Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M110225200 on January 3, 2002

J. Biol. Chem., Vol. 277, Issue 10, 8061-8067, March 8, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/10/8061    most recent
M110225200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fan, W.
Right arrow Articles by Zhan, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fan, W.
Right arrow Articles by Zhan, Q.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

BRCA1 Regulates GADD45 through Its Interactions with the OCT-1 and CAAT Motifs*

Wenhong FanDagger , Shunqian JinDagger , Tong TongDagger , Hongcheng ZhaoDagger , Feiyue FanDagger , Michael J. AntinoreDagger , Baskaran Rajasekaran§, Min Wu, and Qimin ZhanDagger §||

From the Dagger  Department of Radiation Oncology, Cancer Institute, and § Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213 and  National Laboratory of Molecular Oncology, Cancer Institute, Chinese Academy of Medical Sciences, Beijing 100021, China

Received for publication, October 24, 2001, and in revised form, December 18, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

BRCA1, a breast and ovarian cancer susceptibility gene, has been implicated in gene regulation. Previous studies demonstrate that BRCA1 induces GADD45, a p53-regulated and stress-inducible gene that plays an important role in cellular response to DNA damage. However, the mechanism(s) by which BRCA1 regulates GADD45 remains unclear. In this report, we have shown that BRCA1 activation of the GADD45 promoter is mediated through the OCT-1 and CAAT motifs located at the GADD45 promoter region. Site-directed mutations of both OCT-1 and CAAT motifs abrogate induction of the GADD45 promoter by BRCA1. Both OCT-1 and CAAT motifs are able to confer BRCA1 inducibility in a non-related minimal promoter. Physical associations of BRCA1 protein with transcription factors Oct-1 and NF-YA, which directly bind to the OCT-1 and CAAT motifs, are established by biotin-streptavidin pull-down and coimmunoprecipitation assays. Such protein interactions are required for interaction of BRCA1 with the GADD45 promoter because either immunodepletion of Oct-1 and NF-YA proteins or mutations in the OCT-1 and CAAT motifs disrupt BRCA1 binding to the GADD45 promoter. These findings indicate that BRCA1 can up-regulate its targeted genes through protein-protein interactions and provide a novel mechanism by which BRCA1 participates in transcriptional regulation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mutations of the breast cancer susceptibility gene, BRCA1, are associated with more than half the cases of hereditary breast cancer (1-3). The human BRCA1 gene encodes a nuclear protein of 1863 amino acids and is expressed in a variety of human tissues (3, 4). Neoplastic development in BRCA1 mutation carriers is generally accompanied by loss of the wild-type allele, suggesting BRCA1 protein may function as a tumor suppressor. A number of observations have implicated BRCA1 in cellular response to DNA damage. BRCA1 associates and colocalizes with Rad51 protein and may be involved in DNA recombination. Following DNA damage, BRCA1 becomes hyperphosphorylated by ATM (5) and hCds1/Chk2 (6) and relocalizes to complexes containing proliferating cell nuclear antigen (7). Additionally, BRCA1 plays an important role in the transcription-coupled repair (8) and in the control of cell cycle arrest following DNA damage (9, 10). Recently, multiple reports (11-13) have suggested that BRCA1 might also play a role in apoptosis. Therefore, through its functions in DNA repair process, apoptosis, and cell cycle arrest, BRCA1 plays an important role in the maintenance of genomic integrity. This is strongly supported by the demonstration that murine embryos carrying a BRCA1 null mutation exhibit hypersensitivity to DNA damage and chromosomal abnormalities, probably due to defective G2/M checkpoint control and improper centrosome duplication (14).

GADD45 is a DNA damage-responsive gene and is induced by a wide spectrum of genotoxic stress agents, including ionizing radiation, UV radiation, methyl methanesulfonate (MMS),1 and medium starvation (15-17). It has been shown that induction of GADD45 after DNA damage is mediated via both p53-dependent (18, 19) and -independent pathways (20). Expression of Gadd45 protein suppresses cell growth (21, 22). Gadd45 protein is able to associate with multiple important cellular proteins, including proliferating cell nuclear antigen (23), p21 (24, 25), Cdc2 (26), core histone (27), and MTK1/MEKK4 (28). Recent findings suggest that GADD45 is involved in the control of cell cycle checkpoint (29) and apoptosis (28, 30). This argument is further supported by the finding that GADD45-null mice exhibit significant genomic instability, which is exemplified by aneuploidy, chromosomal aberrations, and gene amplification, and increased carcinogenesis following treatment with DNA damage (31). Therefore, GADD45 appears to be an important player in maintenance of genomic stability.

Several lines of evidence support a role for BRCA1 in transcriptional regulation. BRCA1 has an N-terminal ring finger domain and a C-terminal transcription activation domain that activates transcription when fused to a DNA-binding domain (32). It has been shown that BRCA1 interacts with transcriptional regulators, including p53 (33, 34), c-Myc (35), STAT1 (36), and estrogen receptor (37), and proteins involved in chromatin remodeling including p300/CBP (38) and RBAP46/48-HDAC (39). Expression of BRCA1 activates or suppresses expression of several important cellular proteins, such as p21waf1/CIP1 (10) and cyclin B1 (40). Most recently, studies from our group and others (30, 40, 41) have demonstrated that BRCA1 strongly activates GADD45 in a p53-independent manner. Activation of the GADD45 promoter requires normal transcription-activating function of BRCA1 because the tumor-derived BRCA1 mutants (1749R and Y1853insA), which lack transcription activity, are unable to activate the GADD45 promoter (41). However, the molecular mechanism by which BRCA1 up-regulates GADD45 is complex and may involve the regulatory elements located at either the third intron or the promoter region of GADD45. BRCA1 also represses GADD45 expression through its interaction with ZBRK1 transcription factor (42). Despite the discrepancy of the effect of BRCA1 on GADD45 transcription, it has been well accepted that GADD45 is one of the BRCA1 downstream effectors and probably mediates the role of BRCA1 in maintenance of genomic stability.

The transcription factor Oct-1, a member of the POU homeodomain family, is ubiquitously expressed and binds to the AGTCAAAA consensus sequence through its DNA-binding POU domain (43). High affinity Oct-1-binding sites are found in a number of cellular promoters (44), and binding of Oct-1 factor to its consensus motif normally activates Oct-1-regulated genes (45-49). NF-Y is also a ubiquitous transcription factor consisted of three subunits, A-C. NF-Y specifically binds CAAT box motifs, which are found in 30% of eukaryotic promoters (50, 51). Recently, both Oct-1 and NF-YA, but not NF-YB and NF-YC, were found to be induced following treatment with genotoxic agents, indicating that these two transcription factors may participate in cellular response to DNA damage (52, 53).

