth inhibition induced by transforming growth factor- (TGF-) and is frequently impaired in cancer cells. We determined a Smad-responsive element in the c-myc promoter. This element is a complex of the TGF-1 inhibitory element (TIE) originally identified in the transin/stromelysin promoter and an E2F site responsible for transcriptional activation of the c-myc promoter. Smad3 and E2F-4 directly bound to the element (TIE/E2F), and substitution of two nucleotides in TIE/E2F impaired binding of both Smad3 and E2F-4 as well as serum-induced activation and TGF--induced suppression of the c-myc promoter activity. Smads bound TIE/E2F within 1 h after stimulation with TGF-, before the suppression of c-myc transcription, whereas binding of p130 to TIE/E2F became augmented later than 12 h. TGF- signaling did not compete with E2F-4 for binding to TIE/E2F, but reduced p300 co-immunoprecipitating with E2F-4. Therefore, TGF- signaling may suppress c-myc promoter activity by dissociating p300 from E2F-4.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The transforming growth factor- (TGF-)¹ superfamily is a group of multifunctional cytokines that affect cell growth, cell death, differentiation, and morphogenesis. It consists of more than 40 family members including TGF-s, activins, and bone morphogenetic proteins. TGF- transduces signals via heteromeric complex formation of cognate type II and type I serine/threonine kinase receptors. TGF- type II receptor kinase phosphorylates serine and threonine residues in the GS domain of TGF- type I receptor, which results in activation of the type I receptor kinase. Then, activated type I receptor transduces signals into cytoplasm through phosphorylation of receptor-regulated Smads (R-Smad). Smad2 and Smad3 are the R-Smads activated by the TGF- type I receptor. Activated R-Smads bind to Smad4, which is a common partner Smad and translocate into the nucleus, and this complex serves as a transcriptional regulator (1-3).

TGF- inhibits the growth of many divergent cell types, and loss of TGF- sensitivity has been implicated in tumorigenesis (4-6). Some tumors acquire TGF- resistance following inactivation of TGF- receptors (7, 8) and others by mutations in Smad genes (9-12). However, such alterations cannot account for many cancers in which TGF- responsiveness is lost. Identification of more components essential for the TGF- signaling pathway leading to growth arrest might therefore be required to identify genetic alterations responsible for TGF- resistance in cancer cells.

c-myc was discovered as the cellular homologue of the retroviral v-myc oncogene, and the c-myc proto-oncogene was subsequently found to be activated in various animal and human tumors. Amplification of the c-myc gene has been described in ~15% of all human tumors (13). TGF- down-regulates expression of c-myc in human endothelial cells, breast carcinoma cell lines, a Balb/MK mouse keratinocyte cell line, and HaCaT cells (14-17), and overexpression of c-myc abrogates the growth inhibition of keratinocytes induced by TGF- (18, 19). Genetic screening also showed that c-myc as well as NF-IX-1 sustained proliferation of Mv1Lu cells in the presence of TGF- (20). Loss of TGF--induced suppression of c-myc correlated well with TGF- resistance in colon cancer (21), thyroid cancer (22), and human squamous cell carcinoma cell lines (23, 24).

TGF- was shown to induce G₁ arrest through its effects on the Rb/E2F pathway (25-27), and the c-myc promoter is also a target of the Rb/E2F pathway. However, dephosphorylation of Rb family proteins requires more than several hours, whereas TGF- rapidly down-regulates levels of c-myc mRNA beginning within 1 h of its administration (28). Furthermore, Myc down-regulation was shown to be required for activation of p15^ink4b (29, 30) and p21 CIP1 (19), which precedes inactivation of G₁ cyclin-dependent kinases and dephosphorylation of Rb family proteins. There thus must be a pathway through which TGF- down-regulates c-myc early after TGF--stimulation other than that mediated by Rb family proteins.

To identify this pathway, we analyzed TGF--responsive elements in the human c-myc promoter and found that Smad proteins directly bound to an element in the c-myc promoter and suppressed c-myc promoter activity.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cells-- HaCaT cells and the R mutant of Mv1Lu cells (clone 4-2) were provided by N. E. Fusenig (DKFZ, Heidelberg) and J. Massagué (Sloan-Kettering Cancer Center, New York), respectively. Mv1Lu cells and COS-7 cells were obtained from the American Type Culture Collection. These cells were cultured in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal bovine serum and 10 µg/ml gentamicin. Subclones of HaCaT cells were maintained in MCDB153 medium (Sigma) supplemented with 0.1 mM calcium chloride, 10 ng/ml epidermal growth factor, 10 µg/ml gentamicin, and 5% dialyzed fetal bovine serum. These subclones were used for experiments including DNA transfection. HaCaT cells stably expressing FLAG-Smad3D407E were previously described (31).

DNA Constructs-- c-myc cDNA was excised from pBS0/1 Myc (provided by B. Blackwood and R. N. Eisenman, Fred Hutchinson Cancer Research Center, Seattle, WA) and subcloned into pcDNA3 mammalian expression vector (Invitrogen). cDNA for E2F-1 and E2F-4 was provided by K. Helin (European Institute of Oncology, Milan, Italy) and C. Sardet (Institut de Genetique Moleculaire, Montpellier, France), respectively. AR3-lux was provided by L. Attisano (University of Toronto, Toronto, Canada). pHXluc, a luciferase reporter construct containing 2329/+510 of the human c-myc promoter, was described previously (32). Deletion constructs (367/+16, 142/+16, 40/+16) of the c-myc promoter were amplified using PCR and subcloned into BglII/HindIII sites of pGL3-basic (Promega). Mutants (m-GTCT, GC, m-CAGA, m-TIE, and m-E2F) of the c-myc promoter (367/+16) were amplified by PCR using mutant primers. Upper strand sequences of the mutant primers are as follows: m-GTCT, TGCGAGGaTtTGGACGG; GC, TGTGCTGCTCGCGG:GGGCCCCGGCCGT; m-CAGA, GGCTTCTtAaAGGCTTGG; m-TIE, CAGAGGCcTaGCGGGAA; m-E2F, CTTGGCGttAAAAAGAACG. Luciferase reporters containing 3× TIE/E2F and 3× m-TIE/E2F were constructed by subcloning of CCCGGG-(CAGAGGC(T/c)T(G/a)GCGGGAAAAA)₃-CTCGAG into SmaI/XhoI sites of the pGL3-c-myc core promoter (40/+16). All sequences were confirmed by sequencing. Expression constructs coding TR-I(TD), FLAG-Smad3, FLAG-Smad3D407E, glutathione S-transferase (GST)-Smad3, HA-FAST-1, and p300-HA were described previously (31, 33, 34).

