HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 10, 8716-8723, March 8, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/10/8716    most recent M110271200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Marini, F. Articles by Wood, R. D. Search for Related Content PubMed PubMed Citation Articles by Marini, F. Articles by Wood, R. D. Social Bookmarking                      What's this?

A Human DNA Helicase Homologous to the DNA Cross-link Sensitivity Protein Mus308^*

Federica Marini and Richard D. Wood

From the University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania 15261

Received for publication, October 25, 2001, and in revised form, December 14, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Repair of DNA interstrand cross-links is a challenging problem for cells. Many human gene products influence sensitivity to DNA cross-linking agents, but the mechanisms of cross-link repair are unknown. In Drosophila melanogaster, the mus308 mutation leads to marked sensitivity to DNA cross-linking agents. The C-terminal portion of the Mus308 polypeptide encodes a DNA polymerase, whereas a putative DNA helicase is encoded by the N-terminal portion. As a step toward isolating proteins involved in DNA cross-link repair, we searched for mammalian genes similar to the DNA helicase portion of Mus308. Human and mouse homologs were isolated from cDNA expression libraries and designated HEL308. Human HEL308 is on chromosome 4q21 and encodes a polypeptide of 1101 amino acids. The protein was expressed in insect cells and purified. HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase. Mutation of a highly conserved lysine to methionine in helicase domain I eliminated both activities. The protein readily displaces 20- to 40-mer duplex oligonucleotides. Displacement of longer substrates was less efficient but was stimulated by the single-stranded DNA-binding protein RPA. Activity was supported by ATP or dATP but not other nucleotide triphosphates. The enzyme translocates on DNA with 3' to 5' polarity and behaves as a multimer upon gel filtration.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

DNA interstrand cross-linking agents such as nitrogen mustards, mitomycin C, and psoralen are widely used in cancer chemotherapy because of their high cytotoxicity to dividing cells (1). A single unrepaired interstrand cross-link (ICL)¹ can kill a bacterial or yeast cell, and about 40 unrepaired ICLs can kill a mammalian cell (2, 3). Moreover, DNA ICLs induce mutations and chromosomal rearrangements. The most extensive studies of cross-link repair have been carried out in Escherichia coli, in which the major interstrand cross-link repair pathway is well characterized, both genetically and biochemically. ICL repair in eukaryotes is less well understood, and there may be several pathways (4). In E. coli and in Saccharomyces cerevisiae, the repair of ICLs depends on both nucleotide excision repair and homologous recombination (5-7). In mammals, mutant cell lines sensitive to cross-linking agents have been useful to identify proteins that might be involved in ICL repair. XPF and ERCC1 mutant cell lines, in addition to being defective in nucleotide excision repair, are particularly sensitive to cross-linking agents (8), suggesting that these proteins play a special role in ICL repair. Similarly, mutations in the XRCC2 and XRCC3 genes, encoding proteins with sequence homology to the human RAD51 protein, confer sensitivity to cross-linking agents (9). Fanconi anemia cell lines are also particularly susceptible to such agents. Thus far, eight Fanconi anemia complementation groups have been defined, and six genes have been mapped and cloned, FANCA, FANCC, FANCD2, FANCE, FANCF, and FANCG (1). Studying Fanconi anemia will likely be of great value in understanding human ICL repair mechanisms, but the function of the FANC proteins is still unclear.

In Drosophila melanogaster, mutations in the mus308 gene lead to marked sensitivity to cross-linking agents. Experiments suggested that some incision event takes place in mus308 mutants, but full repair does not take place (10). The C-terminal portion of the Mus308 protein encodes a DNA polymerase, whereas the N-terminal portion encodes the seven characteristic motifs found in DNA and RNA helicases (11). Sharief et al. (12) cloned a human cDNA for POLQ, encoding a polypeptide homologous to the Mus308 polymerase domain but with no corresponding helicase region. A longer cDNA sequence for human POLQ, deposited with the NCBI data base by Abbas and Linn (NCBI accession number NM_006596, predicts a presumably full-length protein with the polymerase domain in the C-terminal portion and a helicase domain at the N terminus, similar to D. melanogaster Mus308.

In many DNA repair pathways, the function of DNA helicases is essential. In particular, UvrD helicase is needed to repair ICLs in E. coli (13). Moreover, defects in DNA helicases are the causes of several human diseases. BLM and WRN, the products of the Bloom and Werner syndrome genes, are members of the RecQ family of DNA helicases (14, 15). Although their most critical roles in cells are not precisely known, they participate in pathways of DNA damage tolerance. Another member of the RecQ family of helicases, RECQ4, has been implicated in a subset of cases of Rothmund-Thompson syndrome (16). XPD and XPB helicases, two of the subunits of TFIIH transcription/repair factor, are involved in nucleotide excision repair (17), and mutations in their genes can lead to the disorders xeroderma pigmentosum and trichothiodystrophy.