In this article, we identify OCT-1 and CAAT as the BRCA1-regulatory elements required for BRCA1 activation of the GADD45 promoter. Disruptions of the OCT-1 and CAAT motifs abolish activation of the GADD45 promoter by BRCA1. Moreover, BRCA1 physically associates with Oct-1 and NF-YA transcription factors. These results characterize an important molecular mechanism by which BRCA1 regulates GADD45.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Clones-- The following GADD45 promoter reporter constructs were used: pHG45-CAT1, pHG45-CAT2, pHG45-CAT5, pHG45-CAT7, pHG45-CAT11, pHG-CAT12, and pHG45-CAT13 (53, 54). GADD45 promoter reporters that contain mutations in either Oct-1 or CATT box motifs (pHg45-CAT11 m1, pHg45-CAT11 m2, pHg45-CAT11 m3, pHg45-CAT11 m4, pHg45-CAT11 m5, pHg45-CAT11 m6, and pHg45-CAT11 m7) were constructed by PCR cloning as described previously (53). pCR3-BRCA1, a construct expressing wt human BRCA1 protein, was provided by B. Weber (see Ref. 10). pC53-SN3, which expresses wild-type p53 protein, was provided by B. Vogelstein (see Ref. 55). PG-CAT-107/-57 was constructed by inserting the HindIII-PstI DNA fragment corresponding to -107 and -57 of the GADD45 promoter upstream of a minimal polyomavirus early promoter linked to a CAT gene, which was derived from PG-13 CAT that was provided by Dr. B. Vogelstein. Similarly, PG-OCT-1wt or PG-OCT-1mut was constructed by cloning 5 direct repeats of the intact OCT-1 motif (TGATTTGCATAGCCCTGTGG) or mutated OCT-1 motif (TGGCCTGCATAGCCCTGTGG) upstream of a minimal polyomavirus early promoter linked to a CAT gene via HindIII- and PstI-cloning sites. In the case of PG-CAATwt or PG-CAATmut, 3 repeats of the intact CAAT motif (TTAACCAATCAC) or mutated CAAT box (TTAACGTATCAC) were cloned into the same reporter plasmids described above.

Cell Culture and Treatment-- The human breast carcinoma MCF-7 line, the human lung carcinoma line H1299, and the human colorectal carcinoma line HCT116 were grown in F-12 medium supplemented with 10% fetal bovine serum as described previously (18, 19). For MMS treatment, cells were exposed to medium containing MMS (Aldrich) at 100 µg/ml for 4 h, and then the medium was replaced with fresh medium. For UV radiation, cells in 100-mm dishes were rinsed with PBS and irradiated to a dose of 10 Jm-2. Cells treated with MMS and UV were collected 16 h posttreatment for the CAT assay (20, 54).

Transfection and CAT Assay-- 4 µg of the GADD45 promoter reporter constructs and 4 µg of indicated expression vectors were cotransfected into human cells by calcium phosphate precipitation. 40 h later, cells were collected for the CAT assay. In addition, 4 µg of pCMV-GFP plasmid (which expresses green fluorescence protein) was included in each experiment. After transfection, expression of GFP protein was detected by Western blotting assay to determine transfection efficiency. Measurement of CAT activity was carried out as described previously (56). Cells were collected, resuspended in 0.25 M Tris (pH 7.8), and disrupted by three freeze-thaw cycles. Equal amounts of protein were used for each CAT assay. The CAT reaction mixture was incubated at 37 °C overnight, and the CAT activity was determined by measuring the acetylation of 14C-labeled chloramphenicol using thin layer chromatography. Radioactivity was measured directed with Betascope analyzer. The specific CAT activity was calculated by determining the fraction of chloramphenicol that had been acetylated. The relative CAT activity was determined by normalizing the activity of the treated samples to that of the untreated sample. Each value represented the average of at least three separate determinations (54, 56).

Antibodies, Preparation of Nuclear Protein, Immunoprecipitation, and Immunoblotting Analysis-- Antibodies against BRCA1, Oct-1, NF-YA, and Jun-D were commercially provided by Santa Cruz Biotechnology (Santa Cruz, CA). For preparation of nuclear protein, exponentially growing HCT116 cells were collected, rinsed with PBS, and resuspended in 200 µl of cold buffer A (10 mM Hepes (pH 7.9); 10 mM KCl; 0.1 mM EDTA; 0.1 mM EGTA; 1 mM dithiothreitol; 0.5 mM phenylmethylsulfonyl fluoride). Following vortexing, the samples were incubated on ice for 10 min, and Nonidet P-40 was added to a final concentration of 0.5%. After centrifugation, insoluble pellets were resuspended in 100 µl of ice-cold buffer C (20 mM Hepes (pH 7.9); 400 mM KCl; 1 mM EDTA; 1 mM EGTA; 1 mM dithiothreitol; 1 mM phenylmethylsulfonyl fluoride). The samples were placed on ice and subjected to vortexing for 15 s every 10 min, over a period of 40 min. Finally, the samples were centrifuged at 14,000 × g for 10 min, and the supernatant (nuclear extract) was collected for further analysis. For immunoprecipitation and immunoblotting analysis, 300 µg of nuclear protein was immunoprecipitated with anti-BRCA1, Oct-1, NF-YA, or Jun-D antibodies and protein A-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) for 4 h at 4 °C. The immunoprecipitated protein complexes were washed three times with lysis buffer and loaded onto a SDS-PAGE gel. After electrophoresis, the proteins were transferred to Protran membranes. Membranes were blocked in 5% milk, washed with PBST (PBS with 0.1% Tween), and incubated with anti-Oct-1, NF-YA, and BRCA1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Following washing and incubation with horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody at 1:4000 in 5% milk, the membranes were washed, and bound horseradish peroxidase was detected by ECL (Amersham Biosciences) and exposure to x-ray film.

Biotin-Streptavidin Pull-down Assay-- Four oligonucleotides containing biotin on the 5'-nucleotide of the sense strand were used in the pull-down assays. The sequences of these oligonucleotides are as follows: 1) wt oligo, 5'-GCAGGCTGATTTGCATAGCCCAATGGCCAAGCTGCATGCAAATGAGGCGGA, which corresponds to positions -107 to -57 of the human GADD45 promoter; 2) mut oligo1, 5'-GCAGGCTGATTTGCATAGCCtgATGGCCAAGCTGCATGCAAATGAGGCGGA, which corresponds to positions -107 to -57 of the human GADD45 promoter with the CAAT box mutated; 3) mut oligo2, 5'-GCAGGCTGgccTGCATAGCCCAATGGCCAAGCTGCATGCAggcGAGGCGGA, which corresponds to positions -107 to -57 of the human GADD45 promoter with two OCT-1 motifs mutated; and 4) mut oligo3, 5'-GCAGGCTGATTTGCATAGCCtgATGGCCAAGCTGCATGCA ggcGAGGCGGA, which corresponds to positions -107 to -57 of the human GADD45 promoter with two OCT-1 sites and one CAAT box mutated.

