 |
INTRODUCTION |
Neuronal nicotinic acetylcholine receptors
(nnAChRs)1 are ligand-gated
cation channels activated by endogenous neurotransmitter acetylcholine
(ACh) and exogenous drugs, such as nicotine (1, 2). nnAChRs consist of
five subunits (3), and expressed subunits of nnAChRs are numerous,
which gives rise to the potential for enormous functional diversity of
nnAChRs (2). nnAChRs in the central nervous system are a target of
nicotine and mediate fast depolarization of neuronal membrane (4) to
increase the permeability to Ca2+ above that of
their counterparts at the neuromuscular junction (5). This high
permeability of neuronal membrane to Ca2+ produces, in
turn, many effects of nicotine in the central nervous system including
memory facilitation, increase in spontaneous activity, convulsions,
suppression of irritability and appetite, and stimulation of
local glucose utilization (6, 7). In addition, nnAChRs participate in
alterations of central nervous functions through facilitating the
release of several neurotransmitters, such as ACh, dopamine,
-aminobutyric acid, glutamate, and serotonin, by its activation, and
this potential of nnAChRs to stimulate neurotransmitter release is
suppressed by various inhibitors for voltage-dependent
calcium channels (VDCCs), suggesting that VDCCs play a critical role in
neurotransmitter release evoked by nnAChR activation and that the
opening of VDCCs via neuronal membrane depolarization is important for
alterations in neuronal functions induced by nnAChRs (8). The latter
suggestion is also, in part, supported by evidence that the
expression of an endogenous neuroactive peptide, diazepam binding
inhibitor (DBI), possessing the activity to cause anxiety (9), is
enhanced by chronic stimulation of nnAChRs with low doses of nicotine
in mouse cerebral cortex and primary cultures of mouse cerebral
cortical neurons, and this stimulatory effect is mediated through
L-type VDCCs (10).
The effects of both acute and chronic nicotine application on the
activity of different nnAChR subtypes may be relevant to tolerance,
dependence, and withdrawal syndrome associated with nicotine
addiction (11, 12). Chronic exposure to low doses of nicotine induces
the up-regulation of high affinity 
4/
2
subunit of nnAChRs possessing [3H]nicotine binding sites
in the neurons (13-15), although chronic nicotine exposure also leads
to association with long lasting down-regulation in responsiveness to
nicotine (16-18). This up-regulation of nnAChRs is supposed to be a
compensatory reaction against agonist-induced desensitization (16, 19).
From these data, it is reasonable to suppose that decreased function of
nnAChRs after chronic exposure to low doses of nicotine is
predominantly due to functional alterations of the
4/2 subunit of nnAChRs.
In our previous reports, we have demonstrated that chronic exposure of
cultured neurons to nicotine is reported to induce increase of
45Ca2+ influx when examining by the application
of 30 mM KCl (10), which leads to an assumption that
functional changes of nnAChRs after continuous activation may be
accompanied with those of VDCCs functionally coupled to nnAChRs.
However, pharmacological characteristics of such functional alterations
in VDCCs have not been fully investigated, and few available
investigations were reported. In the present study, we attempted to
investigate this possibility by examining VDCC functions using mouse
cerebral cortical neurons in primary culture after long term treatment
with low doses of nicotine.
| |
EXPERIMENTAL PROCEDURES |
Isolation and Primary Culture of Mouse Cerebral Cortical
Neurons--
Isolation and primary culture of cerebral cortical
neurons were carried out according to the method described previously
(20). In brief, the neopallium free of the meninges was removed from the 15-day-old fetus of a ddY strain mouse under anesthesia with diethyl ether, minced with scissors, dispersed by trypsin, and centrifuged. Thereafter, the isolated cells were inoculated on a
poly-L-lysine-treated culture dish with Dulbecco's
modified Eagle's medium supplemented with 15% fetal calf serum and
cultured at 37 °C in humidified 95% air, 5% CO2 for 3 days. After the treatment of the cells with 10 µM
cytosine arabinoside in Dulbecco's modified Eagle's medium containing
10% horse serum for 24 h to suppress the proliferation of
nonneuronal cells, the culture medium was exchanged to Dulbecco's
modified Eagle's medium with 10% horse serum, and the incubation was
continued under the same conditions described above. The culture medium
was exchanged to fresh Dulbecco's modified Eagle's medium with 10%
horse serum every 4 days. More than 95% of the primary cultured cells
used here have been confirmed to be neurons by an immunohistochemical
approach (20).
Long Term Treatment of Nicotine--
For studying the effects of
long term exposure to nicotine on VDCC functions, nicotine was diluted
with Hanks' solution and was directly added into the culture medium.
To avoid the degradation of nicotine because of its high light
sensitivity, the handling, such as the addition of nicotine into the
medium and culture of cells with culture medium containing nicotine,
was carried out under dark conditions. In addition,
nicotine-containing culture medium was exchanged every day during
nicotine exposure. Cells cultivated in the absence of nicotine
were used as control. Mecamylamine (1 µM) was added into
the culture medium 5 min before the addition of nicotine.
Under the experimental conditions used here, the exposure of nicotine
(0.1 µM) to the neurons for 72 h showed no increase of lactic dehydrogenase leakage from the neurons and of the number of
cells staining with trypan blue dye (data not shown), indicating that
the exposure of nicotine with the concentration used in the present
study was not neurotoxic.
To prepare nicotine-dependent mice, male ddY strain mice
weighing 30 g purchased from Japan SLC (Hamamatsu, Japan) were
used after feeding them laboratory chow (Oriental Yeast, Chiba,
Japan) and tap water ad libitum for 1 week. Mice were
subcutaneously injected nicotine (three times a day; each dose was 1 mg/kg) for 7 days. Four hours after the last dose of nicotine, mice
were killed by decapitation, and the cerebral cortices were dissected to prepare the particulate fractions used for
[3H]nicotine and [3H]verapamil bindings
described below (21). Mice after continuous treatments with nicotine
showed weight loss, increased defecation, and increased locomotor
activity, indicating that mice are clearly dependent on nicotine.
Measurement of 45Ca2+
Influx--
45Ca2+ influx into the neurons was
measured according to the previously reported method (22). In short,
the neurons were incubated in Ca2+-free and 20 mM Hepes-containing Krebs-Ringer bicarbonate buffer (KRB-Hepes; 137 mM NaCl, 4.8 mM KCl, 1.2 mM KH2PO4, 1.2 mM
MgSO4·6H2O, 25 mM
NaHCO3, and 10 mM glucose, pH 7.4) at 37 °C
for 10 min, and the incubation buffer was discarded to change to fresh
and warm (37 °C) Ca2+-free KRB-Hepes. The reaction was
initiated by the addition of 2.7 mM
CaCl2·H2O (1.0 µCi of
[45Ca2+]Cl2/dish). After the
incubation of the neurons at 37 °C for 2 min, the radiolabeled
Ca2+-containing incubation buffer was discarded followed by
five washes with ice-cold KRB-Hepes containing 2.7 mM CaCl2·H2O (total volume 7.5 ml), and the neurons were scraped off from a culture dish with 0.5 M NaOH. An aliquot of the alkaline-digested neurons was neutralized with equimolar acetic acid and then used to measure radioactivity accumulated in the neurons by liquid scintillation spectrometry.