With the aim of isolating new proteins implicated in DNA cross-link repair, we sought mammalian homologs of the putative helicase portion of D. melanogaster Mus308. We report identification of new human and mouse genes and the biochemical activity of the human gene product.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning of Human and Mouse HEL308-- Human and mouse HEL308 genes were cloned by 3' and 5' rapid amplification of cDNA ends using a CLONTECH SMART RACE cDNA Amplification kit. Primers were designed from human expressed sequence tags AA625285, H08004, and R24580 in order to clone the full human HEL308 coding region. cDNA was prepared from the testis cancer cell line 833K and the bladder cancer cell line MGH-U1 (18) according to the manufacturer's instructions (CLONTECH). Two fragments of 1767 bp (3' RACE) and 2167 bp (5' RACE) were combined to obtain the entire HEL308 coding region. The mutant HEL308^K365M gene was generated with the QuikChange site-directed mutagenesis kit (Stratagene); the single AAA to ATG (lysine to methionine) substitution was confirmed by sequencing. Primers were designed from mouse expressed sequence tag AA517170 to clone mouse Hel308 by RACE PCR from mouse leukemia L1210 cells RNA (19) and mouse total liver RNA (Ambion Inc.) using a CLONTECH SMART RACE cDNA Amplification kit.

Purification of Human HEL308-- The human HEL308 open reading frame was subcloned into plasmid pFastBac HTb, and the Bac-to-Bac baculovirus expression system (Invitrogen) was used to obtain recombinant baculovirus to infect Sf9 cells. A 500-ml spinner flask of Sf9 cells (1 × 10⁶/ml) was infected with the His6-HEL308 baculovirus (multiplicity of infection of 2) for 48 h at 27 °C. Cells were lysed in 20 ml of Buffer A (0.15 M Tris, pH 8.0, 0.15 M KCl, 1 mM phenylmethylsulfonyl fluoride, 10% glycerol, 0.5% Nonidet P-40, EDTA-free protease inhibitor mixture from Roche Diagnostics) for 30 min on ice. Insoluble material was removed by centrifugation (22,000 × g for 15 min). KCl was added to raise the salt concentration to 0.3 M. The extract (12.2 mg/ml) was incubated overnight at 4 °C with 5 ml of Ni²⁺-nitrilotriacetate superflow resin (Qiagen). The resin was washed with 5 column volumes of Buffer A plus 20 mM imidazole, and the protein was eluted with 20 ml (4 column volumes) of 100 mM imidazole. After reducing the salt concentration to 0.1 M with 10% (v/v) glycerol, the eluate was loaded onto a Mono Q column, HR 5/5 (AKTA design system, Amersham Biosciences, Inc.) equilibrated with Buffer C (20 mM Hepes-KOH, pH 8.0, 1 mM EDTA, 10% glycerol, 1 mM dithiothreitol, 0.01% Nonidet P-40) containing 0.1 M KCl. The column was washed with 1 column volume of equilibration buffer, and HEL308 protein was eluted with a 20-column volume linear gradient from 0.1 to 0.5 M KCl in Buffer C. HEL308 presence in the eluted fractions was detected by ATPase and helicase activities and by immunoblotting. Active fractions eluting from 0.275 to 0.425 M KCl were pooled, dialysed into Buffer C containing 0.1 M KCl, and loaded onto a Mono S column, HR 5/5 (AKTA design system, Amersham Biosciences, Inc.) equilibrated with Buffer C containing 0.1 M KCl. The column was washed with 1 column volume of equilibration buffer, and HEL308 protein was eluted with a 20-column volume linear gradient from 0.1 to 0.3 M in Buffer C. Active fractions eluting from 0.125 to 0.20 M KCl were pooled and dialysed into Buffer C containing 0.1 M KCl. Protein concentration was determined with the Coomassie Plus Protein Assay Reagent Kit (Pierce).

For analysis by gel filtration, 200 µl of fraction number 28 from the Mono Q elution (~0.3 M KCl) was loaded onto a Superose TM 6 HR 10/30 column (AKTA design system, Amersham Biosciences, Inc.) equilibrated in Buffer C without Nonidet P-40 and containing 0.5 M KCl. Protein was eluted with 1.5 column volumes of the same buffer at a flow rate of 0.5 ml/min, and 0.5-ml fractions were analyzed by immunoblotting, ATPase, and helicase assays. A calibration curve was prepared by measuring the elution volumes of molecular weight standards using a Gel Filtration Calibration Kit (Amersham Biosciences, Inc.).

ATPase Assay-- Standard reaction mixtures (10 µl) contained: 50 mM KCl, 20 mM Tris-HCl, pH 7.5, 4 mM MgCl₂, 1 mM dithiothreitol, 50 µg/ml bovine serum albumin, 0.1 mM cold ATP, 0.25 µCi [-³²P]ATP (specific activity > 5000 Ci/mmol), 1.4 nM HEL308 or 1.4 nM HEL308^K365M protein. Incubations were for 60 min at 30 °C. Reactions were terminated by the addition of 5 µl of 0.5 M EDTA. Released phosphate was separated from ATP by thin-layer chromatography on polyethyleneimine cellulose using 0.75 M KH₂PO₄ as the running buffer. Hydrolysis was quantified with the use of a Fuji phosphorimaging device.