These oligonucleotides were annealed to their respective complementary oligonucleotides, and 51-bp double-stranded oligonucleotides were gel-purified and used. Nuclear protein was extracted as described earlier. One microgram of each double-stranded oligonucleotide was incubated with 300 µg of nuclear protein for 20 min at room temperature in binding buffer containing 12% glycerol, 12 mM Hepes (pH 7.9), 4 mM Tris (pH 7.9), 150 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, and 10 µg of poly(dI-dC) competitor. Following the incubation, 30 µl of streptavidin-agarose (Sigma) was added to the reaction and incubated at 4 °C for 4 h. Prior to this step, 300 µl of the original streptavidin-agarose bead preparation was preabsorbed with 500 µl of bovine serum albumin, 50 µg of poly(dI-dC), and 50 µg of sheared salmon sperm DNA for 30 min at 25 °C. The streptavidin-agarose beads were washed three times and resuspended in 300 µl of the binding buffer. The protein-DNA-streptavidin-agarose complex was washed three times with binding buffer and loaded onto a SDS gel. Detection of BRCA1, Oct-1, and NF-YA proteins was performed as described above (54).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mapping of the BRCA1 Regulatory Elements in the GADD45 Promoter-- Our group recently demonstrated (41) that BRCA1 induces expression of GADD45 mRNA and activates the GADD45 promoter. As shown in Fig. 1A, when pHG45-CAT2, a GADD45 promoter reporter construct that spans -909 to +144 of the GADD45 promoter region, was cotransfected with either pCMV.neo (Neo) or pCR3.BRCA1 (BRCA1) into the human breast carcinoma MCF-7 cell line (wt p53), human colorectal carcinoma HCT116 cell line (wt p53), or HCT116 p53-/- cell line (where p53 alleles were deleted via homologue recombination), the GADD45 promoter reporter was strongly activated in all cell lines regardless of p53 status. To determine transfection efficiency, GFP expression vector was cotransfected with each tested plasmid. The expression of GFP protein detected by immunoblotting analysis indicated that transfection efficiency was similar among different samples with variations less than 20%. To map the BRCA1-responsive elements in the GADD45 promoter, a series of the GADD45 CAT reporters that spanned the different regions of the human GADD45 promoter were constructed. Following cotransfection of these GADD45 promoter reporter plasmids with the BRCA1 expression vector into human colorectal carcinoma HCT116 and HCT116 p53-/- cells, CAT assays were conducted, and the CAT activities were analyzed. As illustrated in Fig. 1B, most of the GADD45 CAT reporters were strongly activated following expression of BRCA1 protein. With progressive 5'-deletion, pHG45-CAT13 that extended 5' only to -62 relative to the transcription start site exhibited little induction following expression of BRCA1. These observations indicate that the region between -107 and -62 contains the regulatory elements required for the responsiveness of the GADD45 promoter to BRCA1 expression.


View larger version (36K):
[in this window]
[in a new window]
  		Fig. 1.   Mapping of the BRCA1-regulatory elements in the GADD45 promoter. A, 4 µg of the GADD45 promoter CAT reporter constructs pHG45-CAT2 was cotransfected with 4 µg of either pCR3.BRCA1 (BRCA1) or pCMV.neo (Neo) expression vectors into MCF-7, HCT116, or HCT116p53-/- cells using calcium phosphate precipitation. 48 h later, cells were collected, and CAT activity was assayed (see "Experimental Procedures"). To determine transfection efficiency, 4 µg of GFP expression vector was cotransfected with each tested plasmid, and the expression of GFP protein was detected as the internal control of transfection. B, 4 µg of the CAT reporter constructs containing the indicated regions of the GADD45 promoter were cotransfected with pCR3.BRCA1 into HCT116 and HCT116 p53-/- cell lines. CAT assay was carried out as in A. C, 4 µg of PG-CAT-107/-57 plasmid, where the DNA fragment corresponding to -107 to -57 of the GADD45 promoter was cloned upstream of a minimal polyomavirus promoter linked to a CAT gene, was cotransfected with either pCR3.BRCA1 (BRCA1), pCMV.neo (Neo), or pC53-SN3 (p53). The CAT assays were performed, and the CAT activities were measured as described under "Experimental Procedures." In some cases, the cells transfected with PG-CAT-107/-57 alone were treated with UV radiation or MMS and followed by CAT assay. All experiments presented in A and C were repeated at least three times, but only a representative experiment of CAT assay is shown here. D, DNA sequence analysis indicates that there are two OCT-1 sites and one CAAT box located at the region of the GADD45 promoter from -107 to -62.

To confirm if the region from -107 to -62 is responsible for activation of the GADD45 promoter by BRCA1, we constructed a reporter plasmid designated as PG-CAT-107/-57, where a DNA fragment corresponding to the GADD45 promoter region between -107 and -57 was cloned upstream of a minimal polyomavirus promoter linked to a CAT reporter gene. This minimal polyomavirus promoter itself is unable to respond to BRCA1 expression or DNA-damaging agents (data not shown). When cotransfected with pCR3.BRCA1 (BRCA1) into HCT116 cells, PG-CAT-107/-57 exhibited induction (Fig. 1C). In contrast, both pCMV.neo (Neo) and pC53-SN3 (p53) had no effect on this reporter, indicating that the region between -107 and -57 is capable of conferring the BRCA1 inducibility to a non-related promoter reporter. Interestingly, PG-CAT-107/-57 was also shown to be strongly induced by UV radiation and MMS, suggesting that activation of the GADD45 promoter by BRCA1 and DNA damage might share some common regulatory elements. Inspection of DNA sequence exhibits two OCT-1 motifs and one CAAT box located at this region of the human GADD45 promoter (Fig. 1D).

BRCA1 Activation of the GADD45 Promoter Is Mediated through Both OCT-1 and CAAT Motifs-- To determine whether the OCT-1 and CAAT box motifs play roles in activating the GADD45 promoter following expression of BRCA1, we mutated the OCT-1 or CAAT motifs in GADD45 promoter CAT reporter constructs (53). It should be noted here that our previous work (54) has demonstrated that there are certain regulatory elements located more upstream of the GADD45 promoter, such as EGR1/WT1. Therefore, to exclude the influence of such responsive elements, we choose pHG45-CAT11, which only contains the region from -121 to +144 of the GADD45 promoter. Following cotransfection of these mutants of the GADD45 promoter reporters into both HCT116 (wt p53) and H1299 cells, where the p53 gene is deleted, induction of CAT activity was determined. As shown in Fig. 2, pHG45-CAT11 exhibited the strongest activation by BRCA1. Single mutation in either OCT-1 or CAAT1 motifs (pHG45-CAT11 m1, pHG45-CAT11 m2, and pHG45-CAT11 m3) had little effect on BRCA1-induced activation of the GADD45 promoter. However, double mutations in OCT-1 and CAAT sites (pHG45-CAT11 m4, pHG45-CAT11 m5, and pHG45-CAT11 m6) inhibited activation of the GADD45 promoter by BRCA1, reducing induction of these reporters by 60%. When all three sites were mutated (pHG45-CAT11 m7), the GADD45 promoter reporter did not exhibit any activation following expression of BRCA1. The responsiveness of the pHG45-CAT11 m7 to BRCA1 expression was observed to be similar to that seen in pHG45-CAT13 (Fig. 1B), which only contains the GADD45 promoter region from -62 to +144. In addition to HCT116 and H1299, we have also examined the activity of the GADD45 promoter reporters in MCF-7 (wt 53) and HCT116 p53-/- and obtained similar results (data not shown), suggesting that the OCT-1 and CAAT-mediated BRCA1 activation of the GADD45 promoter does not require p53. These results indicate that both the OCT-1 and CAAT motifs play an important role in BRCA1 activation of the GADD45 promoter in a p53-independent manner.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 2.   Mutations of OCT-1 and CAAT motifs abrogate the activation of the GADD45 promoter following expression of BRCA1. 4 µg of the GADD45 promoter reporter constructs containing the indicated mutations either in OCT-1 sites or in CAAT box were cotransfected with pCR3.BRCA1 into either human colorectal carcinoma HCT116 cells (wt p53) or human lung carcinoma H1299 cells, which contain deleted p53 gene. 40 h later, cells were collected for CAT assay as described under "Experimental Procedures." The values represent the relative induction of the GADD45 promoter CAT reporters by BRCA1 to that of the Neo-cotransfected controls.