KCl (30 mM) and nicotine were simultaneously added into the
incubation buffer with
[45Ca2+]Cl2. The addition of Bay
k 8644 was also simultaneously added with
[45Ca2+]Cl2 into the incubation
buffer. To examine the effects of inhibitors for VDCCs on the 30 mM KCl- and nicotine-induced alterations in [45Ca2+]influx, these agents were added into
the incubation buffer 15 s before the addition of 30 mM KCl, nicotine, and Bay k 8644.
Measurement of [3H]Nicotine and
[3H]Verapamil Binding--
The receptor binding assay
was carried out using the particulate fractions from the mouse cerebral
cortical neurons. For the preparation of the particulate fractions, the
neurons were washed three times with ice-cold phosphate-buffered saline
(137 mM NaCl, 2.7 mM KCl, 10 mM
Na2HPO4, and 1.8 mM
KH2PO4, pH 7.4), scraped off from the dishes
with ice-cold 50 mM Tris-HCl buffer (pH 7.4) and
homogenized with a Polytron homogenizer and centrifuged (48,000 × g, 4 °C, 20 min). The washing procedure was carried out
four times before stocking at 
80 °C for at least 24 h. Before
the binding experiment, the frozen pellet was thawed, suspended with the same buffer, and washed three times as described above.
Procedures similar to preparing the particulate fractions from the
neurons were employed to prepare those of the cerebral cortex from the
nicotine-dependent mice. The techniques for measuring bindings of [3H]nicotine and [3H]verapamil
to the particulate fractions obtained from the cerebral cortex were
similar to those for the particulate fractions of the neurons described below.
The [3H]nicotine binding assay was carried out according
to the method of Zhang and Nordberg (23) with a minor modification. Briefly, the particulate fractions were incubated with 50 mM Tris-HCl buffer (pH 8.0) containing 5 nM
[3H]nicotine in a final volume of 1 ml at 2 °C for 60 min. The reaction was terminated by adding 2 ml of the ice-cold buffer,
and the reaction mixture was filtered through Whatman GF/C glass
filters presoaked with 0.3% polyethyleneimine solution for 5 h.
The filters were washed three times with the ice-cold buffer and then
subjected to measure radioactivity retained on the filters by liquid
scintillation spectrometry. Nonspecific binding was determined in the
presence of 1 µM cystine. For Scatchard analysis,
the particulate fractions were incubated with various concentrations of
[3H]nicotine (0.2-20 nM) under the same
conditions described above.
The [3H]verapamil binding assay was carried out according
to the method previously reported (24) with minor modifications. Briefly, the particulate fractions were incubated in 50 mM
Tris-HCl buffer (pH 7.4) containing 0.2 nM
[3H]verapamil in a final volume of 1 ml at 2 °C for 60 min. The reaction was terminated by adding 2 ml of the ice-cold buffer into the assay system, and the reaction mixture was then filtered through Whatman GF/B glass filters presoaked with 0.3%
polyethyleneimine solution for 5 h. The filters were washed three
times with the ice-cold buffer and then subjected to measurement
of radioactivity retained on the filters by liquid scintillation
spectrometry. Nonspecific binding was determined in the presence of 10 µM nonlabeled verapamil. For Scatchard analysis, the
particulate fractions were incubated with various concentrations of
[3H]verapamil (0.01-8 nM) under the same
conditions described above.
Protein Electrophoresis and Immunoblots for nnAChRs and
VDCCs--
The extraction of protein from the neurons was carried out
as follows. The neurons attached to a culture dish were washed five
times with ice-cold 0.15 M NaCl and fixed with 0.15 M NaCl containing 6% trichloroacetic acid at 4 °C. The
neurons were scraped off from the dishes and centrifuged (10,000 × g, 5 min, 4 °C). After washing the pellet with
ice-cold 50 mM Tris-HCl buffer (pH 7.5), the sample buffer
(100 mM Tris-HCl (pH 6.8) containing 4% sodium lauryl
sulfate, 12% -mercaptoethanol, and 20% glycerol) was added to the
pellet in a final volume of 0.2 ml and well mixed. The suspension thus
obtained was sonicated (1 min), boiled (3 min), and centrifuged
(10,000 × g, 60 min, 4 °C), and the supernatant was
stored at 80 °C until use.
After SDS-PAGE using 5/20% gradient gel (10 × 10 cm in size,
0.5-mm thickness) was performed (20 mA for 90 min), the separated proteins in the gel were transferred onto a nitrocellulose filter using
a semidry type transblotter (160 mA for 60 min) (25). The
nitrocellulose filters were washed with phosphate-buffered saline and
blocked with Tris-buffered saline (20 mM Tris-HCl (pH 7.4)
containing 0.15 M NaCl) containing 1% bovine serum albumin at room temperature for 60 min. For immunoblotting, the nitrocellulose filters were incubated at 4 °C for overnight with the antibodies against the nnAChR 4, 3, and
2 subunits, each 1 subunit of L-, N-, and
P/Q-types of VDCCs, and the 2/
1 subunit
of L-type VDCCs (diluted 1:200 to 1:1000 in Tris-buffered saline
containing 0.1% normal serum). After washing four times with
Tris-buffered saline containing 0.05% Tween 20, the antigenic protein
bands were stained using anti-rabbit IgG antibody conjugated with
alkaline phosphatase (diluted 1:2000 for nnAChRs) and anti goat-IgG
antibody conjugated with alkaline phosphatase (diluted 1:2500 for
VDCCs). For protein staining, the blots were rinsed with prestained
buffer (ethanol/acetic acid/H2O, 4:1:5) and stained with
Coomassie Brilliant Blue.
The relative intensity of immunoreactive bands for each subunit for
nnAChRs and VDCCs was calculated using ImageMaster 1D Elite software
(Amersham Biosciences), and the data were estimated as percentages of
each control (without treatment of nicotine).
Amplification of cDNA for 1F and
4 Subunits--
cDNA for 1F and
4 subunits of L-type VDCCs was amplified from mouse
brain cDNA by polymerase chain reaction using a set of
oligonucleotides (1F, TTCGACTCTTGTTGGGTCTTG and
TCAAAGCGGGAAAGAATAGA; 4, CTATAAACTCTCATCATTTCAC and
TCATAACGGGTTGCACATAC) specific for the cDNA sequence of
mouse 1F and 4 subunits of L-type VDCC (26, 27). After the amplification, the cDNA was ligated with EcoRI adapter and inserted into the EcoRI site of pUC18.
Purification of mRNA and RNA Blot Hybridization--
After
washing the neurons with ice-cold phosphate-buffered saline (pH 7.4),
the neurons were scraped off from a culture dish. Poly(A)+
RNAs were isolated from these cells using FASTTrackTM (10). The lysates
obtained from the neurons were applied to oligo(dT)-cellulose affinity
chromatography to purify poly(A)+ RNA.