DNA Helicase Assay-- Partially double-stranded DNA substrates were generated by annealing oligonucleotides to M13mp18 viral DNA (New England Biolabs). Sequences of the oligonucleotides used were as follows: 20-mer, 5'-GGTCGACTCTAGAGGATCCC; 24-mer, CGCCAGGGTTTTCCCAGTCACGAC; 40-mer, GCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCG; 40-mer + 3'-tail, same sequence as 40-mer plus a non-complementary stretch of (A)₁₀ at its 3'-end; 40-mer + 5'-tail, same sequence as 40-mer plus a non-complementary stretch of (A)₁₀ at its 5'-end; 60-mer, AGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGTAA; 70-mer, TGTAAAACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGC. The gel-purified oligonucleotides were 5'-end-labeled using T4 polynucleotide kinase and [-³²P]ATP and annealed to M13mp18 viral DNA. For determination of polarity, 60- and 70-mer oligonucleotides were annealed to M13mp18, and the duplex portion was cut with SalI and labeled with DNA polymerase I (Klenow fragment), 15 µM cold dTTP, and 20 µCi [-³²P]dCTP. Labeled substrates were separated from labeled oligonucleotides with MobiSpin Sephacryl S-400 columns (MoBiTec). Unless otherwise specified, standard reaction mixtures contained 50 mM KCl, 20 mM Tris-HCl, pH 7.5, 4 mM MgCl₂, 1 mM dithiothreitol, 50 µg/ml bovine serum albumin, 2 mM ATP, and ~6 fmol of substrate in a 20-µl volume. Human RPA was produced as a recombinant protein in E. coli, purified according to the method of Henricksen et al. (20), and included where indicated. Incubation was for 30 min at 37 °C. Reactions were terminated by the addition of 6 µl of gel loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol, 30% glycerol, and 0.17 M EDTA). DNA species were separated by electrophoresis through non-denaturing 10% polyacrylamide gels that were dried and analyzed by autoradiography or quan- tified with a Fuji phosphorimaging device.

Accession Numbers-- The GenBank^TM accession number of D. melanogaster mus308 is L76559. The human POLQ NCBI accession number is NM_006596. The mus1 homolog from Caenorhabditis elegans spans cosmids U50184 and U00066 (GenBank^TM/EBI accession numbers). The Arabidopsis thaliana homolog is on cosmid AL022537 (GenBank^TM/EBI accession number).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation of the Human and Mouse HEL308 Genes-- With the aim of isolating proteins involved in DNA cross-link repair, we searched data bases with the DNA helicase portion of Drosophila mus308. We found three human expressed sequence tags, AA625285, H08004, and R24580 (NCBI accession numbers), homologous to motif VI of the D. melanogaster mus308 helicase domain. From this ~700-bp sequence, primers were designed to clone the whole gene by 3' and 5' rapid amplification of cDNA ends (CLONTECH SMART RACE cDNA Amplification kit). Total RNA was prepared from a testis cancer cell line (833K) and a bladder cancer cell line (MGH-U1). Two different amplification reactions were performed for each cell line, and in both cases, two fragments of 1767 and 2167 bp were amplified through 3' RACE and 5' RACE, respectively. Six different PCR products (three from the 3' RACE and three from the 5' RACE) were sequenced to exclude mistakes obtained by PCR amplification. Finally, the complete open reading frame (3303 bp) was constructed by subcloning the 5'- and 3'-fragments into NcoI and KpnI sites of plasmid pFastBac HTb. To reflect the helicase activity described below and the high homology to mus308, we designated the previously unannotated gene as HEL308.

The human HEL308 gene maps on chromosome 4q21 and encodes for a protein of 1101 amino acids with a predicted molecular size of 124.5 kDa. We also found a mouse expressed sequence tag (NCBI accession number AA517170) that allowed us to clone mouse Hel308 by 3' and 5' rapid amplification of cDNA ends. Mouse Hel308 maps on chromosome 5-E in a region that is syntenic to human 4q21.

Human and mouse proteins share 88.6% identity and 93.5% similarity in the region shown in Fig. 1, and they belong to the "superfamily II" of DNA and RNA helicases. We aligned human and mouse HEL308 to D. melanogaster Mus308, C. elegans MUS-1 (3), human POLQ, and the A. thaliana homolog that we found in the data base (Fig. 1). These proteins share ~50% similarity, and they fall into the group of helicases designated by Harris et al. (11) as the MUS308 subfamily. Over the helicase domain region, Drosophila Mus308 has 40% identity (55% similarity) with HEL308 and 50% identity (66% similarity) with human POLQ. Human POLQ and human HEL308 share 40% identity (55% similarity) over the same region. No other human sequences were found approaching these high levels of homology to the Drosophila Mus308 helicase domain.