We also made mutations in all OCT1 and CAAT motifs in pHG45-CAT2, which covers a longer promoter region between -909 and +144 and determined the BRCA1 activation on this construct. BRCA1 activation of this mutated promoter (pHG45-CAT2ma) was reduced by 70% compared with the pHG45-CAT2 that contains the intact GADD45 promoter (results not shown). In contrast, BRCA1 activation of the pHG45-CAT11 m7 was completely abolished (Fig. 2). This result is in agreement with our previous finding (54) that there are certain regulatory elements (such as EGR1/WT1) at the upstream region of the GADD45 promoter. These upstream-responsive elements might also play a role in activation of the GADD45 promoter by BRCA1, even when mutations were made in OCT1 and CAAT1 motifs.

To determine further the roles of the OCT-1 and CAAT1 motifs in the BRCA1-mediated transcriptional activation, we constructed both OCT-1 and CAAT reporter plasmids, where the multiple repeats of either OCT-1 or CAAT motifs were placed upstream of a polyomavirus minimal promoter that is linked to a chloramphenicol acetyltransferase (CAT) gene. In Fig. 3A, PG-OCT-1wt that contains 5 repeats of the intact OCT-1 motifs was transfected with expression vectors for BRCA1, Neo, and Oct-1 into HCT116 cells. PG-OCT-1wt was activated following expression of BRCA1. As an OCT-1 reporter, this construct was also strongly induced by Oct-1 expression. Interestingly, the OCT-1 reporter was responsive to MMS treatment. In contrast, the PG-OCT-1mut that contains 5 repeats of the mutated OCT-1 sites did not exhibit any responsiveness to expression of BRCA1 and Oct-1 protein or to MMS treatment. Similarly, the PG-CAATwt with 3 repeats of the CAAT motifs demonstrated a clear induction following expression of either BRCA1 or NF-YA, which is one of the subunits of NF-Y transcription factor and binds to CAAT box. PG-CAAT also exhibited strong activation by MMS. However, PG-CAATmut with mutated CAAT motifs did not respond to expression of BRCA1 and NF-YA or MMS treatment. Collectively, the results presented above further indicate that the BRCA1 activation of the GADD45 promoter is mediated through the OCT-1 and CAAT motifs.


View larger version (68K):
[in this window]
[in a new window]
  		Fig. 3.   Both OCT-1 and CAAT box motifs confer inducibility of BRCA1 to a non-related minimal promoter. A, 4 µg of PG-OCT-1wt and PG-OCT-1mut constructs containing 5 repeats of intact OCT-1 or mutant OCT-1 motifs upstream of the minimal polyomavirus promoter linked to a CAT gene were cotransfected with 4 µg of the indicated expression vectors (pCMV.neo, pCR3.BRCA1, and pCR3.Oct-1) into HCT116 cells. 40 h later, cells were collected for CAT assay as described in A. B, 4 µg of PG-CAATwt or PG-CAATmut plasmids, which are CAAT reporter constructs (see "Experimental Procedures"), were transfected with 4 µg of the indicated expression vectors (pCMV.neo, pCR3.BRCA1, and pCMV.NF-YA) into HCT116 cells. CAT assay was performed as in A.

BRCA1 Physically Interacts with OCT-1 and CAAT Motifs Via Its Physical Association with Both Oct-1 and NF-YA Proteins-- Because the OCT-1 and CAAT motifs mediate the transcriptional activation of the GADD45 promoter by BRCA1, effort was made to determine whether BRCA1 directly binds to the GADD45 promoter region containing both OCT-1 and CAAT sites. An approach called "biotin-streptavidin pull-down assay" was employed to identify the proteins bound to the BRCA1-responsive region of the GADD45 promoter. The biotin-labeled 51-bp double-stranded oligonucleotides corresponding to -107 to -57 of the GADD45 promoter were incubated with nuclear extracts from HCT116 cells and pulled down by streptavidin (see "Experimental Procedures"). The protein complexes bound to the oligonucleotides were loaded onto SDS-PAGE gel and analyzed by immunoblotting assay with antibodies against BRCA1, Oct-1, and NF-YA. In Fig. 4A, the Oligo-wt that contains the intact OCT-1 and CAAT motifs was able to pull down the Oct-1, NF-YA, and BRCA1 proteins, indicating that all three proteins physically associate with this BRCA1-regulatory region. In Oligo-mut1, where the CAAT box was mutated, both the Oct-1 and BRCA1 proteins but not NF-YA were detected in the precipitated complexes. In the case of Oligo-mut2, where two OCT-1 sites were disrupted, BRCA1 and NF-YA proteins were present but not Oct-1. However, when all OCT-1 and CAAT motifs were mutated in the Oligo-mut3, no BRCA1, Oct-1, or NY-FA proteins were detected. These results strongly suggest the following two interpretations: (a) BRCA1 physically associates with the region of the GADD45 promoter between -107 and -57 through its interaction with both OCT-1 and CAAT motifs; and (b) BRCA1 interacts with OCT-1 or CAAT motifs independently because single mutation of either motif did not disrupt BRCA1 interaction with the BRCA1-responsive region of the GADD45 promoter.


View larger version (38K):
[in this window]
[in a new window]
  		Fig. 4.   Pull-down assay with biotin-labeled oligonucleotides containing the OCT-1 and CAAT1 motifs. A, nuclear extracts were prepared from HCT116 cells as described under "Experimental Procedures" and incubated with biotin-labeled 51-bp oligonucleotides, which contain either intact or mutated OCT-1 and CAAT sequences. Proteins bound to these nucleotides were isolated with streptavidin-agarose beads, and BRCA1, Oct-1, and NF-YA were detected by immunoblotting analysis (see "Experimental Procedures"). B, the nuclear extracts were immunodepleted with the antibodies against Jun-D, Oct-1, and NF-YA prior to incubation with the nucleotide containing intact OCT-1 and CAAT motifs (Oligo-wt).

However, because BRCA1 is not a sequence-specific binding transcription factor, it is most likely that the association of BRCA1 protein with the GADD45 promoter is through its interaction with the Oct-1 and NF-Y factors, which directly bind to the GADD45 promoter via their motifs. To address this issue, the Oligo-wt was incubated with the nuclear extracts, which were immunodepleted with anti-Oct-1 or -NF-YA antibodies prior to the pull-down assay. As shown in Fig. 4B, depletion with single antibody to either Oct-1 or NF-YA proteins did not affect binding of BRCA1 to the GADD45 promoter region. However, immunodepletion of both the Oct-1 and NF-YA proteins completely abolished the association of BRCA1 with the GADD45 promoter, indicating that association of BRCA1 with the GADD45 promoter is through its interaction with the Oct-1 and NF-YA proteins, which directly bind to the GADD45 promoter.