RNA blot hybridization was performed as previously described (10).
Denatured poly(A)+ RNA (1 µg) was electrophoresed on
1.1% agarose gel containing formaldehyde. Gels were stained with
ethidium bromide and photographed under UV illumination to assess the
integrity of the RNA by visual inspection. RNA was transferred to a
nitrocellulose membrane (NitroPure; Osminics Inc., Westborough, MA)
using 20× standard saline citrate (SSC) buffer by the capillary
blotting method, and the completeness of transfer was confirmed by
examining gels for ethidium fluorescence. The cDNA fragment from mouse
brain was labeled by the Klenow fragment with random primer and
[-32P]dCTP. Antisense oligomer
(AGGTCTCAAACATGATCTGGGTCA) for -actin (28) prepared by an Applied
Biosystems DNA synthesizer was end-labeled by terminal deoxynucleotidyl
transferase with [-32P]dCTP. These denatured DNA were
used as probes in the hybridization. The baked filter was hybridized
with 50 mM sodium phosphate buffer (pH 7.0), 5× SSC, 50 mg/ml salmon sperm DNA, 1× Denhardt's solution, 30% formamide, 10%
dextran sulfate, and 32P-labeled probe at 42 °C for
24 h. The filters were washed with 0.2× SSC and 0.1% sodium
lauryl sulfate at 50 °C and autoradiographed. The radioactive
intensities of the bands were represented as arbitrary units determined
by a Fujix BAS 2000 System (Fuji-Film Co., Ltd., Tokyo, Japan).
The contents of poly(A)+ RNAs isolated from the mouse
cerebral cortical neurons after the treatments with nicotine were
similar to those from the neurons not treated with nicotine (data not shown).
In the present study, the levels of mRNA for subunits of L-type
VDCCs were corrected according to the message of -actin signal, and
the levels of -actin mRNA in the nicotine-treated neurons were
the same as those in the nontreated neurons with the drugs.
Electrophysiological Experiments--
The whole-cell
configuration of the patch clamp technique was used to perform
electrophysiological experiments according to the method (29)
previously reported with a minor modification. Patch pipettes were made
from a barosilicate glass tube (1.5-mm outer diameter,
0.86-mm inner diameter; A-M System Inc., Pangbourne, UK)
in a micropipette puller (model 87; Sutter Instruments). Pipette resistances ranged from 5 to 8 megaohms when filled with a
solution (pH 7.4; 117 mM tetraethylammonium
chloride, 9 mM Hepes, 9 mM EGTA, 4.5 mM MgCl2, 1 mM GTP, 4 mM ATP, and 14 mM phosphocreatine; osmolarity
330 mosmol/liter). Whole-cell currents were amplified with a patch
clamp amplifier system (EPC-8; HEKA Elektronik), filtered at 3 kHz, and
digitized at 10 kHz with a Digidata 1200A acquisition board (Axon
Instruments, Foster City, CA) for subsequent storage on a personal
computer. The data acquisition and analysis were carried out with the
pClamp 8.0 software package (Axon Instruments, Foster City, CA). The
external solution consisted of 25 mM BaCl2, 145 mM tetraethylammonium chloride, 10 mM
Hepes, 0.1 mM EGTA, and 10 mM
D-glucose (pH 7.4; osmolarity 340 mosmol/liter adjusted with sucrose). Leakage currents were subtracted using the P/4 protocol,
and the series resistance was compensated by 50-60%.
Measurement of Protein Content--
The protein content in the
neurons was determined by the method of Lowry et al. (30)
with bovine serum albumin as a standard.
Statistical Analysis--
Each value of the data was expressed
as the mean ± S.E. The statistical significance was assessed by
the methods as described in each legend of figures following the
application of the one-way analysis of variance.
Chemicals--
PerkinElmer Life Sciences was a source of
45CaCl2 (specific activity 0.3511 GBq/mg),
[3H]nicotine (specific activity 3.02 TBq/mmol), and
[3H]verapamil (specific activity 2.81 TBq/mmol).
Antibodies against 3, 4, and
2 subunits of nnAChRs and anti-goat IgG were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and antibodies against VDCCs were products of Almone Labs Ltd. (Jerusalem, Israel). Anti-rabbit IgG as a part of picoBlueTM immunoscreening kit was obtained from Stratagene. Nifedipine was obtained from Wako Pure Chemical Industries (Osaka, Japan). 
-Conotoxin GIVA (-CTX) and -agatoxin VIA (-ATX) were purchased from the Peptide Institute, Inc. (Osaka, Japan). Gradient gels (5/20%) were products of Atto Co.
Ltd. (Tokyo, Japan). Other reagents used were commercially available
and of analytical grade.
| |
RESULTS |
Effect of Long Term Exposure to Nicotine on 30 mM
KCl-induced 45Ca2+ Influx into the
Neurons--
The effects of the duration of nicotine (0.1 µM) exposure on 30 mM KCl-evoked
45Ca2+ influx were examined. The increase in 30 mM KCl-induced 45Ca2+ influx was
found to be dependent on the duration of exposure to 0.1 µM nicotine (Fig.
1A). The influx attained its
plateau 24 h after the exposure, and a similar extent of influx
was thereafter maintained up to 72 h (Fig. 1A). On the
other hand, the basal 45Ca2+ influx was not
altered during continuous exposure to nicotine (Fig.
1A).
View larger version (29K):
[in this window]
[in a new window]
|
Fig. 1.
Effects of 30 mM KCl on
45Ca2+ influx into cerebral cortical neurons in
primary culture following exposure to nicotine. The neurons were
cultured with 0.1 µM nicotine at 37 °C for 72 h.
After incubation of the neurons in Ca2+-free incubation
buffer for 10 min, the buffer was exchanged to fresh
Ca2+-free incubation buffer, and KCl and
[45Ca2+]Cl2 (1.0 µCi of
[45Ca2+]Cl2/dish) were
simultaneously added into the incubation buffer. The neurons were
thereafter incubated at 37 °C for 2 min, and the reaction was
terminated by aspiration of the incubation buffer followed by five
washes of the neurons with ice-cold incubation buffer containing 2.7 mM CaCl2. The neurons were digested with 0.5 M NaOH, and an aliquot of the alkaline-digested neurons was
subjected to measure radioactivity following neutralization with
equimolar acetic acid. Each value represents the mean ± S.E.
obtained from four separate experiments run in triplicate.