View larger version (109K): [in this window] [in a new window]   Fig. 1.   Sequence alignment of human and mouse HEL308 with A. thaliana MUS308, human POLQ, D. melanogaster Mus308, and C. elegans MUS-1 and with human WRN and BLM DNA helicases and E. coli Dead RNA helicase. Roman numerals indicate regions conserved in DNA and RNA helicases, and the bars mark their approximate extent. The arrow indicates the lysine that was mutated to methionine in mutant HEL308K365M. Positions with six or more identical residues are shaded. The asterisks denote residues that are conserved in the MUS308 subfamily of helicases but not in other known or putative helicases. The sequence alignment was carried out using the Clustal X program.

Purification of the Human HEL308 Protein-- The HEL308 open reading frame was cloned into plasmid pFastBac HTb, linked to a hexahistidine tag at the N-terminal end. We also generated a cDNA expression construct encoding a tagged version of HEL308 with a single amino acid substitution at position 365. This conserved lysine residue is in the putative Walker A nucleotide binding motif and was changed to a methionine residue using site-directed mutagenesis. The resulting protein is referred to as HEL308^K365M. For a number of ATPases, including E. coli UvrD and S. cerevisiae Rad3, mutation of the equivalent lysine residue severely impairs nucleotide triphosphate hydrolysis, although the overall structure of the protein seems to remain intact (21-23).

For protein production, both cDNAs were placed under the transcriptional control of the polyhedrin promoter in recombinant baculoviruses. These viruses were used to transfect Sf9 cells. The proteins HEL308 and HEL308^K365M were detected in cell extracts by immunoblotting (data not shown). The extract was fractionated over a Ni²⁺-nitrilotriacetate superflow resin (Qiagen), a Mono Q column, and a Mono S column, and samples of the HEL308-containing fractions were analyzed by electrophoresis through an SDS-polyacrylamide gel (Fig. 2). A sample of the final purification step of the HEL308^K365M protein, which was produced and purified in exactly the same manner as the wild type protein, is shown in Fig. 2, lane 5.

View larger version (71K): [in this window] [in a new window]   Fig. 2.   Purification of human HEL308 protein. A silver-stained SDS-polyacrylamide gel containing samples taken at different stages of the HEL308 purification is shown. A protein extract from Sf9 cells infected with a baculovirus expressing human HEL308 was fractionated sequentially over Ni2+-nitrilotriacetate (Ni-NTA) superflow resin (lane 2), Mono Q (lane 3), and Mono S (lane 4) columns. The HELK365M protein was purified by the same method, and a sample of the final preparation is shown in lane 5. Lanes 2-5 contain ~0.34 µg of protein. M, broad range molecular weight markers (Bio-Rad Laboratories).

ATPase and Helicase Activity of Human HEL308-- To characterize human HEL308, helicase and ATPase assays were performed on fractions along the Mono Q column gradient. Human HEL308 co-fractionated with a helicase activity and an ATPase activity (Fig. 3), though protein eluting after the peak fraction may be in a less active form. The helicase assay tested the ability to displace a 24-nt oligonucleotide from M13mp18 viral DNA (Fig. 3B). In the ATPase assay, released radiolabeled phosphate was separated from non-hydrolyzed ATP by thin layer chromatography, and the extent of hydrolysis was quantified (Fig. 3C). This ATPase activity was dependent upon the addition of single-stranded DNA to the reaction mixture, as found for other related enzymes (24).

View larger version (66K): [in this window] [in a new window]   Fig. 3.   ATPase and DNA helicase activities of HEL308. Recombinant HEL308 was fractionated on a Mono Q column. A, immunoblot using His Tag Monoclonal Antibody (Novagen). B, DNA helicase assay using a 24-nt oligomer annealed to M13 viral DNA as a substrate. Oligonucleotide was labeled with 32P at the 5'-end before annealing to the viral DNA. DNA substrate (~6 fmol) was incubated with 5 µl from different fractions along the Mono Q gradient in the presence of ATP for 30 min at 37 °C. Products were separated by electrophoresis through a non-denaturing polyacrylamide gel and visualized by autoradiography. The positions of the substrate and the radiolabeled reaction products are indicated to the left of the autoradiogram. The asterisk denotes the position of the 32P label. First lane, substrate incubated in the helicase buffer in the absence of any protein fraction. Lane B, boiled substrate. C, ATPase assay in the presence (+ ssDNA) or absence ( ssDNA) of 100 ng of M13mp18 single-stranded DNA.