Next, we further determined the physical interactions of BRCA1 with Oct-1 and NF-YA proteins. Nuclear extracts isolated from HCT116 cells were incubated with anti-Jun-D, anti-Oct-1, anti-NF-YA, or anti-BRCA1 antibodies and immunoprecipitated with protein A/G-agarose beads. The immunocomplexes were then analyzed by Western blotting assay, and the results are shown in Fig. 5. NF-YA protein was present in the immunocomplexes precipitated by the antibodies against Oct-1, NF-YA, and BRCA1, suggesting physical interactions of NF-YA with Oct-1 and BRCA1. Oct-1 protein was detected in the immunocomplexes with both anti-Oct-1 and anti-BRCA1 antibodies. Similarly, BRCA1 protein was detected in the anti-Oct-1 and anti-BRCA1 immunocomplexes. In contrast, no NF-YA, Oct-1, or BRCA1 proteins was present in the anti-Jun-D-immunoprecipitated complex. However, it is somewhat surprising that we did not detect Oct-1 and BRCA1 proteins in the anti-NF-YA-immunocomplex. One likely interpretation is that the interacting domains of Oct-1 and BRCA1 in NF-YA protein might share the region with the epitopes to the antibody against NF-YA, which possibly lead to dissociation of the NF-YA-BRCA1 and NF-YA-Oct-1 protein complexes. Taken together, these results indicate an association of BRCA1 with Oct-1 and NF-YA and an interaction between Oct-1 and NF-YA as well.


View larger version (42K):
[in this window]
[in a new window]
  		Fig. 5.   Physical association of BRCA with Oct-1 and NF-YA. Nuclear protein from HCT116 cells was prepared (see "Experimental Procedures") and immunoprecipitated with anti-Jun-D, anti-Oct-1, anti-NF-YA, and anti-BRCA1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). The immunocomplexes were analyzed by SDS-PAGE and immunoblotted with antibodies against NF-YA, Oct-1, and BRCA1, respectively. The visualized bands are shown; their estimated masses were 42-46 kDa for NF-YA, 97 kDa for Oct-1, and 220 kDa for BRCA1. IP, immunoprecipitation; IB, immunoblotting analysis.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Studies presented in this paper and our earlier report (41) have demonstrated that BRCA1 activates the GADD45 promoter. By using 5'-deletion analysis, the BRCA1-regulatory elements have been mapped at the GADD45 promoter region between -107 and -62, where there are two OCT-1 motifs and one CAAT motif. Disruption of the OCT-1 and CAAT motifs abrogates the activation of the GADD45 promoter by BRCA1 expression, indicating that both OCT-1 and CAAT sites are required for the BRCA1 activation of the GADD45 promoter. This finding is further supported by the observation that the OCT-1 and CAAT motifs are able to confer BRCA1 inducibility to a non-related minimal polyomavirus promoter, when multiple repeats of these motifs are cloned upstream of the minimal promoter linked to a CAT gene. In the biotin-streptavidin pull-down assay, BRCA1 protein exhibits an association with the oligonucleotides corresponding to the GADD45 promoter region from -107 to -57. Mutations of all OCT-1 and CAAT sites in such oligonucleotides disrupt association of BRCA1 with the GADD45 promoter. Importantly, BRCA1 protein is demonstrated to interact physically with both Oct-1 and NF-YA proteins, and depletion of Oct-1 and NF-YA proteins results in abrogation of association of BRCA1 with the GADD45 promoter. We conclude that BRCA1 transactivation of the GADD45 promoter is mediated through BRCA1 interaction with Oct-1 and NF-YA proteins.

BRCA1 has been implicated in DNA damage-induced cellular response, including apoptosis, cell cycle arrest, and DNA repair (7-13). Inactivation of BRCA1 correlates with genomic instability (14), indicating that one of the major roles for BRCA1 is to maintain genomic fidelity. In addition to direct interactions of BRCA1 with proteins involved in cell cycle control and DNA repair, BRCA1-mediated transcriptional regulation may also greatly contribute to its role in cellular response to DNA damage. For example, both p21and GADD45, which are important players in the control of cell cycle checkpoints (29, 57), are regulated by BRCA1 (10, 41). It has been well accepted that the roles of BRCA1 as a tumor suppressor might be at least in part mediated through its transcriptional properties, given the evidence that tumor-derived mutations within the C terminus of BRCA1 are defective in transcriptional activation (10, 32). In agreement with this point, the tumor-derived BRCA1 mutants (p1749R and Y1853insA) that lack transcriptional activity are unable to activate the GADD45 promoter (41). However, the regulation of GADD45 by BRCA1 appears to be complex and might involve differential mechanism(s). This complex regulation may be due to the following points. (a) BRCA1 activation of GADD45 has been shown to involve the BRCA1-responsive elements located at both the intronic or promoter regions of GADD45 (30, 41, 58). (b) Most likely, BRCA1 regulates GADD45 through its interaction with other transcription factors that directly bind to the GADD45 promoter or intronic regions instead of direct binding of BRCA1 to the regulatory regions. (c) BRCA1 protein might be subject to phosphorylation in the process of DNA damage-induced transcriptional activation (5, 6). (d) BRCA1-mediated transactivation might recruit transcriptional coactivators, such as p300/CBP (38). Therefore, future work will further characterize the biochemical consequences of the interaction between BRCA1 and Oct-1 and NF-YA to determine whether Oct-1 and NF-YA are subject to protein stabilization, phosphorylation, or acetylation.

The GADD45 promoter is strongly activated following genotoxic stress, including UV radiation, MMS, and medium starvation (54). Most recently, we have demonstrated that the p53-independent UV induction of the GADD45 promoter is also regulated through both OCT-1 and CAAT motifs located at the same region between -107 and -62 of the GADD45 promoter. Mutations of all OCT-1 and CAAT motifs abolish the induction of the GADD45 promoter by UV radiation and MMS. In addition, protein levels of the Oct-1 and NF-YA transcription factors are elevated following DNA damage (53). Moreover, mitogen-activated protein kinases (c-Jun N-terminal kinase and extracellular signal-regulated kinase) also activate the GADD45 promoter through the OCT-1 and CAAT motifs. In the current study, we demonstrate that the OCT-1 and CAAT motifs mediate the BRCA1 activation of the GADD45 promoter. Therefore, it can be speculated that the OCT-1 and CAAT motifs are critical in the regulation of the p53-independent induction of GADD45 in response to growth arrest signals (such as BRCA1 expression) and a variety of DNA-damaging agents. It is worth noting that in the OCT-1 and CAAT motifs appear to function in an additive but independent manner because single mutation of either OCT-1 sites or the CAAT box only reduced induction of the GADD45 promoter by BRCA1, whereas mutations of all OCT-1 and CAAT motifs completely disrupted the BRCA1 activation of the GADD45 promoter (Fig. 2).