Northern Blot Analysis-- Total cellular RNA was extracted using Isogen (Nippongene, Tokyo, Japan) following the manufacturer's recommendations. Twenty-µg aliquots were electrophoresed on 1% agarose-formaldehyde gels and transferred to nylon membrane (Biodyne A; Pall BioSupport Co.). The membranes were hybridized at 42 °C overnight with random primed DNA probes labeled with [-³²P]dCTP in a hybridization buffer containing 5× SSC, 25% formamide, 1% SDS, 5× Denhardt's solution, and 0.2 mg/ml denatured salmon testis DNA. The membranes were washed to a final stringency of 0.1× SSC, 0.1% SDS at 65 °C, and analyzed using a Fuji BAS 2500 Bio-Image Analyzer (Fuji Photo Film, Tokyo, Japan) and autoradiography.

Immunoprecipitation and Immunoblotting-- Immunoprecipitation and immunoblotting were performed as previously described (34). Cells were solubilized in a buffer containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 1.5% aprotinin, and 1 mM phenylmethylsulfonyl fluoride. After clearing with centrifugation, total cell lysates or immunoprecipitates obtained using anti-HA (12CA5, Roche Molecular Biochemicals) or anti-p300 (Upstate Biotechnology, Inc., Lake Placid, NY) were subjected to SDS-PAGE. Proteins were electrotransferred to polyvinylidene difluoride membranes (ProBlott; Applied Biosystems) and subjected to immunoblotting. Anti-Myc (9E10; Calbiochem), anti-FLAG (M2; Sigma), anti-Smad2/3 (clone 18; Transduction Laboratories, Lexington, KY), anti-E2F-1 (KH95; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-E2F-4 (C-20, Santa Cruz), anti-p130 (C-20; Santa Cruz Biotechnology), anti-p107 (SD9; BD PharMingen), anti-Rb (G3-245; BD PharMingen), anti-HA (3F10; Roche Molecular Biochemicals), and anti-p300 (Upstate Biotechnology) antibodies were used as first antibodies for immunoblotting. Reacted antibodies were detected using an enhanced chemiluminescence detection system (Amersham Pharmacia Biotech). For reblotting, the membranes were stripped following the manufacturer's protocol.

Growth Inhibition Assay-- Cells were seeded in 24-well plates at a density of 5 × 10⁴ cells/well and cultured for 24 h in the growth medium for each cell line. Then the culture fluids were changed to growth medium containing various concentrations of human TGF-. After 16-20 h of incubation, 0.25 µCi/well of [³H]thymidine (Amersham Pharmacia Biotech) was added, and the cells were incubated for an additional 1 h. The cells were fixed in 5% ice-cold trichloroacetic acid for 1 h and solubilized in 1 M NaOH. After neutralization with 1 M HCl, ³H radioactivity was measured with a Beckman LS 6500 liquid scintillation counter.

DNA Transfection and Luciferase Assay-- Cells were transfected using FuGENE6 transfection reagent (Roche Molecular Biochemicals) following the manufacturer's recommendations. Stable HaCaT clones transfected with pcDNA3-c-myc were selected and maintained in the presence of 300 µg/ml G418 (Invitrogen). Luciferase activity in the cell lysates was determined by a dual luciferase reporter assay system (Promega) using a luminometer (AutoLumat LB953; EG & G Berthold). Luciferase activities were normalized to either sea pansy luciferase activity of cotransfected pRL-TK (Promega) or -galactosidase activity of cotransfected pcDNA3.1/Hygro/lacZ (Invitrogen).

Electrophoretic Mobility Shift Assay (EMSA)-- EMSA was performed as described previously (34). A GST fusion protein was prepared as described (35). A c-myc promoter DNA fragment (263/+16) was excised by XbaI/SacI and end-labeled with [-³²P]dATP using Klenow fragment of DNA polymerase. The upper strand sequences of oligonucleotide probes were as follows: TIE/E2F, GGG-(CAGAGGCTTGGCGGGAAAAA)₃-C; m-TIE/E2F, GGG-(CAGAGGCcTaGCGGGAAAAA)₃-C. Binding reactions containing whole cell extracts (34) or 400 ng of GST-Smad3MH2 (Smad3 lacking the MH2 domain (35)) and 2 ng of labeled oligonucleotides were performed for 20 min at 37 °C in 18 µl of binding buffer. Protein-DNA complexes were then resolved in 5% polyacrylamide gels containing 0.5× Tris borate/EDTA electrophoresis buffer. Specificity of binding was demonstrated by a competition assay using 2× TRE or 3× TIE/E2F oligonucleotides as a cold probe; the upper strand sequence of 2× TRE was as follows: GATATGAGTC AGACACCTCT GGCTTTCTGG AAGGGATGAG TCAGACACCT CTGGCTTTCT GGAAGGGAGC TTG. For supershift analysis, anti-Smad2/3 (clone 18; Transduction Laboratories), anti-FLAG (M2; Sigma), or anti-E2F-4 (C-20; Santa Cruz Biotechnology) were added to the whole cell extracts or GST-fused proteins.

DNase I Footprinting Analysis-- GST-Smad3MH2 was preincubated for 10 min on ice in 50 µl of 20 mM HEPES-KOH (pH 7.6), 20% glycerol, 100 mM NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 50 µg/ml poly(dI-dC), followed by a 30-min incubation in the presence of 20,000 cpm of asymmetrically ³²P-labeled DNA probe. After the addition of 50 µl of 10 mM MgCl₂, 5 mM CaCl₂, each reaction was treated with 2.5 or 5.0 µg/ml of DNase I (Amersham Biosciences, Inc.) for 5 min on ice and then stopped by adding 100 µl of stop solution (1% SDS, 20 mM EDTA, 250 µg/ml yeast tRNA). The DNA was then precipitated and subjected to electrophoresis.