Human HEL308 was further purified through a Mono S column. HEL308 ATPase activity was strongly stimulated by single-stranded DNA but not by double-stranded plasmid DNA (Fig. 4A). Unwinding of the 40-bp partial duplex substrate catalyzed by HEL308 required a nucleotide cofactor (Fig. 4B), as expected. Substituting 4 mM Mn²⁺ instead of Mg²⁺ gave barely detectable helicase activity (Fig. 4B, lane 1). A non-hydrolyzable ATP analog, AMP-PNP, could not support the helicase activity (Fig. 4B, lane 2). To determine whether nucleotide hydrolysis was needed for helicase activity, increasing amounts of AMP-PNP or ATPS were added to reaction mixtures that contained 2 mM ATP (Fig. 4C). AMP-PNP at 10 mM and ATPS at 2 mM were competitive inhibitors of helicase action, indicating that they bind to HEL308 in place of ATP and that nucleotide hydrolysis is necessary for activity. The result also suggests that ATPS has a higher affinity for HEL308 nucleotide binding sites than AMP-PNP. Drosophila RecQ5 helicase activity is similarly inhibited by an equimolar ratio of ATPS to ATP but not by an equimolar ratio of AMP-PNP to ATP (25). Interestingly, 2-4 mM AMP-PNP stimulated unwinding activity by about 2-fold in the presence of 2 mM ATP. This may suggest cooperative binding to an enzyme that has both catalytic and noncatalytic nucleotide binding sites, as found for the hexameric T7 gene 4 and E. coli Rho helicases (26, 27). T7 gene 4 helicase prefers dTTP as a nucleotide cofactor, and the non-hydrolyzable nucleotide analog dTMP-PCP can bind to a noncatalytic site with little effect on dTTPase turnover (27).

View larger version (27K): [in this window] [in a new window]   Fig. 4.   Nucleotide and DNA cofactors for HEL308 activity. A, ATPase assay. 0.1 mM ATP and 0.25 µCi of [-32P]ATP were incubated with 1.4 nM HEL308 (lanes 2-4) in the presence of 100 ng of M13 single-stranded DNA (ssDNA, lane 3) or 100 ng of pGEM-3Z double-stranded DNA (dsDNA, lane 4). Reactions were for 60 min at 30 °C. Released phosphate was separated from ATP by thin-layer chromatography on polyethyleneimine cellulose. B, helicase reaction mixtures contained the 40-bp partial duplex substrate, 1.4 nM HEL308, 50 mM KCl, 4 mM MgCl2, and 2 mM of the indicated nucleotides in a 20-µl volume. Incubation was for 30 min at 37 °C. In the first lane, MgCl2 was omitted, and 4 mM MnCl2 used instead. The nucleotide cofactor was ATP. Radioactivity was quantified with the use of a Fuji phosphorimaging device, and the percentage of displaced radioactivity is shown under each lane of the autoradiogram. C, helicase reaction mixtures contained the 40-bp partial duplex substrate, 1.4 nM HEL308, 50 mM KCl, 4 mM MgCl2, 2 mM ATP, and the indicated amount of either AMP-PNP or ATPS in a 20-µl volume. In the lanes where AMP-PNP and ATPS were added, additional MgCl2 was also added at equimolar concentration. In the first two lanes, no protein was added. Lane B, boiled substrate.

To determine the nucleotide preference of HEL308, eight nucleotides were tested for their ability to support unwinding of the 40-bp partial duplex substrate. At the 2 mM nucleotide concentration used, only ATP and dATP gave detectable activity with 76% displacement in the presence of dATP and 33% displacement with ATP (Fig. 4B). ATP was used in further experiments since the ATP concentration in the cell is higher than the dATP concentration.

Unwinding of Longer DNA Duplexes by HEL308-- To determine whether HEL308 can unwind longer DNA duplexes, similar DNA substrates were constructed containing 60- or 70-nt fragments annealed to M13mp18. DNA helicase assays were performed with each DNA substrate in the presence of increasing amounts of HEL308 (Fig. 5). The mutant HEL308^K365M could displace none of the substrates (Fig. 5, lanes 3, A-F) and had no ATPase activity (not shown), confirming that these catalytic activities are due to wild type HEL308 enzyme. The HEL308 helicase displaced both the 60- and the 70-nt fragments, although with much less efficiency than the 20- and 40-nt fragments. After 30 min, 1.4 nM HEL308 displaced 89, 32, 2.6, and 2.5% of the 20-, 40-, 60-, and 70-nt oligonucleotides, respectively.

View larger version (29K): [in this window] [in a new window]   Fig. 5.   Unwinding reactions on different DNA substrates catalyzed by HEL308. The unwinding activity of HEL308 DNA helicase was evaluated with six different substrates and increasing amounts of the protein HEL308 (A-F). A schematic diagram of the structure of each substrate is shown on the left of each autoradiogram. In the first two lanes, no protein was added. Lane B, boiled substrate. In the third lane, K365M mutant protein was added at a concentration of 2.8 nM. Remaining lanes, increasing amounts of purified HEL308 (in nM). G, plot of fragment displacement (%). Each point is the mean value of three different experiments. H, displacement of the 20-nt fragment from M13mp18 viral DNA at different times with 0.14 nM HEL308. In the first two lanes, no protein was added. Lane B, boiled substrate.

Substrates with 3'- or 5'-unpaired flaps were also tested. A non-complementary stretch of (A)₁₀ was added either 5' or 3' of the 40-nt fragment (Fig. 5, C and D). In neither case was unwinding activity changed, as compared with the displacement of the 40-nt fragment (Fig. 5G). We followed the unwinding reaction of the 20-bp partial duplex substrate at different time points using 0.14 nM HEL308 (Fig. 5H). After 10 min, 20% of the substrate was unwound with 50% unwinding reached after 18 min. The percentage of unwound substrate increased further with time.