A, time course of changes in 30 mM
KCl-stimulated 45Ca2+ influx. The neurons were
cultured with 0.1 µM nicotine at 37 °C for the period
indicated. *, p < 0.05; **, p < 0.01, compared with the control value (without treatment of nicotine;
Dunnett's test). B, changes in 30 mM
KCl-stimulated 45Ca2+ influx following exposure
to various concentrations of nicotine. The neurons were cultured with
nicotine at 37 °C for 72 h. **, p < 0.01, compared with the control value
(without treatment of nicotine, Dunnett's test). C, effect
of mecamylamine on 30 mM KCl-stimulated
45Ca2+ influx. The neurons were cultured with
nicotine and mecamylamine at 37 °C for 72 h. **,
p < 0.01, Bonferroni's test.
|
|
In addition, we examined effects of 72-h exposure to various
concentrations of nicotine on 30 mM KCl-evoked
45Ca2+ influx. As shown in Fig. 1B,
the increase of the 30 mM KCl-induced 45Ca2+ influx dependent on nicotine
concentration was noticed, and its plateau was observed at nicotine
concentrations of 0.1-1 µM, although a further
remarkable increase of 30 mM KCl-evoked
45Ca2+ influx was detected after 72-h exposure
to 3 µM nicotine. The latter increase was considered to
be due to injury of neuronal membrane function, because leakage lactic
dehydrogenase activity was significantly larger than that of nontreated
neurons. Moreover, the leakage of lactic dehydrogenase activity tends
to increase, but not significantly, after 72-h exposure to 1 µM nicotine (data not shown). Taking these data together,
we employed 0.1 µM nicotine for long term exposure of
neurons in the following experiments.
Whether the significant increase of the 30mM KCl-induced
45Ca2+ influx into the neurons after exposure
to 0.1 µM nicotine for 72 h was attributable to
continuous nnAChR activation by nicotine was examined by measuring 30 mM KCl-stimulated 45Ca2+ influx
after concomitant exposure of the neurons to nicotine and mecamylamine,
an antagonist specific for nnAChRs. As shown in Fig. 1C,
this manipulation completely abolished the increase of the KCl-induced
45Ca2+ influx. These results indicate that the
increased influx by 30 mM KCl after 72-h exposure to 0.1 µM nicotine is mediated through nnAChR activation. Such
data also suggest that the increased extent of 30 mM
KCl-induced 45Ca2+ influx found after 72-h
exposure to 0.1 µM nicotine may be due to functional
up-regulation of VDCCs, because 30 mM KCl is known to
produce neuronal membrane depolarization, and the
45Ca2+ influx observed in the presence of 30 mM KCl occurs through opening VDCCs in the neurons used
here as reported previously (22).
Effects of VDCC Inhibitors on 30 mM KCl-induced
45Ca2+ Influx after 72-h Exposure to 0.1 µM Nicotine--
In a previous experiment, the neurons
used in the present study have been determined to possess at least four
types of VDCCs (22). Therefore, which type of VDCC was involved in the
enhanced increase of 30 mM KCl-induced
45Ca2+ influx after the long term (72-h)
exposure to 0.1 µM nicotine was examined. The
concentration of each VDCC inhibitor used in this experiment was
confirmed to show their maximal inhibitory effects on the 30 mM KCl-induced 45Ca2+ influx into
the neurons, and there was a significant difference in the degree of
inhibitory actions of -ATX on the KCl-induced 45Ca2+ influx at concentrations between 0.1 and
1 µM (22), since previous reports have revealed that
-ATX at concentrations lower than 200 nM suppresses only
P-type VDCCs and at higher concentrations inhibits both P- and Q-type
VDCCs (31-34). Therefore, we conclude that both P- and Q-type VDCCs
are present in the neurons.
Thirty millimolar KCl-increased 45Ca2+ influx
was significantly suppressed by nifedipine (1 µM),
-CTX (1 µM), and -ATX (1 µM), inhibitors for L-, N-, and P/Q-type VDCCs, respectively (Fig. 2), which is in good agreement with the
data previously reported by our laboratory (22). The inhibitory ratio
by nifedipine, -CTX, and -ATX was about 40, 25, and 35%,
respectively (Fig. 2). In the neurons exposed to 0.1 µM
nicotine for 72 h, these VDCC inhibitors significantly reduced the
KCl-induced 45Ca2+ influx as in the case of
nontreated neurons (Fig. 2). It was noted that the extent of inhibition
of the KCl-induced 45Ca2+ influx by -CTX in
nicotine-exposed neurons (1717 ± 108 dpm/mg of protein/2 min,
n = 4) was as same as that in nontreated neurons (1633 ± 159 dpm/mg of protein/2 min, n = 4).
Similarly, no significant differences in the inhibitory degrees by
-ATX of the KCl-induced 45Ca2+ influx were
noticed between nontreated and nicotine-exposed neurons (nontreated:
1895 ± 118 dpm/mg of protein/2 min, n = 4;
nicotine-exposed: 2019 ± 123 dpm/mg of protein/2 min,
n = 4). On the other hand, nifedipine reduced the
KCl-induced 45Ca2+ influx into the
nicotine-treated neurons to the level of the KCl-induced
45Ca2+ influx into the nontreated neurons
observed in the presence of nifedipine (Fig. 2). These results suggest
that the increase of the KCl-induced 45Ca2+
influx in the neurons exposed to 0.1 µM nicotine for
72 h is mediated via functionally up-regulated L-type VDCCs.
View larger version (43K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of VDCC inhibitors on 30 mM KCl-stimulated 45Ca2+ influx
into cerebral cortical neurons in primary culture following exposure to
nicotine. The neurons were cultured with 0.1 µM
nicotine at 37 °C for 72 h, and the amount of high
KCl-stimulated 45Ca2+ influx was measured as
described in the legend to Fig. 1. Each inhibitor for VDCCs was added
into the incubation buffer 15 s before the simultaneous addition
of 30 mM KCl and
[45Ca2+]Cl2. The addition of each
inhibitor for VDCCs was carried out 15 s before the addition of 30 mM KCl and
[45Ca2+]Cl2. Each value
represents the mean ± S.E. obtained from four separate
experiments run in triplicate. **, p < 0.01, Bonferroni's test. Drug concentrations were as follows: -ATX, 1 µM; -CTX, 1 µM; nifedipine, 1 µM.
|
|
Effect of 72-h Exposure to Nicotine on Bay k 8644-induced
45Ca2+ Influx--
As described above, the
present study demonstrated the possibility that the long term exposure
to low concentration (0.1 µM) of nicotine causes the
enhancement of L-type VDCC function. To confirm this possibility, we
examined effect of the long term (72-h) exposure to nicotine on
45Ca2+ influx stimulated by Bay k 8644, an
activator specific for L-type VDCCs (35). In the neurons
without nicotine treatment, Bay k 8644 dose-dependently
increased the entry of 45Ca2+ into the neurons,
and the maximal stimulatory effect was obtained at 1-10
µM. The maximal extent of 45Ca2+
influx evoked by Bay k 8644 was about 40% of the 30 mM
KCl-induced 45Ca2+ influx (Fig.
3), which is in agreement with the extent
of reduction of the 30 mM KCl-induced
45Ca2+ influx by nifedipine (Fig. 2).
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of nifedipine on Bay k 8644-stimulated
45Ca2+ influx into cerebral cortical neurons in
primary culture following exposure to nicotine. The neurons were
cultured with 0.1 µM nicotine at 37 °C for 72 h.