DNA Affinity Precipitation (DNAP)-- Cell lysates prepared in 1% Nonidet P-40, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 1.5% aprotinin, 20 mM Tris-HCl (pH 7.5) were precleared with streptavidin-agarose beads (Sigma) and then incubated with 200 ng of biotinylated double-stranded oligonucleotides in the presence of 2 µg of poly(dI-dC) at 4 °C for 1 h. DNA-bound proteins were mixed with streptavidin-agarose (Sigma) for 1 h with end-over-end rotation, washed extensively with cell lysis buffer, and analyzed by SDS-PAGE and immunoblotting. The sequences of the upper strands of oligonucleotides were three repeats of the following sequences: TIE/E2F, CAGAGGCTTGGCGGGAAAAA; m-TIE/E2F, CAGAGGCcTaGCGGGAAAAA; m-CAGA, tAaAGGCTTGGCGGGAAAAA; TIE/m-E2F, CAGAGGCTTGGCGttAAAAA.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

c-myc Is an Early TGF--responsive Gene and Must Be Decreased for Growth Inhibition of HaCaT Cells-- Levels of c-myc mRNA in exponentially growing HaCaT cells were suppressed rapidly after TGF--stimulation. c-myc mRNA began to decrease within 1 h and reached less than 30% of the control level within 6 h. The decrease was not affected by the presence of cycloheximide, indicating that this response did not require new protein synthesis (Fig. 1A). To elucidate whether the c-myc is suppressed through the Smad pathway, we used HaCaT cells stably expressing a dominant negative mutant of Smad3 (31). As shown in Fig. 1B, Smad3D407E blocked down-regulation of c-Myc in HaCaT cells both in mRNA and protein levels, suggesting that c-myc is a downstream target of the Smad pathway. In addition to dysregulation of c-myc, these cell lines lost growth-inhibitory response to TGF- as previously reported (31). Furthermore, we established HaCaT cells stably expressing exogenous c-myc. Levels of c-Myc in these transfectants were not suppressed by TGF- (Fig. 2A). Growth of these transfectants was not affected by TGF- (Fig. 2B), as previously shown for Balb/MK (18), Mv1Lu (20), and HaCaT cells (19).

View larger version (23K): [in this window] [in a new window]   Fig. 1.   c-myc is an immediate early responsive gene downstream of the Smad pathway. A, Northern blot analysis for c-myc. Exponentially growing HaCaT cells were incubated with 100 pM TGF- for the indicated periods in the absence or presence of cycloheximide (CXH). Relative levels of c-myc expression were determined by densitometry and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. B, TGF- does not down-regulate c-Myc in the presence of a dominant-negative Smad3. Immunoblot (Blot) analysis for FLAG-Smad3D407E in FLAG-Smad3D407E-transfected HaCaT cell lines (H3.3, H3.4, and H3.9) is shown in the upper panel (anti-FLAG). These cells were stimulated with TGF- (100 pM, 6 h) as indicated and subjected to Northern blot analysis for c-myc and GAPDH and immunoblot analysis for c-Myc, as indicated. GI (%), percentage reduction of [3H]thymidine incorporation of each clone after incubation with TGF- (100 pM, 24 h).

View larger version (31K): [in this window] [in a new window]   Fig. 2.   Down-regulation of c-Myc is required for inhibition of growth of HaCaT cells by TGF- signaling. A, establishment of HaCaT cells stably expressing c-Myc. Immunoblot analysis for c-Myc in the absence or presence of 100 pM TGF- in c-myc-transfected HaCaT cell lines is shown. HaCaT, HaCaT cells; Mock, a mock-transfected clone of HaCaT cells; HaCaT-c-myc clone 1 and clone 2, c-myc-transfected clones of HaCaT cells. B, stable expression of c-myc confers resistance to TGF--induced growth inhibition. Effects of TGF- on [3H]thymidine incorporation by c-myc-transfected HaCaT cell lines (A) are shown. , HaCaT; , HaCaT-Mock; , HaCaT-c-myc clone 1; , HaCaT-c-myc clone 2.

Identification of Smad3-binding Elements in the c-myc Promoter-- We next mapped TGF--responsive region(s) in the human c-myc promoter (Fig. 3A). Within the 2329/+510 human c-myc promoter, the proximal 150 bp (142/+16) was sufficient for serum-induced activation and TGF--dependent suppression of c-myc promoter activity. The 367/+16 promoter stronger serum-induced activation and repression by TGF- much stronger than the 2329/+510 reporter, suggesting the presence of negative regulatory element(s) in 2329/367 or +16/+510. We further examined whether Smad3 directly bound the c-myc promoter. As shown in Fig. 3B, purified GST-Smad3MH2 (Smad3 lacking the MH2 domain) (35) directly bound the c-myc promoter including 142/+16. The shift band was diminished by the presence of an excess amount of a cold probe. Smad binding elements in this DNA fragment were then identified by DNase I footprinting analyses. There were three Smad3 binding elements in this region: a GTCT element upstream of the P1 promoter, a GC-rich element, and TIE overlapping with the E2F element (Fig. 3C, a, b, and c, respectively).

View larger version (34K): [in this window] [in a new window]   Fig. 3.   Identification of Smad-responsive elements in the c-myc promoter. A, the 142/+16 region of the human c-myc promoter is sufficient for responsiveness to TGF-. Reporter constructs containing 5'-deleted fragments of human c-myc promoter were transfected into Mv1Lu cells. TGF- (100 pM) was added at 4 h after transfection and incubated for another 24 h. Luciferase activity was normalized to galactosidase activity of cotransfected pcDNA3.1/lacZ. B, EMSA showing that purified GST-Smad3MH2 (GST-Smad3) directly binds 263/+16 of the c-myc promoter. Competitor, nonlabeled competitive oligonucleotides (2× TRE, 20 pmol). C, DNase I footprinting analysis showing that 263/+16 region of the c-myc promoter has three Smad binding elements. Sequences blocked by GST-Smad3MH2 binding (a, b, and c) are shown at the bottom and underlined.

TIE/E2F Element Is Responsible for Repression by TGF--- We next mutated or deleted each Smad3-binding element in the 367/+16 c-myc promoter as shown in Fig. 4A. Loss of Smad binding to these mutated elements was confirmed by DNase I footprinting analyses (data not shown). Mutations in the GTCT element and deletion of the GC-rich element affected neither control promoter activity nor TGF--responsiveness in growing Mv1Lu cells. Concerning the TIE/E2F element, we created a TIE mutant (m-TIE) that did not change the original E2F element (36) and a mutant in the E2F element (m-E2F) that kept the intact TIE sequence (37) (Fig. 4A). Both of these mutants considerably reduced serum-induced activation of the c-myc promoter and completely abrogated TGF--dependent repression (Fig. 4, B and C). TIE/E2F was indispensable for TGF--induced suppression of the c-myc promoter activity, whereas serum-responsive elements should exist besides TIE/E2F because m-TIE still responded to serum (Fig. 4C). We next constructed a reporter consisting of three tandem repeats of the TIE/E2F (3× TIE/E2F) connected to the core P2 promoter (40/+16) of c-myc. Serum stimulation clearly enhanced transcriptional activity from the element, and this enhancement was totally blocked by TGF-. These responses were completely lost with a TIE mutation (Fig. 4C). Therefore, the TIE/E2F element is involved in both positive and negative regulation of c-myc promoter activity.