Single-stranded DNA-binding Protein RPA Stimulates the HEL308 Helicase-- One possible reason for the fact that the HEL308 helicase is less efficient in unwinding DNA duplexes of increasing length might be that the displaced single strand tends to re-anneal. If this is the case, the activity of HEL308 might be stimulated by single-stranded DNA-binding proteins. To test this possibility, the helicase activity was measured in the presence of purified human RPA (Fig. 6). In reactions containing the annealed 70-nt fragment and 2.8 nM HEL308, RPA stimulated HEL308 helicase activity with maximal stimulation at ~2 nM RPA. At this concentration, RPA increased displacement of the 70-nt fragment by 2.6-fold. 7.5 nM RPA did not stimulate HEL308 helicase activity (Fig. 6, lane 8), and concentrations of RPA equal or higher than 15 nM inhibited its activity (data not shown). These results suggest that RPA stimulates HEL308 by binding to the unwound regions produced by HEL308 helicase activity and inhibiting re-annealing. Given a binding site of about 30 nt for human RPA (28), 15 nM RPA covers approximately 25% of the M13 single-stranded DNA annealed to the 70-nt fragment. This concentration of RPA may more likely inhibit HEL308 translocation on DNA rather than its binding to DNA. The order of addition of RPA and HEL308 did not affect these results (data not shown).

View larger version (70K): [in this window] [in a new window]   Fig. 6.   RPA Stimulates displacement of the 70-nt fragment. Displacement of the 5'-end-labeled 70-nt fragment annealed to M13mp18 single-stranded DNA was examined in the presence of increasing amounts of human RPA. Reaction mixtures contained ~6 fmol of DNA substrate. In the first two lanes, no protein was added. Lane B, boiled substrate. Remaining lanes, 2.8 nM purified HEL308 was added together with increasing amounts of RPA.

The HEL308 Helicase Acts in the 3' to 5' Direction-- To determine the polarity of the HEL308 helicase ,the 60-nt oligonucleotide was annealed to M13mp18 DNA, cut with SalI, and labeled at the 3'-ends with ³²P. This produced linear M13mp18 DNA with a 20-nt fragment annealed to its 5'-end and a 44-nt fragment annealed to its 3'-end. HEL308 displaced only the 20-nt fragment, indicating translocation in the 3' to 5' direction (Fig. 7A). Because HEL308 helicase activity decreases as a function of the size of the annealed oligonucleotide that it has to displace, a second DNA substrate was prepared. In this case, 42- and 32-nt fragments were annealed at the 5'- and 3'-end of linear M13mp18 DNA, respectively. HEL308 helicase activity displaced only the 42-nt fragment (Fig. 7B). These results confirm that the polarity of the HEL308 helicase is 3' to 5' relative to the single-stranded region.

View larger version (32K): [in this window] [in a new window]   Fig. 7.   Unwinding of DNA duplexes flanking a single-stranded region. The DNA substrate was an ~7100-nt-long single-stranded region flanked by labeled duplexes as shown on the right of each autoradiogram. Lane B, boiled substrate; , no protein added; +, 2.8 nM HEL308. In panel B, first lane, the band intermediate between the 32- and 42-nt fragments is derived from limited extension of the 32-mer with DNA polymerase. Pol I, DNA polymerase I.

Gel Filtration Analysis of Human HEL308-- The oligomeric structure of a DNA helicase is an important parameter that may have implications for its mechanism of action (29). The native molecular weight of human HEL308 was estimated from gel filtration analysis. Fraction 28 of the Mono Q column was loaded onto a Superose column equilibrated in buffer that included 0.5 M KCl. Proteins were eluted, and fractions were analyzed. Immunoblotting, ATPase, and helicase activities all co-eluted at a position corresponding to a molecular size of ~600 kDa as determined from standards (Fig. 8). This would be consistent with a possible hexameric association given the predicted molecular size of 124 kDa for a HEL308 monomer. Under the same gel filtration conditions, the mutant HEL308^K365M protein eluted at the same position as wild type HEL308 as determined by immunoblotting (not shown). This suggests that the point mutation K365M in the Walker A motif does not alter the quaternary structure of the protein.