The neurons were incubated in Ca2+-free incubation buffer
at 37 °C for 10 min, and the incubation buffer was changed to fresh
Ca2+-free incubation buffer. Thereafter, Bay k 8644 and
[45Ca2+]Cl2 (1.0 µCi of
[45Ca2+]Cl2/dish) were
simultaneously added into the incubation buffer, and the neurons were
incubated at 37 °C for 2 min. The reaction was terminated by
aspiration of the incubation buffer followed by five washes of the
neurons with ice-cold incubation buffer containing 2.7 mM
CaCl2, and the 45Ca2+ influx was
measured as described in the legend to Fig. 1. Nifedipine was added
into the incubation buffer 15 s before the addition of Bay k 8644 and [45Ca2+]Cl2. Each value
represents the mean ± S.E. obtained from four separate
experiments run in triplicate. #, p < 0.05; ##,
p < 0.01, compared with each control value
(Bonferroni's test, n = 4). **, p < 0.01, Bonferroni's test.
|
|
In the case of the neurons exposed to 0.1 µM nicotine for
72 h, the 45Ca2+ influx induced by 10 µM Bay k 8644 was significantly larger than that into the
nontreated neurons, and this increased influx of 45Ca2+ was inhibited by nifedipine in a
dose-dependent manner (Fig. 3), indicating that the
continuous exposure to nicotine certainly enhances
45Ca2+ influx via L-type VDCCs.
Changes of L-type VDCCs after Long Term Exposure to
Nicotine--
To investigate mechanisms for the changes of L-type VDCC
function accompanying with continuous activation of nnAChRs by
nicotine, the Scatchard analysis on [3H]verapamil binding
to the particulate fractions prepared from the neurons exposed to
nicotine was carried out. The binding of [3H]verapamil is
saturable, and only high affinity binding sites were recognized in the
preparations obtained from both nicotine-treated and nontreated neurons
(data not shown). In addition, the long term exposure to 0.1 µM nicotine significantly increased the
Bmax value with no changes in the
Kd value (Table
I). This increase of
[3H]verapamil binding sites was not observed when
incubating the neurons with both nicotine and mecamylamine (Table
I).
View this table:
[in this window]
[in a new window]
|
Table I
Changes in Bmax and Kd values of [3H]nicotine
and [3H]verapamil binding to particulate fractions from
cerebral cortical neurons in primary culture following exposure to
nicotine
The neurons were cultured with 0.1 µM nicotine at
37 °C for 72 h. Mecamylamine (1 µM) was added
into the culture medium 5 min before the addition of nicotine. The
particulate fractions were incubated with 50 mM Tris-HCl
buffer (pH 8.0) containing 5 nM [3H]nicotine in a
final volume of 1 ml at 2 °C for 60 min. Nonspecific binding was
determined in the presence of 1 µM cystine. Measurement
of [3H]verapamil binding was carried out as described below.
The particulate fractions were incubated in 50 mM Tris-HCl
buffer (pH 7.4) containing 0.2 nM [3H]verapamil
in a final volume of 1 ml at 2 °C for 60 min. Nonspecific binding
was determined in the presence of 10 µM nonlabeled
verapamil. Each value represents the mean ± S.E. obtained from
four separate experiments run in triplicate. **,
p < 0.01, compared with the control value (without
nicotine treatment, Bonferroni's test).
|
|
The immunoblotting analysis was carried out to confirm the
up-regulation of L-type VDCCs in association with continuous activation of nnAChRs with nicotine. The immunoreactivity against the
1C subunit of L-type VDCCs in membrane proteins obtained
from the nicotine-exposed neurons was found at the band with a
molecular mass of 240 kDa, and this reactivity was significantly higher than that from the nontreated neurons, whereas no significant alterations in expressions of immunoreactivities against
1A and 1B subunits of P/Q- and N-type
VDCCs, respectively (Fig. 4A). Similarly, significant increase in expressions of 1D and
2/1 subunits of L-type VDCCs was observed
in the neurons exposed to nicotine for 72 h (Fig. 4B).
In addition, we also checked expressions of mRNAs for
1F and 4 subunits of L-type VDCCs. As
shown in Fig. 4C, a Northern blot analysis revealed
increased expression of 1F subunit mRNA, whereas
expression of mRNA for the 4 subunit of L-type VDCCs
did not show any changes after the exposure of the neurons to nicotine
for 72 h. These data certainly establish that the up-regulation of
L-type VDCCs following the long term exposure of the neurons to a low
concentration of nicotine occurs.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of nicotine exposure on expression of
VDCC subunits in cerebral cortical neurons. A and
B, expression of proteins of VDCC subunits after nicotine
exposure for 3 days. The neurons were cultured with 0.1 µM nicotine at 37 °C for 72 h, and the expressed
proteins were measured as described below. After the neurons were
fixed with 6% trichloroacetic acid in 0.15 M NaCl,
they were centrifuged. The resultant pellet was mixed with the buffer
described in the text, sonicated, boiled, and centrifuged. An aliquot of the resultant
supernatant was used for SDS-PAGE electrophoresis using a 5/20%
gradient gel. The separated proteins were transferred onto a
nitrocellulose filter. Thereafter, the nitrocellulose filter was
incubated at 4 °C overnight with antibodies against each subunit of
VDCCs as indicated in the figure. The separated antigenic
proteins were stained with anti-gout IgG antibody conjugated with
alkaline phosphatase. Representative immunoblotting analysis was
indicated in each image. Each value represents the mean ± S.E. obtained from four separate experiments run in triplicate. **,
p < 0.01, compared with each control value (without
treatment of nicotine, Bonferroni's test). Cont, control
(nontreated neurons); Nic, nicotine-treated neurons.
L, N, and P/Q represent L-,
N-, and P/Q-type VDCCs, respectively. C, expression of
mRNA for subunits (1F and 4 of L-type
VDCCs) after nicotine exposure for 3 days. The neurons were cultured
with 0.1 µM nicotine at 37 °C for 72 h, and
poly(A)+ RNA was isolated. Denatured poly(A)+
RNA was electrophoresed on 1.1% agarose gel. Separated mRNA was
transferred to a nitrocellulose membrane and hybridized with
32P-labeled oligonucleotides for 1F and
4. The radioactive intensities of the band for each
subunit mRNA were represented as arbitrary units determined by the
Fujix BAS 2000 system. Each value represents the mean ± S.E.
obtained from four separate experiments run in triplicate. **,
p < 0.01, compared with each control value (without
treatment of nicotine, Bonferroni's test). Cont, control
(nontreated neurons); Nic, nicotine-treated neurons.
L, L-type VDCCs.
|
|
Effect of Long Term Exposure to Nicotine on Ba2+
Currents--
Ba2+ currents evoked by depolarizing voltage
steps in increments of 5 mV ranging from 80 to +50 mV and maximum
currents were obtained at 0 mV in both nicotine-treated and nontreated
neurons (Fig. 5, A-C). The
peak Ba2+ current amplitudes in membrane potentials between
25 and +35 mV in the nicotine-treated neurons were significantly
greater than those in the nontreated neurons (Fig. 5C). The
maximum current amplitudes at 0 mV were 268.3 ± 27.2 pA
(n = 18) and 124.9 ± 27.2 pA (n = 17) in the nicotine-treated and nontreated neurons, respectively.
There were no significant differences in size (diameter) or capacitance
in the cerebral cortical neurons between the nicotine-treated and
nontreated groups.
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5.
Calcium current-voltage relationship in
cerebral cortical neurons exposed to nicotine. The neurons were
exposed to 0.1 µM nicotine at 37 °C for 72 h.
Superimposed traces of high voltage-gated Ca2+ channel
currents detected in nontreated neurons (control) (A) and
neurons exposed to nicotine (B) are shown. The currents were
elicited by 100-ms voltage steps in the range of 80 to 50 mV from a
holding potential of 90 mV at a 5-s interval. C,
peak calcium current-voltage relationship was obtained by plotting the
peak current amplitudes in the control neurons (open
circle) and nicotine-treated neurons (filled
circle) as a function of the test pulse potential. Each
value shown in C represents the mean ± S.E. obtained
from 17-18 separate cells. *, p < 0.05; **,
p < 0.01, compared with each control value
(Bonferroni's test).
|
|
Effect of Nicardipine on Voltage-dependent
Ba2+ Currents after Long Term Exposure to Nicotine--
To
evoke Ba2+ currents, 100-ms voltage steps to 20 mV from a
holding potential of 90 mV in both nicotine-treated and nontreated neurons. Nicardipine (1 µM), an selective antagonist for
L-type VDCCs, was applied to the bath for 2 min. In the nontreated
neurons, 1 µM nicardipine significantly reduced the peak
amplitude of Ba2+ currents from 98.3 ± 10.9 pA
(n = 24) to 50.7 ± 6.9 pA (n = 24) in the neurons without the exposure to nicotine (p < 0.01, Bonferroni's test) (Fig. 6,
A and B). Moreover, the peak amplitude of
Ba2+ currents in the neurons exposed to nicotine for
72 h was significantly reduced by 1 µM nicardipine
(without nicardipine, 160.3 ± 21.1 pA, n = 18;
with nicardipine, 69.6 ± 8.5 pA, n = 24;
p < 0.01 by Bonferroni's test) (Fig. 6, A
and C). In the presence of nicardipine, Ba2+
currents in the both types of neurons were at similar level (Fig. 6A). These results indicate that increased Ba2+
current found in the neurons after chronic exposure to nicotine is
produced by up-regulated L-type VDCCs.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of nicardipine on high voltage-gated
Ca2+ channel currents. The neurons were exposed to 0.1 µM nicotine at 37 °C for 72 h. A,
superimposed trace of time course of effect of
nicardipine on high voltage-gated Ca2+ channel currents.
Nicardipine (1 µM) was applied for 2 min while currents
were evoked by 100-ms step potentials to 20 mV from a holding
potential of 90 mV at a 10-s interval. Each value represents
the mean ± S.E. obtained from 19-24 separate neurons. During the
experiments, currents were measured for 60 s after the initiation
of the experiments and then measured in the presence of
nicardipine (1 µM). Thereafter, currents were
recorded in the absence of nicardipine. B and C,
effects of nicardipine (1 µM) on high voltage-gated
Ca2+ channel currents in nontreated (control)
(B) and nicotine-treated (C) neurons. In
B and C, control and
washout represent the phases before the application of
nicardipine and after nicardipine was washed out from the incubation
buffer, respectively.
|
|
Changes of Pharmacological Characteristics of nnAChRs after Long
Term Exposure to Nicotine--
Previous studies have revealed that
continuous activation of nnAChR with nicotine produces an increase in
nnAChR number with desensitization (19, 36-39). Therefore, whether
such modification of pharmacological characteristics occurs in the
neurons exposed to 0.1 µM nicotine for 72 h was
investigated by measuring [3H]nicotine to the particulate
fractions prepared from the neurons exposed to nicotine. The Scatchard
analysis revealed that the long term exposure to nicotine caused the
increased Bmax value with no changes of
Kd value (Table I).
The expressions of 3, 4, and
2 subunits of nnAChRs were also examined in the
nicotine-exposed neurons using Western blot analysis. As shown in Fig.
7, significant increased expression of
4 and 2 subunits was observed, whereas
the expression of 3 subunit did not show any changes.
Based on the data obtained by the Scatchard and the Western blot
analyses, the up-regulation of nnAChRs consisting of 4
and 2 subunits certainly appeared after the long term
exposure to 0.1 µM nicotine.
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of nicotine exposure on expression of
nnAChR subunits in cerebral cortical neurons. The neurons were
cultured with 0.1 µM nicotine at 37 °C for 72 h,
and the expressed proteins were measured as described below. After the
neurons were washed with 0.15 M NaCl, they were fixed with
6% trichloroacetic acid in 0.15 M NaCl. The neurons were
centrifuged at 10,000 × g at 4 °C for 5 min, and
the pellet was mixed with 100 mM Tris-HCl buffer containing
4% sodium lauryl sulfate, 12% -mercaptoethanol, and 20% glycerol,
sonicated, boiled, and centrifuged (10,000 × g, 60 min, 4 °C).
An aliquot of the resultant supernatant was used for SDS-PAGE
electrophoresis using a 5/20% gradient gel. The separated proteins
were transferred onto a nitrocellulose filter, and the filter was
blocked with 20 mM Tris-HCl buffer containing 0.15 M NaCl and 1% bovine serum albumin at room temperature.
Thereafter, the nitrocellulose filter was incubated at 4 °C
overnight with antibodies against each subunit of nnAChR as indicated
in the figure. The filter was then washed with 20 mM Tris-HCl buffer containing 0.15 M NaCl and
0.05% Tween 20, and the separated antigenic proteins were stained with
anti-rabbit IgG antibody conjugated with alkaline phosphatase.
Representative immunoblotting analysis is indicated in each
image. Each value represents the mean ± S.E. obtained
from four separate experiments run in triplicate. **, p < 0.01, compared with each control value (without treatment of
nicotine, Bonferroni's test). Cont, control (nontreated
neurons); Nic, nicotine-treated neurons.
|
|
As mentioned above, the conditions in which nnAChRs were
continuously activated produce the reduction in nnAChR functions, although the numbers of nnAChRs increased (19, 36-39). Accordingly, in
the following experiments, we checked whether the alterations in the
nicotine-induced 45Ca2+ influx into the neurons
alter the exposure to nicotine for 72 h. In a preliminary
experiment, 1 µM nicotine linearly stimulated 45Ca2+ influx into the nontreated neurons up to
3 min and also nicotine dose-dependently increased
45Ca2+ influx for 2 min. The maximal
stimulation was found at 1-3 µM, which was completely
inhibited by 0.1 µM mecamylamine (data not shown). Based
on these results obtained from the preliminary experiment, we used 1 µM nicotine and 2 min as the concentration of nicotine and the reaction time to measure 45Ca2+ influx
in the presence of nicotine, respectively. Fig.
8 shows that 1 µM nicotine
increases 45Ca2+ influx into the neurons as
well as 30 mM KCl does in the neurons exposed to 0.1 µM nicotine for 72 h (Fig. 2). In addition, the inhibitory pattern of 1 µM nicotine-induced
45Ca2+ influx by various inhibitors for VDCCs
was the same as that of 30 mM KCl-induced
45Ca2+ influx. These data therefore indicate
that the potential of nnAChRs to induce 45Ca2+
influx into the neurons is maintained even after its chronic exposure
of nicotine inducing nnAChR up-regulation.
View larger version (40K):
[in this window]
[in a new window]
|
Fig. 8.
Effects of VDCC inhibitors on 1 µM nicotine-stimulated
45Ca2+ influx into cerebral cortical neurons in
primary culture following exposure to nicotine. The neurons were
cultured with 0.1 µM nicotine at 37 °C for 72 h.
After the incubation of the neurons in Ca2+-free incubation
buffer for 10 min, the buffer was exchanged to fresh
Ca2+-free incubation buffer, and nicotine and
[45Ca2+]Cl2 (1.0 µCi of
[45Ca2+]Cl2/dish) were
simultaneously added into the incubation buffer. The neurons were
thereafter incubated at 37 °C for 2 min. The reaction was terminated
by aspiration of the incubation buffer followed by five washes of the
neurons with ice-cold incubation buffer containing 2.7 mM
CaCl2, and the 45Ca2+ influx was
measured as described in the legend to Fig. 1. The neurons were
digested with 0.5 M NaOH, and an aliquot of the
alkaline-digested neurons was subjected to measure radioactivity
following neutralization with equimolar acetic acid. To examine effects
of inhibitors for VDCCs, each inhibitor was added into the incubation
buffer 15 s before the simultaneous addition of nicotine and
[45Ca2+]Cl2. Each value
represents the mean ± S.E. obtained from four separate
experiments run in triplicate. **, p < 0.01, Bonferroni's test. Drug concentrations were as follows: -ATX, 1 µM; -CTX, 1 µM; nifedipine, 1 µM.
|
|
Changes in [3H]Nicotine and
[3H]Verapamil Binding Prepared from the Cerebral Cortices
of Nicotine-dependent Mice--
In the present study,
whether long term treatment with nicotine produces up-regulation of
L-type VDCCs and nnAChRs has been examined by measuring
[3H]verapamil and [3H]nicotine binding,
respectively, to the particulate fractions derived from
nicotine-dependent mice. Fig.
9 shows an increase of
[3H]verapamil binding to the particulate fractions
prepared from the cerebral cortices of nicotine-dependent
mice. Similarly, [3H]nicotine binding was found to
increase. These results indicated that the up-regulation of
[3H]verapamil binding as well as that of
[3H]nicotine binding occurs in the cerebral cortices of
nicotine-dependent mice.
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 9.
Changes in binding of
[3H]nicotine and [3H]verapamil to the
particulate fractions prepared from the cerebral cortices of the
nicotine-dependent mice. Mice were subcutaneously
injected with nicotine (three times a day; each dose was 1 mg/kg) for 7 days. Four hours after the last dose of nicotine, mice were killed by
decapitation, and the cerebral cortices were dissected to prepare the
particulate fractions used for [3H]nicotine and
[3H]verapamil bindings. A,
[3H]nicotine binding. The particulate fractions were
incubated with 50 mM Tris-HCl buffer (pH 8.0) containing 5 nM [3H]nicotine in a final volume of 1 ml at
2 °C for 60 min. Nonspecific binding was determined in the presence
of 1 µM cystine. Each value represents the
mean ± S.E. obtained from eight mice and expressed as a
percentage of control. **, p < 0.01, compared with the
control value (Bonferroni's test). Control, 4.9 ± 0.3 fmol/mg protein. B, [3H]verapamil binding. The
particulate fractions were incubated in 50 mM Tris-HCl
buffer (pH 7.4) containing 0.2 nM
[3H]verapamil in a final volume of 1 ml at 2 °C for 60 min. Nonspecific binding was determined in the presence of 10 µM nonlabeled verapamil. Each value represents the
mean ± S.E. obtained from eight mice and expressed as a
percentage of control. **, p < 0.01, compared with the
control value (Bonferroni's test). Control, 64.0 ± 2.5 fmol/mg protein.
|
|
| |
DISCUSSION |
In the present study, we have attempted to clarify mechanisms for
behavioral alterations in Ca2+ entry observed after long
term exposure to low concentrations of nicotine using a primary culture
of mouse cerebral cortical neurons possessing nnAChRs and VDCCs (22,
40), because our previous report reveals that long term exposure of the
neurons to nicotine enhances the expression of DBI, an endogenous
anxiogenic peptide with a pharmacological property as an inverse
agonist for benzodiazepine receptors associated with the increase in
Ca2+ influx (10).
As shown in this study, high potassium (30 mM KCl)-evoked
45Ca2+ influx into the neurons was dependent on
the duration of nicotine exposure and the nicotine concentration. This
enhancement of the 30 mM KCl-induced
45Ca2+ influx after long term exposure to
nicotine is considered to be mediated through continuous interaction
between nnAChRs and nicotine, which is supported by the inhibition of
the influx with mecamylamine, an antagonist for nnAChRs. In addition,
continuous exposure of nnAChRs to nicotine for less than 6 h is
demonstrated not to cause an increase in the KCl-induced
45Ca2+ influx as demonstrated in this study.
In neurons located in the central nervous system, at least four types
of VDCCs (i.e. P-, Q-, N-, and L-type) are present (41, 42).
High potassium stimulation is well known to depolarize the neuronal
membrane. Therefore, the increase of 30 mM KCl-induced 45Ca2+ influx in the neurons exposed to
nicotine for the long term may be due to functional acceleration of any
and/or all types of VDCCs. On the other hand, the neurons used here
have all types of VDCCs mentioned above when examining inhibitory
effects of VDCC inhibitors on 45Ca2+ influx in
response to 30 mM KCl stimulation (22). From the results
obtained in the experiments measuring the
45Ca2+ influx in the presence of various
inhibitors for VDCCs, it is indicated that the portion of increased
45Ca2+ influx after the long term exposure to
nicotine is attributed to only the increase in the component
of 45Ca2+ influx inhibited by nifedipine. The
45Ca2+ influx into the neurons induced by an
activator specific for L-type VDCCs, Bay k 8644, was also
significantly facilitated after chronic nicotine exposure. These data
on 45Ca2+ influx suggest that this increased
45Ca2+ influx produced by the long term
exposure to nicotine is consequent to functional enhancement of L-type VDCCs.
The possibility of up-regulation of L-type VDCCs after continuous
nnAChR activation was further explored to examine whether expression of the protein molecule of L-type VDCCs increases by a
binding assay and a Western blotting analysis. The binding sites for
[3H]verapamil in the particulate fractions obtained from
the neurons both treated with and without nicotine consisted of those
with only high affinity. Previous investigations have also reported that only a high affinity site of dihydropyridine binding is present in
the brain (43-45). In addition, the present study demonstrated that
the exposure to nicotine for the long term significantly increased
Bmax value with no alterations in the
Kd value of [3H]verapamil binding.
Furthermore, the Western and Northern blot analyses revealed
significant increase of 1C, 1D,
1F, and 2/1 subunits of
L-type VDCCs without any quantitative alterations in 1A,
1B, and 4 subunits of P/Q-, N-, and
L-type VDCCs, respectively. These results indicate that the enhancement
of 45Ca2+ influx induced after long term
exposure to nicotine is caused by an increased number of
1 and 2/1 subunits of
L-type VDCC molecules.
To further confirm the up-regulated function of L-type VDCCs,
electrophysiological examinations were also carried out. Whole-cell patch cramp analysis showed that the amplitude of Ba2+
currents in the nicotine-exposed neurons was significantly higher than
those in nontreated neurons and that this increase was completely abolished in the presence of nicardipine. In addition, these
Ba2+ currents in the control and nicotine-exposed neurons
are initiated at the membrane potentials at 60 and 50 mV. These
electrophysiological data indicate that the increased amplitude of
Ba2+ currents in the nicotine-exposed neurons is mediated
through an increase in L-type VDCCs. Accordingly, it has been confirmed that the up-regulation of L-type VDCCs is induced by long term exposure
to nicotine.
Nicotine is a drug of abuse, and its chronic administration mainly by
smoking produces physical dependence. In patients suffering from
nicotine dependence, withdrawal of nicotine produces withdrawal syndrome such as anxiety, irritability, disturbance of sleep, tremors, and convulsions. Similarly, other drugs of abuse including ethanol, morphine, and benzodiazepines cause physical dependence, and
most of the withdrawal syndrome resemble those in patients with
nicotine dependence. Although mechanisms for the formation of drug
dependence and emergence of withdrawal syndrome have not adequately been clarified, recent investigations suggest that disturbance of Ca2+ homeostasis in neurons of the central
nervous system, especially abnormal influx of Ca2+ into
neurons, is partially involved in these phenomena observed in patients
with drug dependence (46). In addition, such enhanced increase of
Ca2+ entry is reported to be due to up-regulation of L-type
VDCCs under the conditions of drug dependence by ethanol, morphine, and
benzodiazepine (46-49), although in the case of nicotine little available data on these events has been reported, and the
involvement of P/Q- and N-type VDCCs in these pathophysiological
conditions is controversial (46). As demonstrated in the present
investigation, the up-regulation of L-type VDCCs formed after long term
exposure to nicotine, therefore, may participate in the formation of
nicotine dependence and/or the emergence of withdrawal syndrome
as in the cases of other drugs of abuse.
There are few available data on up-regulation of L-type VDCCs in the
brains of nicotine-dependent animals. As the present report
demonstrates, the up-regulation of L-type VDCCs in the cerebral
cortical neurons exposed to nicotine for the long term, whether or
not similar alterations in the L-type VDCC function occur in
cerebral cortex of nicotine-dependent mice, was examined using the cerebral cortices of nicotine-dependent mice. We
employed here the binding assay methods using
[3H]verapamil and [3H]nicotine to measure
functional alterations in L-type VDCCs and nnAChR, respectively. The
binding assay revealed an increase in both [3H]verapamil
and [3H]nicotine binding, which indicates that functional
increase of L-type VDCCs and nnACh receptors, respectively, is induced
in the cerebral cortex under nicotine-dependent conditions.
The latter is certified by the increase of [3H]nicotine
binding to the particulate fractions derived from the cerebral cortices
of nicotine-dependent mice, because previous investigations
have demonstrated the increased binding of [3H]nicotine
to brain preparations from animals treated with nicotine (38, 39).
Therefore, the up-regulation of L-type VDCCs in the cerebral cortical
neurons induced by long term exposure to nicotine is considered
to occur in the brain of nicotine-dependent animals.
Nicotine is a potent factor to stimulate release of several
neurotransmitters including ACh, dopamine, serotonin, -aminobutyric acid, and glutamate, which are mediated via stimulation of nnAChRs. VDCC inhibitors also inhibit this stimulatory action of nicotine, suggesting that the role of VDCCs in the release process of
neurotransmitter by nicotine is critical (8). Among various types of
VDCCs, recent investigations have indicated that L-type (50,
51) as well as N-type VDCCs (52-54) play a role in neurotransmitter release. In addition, Ca2+ moved from extracellular to
intracellular space through L-type VDCCs modulates protein function and
transcription process through phosphorylation (55-57). Thus,
functional up-regulation of L-type VDCCs accompanying nnAChR
up-regulation induced by long term exposure to nicotine may modify a
variety of biochemical processes in neurons. Indeed, the findings
showing that the long term exposure of the mouse cerebral cortical
neurons to nicotine increases DBI mRNA expression in association
with increases in [3H]nicotine binding and
45Ca2+ influx and that this enhancement of DBI
mRNA expression is completely abolished by L-type VDCC blockade
(10) are assumed to be a case of the phenomenon described above.
The present investigation demonstrates that continuous exposure of the
mouse cerebral cortical neurons to nicotine for 72 h causes an
increase of [3H]nicotine binding to their particulate
fractions, and this increase is attributed to increased
[3H]nicotine binding sites with no changes in the
affinity of nnAChRs to the radiolabeled ligand. Similarly, the
up-regulation of nAChRs is reported to be induced in the central
nervous system of experimental animals chronically treated with
nicotine (38, 39, 58) and neural cells exposed to nicotine (13, 59)
when examined by a receptor binding assay using
[3H]nicotine as a radiolabeled ligand.
nnAChRs exist as a variety of subtypes, which is due to the diversity
of the genes encoding nnAChRs. Among various regions of the central
nervous system, the 3, 4,
2, and 4 subunits of nnAChRs are
unequally distributed in the different layers of the cerebral cortex
(60), and several investigations have reported that the up-regulation
of the receptors is due to the increased numbers of
4/2, 3/4,
and 7 nnAChR subunits in neurons and nonneuronal
expression systems (13, 17, 61). In addition to these data, nnAChRs
composed with 4/2 are adequately
activated by nicotine at concentrations less than 10-100
nM (13) and also have been reported to show up-regulation
after long term nicotine treatment (13-15, 18). Based on these data,
we attempted to examine which of the 3,
4, and 2 subunits showed up-regulation
under the conditions used in the present study. The Western blot
analysis demonstrated the up-regulation of
4/2 nnAChRs after the long term exposure
of the neurons to 0.1 µM nicotine. These data are in good
agreement with the previous reports using human embryonic kidney cells
(14) and Xenopus oocytes (15), although in the latter study
the induction of up-regulation of 3/4
nnAChRs required a 10-fold higher nicotine concentration for
up-regulating 4/2 nnAChRs (15).
Previous reports indicated that one of the functional changes
of up-regulated nAChRs is desensitization, which is confirmed by the
electrophysiological method (15) and neurochemical measurement of
86Rb+ efflux from cultured cells (14, 62). On
the other hand, our data pres
,
,
TOP
ABSTRACT
INTRODUCTION