The finding that BRCA1 regulates the GADD45 through its interaction with transcription factors Oct-1 and NF-YA is of importance, given evidence that both the OCT-1 and CAAT motifs are widely present in the many gene promoters. Oct-1 and NF-YA are ubiquitous transcription factors involved in the development, cell cycle regulation, and cellular senescence (50, 51, 59, 60). Recently, we have found that OCT-1 and NF-YA proteins are induced after exposure of cells to multiple DNA-damaging agents and therapeutic agents in a p53-independent manner (52, 53). These observations indicate that both Oct-1 and NF-YA proteins are able to participate in cellular responses to genotoxic stress. In addition, our current study has shown a physical interaction of NF-YA with Oct-1 protein, suggesting that induction of GADD45 by BRCA1 might involve a functional interaction between these two proteins. In fact, Oct-1 and NF-YA proteins have been reported previously to synergistically regulate histone H2B gene transcription during Xenopus early development (61). In summary, the study presented here has demonstrated the biochemical mechanism by which BRCA1 regulates the GADD45 promoter and indicated that GADD45 is a BRCA1 downstream effector. Furthermore, identification of the OCT-1 and CAAT1 as BRCA1-responsive elements has broadened the biological roles for BRCA1 in transcriptional regulation.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grant R01 CA 93640-01 and Department of Defense Grant DAMD 17-00-1-0414.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

|| To whom correspondence should be addressed: Cancer Institute, University of Pittsburgh School of Medicine, BST W-945, 200 Lothrop St., Pittsburgh, PA 15213. Fax: 412624-0295; E-mail: Qzhan@pitt.edu.