View larger version (29K): [in this window] [in a new window]   Fig. 8.   Gel filtration analysis of native HEL308. Fractionation of human HEL308 on a Superose column. A, immunoblot using His Tag Monoclonal Antibody (Novagen). Lane L contained 10 µl of fraction number 28 from the Mono Q elution (~0.3 M KCl) that was loaded onto the Superose column; the remaining lanes contained 10 µl of the indicated fractions. Gel filtration standards (Amersham Biosciences, Inc.) were as follows: thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), and albumin (67 kDa). B, displacement of a 20-nt fragment from M13mp18 single-stranded DNA by 10 µl of the indicated fractions. C, plot of protein concentration (immunoblot), percentage of displaced 20-nt fragment (helicase assay), and percentage of released phosphate (ATPase assay) for each fraction. Protein concentration on the immunoblot was quantified with the ChemiDoc chemiluminescence detection system (Bio-Rad Laboratories). Displaced radioactivity was quantified with the Fuji phosphorimaging device.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We isolated human and mouse homologs of the helicase domain of D. melanogaster mus308 and designated them HEL308. Drosophila mus308 encodes a DNA polymerase in its C-terminal portion and a DNA helicase in its N-terminal portion (11). We found homologs of Drosophila mus308 in C. elegans and A. thaliana in addition to those in human and mouse, but we could not find any homolog in S. cerevisiae or in other yeast and bacterial species. The presumably full-length cDNA for human POLQ also has a predicted helicase domain at the N terminus, but its activity remains to be demonstrated.

The MUS308 family of helicases is part of the superfamily II of DNA and RNA helicases. Harris et al. (11) identified other sequences in GenBank^TM that have sequence similarity to the helicase domain of Drosophila mus308. Besides the seven characteristic motifs of the superfamily II, these putative helicases include motifs Ib and IVa containing characteristic residues in the MUS308 subfamily. Motif I (the Walker A box) is unusual in having a serine in place of the glycine found in almost all Walker A motifs of known or putative helicases (Fig. 1, asterisk). Other residues, shown with an asterisk in Fig. 1, are peculiar to the MUS308 family of helicases: in motif V, the threonine is usually a hydrophobic residue in other members of superfamily II; in motif VI, the methionine is on the contrary usually a charged residue. Moreover, the MUS308 subfamily seems to combine motifs from various families. Motif II is characteristic of the so-called DEXH family of helicases, which includes many "repair/recombination" helicases, such as Rad3, Rad54, WRN, and BLM, whereas motif IV has characteristics of the DEAD family of RNA helicases.

HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase. It translocates on DNA with 3' to 5' polarity and efficiently displaces 20- to 40-mer duplex oligonucleotides. Although activity on longer substrates is lower, it can be stimulated by the single-stranded DNA-binding protein RPA. Other helicases have been shown to be stimulated by single-stranded DNA-binding proteins. For example, S. cerevisiae MER3 helicase efficiently unwinds a 631-nt fragment only in the presence of RPA (30). Substrates with 3'- or 5'-unpaired flaps do not stimulate HEL308 activity, whereas many helicases, such as E. coli DnaB, phage T4 gene 41 protein, and phage T7 gene 4 protein, require a forked DNA substrate to initiate DNA unwinding in vitro (29). WRN helicase displaces a 40-nt oligonucleotide much more efficiently when two unpaired 10-mers are added to the 40-mer at its 3'- and 5'-ends (31). Both BLM and WRN prefer a fork DNA substrate to unwind DNA (32). Gel filtration analysis suggests that HEL308 behaves as a multimer, possibly a hexamer. A few DNA helicases studied to date operate as monomers, such as PcrA (33) and T4 Dda helicase (34). Many more helicases are active as oligomers, often as hexamers (T7 gene 4, T4 gp41, E. coli DnaB, and BLM) or dimers (E. coli Rep helicase) (29, 35). Studies by electron microscopy will reveal whether HEL308 forms multimeric structures.

Drosophila mus308 is believed to be involved in the repair of interstrand DNA cross-linking damage since mus308 mutants are hypersensitive to DNA cross-linking agents such as photoactivated psoralen, diepoxybutane, and nitrogen mustard but are not sensitive to the monofunctional alkylating agent methyl methanesulfonate (11). Not much is known about how interstrand cross-links are repaired in eukaryotes. Biochemical and genetic analyses in prokaryotes indicate that DNA interstrand cross-links are repaired by an excision-recombination mechanism (36, 37). In E. coli, removal of a DNA interstrand cross-link is initiated by the UvrABC endonuclease complex, which incises one strand on each side of the cross-link. The 5' nuclease activity of DNA polymerase I, in concert with the UvrD helicase, generates a gap at the site of incision. The resulting single-stranded region provides a substrate for binding of RecA protein and for the initiation of homologous pairing and strand exchange. The polymerase activity of DNA polymerase I can then carry out repair synthesis with an undamaged homolog as a template. Some aspects of this mechanism of interstrand cross-link repair may be conserved in eukaryotes. Genetic data suggest that both excision and recombination are involved in the repair of interstrand cross-links in eukaryotes as well. Mus308 and POLQ belong to the A family of DNA polymerases, as does E. coli DNA polymerase I. Both UvrD and HEL308 are 3' to 5' multimeric DNA helicases. This direction of translocation along DNA would fit a model where coupling between a helicase and a polymerase coordinates duplex unwinding and polymerization. Gene 4 of bacteriophage T7 encodes a protein (gp4) that has both a helicase and an RNA primase domain. gp4 forms hexameric rings that can translocate along single-stranded DNA, coupling the unwinding of duplex DNA with the synthesis of short RNA primers that are elongated by T7 DNA polymerase (38). It will be interesting to analyze whether HEL308 interacts with a polymerase and forms a complex with an activity similar to T7 gp4. The existence of both HEL308 and the very similar putative helicase of POLQ raises further questions concerning the functions of these enzymes. It is possible that they function in DNA repair processes in different tissues.