View larger version (21K): [in this window] [in a new window]   Fig. 4.   Mutations in TIE/E2F but not other Smad3-binding elements abrogate TGF--induced repression of c-myc promoter activity. A, schematic presentation of the human c-myc promoter, three Smad3 binding sites, and their mutants. TCE, a TGF- control element previously reported (42). B, mutational analysis of c-myc promoter activity. Mv1Lu cells were transfected with 367/+16 c-myc promoter reporter constructs with mutations shown in A. C, the TIE/E2F element mediates both serum-induced activation and TGF--induced suppression of c-myc promoter activity. Mv1Lu cells were transfected with 367/+16(WT), 367/+16(m-TIE), 3× TIE/E2F, or 3× m-TIE/E2F reporter constructs, starved for 24 h, and refed with 10% fetal bovine serum with or without 100 pM TGF-, as indicated. After another 24-h incubation, cells were subjected to luciferase assay.

TIE/E2F Binds both Smads and E2F-4-- To examine whether Smad3 bound TIE/E2F in a TGF--dependent manner, COS-7 cells were transfected with FLAG-Smad3 in the absence or presence of constitutively active form of TGF- type I receptor. Total cellular lysates were subjected to DNAP analyses using a biotinylated TIE/E2F oligonucleotide as a probe. Smad3 but not a dominant-negative mutant of Smad3 bound TIE/E2F oligonucleotides in a TGF- signaling-dependent manner (Fig. 5A). This binding was specific to the sequence, since two-nucleotide substitution in the TIE element (m-TIE/E2F) totally abrogated Smad binding to the DNA. E2F-1 and E2F-4 were also highly expressed in COS-7 cells upon transient DNA transfection. In this condition, E2F-4, but not E2F-1, bound TIE/E2F (Fig. 5B).

View larger version (53K): [in this window] [in a new window]   Fig. 5.   TIE/E2F in the c-myc promoter binds Smads in a TGF--signal-dependent manner. A, overexpressed FLAG-Smad3 binds TIE/E2F depending on the presence of coexpressed constitutively active TGF- type I receptor. FLAG-Smad3, a dominant negative mutant of Smad3 (FLAG-Smad3D407E) and constitutively active TGF- type I receptor (TRI-TD) were transfected into COS-7 cells as indicated. Total cell lysates were incubated with biotinylated TIE/E2F or mutant oligonucleotides (m-TIE/E2F) and precipitated by streptavidin-agarose beads (Sigma). DNA affinity-purified precipitates (upper panel) or aliquots of total cell lysates (lower panel) were subjected to immunoblot analysis using anti-FLAG antibody. B, E2F-4 but not E2F-1 binds TIE/E2F in the c-myc promoter. COS-7 cells were transfected with E2F-1 (upper panel) or E2F-4 (lower panel) as indicated, and then cell lysates were subjected to SDS-PAGE either directly (lanes 1 and 2 from the left) or after DNAP using TIE/E2F oligonucleotides as a probe (lanes 3 and 4 from the left). After transfer, membranes were blotted for E2F-1 (upper panel) or E2F-4 (lower panel) using specific antibodies. C, endogenous Smad3 in HaCaT cells together with Smad2 binds TIE/E2F immediately after stimulation with TGF-. HaCaT cells were incubated with TGF- (20 pM, 1 h), lysed, and subjected to DNAP using biotinylated TIE/E2F or mutant oligonucleotides. After SDS-PAGE and transfer, the membranes were blotted with anti-Smad2/3 antibody (upper panel) or anti-E2F-4 antibody (lower panel). D, EMSA showing that purified GST-Smad3MH2 (GST-Smad3) directly binds 3× TIE/E2F but not 3× m-TIE/E2F. Antibody, anti-Smad2/3 (clone 18; Transduction Laboratories). Competitor, nonlabeled competitive oligonucleotides (3× TIE/E2F; 20 pmol). E, EMSA showing that E2F-4 and FLAG-Smad3 independently bind 3× TIE/E2F. COS-7 cells were transfected with E2F-4, DP-1, FLAG-Smad3, and TRI(TD), as indicated, and total cell lysates were subjected to EMSA using 3× TIE/E2F or 3× m-TIE/E2F as probes in the absence or presence of the indicated antibodies. Antibodies, anti-E2F-4 (C-20; Santa Cruz Biotechnology), anti-FLAG (M2; Sigma).

Binding of endogenous Smad proteins and E2F in HaCaT cells was further examined. Both of the TGF- receptor-regulated Smads, Smad2 and Smad3, bound the TIE/E2F element at 1 h after TGF- stimulation (Fig. 5C). Since Smad2 does not bind DNA directly, it may bind through Smad3 or Smad4. Mutations either in the TIE element or in the E2F element impaired Smad binding to this DNA fragment (Fig. 5C), while a CAGA mutation did not affect the binding, corresponding to the results of functional assay shown in Fig. 4.

Endogenous E2F-4 bound TIE/E2F regardless of the presence of TGF- signaling. In addition, the E2F-4 binding and the Smad binding were impaired by either the TIE mutation or the E2F mutation (Fig. 5C). Since TGF--regulated Smads and E2F-4 bound the same TIE/E2F element, we further examined whether binding of these two was mutually exclusive. However, binding of Smad did not affect E2F-4 binding to TIE/E2F, as shown in Fig. 5C (see also Fig. 6A). TGF- signaling thus is not likely to repress c-myc promoter activity by competing with E2F-4 for DNA binding.