Published, JBC Papers in Press, January 3, 2002, DOI 10.1074/jbc.M110225200

    ABBREVIATIONS

The abbreviations used are: MMS, methyl methanesulfonate; CAT, chloramphenicol acetyltransferase; PBS, phosphate-buffered saline; GFP, green fluorescence protein; wt, wild type; mut, mutant.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Easton, D. F., Ford, D., and Bishop, D. T. (1995) Am. J. Hum. Genet. 56, 265-271[Medline] [Order article via Infotrieve]
2. Ford, D., and Easton, D. F. (1995) Br. J. Cancer 72, 805-812[Medline] [Order article via Infotrieve]
3. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P. A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L. M., Ding, W., et al.. (1994) Science 266, 66-71[Abstract/Free Full Text]
4. Marquis, S. T., Rajan, J. V., Wynshaw-Boris, A., Xu, J., Yin, G. Y., Abel, K. J., Weber, B. L., and Chodosh, L. A. (1995) Nat. Genet. 11, 17-26[CrossRef][Medline] [Order article via Infotrieve]
5. Cortez, D., Wang, Y., Qin, J., and Elledge, S. J. (1999) Science 286, 1162-1166[Abstract/Free Full Text]
6. Lee, J. S., Collins, K. M., Brown, A. L., Lee, C. H., and Chung, J. H. (2000) Nature 404, 201-204[CrossRef][Medline] [Order article via Infotrieve]
7. Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T., and Livingston, D. M. (1997) Cell 88, 265-275[CrossRef][Medline] [Order article via Infotrieve]
8. Gowen, L. C., Avrutskaya, A. V., Latour, A. M., Koller, B. H., and Leadon, S. A. (1998) Science 281, 1009-1012[Abstract/Free Full Text]
9. Larson, J. S., Tonkinson, J. L., and Lai, M. T. (1997) Cancer Res. 57, 3351-3355[Abstract/Free Full Text]
10. Somasundaram, K., Zhang, H., Zeng, Y. X., Houvras, Y., Peng, Y., Wu, G. S., Licht, J. D., Weber, B. L., and El-Deiry, W. S. (1997) Nature 389, 187-190[CrossRef][Medline] [Order article via Infotrieve]
11. Shao, N., Chai, Y. L., Shyam, E., Reddy, P., and Rao, V. N. (1996) Oncogene 13, 1-7[Medline] [Order article via Infotrieve]
12. Fan, S., Wang, J. A., Yuan, R. Q., Ma, Y. X., Meng, Q., Erdos, M. R., Brody, L. C., Goldberg, I. D., and Rosen, E. M. (1998) Oncogene 16, 3069-3082[CrossRef][Medline] [Order article via Infotrieve]
13. Thangaraju, M., Kaufmann, S. H., and Couch, F. J. (2000) J. Biol. Chem. 275, 33487-33496[Abstract/Free Full Text]
14. Shen, S. X., Weaver, Z., Xu, X., Li, C., Weinstein, M., Chen, L., Guan, X. Y., Ried, T., and Deng, C. X. (1998) Oncogene 17, 3115-3124[CrossRef][Medline] [Order article via Infotrieve]
15. Fornace, A. J., Jr., Alamo, I., Jr., and Hollander, M. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8800-8804[Abstract/Free Full Text]
16. Fornace, A. J., Jr., Papathanasiou, M. A., Tarone, R. E., Wong, M., Mitchell, J., and Hamer, D. H. (1990) Prog. Clin. Biol. Res. 340A, 315-325
17. Papathanasiou, M. A., Kerr, N. C., Robbins, J. H., McBride, O. W., Alamo, I., Jr., Barrett, S. F., Hickson, I. D., and Fornace, A. J., Jr. (1991) Mol. Cell. Biol. 11, 1009-1016[Abstract/Free Full Text]
18. Kastan, M. B., Zhan, Q., El-, Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fornace, A. J., Jr. (1992) Cell 71, 587-597[CrossRef][Medline] [Order article via Infotrieve]
19. Zhan, Q., Bae, I., Kastan, M. B., and Fornace, A. J., Jr. (1994) Cancer Res. 54, 2755-2760[Abstract/Free Full Text]
20. Zhan, Q., Fan, S., Smith, M. L., Bae, I., Yu, K., Alamo, I., Jr., O'Connor, P. M., and Fornace, A. J., Jr. (1996) DNA Cell Biol. 15, 805-815[Medline] [Order article via Infotrieve]
21. Zhan, Q., Lord, K. A., Alamo, I., Jr., Hollander, M. C., Carrier, F., Ron, D., Kohn, K. W., Hoffman, B., Liebermann, D. A., and Fornace, A. J., Jr. (1994) Mol. Cell. Biol. 14, 2361-2371[Abstract/Free Full Text]
22. Jin, S., Antinore, M. J., Lung, F. D., Dong, X., Zhao, H., Fan, F., Colchagie, A. B., Blanck, P., Roller, P. P., Fornace, A. J., Jr., and Zhan, Q. (2000) J. Biol. Chem. 275, 16602-16608[Abstract/Free Full Text]
23. Smith, M. L., Chen, I. T., Zhan, Q., Bae, I., Chen, C. Y., Gilmer, T. M., Kastan, M. B., O'Connor, P. M., and Fornace, A. J., Jr. (1994) Science 266, 1376-1380[Abstract/Free Full Text]
24. Kearsey, J. M., Coates, P. J., Prescott, A. R., Warbrick, E., and Hall, P. A. (1995) Oncogene 11, 1675-1683[Medline] [Order article via Infotrieve]
25. Zhao, H., Jin, S., Antinore, M. J., Lung, F. D., Fan, F., Blanck, P., Roller, P., Fornace, A. J., Jr., and Zhan, Q. (2000) Exp. Cell Res. 258, 92-100[CrossRef][Medline] [Order article via Infotrieve]
26. Zhan, Q., Antinore, M. J., Wang, X. W., Carrier, F., Smith, M. L., Harris, C. C., and Fornace, A. J., Jr. (1999) Oncogene 18, 2892-2900[CrossRef][Medline] [Order article via Infotrieve]
27. Carrier, F., Georgel, P. T., Pourquier, P., Blake, M., Kontny, H. U., Antinore, M. J., Gariboldi, M., Myers, T. G., Weinstein, J. N., Pommier, Y., and Fornace, A. J., Jr. (1999) Mol. Cell. Biol. 19, 1673-1685[Abstract/Free Full Text]
28. Takekawa, M., and Saito, H. (1998) Cell 95, 521-530[CrossRef][Medline] [Order article via Infotrieve]
29. Wang, X. W., Zhan, Q., Coursen, J. D., Khan, M. A., Kontny, H. U., Yu, L., Hollander, M. C., O'Connor, P. M., Fornace, A. J., Jr., and Harris, C. C. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3706-3711[Abstract/Free Full Text]
30. Harkin, D. P., Bean, J. M., Miklos, D., Song, Y. H., Truong, V. B., Englert, C., Christians, F. C., Ellisen, L. W., Maheswaran, S., Oliner, J. D., and Haber, D. A. (1999) Cell 97, 575-586[CrossRef][Medline] [Order article via Infotrieve]
31. Hollander, M. C., Sheikh, M. S., Bulavin, D. V., Lundgren, K., Augeri-Henmueller, L., Shehee, R., Molinaro, T. A., Kim, K. E., Tolosa, E., Ashwell, J. D., Rosenberg, M. P., Zhan, Q., Fernandez-Salguero, P. M., Morgan, W. F., Deng, C. X., and Fornace, A. J., Jr. (1999) Nat. Genet. 23, 176-184[CrossRef][Medline] [Order article via Infotrieve]
32. Chapman, M. S., and Verma, I. M. (1996) Nature 382, 678-679[CrossRef][Medline] [Order article via Infotrieve]
33. Ouchi, T., Monteiro, A. N., August, A., Aaronson, S. A., and Hanafusa, H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2302-2306[Abstract/Free Full Text]
34. Zhang, H., Somasundaram, K., Peng, Y., Tian, H., Bi, D., Weber, B. L., and El-Deiry, W. S. (1998) Oncogene 16, 1713-1721[CrossRef][Medline] [Order article via Infotrieve]
35. Wang, Q., Zhang, H., Kajino, K., and Greene, M. I. (1998) Oncogene 17, 1939-1948[CrossRef][Medline] [Order article via Infotrieve]
36. Ouchi, T., Lee, S. W., Ouchi, M., Aaronson, S. A., and Horvath, C. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5208-5213[Abstract/Free Full Text]
37. Fan, S., Wang, J., Yuan, R., Ma, Y., Meng, Q., Erdos, M. R., Pestell, R. G., Yuan, F., Auborn, K. J., Goldberg, I. D., and Rosen, E. M. (1999) Science 284, 1354-1356[Abstract/Free Full Text]
38. Pao, G. M., Janknecht, R., Ruffner, H., Hunter, T., and Verma, I. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 1020-1025[Abstract/Free Full Text]
39. Chen, G. C., Guan, L. S., Yu, J. H., Li, G. C., Choi Kim, H. R., and Wang, Z. Y. (2001) Biochem. Biophys. Res. Commun. 284, 507-514[CrossRef][Medline] [Order article via Infotrieve]
40. MacLachlan, T. K., Somasundaram, K., Sgagias, M., Shifman, Y., Muschel, R. J., Cowan, K. H., and El-Deiry, W. S. (2000) J. Biol. Chem. 275, 2777-2785[Abstract/Free Full Text]
41. Jin, S., Zhao, H., Fan, F., Blanck, P., Fan, W., Colchagie, A. B., Fornace, A. J., Jr., and Zhan, Q. (2000) Oncogene 19, 4050-4057[CrossRef][Medline] [Order article via Infotrieve]
42. Zheng, L., Pan, H., Li, S., Flesken-Nikitin, A., Chen, P. L., Boyer, T. G., and Lee, W. H. (2000) Mol. Cell 6, 757-768[CrossRef][Medline] [Order article via Infotrieve]
43. Sturm, R. A., Das, G., and Herr, W. (1988) Genes Dev. 2, 1582-1599[Abstract/Free Full Text]
44. Fletcher, C., Heintz, N., and Roeder, R. G. (1987) Cell 51, 773-781[CrossRef][Medline] [Order article via Infotrieve]
45. LaBella, F., Sive, H. L., Roeder, R. G., and Heintz, N. (1988) Genes Dev. 2, 32-39[Abstract/Free Full Text]
46. Murphy, S., Pierani, A., Scheidereit, C., Melli, M., and Roeder, R. G. (1989) Cell 59, 1071-1080[CrossRef][Medline] [Order article via Infotrieve]
47. Bergman, Y., Rice, D., Grosschedl, R., and Baltimore, D. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 7041-7045[Abstract/Free Full Text]
48. Eraly, S. A., Nelson, S. B., Huang, K. M., and Mellon, P. L. (1998) Mol. Endocrinol. 12, 469-481[Abstract/Free Full Text]
49. Fadel, B. M., Boutet, S. C., and Quertermous, T. (1999) J. Biol. Chem. 274, 20376-20383[Abstract/Free Full Text]
50. Mantovani, R. (1999) Gene (Amst.) 239, 15-27[CrossRef][Medline] [Order article via Infotrieve]
51. Matuoka, K., and Yu Chen, K. (1999) Exp. Cell Res. 253, 365-371[CrossRef][Medline] [Order article via Infotrieve]
52. Zhao, H., Jin, S., Fan, F., Fan, W., Tong, T., and Zhan, Q. (2000) Cancer Res. 60, 6276-6280[Abstract/Free Full Text]
53. Jin, S., Fan, F., Fan, W., Zhao, H., Tong, T., Blanck, P., Alomo, I., Rajasekaran, B., and Zhan, Q. (2001) Oncogene 20, 2683-2690[CrossRef][Medline] [Order article via Infotrieve]
54. Zhan, Q., Chen, I. T., Antinore, M. J., and Fornace, A. J., Jr. (1998) Mol. Cell. Biol. 18, 2768-2778[Abstract/Free Full Text]
55. Kern, S. E., Pietenpol, J. A., Thiagalingam, S., Seymour, A., Kinzler, K. W., and Vogelstein, B. (1992) Science 256, 827-830[Abstract/Free Full Text]
56. Zhan, Q., Carrier, F., and Fornace, A. J., Jr. (1993) Mol. Cell. Biol. 13, 4242-4250[Abstract/Free Full Text]
57. Waldman, T., Kinzler, K. W., and Vogelstein, B. (1995) Cancer Res. 55, 5187-5190[Abstract/Free Full Text]
58. Li, S., Chen, P. L., Subramanian, T., Chinnadurai, G., Tomlinson, G., Osborne, C. K., Sharp, Z. D., and Lee, W. H. (1999) J. Biol. Chem. 274, 11334-11338[Abstract/Free Full Text]
59. Sturm, R. A., Dalton, S., and Wells, J. R. (1988) Nucleic Acids Res. 16, 8571-8586[Abstract/Free Full Text]
60. Inamoto, S., Segil, N., Pan, Z. Q., Kimura, M., and Roeder, R. G. (1997) J. Biol. Chem. 272, 29852-29858[Abstract/Free Full Text]
61. Hinkley, C., and Perry, M. (1992) Mol. Cell. Biol. 12, 4400-4411[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Genes Dev.Home page
J. Kang, M. Gemberling, M. Nakamura, F. G. Whitby, H. Handa, W. G. Fairbrother, and D. Tantin
A general mechanism for transcription regulation by Oct1 and Oct4 in response to genotoxic and oxidative stress
Genes & Dev., January 15, 2009; 23(2): 208 - 222.
[Abstract] [Full Text] [PDF]