Fanconi anemia cell lines are sensitive to interstrand cross-linking agents. Thus far, eight Fanconi anemia complementation groups have been defined, and six genes have been mapped and cloned (1). We are currently investigating the possibility that HEL308 might be one of the two remaining uncloned genes, FANCB and FANCD1.

	ACKNOWLEDGEMENTS

We thank Dr. G. Sebastiaan Winkler for assistance and our laboratory colleagues for discussions.

	FOOTNOTES

^* This work was supported by postdoctoral fellowships from the European Molecular Biology and from Telethon (to F. M.), by the Imperial Cancer Research Fund, and by the University of Pittsburgh Cancer Institute.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) AF436845 and AF436846.

To whom correspondence should be addressed: S867 Scaife Hall, 3550 Terrace St., Pittsburgh, PA 15261. Tel: 412-648-9248; Fax: 412-383-9822; E-mail: rdwood@pitt.edu.

Published, JBC Papers in Press, December 18, 2001, DOI 10.1074/jbc.M110271200

	ABBREVIATIONS

The abbreviations used are: ICL, interstrand cross-link; RACE, rapid amplification of cDNA ends; AMP-PNP, adenylyl-imidodiphosphate tetralithium salt; ATPS, adenosine-5'-O-(3-thiotriphosphate); nt, nucleotides; dTMP-PCP, ,-methylene deoxythymidine triphosphate.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. D. Richards, K. A. Johnson, H. Liu, A.-M. McRobbie, S. McMahon, M. Oke, L. Carter, J. H. Naismith, and M. F. White Structure of the DNA Repair Helicase Hel308 Reveals DNA Binding and Autoinhibitory Domains J. Biol. Chem., February 22, 2008; 283(8): 5118 - 5126. [Abstract] [Full Text] [PDF]

				R. McCaffrey, D. St Johnston, and A. Gonzalez-Reyes Drosophila mus301/spindle-C Encodes a Helicase With an Essential Role in Double-Strand DNA Break Repair and Meiotic Progression Genetics, November 1, 2006; 174(3): 1273 - 1285. [Abstract] [Full Text] [PDF]

				C. P. Guy and E. L. Bolt Archaeal Hel308 helicase targets replication forks in vivo and in vitro and unwinds lagging strands Nucleic Acids Res., June 30, 2005; 33(11): 3678 - 3690. [Abstract] [Full Text] [PDF]

				R. Fujikane, K. Komori, H. Shinagawa, and Y. Ishino Identification of a Novel Helicase Activity Unwinding Branched DNAs from the Hyperthermophilic Archaeon, Pyrococcus furiosus J. Biol. Chem., April 1, 2005; 280(13): 12351 - 12358. [Abstract] [Full Text] [PDF]

				N. Shima, R. J. Munroe, and J. C. Schimenti The Mouse Genomic Instability Mutation chaos1 Is an Allele of Polq That Exhibits Genetic Interaction with Atm Mol. Cell. Biol., December 1, 2004; 24(23): 10381 - 10389. [Abstract] [Full Text] [PDF]

				A. Laurencon, C. M. Orme, H. K. Peters, C. L. Boulton, E. K. Vladar, S. A. Langley, E. P. Bakis, D. T. Harris, N. J. Harris, S. M. Wayson, et al. A Large-Scale Screen for Mutagen-Sensitive Loci in Drosophila Genetics, May 1, 2004; 167(1): 217 - 231. [Abstract] [Full Text] [PDF]

				S. Cantor, R. Drapkin, F. Zhang, Y. Lin, J. Han, S. Pamidi, and D. M. Livingston The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations PNAS, February 24, 2004; 101(8): 2357 - 2362. [Abstract] [Full Text] [PDF]

				M. Seki, F. Marini, and R. D. Wood POLQ (Pol {theta}), a DNA polymerase and DNA-dependent ATPase in human cells Nucleic Acids Res., November 1, 2003; 31(21): 6117 - 6126. [Abstract] [Full Text] [PDF]

				F. Marini, N. Kim, A. Schuffert, and R. D. Wood POLN, a Nuclear PolA Family DNA Polymerase Homologous to the DNA Cross-link Sensitivity Protein Mus308 J. Biol. Chem., August 22, 2003; 278(34): 32014 - 32019. [Abstract] [Full Text] [PDF]

				N. Shima, S. A. Hartford, T. Duffy, L. A. Wilson, K. J. Schimenti, and J. C. Schimenti Phenotype-Based Identification of Mouse Chromosome Instability Mutants Genetics, March 1, 2003; 163(3): 1031 - 1040. [Abstract] [Full Text] [PDF]

This Article