View larger version (74K): [in this window] [in a new window]   Fig. 6.   Effects of TGF- signaling on the binding of E2F, Smads, and Rb family proteins to the TIE/E2F element. A, binding of p130 to TIE/E2F requires more than several hours after stimulation with TGF-, whereas binding of Smad is a quick event. HaCaT cells were stimulated with TGF- (100 pM) for indicated periods, lysed, and subjected to DNAP using biotinylated TIE/E2F as a probe. After SDS-PAGE and transfer, the membranes were blotted with antibodies against E2F-4, Smad2/3, p130, p107, or pRb, as indicated. B, TGF- dissociates p300 from E2F-4. COS-7 cells were transfected with the indicated expression plasmids, and cell lysates were subjected to immunoprecipitation against p300 followed by immunoblotting for E2F-4 (top panel). Aliquots of the cell lysates were directly subjected to immunoblotting using anti-E2F-4, anti-FLAG, and anti-HA antibodies to detect levels of E2F-4, Smad3 and TR-I(TD), and p300, as indicated. C, dissociation of p300 from E2F-4 depends on Smad3. COS-7 cells were transfected with indicated expression plasmids, and cell lysates were subjected to immunoprecipitation against p300 followed by immunoblotting for E2F-4 or Smad3, as indicated (upper panels). Aliquots of the cell lysates were directly subjected to immunoblotting using anti-E2F-4, anti-HA, and anti-FLAG antibodies to detect levels of E2F-4, p300, Smad3, and TR-I(TD), as indicated. D, transcriptional activation by E2F-4 and p300 via the TIE/E2F element is blocked by TGF- signaling. Mv1Lu cells were transfected with 3× TIE/E2F or 3× m-TIE/E2F reporter constructs together with E2F-4 and p300 expression vectors as indicated and cultured for 4 h. Then, cells were incubated with TGF- (100 pM) for another 24 h and subjected to luciferase analysis.

Since E2F mutation as well as TIE mutation abrogated Smad binding to TIE/E2F, we confirmed whether GST-Smad3MH2 directly bound TIE/E2F in EMSA. GST-Smad3MH2 directly bound TIE/E2F in the absence of E2F-4 in a sequence-specific manner (Fig. 5D). Complexes of FLAG-Smad3 and TIE/E2F in COS-7 cells were also analyzed by EMSA. E2F-4 made detectable complexes with TIE/E2F only in the presence of DP-1. Anti-E2F-4 supershifted complexes of E2F-4 and TIE/E2F. In contrast, shift bands containing FLAG-Smad3 were not affected so much by the presence of anti-E2F-4 both in the absence and in the presence of anti-FLAG antibody. These results suggest that Smad3 and E2F-4 independently bind TIE/E2F and that only a part of TIE/E2F binds both Smad3 and E2F-4 (Fig. 5E).

Time Course of Binding of E2F, Smads, and Rb Family Proteins to TIE/E2F after TGF- Stimulation-- We next examined the time course of binding of E2F-4, Smads, and Rb family proteins to TIE/E2F after administration of TGF- (Fig. 6A). HaCaT cells were stimulated with TGF- for the indicated times, and total cell lysates were subjected to DNAP analyses using 3× TIE/E2F as a probe. Binding of E2F-4 and pRb was not affected by TGF-. Smad2/3 was induced to bind TIE/E2F within 2 h and kept binding up to 24 h (Fig. 6A). Binding of p130 became detectable at 6 h and clearly enhanced after 12 h. Binding of p107 decreased after 6 h, inversely proportional to p130 (Fig. 6A).

TGF- Signaling Dissociates p300 from E2F-4-- We tried to detect endogenous p300 in the precipitates after DNAP with 3× TIE/E2F, but it was under detectable levels. Therefore, the effect of TGF- signaling on the complex formation between E2F-4 and p300 was analyzed using overexpressed proteins in COS-7 cells. Fig. 6B clearly shows that TGF- blocked coprecipitation of p300 with E2F-4. Complexes of E2F-4 and p300 decreased inverse proportionally with the increase of p300-bound Smad3 in the presence of TGF- signaling (Fig. 6C). The effects of TGF- on the cooperation between E2F-4 and p300 were analyzed also by luciferase reporter assay. E2F-4 increased transcriptional activity via TIE/E2F elements, and p300 cooperatively enhanced the promoter activity. This cooperative effect of p300 with E2F-4 was again blocked by TGF- signaling (Fig. 6C).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

c-Myc is an essential regulator of cell cycle progression that is required for activation of cyclin-dependent kinase complexes (19, 29, 30, 38). Overexpression of c-myc overcomes TGF--induced cell cycle arrest, and c-myc is frequently highly expressed in cancer cells. c-myc was also identified as a target of the APC pathway (39) and of tumor-derived p53 mutants (40). The Ras/mitogen-activated protein kinase pathway was shown to stabilize Myc protein (41). Furthermore, c-Myc was reported to activate telomerase (42). All of these recent findings confirmed that c-Myc plays essential roles in carcinogenesis.

We have shown in the present study that c-myc is an early responsive gene required for TGF--induced growth inhibition of HaCaT cells. It was controlled downstream of the Smad pathway, and the TIE/E2F element was responsible for both serum-induced activation and TGF--induced suppression of the c-myc promoter activity. This element was previously reported as the cell cycle-dependent element, including an E2F site (43).

The heteromeric E2F/DP transcription factors frequently act as repressors in G₀/early G₁ because of their association with the Rb family proteins. In late G₁, the Rb family proteins become hyperphosphorylated and dissociate from E2F, leading to derepression of E2F-regulated genes (44, 45). Several cell cycle-regulated genes, including B-myb (46, 47), DHFR (48), and E2F1 (49, 50), are repressed through an E2F-mediated mechanism in G₀/G₁ and derepressed in late G₁. In such cases, mutations in the E2F site up-regulate transcription of these genes in quiescent cells (46, 47, 51). However, in the case of the c-myc promoter, abrogation of E2F binding to this element decreased transcriptional activity of the promoter (Fig. 4, B and C), suggesting that the E2F site in the human c-myc promoter acts essentially as a positive regulatory element. In case of the genes suppressed by the E2F element, the E2F site cooperates with a contiguous corepressor element, termed the cell cycle genes homology region (CHR). The CHR sequence was first identified in the B-myb, cyclin A, cdc2, and cdc25C genes (51). Identical CHR sequence was reported also in the cdc25A gene (52). However, the c-myc gene does not have such a CHR-like element.

A unique characteristic of the c-myc cell cycle-dependent element is the presence of a TIE element, GnnTTGGnG, and an ets binding element overlapping with the E2F site (37, 53, 54). TIE was originally identified in the transin/stromelysin gene (53). A similar sequence was also identified as a TGF--responsive element in the mouse tissue transglutaminase gene (54) and a TGF--inhibitory-response element in the cdc25A promoter (52). In the present study, we have shown that the TIE/E2F element is essential for the transcriptional regulation of c-myc by both serum and TGF-. We could not detect any complexes of E2F-4 and Smad3 either in HaCaT cells or COS-7 cells transfected with E2F-4 and Smad3 (data not shown), and EMSA suggested that E2F-4 and Smad3 independently bound the TIE/E2F element (Fig. 5E). We expected that our TIE mutation would not significantly affect E2F binding, since our TIE mutation did not change any nucleotides in the originally reported E2F element GCGGGAAA (36). However, either TIE mutation or E2F mutation abrogated both Smad3 and E2F-4 binding to this element. It would be interesting to determine whether any mutations impair binding of either Smad3 or E2F alone.

Tumor necrosis factor and interferon- cooperatively repress transcription from the c-myc promoter by reducing E2F binding activity to the E2F element (55), but TGF- signaling suppressed c-myc promoter activity without affecting E2F-4 binding (Figs. 5C and 6A). These results suggest that some molecule(s) other than E2F-4 or acting together with E2F4 might be responsible for serum-induced transcriptional activation of c-myc and that such molecule(s) might be competed by TGF- signaling. Supporting this possibility, we have shown that TGF- signaling dissociated p300 from E2F-4 (Fig. 6, B and C). We could not detect binding of endogenous p300 through E2F-4 to TIE/E2F, but the dissociation of p300 from E2F is a possible mechanism of suppression of c-myc promoter activity induced by TGF-. Further studies using more sensitive experiments such as chromatin precipitation may give an answer for this possibility.

E2F has been shown to form a large complex including Rb family members, cyclin A, Cdk2, and v-Abl (56, 57). These molecules are expected to enhance transcriptional activity of E2F (56). CREG is a corepressor of E2F that inhibits E1A- and E2F-stimulated gene expression (58). TRRAP binds to c-Myc and E2F and is essential for transforming activity of c-Myc and E1A (59). Recently, TRRAP was shown to recruit the histone acetyltransferase hGCN5 to c-Myc (60), suggesting that TRRAP plays a role as a component of transcriptional cofactors for c-Myc and E2F. To get an overall view of how TGF- signaling affects transcriptional activity via the TIE/E2F element in the c-myc promoter, these cofactors should be examined for whether they are affected by TGF- signaling in relation to the time course of suppression of c-myc promoter activity.

We found that transcriptional regulation via TIE/E2F of the c-myc promoter was selectively impaired in cancer cell lines.² We do not know the mechanism of this selectivity. Recently, MCF-10A cells double-transfected with c-Ha-ras (G12V) and c-erbB2 were reported to selectively lose TIE-mediated suppression of c-myc by TGF- signaling, suggesting that defective regulation of c-myc via the TIE element might be a rather common phenomenon in carcinogenesis (61). Since c-myc plays essential roles in carcinogenesis, further studies to clarify TGF--induced transcriptional regulation via the TIE/E2F element should yield important findings for the understanding of dysregulated expression of c-myc and possibly for the autonomous growth of cancer cells.

	ACKNOWLEDGEMENTS

We thank N. E. Fusenig and J. Massagué for HaCaT cells and R mutant cells of Mv1Lu (clone 4-2), respectively. We also thank B. Blackwood and R. N. Eisenman, K. Helin, C. Sardet, and L. Attisano for cDNAs of c-myc, E2F-1, E2F-4, and AR3-lux reporter, respectively.

	FOOTNOTES

^* This study was supported by grants-in-aid for Scientific Research from the Ministry of Education, Science, Sports, Culture and Technology of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The on-line version of this article (available at http://www.jbc.org) contains additional figures.

^** To whom correspondence should be addressed: Dept. of Biochemistry, The Cancer Institute of the Japanese Foundation for Cancer Research, 1-37-1 Kami-ikebukuro, Toshima-ku, Tokyo 170-8455, Japan. Tel.: 81-3-5394-3866; Fax: 81-3-3918-0342; E-mail: mit-ind@umin.ac.jp.

Published, JBC Papers in Press, October 31, 2001, DOI 10.1074/jbc.M104170200

² K. Yagi, K. Miyazono, and M. Kato, unpublished data.

	ABBREVIATIONS

The abbreviations used are: TGF-, transforming growth factor-; R-Smad, receptor-regulated Smad; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase; TRE, 12-O-tetradecanoylphorbol-13-acetate-responsive element; DNAP, DNA affinity precipitation; TIE, TGF-1 inhibitory element; CHR, cell cycle genes homology region.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				L. B. Baughn, M. Di Liberto, R. Niesvizky, H. J. Cho, D. Jayabalan, J. Lane, F. Liu, and S. Chen-Kiang CDK2 Phosphorylation of Smad2 Disrupts TGF-{beta} Transcriptional Regulation in Resistant Primary Bone Marrow Myeloma Cells J. Immunol., February 15, 2009; 182(4): 1810 - 1817. [Abstract] [Full Text] [PDF]

				L. C. Spender and G. J. Inman TGF-{beta} Induces Growth Arrest in Burkitt Lymphoma Cells via Transcriptional Repression of E2F-1 J. Biol. Chem., January 16, 2009; 284(3): 1435 - 1442. [Abstract] [Full Text] [PDF]

				F. Lohmann and J. J. Bieker Activation of Eklf expression during hematopoiesis by Gata2 and Smad5 prior to erythroid commitment Development, June 15, 2008; 135(12): 2071 - 2082. [Abstract] [Full Text] [PDF]

				R. Alvarez-Rodriguez, M. Barzi, J. Berenguer, and S. Pons Bone Morphogenetic Protein 2 Opposes Shh-mediated Proliferation in Cerebellar Granule Cells through a TIEG-1-based Regulation of Nmyc J. Biol. Chem., December 21, 2007; 282(51): 37170 - 37180. [Abstract] [Full Text] [PDF]

				C. Xin, S. Ren, W. Eberhardt, J. Pfeilschifter, and A. Huwiler Sphingosylphosphorylcholine acts in an anti-inflammatory manner in renal mesangial cells by reducing interleukin-1{beta}-induced prostaglandin E2 formation J. Lipid Res., September 1, 2007; 48(9): 1985 - 1996. [Abstract] [Full Text] [PDF]

				N. Kobayashi, K. Goto, K. Horiguchi, M. Nagata, M. Kawata, K. Miyazawa, M. Saitoh, and K. Miyazono c-Ski activates MyoD in the nucleus of myoblastic cells through suppression of histone deacetylases Genes Cells, March 1, 2007; 12(3): 375 - 385. [Abstract] [Full Text] [PDF]

				S. K. Lim and F. M. Hoffmann Smad4 cooperates with lymphoid enhancer-binding factor 1/T cell-specific factor to increase c-myc expression in the absence of TGF-beta signaling PNAS, December 5, 2006; 103(49): 18580 - 18585. [Abstract] [Full Text] [PDF]

				K. Jungert, A. Buck, M. Buchholz, M. Wagner, G. Adler, T. M. Gress, and V. Ellenrieder Smad-Sp1 complexes mediate TGF{beta}-induced early transcription of oncogenic Smad7 in pancreatic cancer cells Carcinogenesis, December 1, 2006; 27(12): 2392 - 2401. [Abstract] [Full Text] [PDF]

				A. Buck, M. Buchholz, M. Wagner, G. Adler, T. Gress, and V. Ellenrieder The Tumor Suppressor KLF11 Mediates a Novel Mechanism in Transforming Growth Factor {beta}-Induced Growth Inhibition That Is Inactivated in Pancreatic Cancer Mol. Cancer Res., November 1, 2006; 4(11): 861 - 872. [Abstract] [Full Text] [PDF]

				I. Fantozzi, O. Platoshyn, A. H. Wong, S. Zhang, C. V. Remillard, M. R. Furtado, O. V. Petrauskene, and J. X.-J. Yuan Bone morphogenetic protein-2 upregulates expression and function of voltage-gated K+ channels in human pulmonary artery smooth muscle cells Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L993 - L1004. [Abstract] [Full Text] [PDF]

				S. McMahon, M. Charbonneau, S. Grandmont, D. E. Richard, and C. M. Dubois Transforming Growth Factor beta1 Induces Hypoxia-inducible Factor-1 Stabilization through Selective Inhibition of PHD2 Expression J. Biol. Chem., August 25, 2006; 281(34): 24171 - 24181. [Abstract] [Full Text] [PDF]

				Y. Asano, H. Ihn, K. Yamane, M. Jinnin, and K. Tamaki Increased Expression of Integrin {alpha}v{beta}5 Induces the Myofibroblastic Differentiation of Dermal Fibroblasts Am. J. Pathol., February 1, 2006; 168(2): 499 - 510. [Abstract] [Full Text] [PDF]

				M. Jinnin, H. Ihn, and K. Tamaki Characterization of SIS3, a Novel Specific Inhibitor of Smad3, and Its Effect on Transforming Growth Factor-beta1-Induced Extracellular Matrix Expression Mol. Pharmacol., February 1, 2006; 69(2): 597 - 607. [Abstract] [Full Text] [PDF]

				S. G. Kim, H.-A. Kim, H.-S. Jong, J.-H. Park, N. K. Kim, S. H. Hong, T.-Y. Kim, and Y.-J. Bang The Endogenous Ratio of Smad2 and Smad3 Influences the Cytostatic Function of Smad3 Mol. Biol. Cell, October 1, 2005; 16(10): 4672 - 4683. [Abstract] [Full Text] [PDF]

				M. Jinnin, H. Ihn, Y. Mimura, Y. Asano, K. Yamane, and K. Tamaki Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1 Nucleic Acids Res., June 21, 2005; 33(11): 3540 - 3549. [Abstract] [Full Text] [PDF]

				J. S. Edmiston, W. A. Yeudall, T. D. Chung, and D. A. Lebman Inability of Transforming Growth Factor-{beta} to Cause SnoN Degradation Leads to Resistance to Transforming Growth Factor-{beta}-Induced Growth Arrest in Esophageal Cancer Cells Cancer Res., June 1, 2005; 65(11): 4782 - 4788. [Abstract] [Full Text] [PDF]

				K. P. Sarker, S. M. Wilson, and S. Bonni SnoN Is a Cell Type-specific Mediator of Transforming Growth Factor-{beta} Responses J. Biol. Chem., April 1, 2005; 280(13): 13037 - 13046. [Abstract] [Full Text] [PDF]

				M. Jinnin, H. Ihn, K. Yamane, Y. Mimura, Y. Asano, and K. Tamaki {alpha}2(I) collagen gene regulation by protein kinase C signaling in human dermal fibroblasts Nucleic Acids Res., March 1, 2005; 33(4): 1337 - 1351. [Abstract] [Full Text] [PDF]

				S. Edlund, S. Y. Lee, S. Grimsby, S. Zhang, P. Aspenstrom, C.-H. Heldin, and M. Landstrom Interaction between Smad7 and {beta}-Catenin: Importance for Transforming Growth Factor {beta}-Induced Apoptosis Mol. Cell. Biol., February 15, 2005; 25(4): 1475 - 1488. [Abstract] [Full Text] [PDF]

				M. C. Hu and N. D. Rosenblum Smad1, {beta}-catenin and Tcf4 associate in a molecular complex with the Myc promoter in dysplastic renal tissue and cooperate to control Myc transcription Development, January 1, 2005; 132(1): 215 - 225. [Abstract] [Full Text] [PDF]

				Y. Asano, H. Ihn, K. Yamane, M. Jinnin, Y. Mimura, and K. Tamaki Phosphatidylinositol 3-Kinase Is Involved in {alpha}2(I) Collagen Gene Expression in Normal and Scleroderma Fibroblasts J. Immunol., June 1, 2004; 172(11): 7123 - 7135. [Abstract] [Full Text] [PDF]

				J. P. Frederick, N. T. Liberati, D. S. Waddell, Y. Shi, and X.-F. Wang Transforming Growth Factor {beta}-Mediated Transcriptional Repression of c-myc Is Dependent on Direct Binding of Smad3 to a Novel Repressive Smad Binding Element Mol. Cell. Biol., March 15, 2004; 24(6): 2546 - 2559. [Abstract] [Full Text] [PDF]

				A. Khanna Concerted effect of transforming growth factor-{beta}, cyclin inhibitor p21, and c-myc on smooth muscle cell proliferation Am J Physiol Heart Circ Physiol, March 1, 2004; 286(3): H1133 - H1140. [Abstract] [Full Text] [PDF]

				N. A. Bhowmick, M. Ghiassi, M. Aakre, K. Brown, V. Singh, and H. L. Moses From the Cover: TGF-{beta}-induced RhoA and p160ROCK activation is involved in the inhibition of Cdc25A with resultant cell-cycle arrest PNAS, December 23, 2003; 100(26): 15548 - 15553. [Abstract] [Full Text] [PDF]

				M. J. McConnell, N. Chevallier, W. Berkofsky-Fessler, J. M. Giltnane, R. B. Malani, L. M. Staudt, and J. D. Licht Growth Suppression by Acute Promyelocytic Leukemia-Associated Protein PLZF Is Mediated by Repression of c-myc Expression Mol. Cell. Biol., December 15, 2003; 23(24): 9375 - 9388. [Abstract] [Full Text] [PDF]

				S. Matsuyama, M. Iwadate, M. Kondo, M. Saitoh, A. Hanyu, K. Shimizu, H. Aburatani, H. K. Mishima, T. Imamura, K. Miyazono, et al. SB-431542 and Gleevec Inhibit Transforming Growth Factor-{beta}-Induced Proliferation of Human Osteosarcoma Cells Cancer Res., November 15, 2003; 63(22): 7791 - 7798. [Abstract] [Full Text] [PDF]

				P. Rao and T. Kadesch The Intracellular Form of Notch Blocks Transforming Growth Factor {beta}-Mediated Growth Arrest in Mv1Lu Epithelial Cells Mol. Cell. Biol., September 15, 2003; 23(18): 6694 - 6701. [Abstract] [Full Text] [PDF]

				B. Hu, Z. Wu, and S. H. Phan Smad3 Mediates Transforming Growth Factor-{beta}-Induced {alpha}-Smooth Muscle Actin Expression Am. J. Respir. Cell Mol. Biol., September 1, 2003; 29(3): 397 - 404. [Abstract] [Full Text] [PDF]

				S. W. Park and L.-N. Wei Regulation of c-myc Gene by Nitric Oxide via Inactivating NF-{kappa}B Complex in P19 Mouse Embryonal Carcinoma Cells J. Biol. Chem., August 8, 2003; 278(32): 29776 - 29782. [Abstract] [Full Text] [PDF]

				I. Horikawa and J. C. Barrett Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms Carcinogenesis, July 1, 2003; 24(7): 1167 - 1176. [Abstract] [Full Text] [PDF]

				M. C. Hu, T. D. Piscione, and N. D. Rosenblum Elevated SMAD1/{beta}-catenin molecular complexes and renal medullary cystic dysplasia in ALK3 transgenic mice Development, June 15, 2003; 130(12): 2753 - 2766. [Abstract] [Full Text] [PDF]

				B. H. Nelson, T. P. Martyak, L. J. Thompson, J. J. Moon, and T. Wang Uncoupling of Promitogenic and Antiapoptotic Functions of IL-2 by Smad-Dependent TGF-{beta} Signaling J. Immunol., June 1, 2003; 170(11): 5563 - 5570. [Abstract] [Full Text] [PDF]

				P. Sharma, N. Fatma, E. Kubo, T. Shinohara, L. T. Chylack Jr., and D. P. Singh Lens Epithelium-derived Growth Factor Relieves Transforming Growth Factor-{beta}1-induced Transcription Repression of Heat Shock Proteins in Human Lens Epithelial Cells J. Biol. Chem., May 23, 2003; 278(22): 20037 - 20046. [Abstract] [Full Text] [PDF]

				H. Ungefroren, W. Lenschow, W.-B. Chen, F. Faendrich, and H. Kalthoff Regulation of Biglycan Gene Expression by Transforming Growth Factor-beta Requires MKK6-p38 Mitogen-activated Protein Kinase Signaling Downstream of Smad Signaling J. Biol. Chem., March 21, 2003; 278(13): 11041 - 11049. [Abstract] [Full Text] [PDF]

				R. L. Baldwin, H. Tran, and B. Y. Karlan Loss of c-myc Repression Coincides with Ovarian Cancer Resistance to Transforming Growth Factor {beta} Growth Arrest Independent of Transforming Growth Factor {beta}/Smad Signaling Cancer Res., March 15, 2003; 63(6): 1413 - 1419. [Abstract] [Full Text] [PDF]

				W. C. Reinhold, H. Kouros-Mehr, K. W. Kohn, A. K. Maunakea, S. Lababidi, A. Roschke, K. Stover, J. Alexander, P. Pantazis, L. Miller, et al. Apoptotic Susceptibility of Cancer Cells Selected for Camptothecin Resistance: Gene Expression Profiling, Functional Analysis, and Molecular Interaction Mapping Cancer Res., March 1, 2003; 63(5): 1000 - 1011. [Abstract] [Full Text] [PDF]

				T. Sasaki, H. Suzuki, K. Yagi, M. Furuhashi, R. Yao, S. Susa, T. Noda, Y. Arai, K. Miyazono, and M. Kato Lymphoid Enhancer Factor 1 Makes Cells Resistant to Transforming Growth Factor {beta}-induced Repression of c-myc Cancer Res., February 15, 2003; 63(4): 801 - 806. [Abstract] [Full Text] [PDF]

				M. Paez-Pereda, D. Giacomini, D. Refojo, A. C. Nagashima, U. Hopfner, Y. Grubler, A. Chervin, V. Goldberg, R. Goya, S. T. Hentges, et al. Involvement of bone morphogenetic protein 4 (BMP-4) in pituitary prolactinoma pathogenesis through a Smad/estrogen receptor crosstalk PNAS, February 4, 2003; 100(3): 1034 - 1039. [Abstract] [Full Text] [PDF]

				V. Strieder and W. Lutz E2F Proteins Regulate MYCN Expression in Neuroblastomas J. Biol. Chem., January 24, 2003; 278(5): 2983 - 2989. [Abstract] [Full Text] [PDF]

				B. K. Law, A. Chytil, N. Dumont, E. G. Hamilton, M. E. Waltner-Law, M. E. Aakre, C. Covington, and H. L. Moses Rapamycin Potentiates Transforming Growth Factor {beta}-Induced Growth Arrest in Nontransformed, Oncogene-Transformed, and Human Cancer Cells Mol. Cell. Biol., December 1, 2002; 22(23): 8184 - 8198. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 277/1/854    most recent M104170200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yagi, K. Articles by Kato, M. Search for Related Content PubMed PubMed Citation Articles by Yagi, K. Articles by Kato, M. Social Bookmarking                      What's this?