Home page
 Endocr Relat CancerHome page
C. Zhou, Y. Tong, K. Wawrowsky, S. Bannykh, I. Donangelo, and S. Melmed
Oct-1 induces pituitary tumor transforming gene expression in endocrine tumors
Endocr. Relat. Cancer, September 1, 2008; 15(3): 817 - 831.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Scuto, M. Kirschbaum, C. Kowolik, L. Kretzner, A. Juhasz, P. Atadja, V. Pullarkat, R. Bhatia, S. Forman, Y. Yen, et al.
The novel histone deacetylase inhibitor, LBH589, induces expression of DNA damage response genes and apoptosis in Ph- acute lymphoblastic leukemia cells
Blood, May 15, 2008; 111(10): 5093 - 5100.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
A. Manea, S. A. Manea, A. V. Gafencu, M. Raicu, and M. Simionescu
AP-1-Dependent Transcriptional Regulation of NADPH Oxidase in Human Aortic Smooth Muscle Cells: Role of p22phox Subunit
Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 878 - 885.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. A. Park, Y.-J. Seok, G. Jeong, and J.-S. Lee
SUMO1 negatively regulates BRCA1-mediated transcription, via modulation of promoter occupancy
Nucleic Acids Res., January 17, 2008; 36(1): 263 - 283.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
R. P. Chowdhury, S. Gupta, and D. Chatterji
Identification and Characterization of the dps Promoter of Mycobacterium smegmatis: Promoter Recognition by Stress-Specific Extracytoplasmic Function Sigma Factors {sigma}H and {sigma}F
J. Bacteriol., December 15, 2007; 189(24): 8973 - 8981.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
A. M. Hosey, J. J. Gorski, M. M. Murray, J. E. Quinn, W. Y. Chung, G. E. Stewart, C. R. James, S. M. Farragher, J. M. Mulligan, A. N. Scott, et al.
Molecular Basis for Estrogen Receptor {alpha} Deficiency in BRCA1-Linked Breast Cancer
J Natl Cancer Inst, November 21, 2007; 99(22): 1683 - 1694.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
D. Tantin, C. Schild-Poulter, V. Wang, R. J.G. Hache, and P. A. Sharp
The Octamer Binding Transcription Factor Oct-1 Is a Stress Sensor
Cancer Res., December 1, 2005; 65(23): 10750 - 10758.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
T. Tong, J. Ji, S. Jin, X. Li, W. Fan, Y. Song, M. Wang, Z. Liu, M. Wu, and Q. Zhan
Gadd45a Expression Induces Bim Dissociation from the Cytoskeleton and Translocation to Mitochondria
Mol. Cell. Biol., June 1, 2005; 25(11): 4488 - 4500.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Gao, S. Jin, Y. Song, M. Fu, M. Wang, Z. Liu, M. Wu, and Q. Zhan
B23 Regulates GADD45a Nuclear Translocation and Contributes to GADD45a-induced Cell Cycle G2-M Arrest
J. Biol. Chem., March 25, 2005; 280(12): 10988 - 10996.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
J. Murtagh, E. McArdle, E. Gilligan, L. Thornton, F. Furlong, and F. Martin
Organization of mammary epithelial cells into 3D acinar structures requires glucocorticoid and JNK signaling
J. Cell Biol., July 5, 2004; 166(1): 133 - 143.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z. Feng, L. Kachnic, J. Zhang, S. N. Powell, and F. Xia
DNA Damage Induces p53-dependent BRCA1 Nuclear Export
J. Biol. Chem., July 2, 2004; 279(27): 28574 - 28584.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
W. Tan, L. Zheng, W.-H. Lee, and T. G. Boyer
Functional Dissection of Transcription Factor ZBRK1 Reveals Zinc Fingers with Dual Roles in DNA-binding and BRCA1-dependent Transcriptional Repression
J. Biol. Chem., February 20, 2004; 279(8): 6576 - 6587.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
V. E. H. Wang, T. Schmidt, J. Chen, P. A. Sharp, and D. Tantin
Embryonic Lethality, Decreased Erythropoiesis, and Defective Octamer-Dependent Promoter Activation in Oct-1-Deficient Mice
Mol. Cell. Biol., February 1, 2004; 24(3): 1022 - 1032.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. A. Krum, G. A. Miranda, C. Lin, and T. F. Lane
BRCA1 Associates with Processive RNA Polymerase II
J. Biol. Chem., December 26, 2003; 278(52): 52012 - 52020.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
D. Bruemmer, F. Yin, J. Liu, J. P. Berger, T. Sakai, F. Blaschke, E. Fleck, A. J. Van Herle, B. M. Forman, and R. E. Law
Regulation of the Growth Arrest and DNA Damage-Inducible Gene 45 (GADD45) by Peroxisome Proliferator-Activated Receptor {gamma} in Vascular Smooth Muscle Cells
Circ. Res., August 22, 2003; 93 (4): e38 - e47.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
H. K. Chung, Y.-W. Yi, N.-C. Jung, D. Kim, J. M. Suh, H. Kim, K. C. Park, D. W. Kim, E. S. Hwang, J. H. Song, et al.
Gadd45{gamma} Expression Is Reduced in Anaplastic Thyroid Cancer and Its Reexpression Results in Apoptosis
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3913 - 3920.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
K. J. Auborn, S. Fan, E. M. Rosen, L. Goodwin, A. Chandraskaren, D. E. Williams, D. Chen, and T. H. Carter
Indole-3-Carbinol Is a Negative Regulator of Estrogen
J. Nutr., July 1, 2003; 133(7): 2470S - 2475.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. R. Seo, M. R. Kelley, and M. L. Smith
From the Cover: Selenomethionine regulation of p53 by a ref1-dependent redox mechanism
PNAS, October 29, 2002; 99(22): 14548 - 14553.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/10/8061    most recent
M110225200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fan, W.
Right arrow Articles by Zhan, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fan, W.
Right arrow Articles by Zhan, Q.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement