|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 12, 10021-10027, March 22, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Merck Research Laboratories,
Rahway, New Jersey 07065
Received for publication, August 27, 2001, and in revised form, January 10, 2002
The LXR nuclear receptors are intracellular
sensors of cholesterol excess and are activated by various oxysterols.
LXRs have been shown to regulate multiple genes of lipid metabolism,
including ABCA1 (formerly known as
ABC1). ABCA1 is a lipid pump that effluxes cholesterol and
phospholipid out of cells. ABCA1 deficiency causes extremely low high
density lipoprotein (HDL) levels, demonstrating the importance of ABCA1
in the formation of HDL. The present work shows that the
acetyl-podocarpic dimer (APD) is a potent, selective agonist for both
LXR A key step in HDL1
metabolism has recently been uncovered through identification of the
genetic defect responsible for Tangier disease (1-5). Patients with
Tangier disease have extremely low HDL, premature coronary heart
disease, and accumulation of cholesterol in macrophages (6). This
condition derives from the inability to transfer cholesterol and
phospholipid to apoA-I (7, 8). The apoA-I that is not lipidated is then
rapidly degraded and does not serve in reverse cholesterol transport.
The defective gene was identified as ABCA1, a homologue of
multidrug resistance proteins (1-4). In normal cells, ABCA1
is transcriptionally controlled and rises upon cholesterol loading (9),
thus allowing macrophages (and other cells) to rid themselves of excess
cholesterol. ABCA1 appears to play a key role in controlling
cholesterol efflux from tissues and HDL levels because of its
sensitivity to intracellular cholesterol levels (9), the ability of
ABCA1 overexpression to enhance cholesterol efflux (10), and emerging
data associating low HDL levels in CHD patients to genetic variants of
ABCA1 (11). Thus, elevation of ABCA1 is predicted to drive
the exit of cholesterol from cells such as macrophages in
atherosclerotic lesions and to elevate plasma HDL levels.
ABCA1 expression increases in cells upon cholesterol loading
(9), and this is dependent on the nuclear receptors LXR Materials--
Human LDL was isolated and acetylated as
previously described (17). Pure human apoA-I was obtained from
Biodesign International (Saco, ME) and desalted on PD-10 columns
(Amersham Biosciences, Inc.) prior to its use in cholesterol efflux
assays. Acetyl-podocarpic dimer (APD; Fig. 1) was synthesized at Merck.
Cells--
All cells were cultured at 37 °C in a humidified
atmosphere consisting of 95% air and 5% carbon dioxide. Primary human
fibroblasts were obtained from the Camden human cell repository. The
cells were grown, handled, and cholesterol-loaded exactly as described by Francis et al. (8). Human primary hepatocytes were
received from In Vitro Technologies (Baltimore, MD) in
six-well dishes and maintained in phenol red-free Dulbecco's modified
Eagle's medium (high glucose) containing 10% charcoal-stripped FCS
(Gemini Bio-Products, Inc., Calabasas, CA), 1% nonessential amino
acids, 1% glutamine, 100 units/ml penicillin G, and 100 µg/ml
streptomycin sulfate. Caco-2 cells were obtained from ATCC and grown in
Opti-MEM (catalog no. 51985-034; Invitrogen) containing 10%
FCS, nonessential amino acids (catalog no. 11140-050; Invitrogen), and
vitamins (catalog no. 11120-052; Invitrogen). THP-1 cells were obtained from ATCC and were grown in RPMI medium (catalog no. R8005; Sigma) containing 10% FCS, 0.05 µM 2-mercaptoethanol, 1 mM sodium pyruvate, 2 mM
L-glutamine, and antibiotic-antimyotic solution (Sigma
catalog no. A9909; 100 units/ml penicillin, 0.1 µg/ml streptomycin,
0.25 µg/ml amphotericin B). THP-1 cells were differentiated into
macrophages in six-well tissue culture dishes at a density of 1 million
cells/well by incubation in the same medium plus 100 nM
tetradecanoyl phorbol acetate for 3 days. After differentiation into
macrophages, cells were used for mRNA measurements or for
cholesterol efflux assays as described below. Human primary monocytes
were prepared as described (18) and differentiated to macrophages by
culturing for 7 days in Teflon jars in RPMI 1640 medium supplemented
with 12% human serum, 100 units/ml penicillin, and 100 µg/ml
streptomycin sulfate) (19). They were then plated in the same medium to
initiate experiments.
Assays of Cholesterol Efflux Using
[3H]Cholesterol--
Cells were labeled by incubation
for 24 h in fresh growth medium containing
[3H]cholesterol (10 µCi/ml). In some experiments, cells
were simultaneously labeled with [3H]cholesterol and
cholesterol-loaded using acetylated LDL (20) (concentrations and times
are reported). Following labeling with [3H]cholesterol,
cells were washed and incubated an additional 24 h in serum-free
media containing 1 mg/ml bovine serum albumin to allow for
equilibration of [3H]cholesterol with intracellular
cholesterol. Cholesterol efflux was initiated by adding the indicated
amount of apoA-I, usually 10 µg/ml, with or without APD, in
serum-free medium. APD was added to cell culture medium from
Me2SO solutions, and control cells received an equivalent
amount of Me2SO, never exceeding 0.1%. After 24 h,
media were harvested, and cells were dissolved in 1 mM
HEPES, pH 7.5 containing 0.5% Triton X-100. Media were briefly centrifuged to remove nonadherent cells, and then aliquots of both the
supernatants and the dissolved cells were subjected to liquid
scintillation spectrometry to determine radioactivity. Cholesterol
efflux is expressed as a percentage, calculated as ([3H]cholesterol in medium/([3H]cholesterol
in medium + [3H]cholesterol in cells)) × 100.
Assays of Cholesterol Efflux Using Gas Chromatography-Mass
Spectrometry--
Cells were handled as described above, except that
[3H]cholesterol was omitted. At the end of the 24-h
efflux assay, cells and media were extracted. Cells were extracted
twice (10 min with shaking each time) with 1 ml of hexane/isopropyl
alcohol/water (3:2:0.1, v/v/v)/5 cm2 of cell surface area.
Media were extracted with 2.5 volumes of chloroform/methanol (2:1,
v/v). Internal standard
([26,27-2H6]cholesterol, Medical Isotopes,
Inc., Concord, NH) was added to the extracts, and the samples were
taken to dryness under a stream of argon. Half of the cellular lipid
extract was saponified for 1 h at 60 °C in a solution of 3%
(weight) KOH in 90% ethanol. One volume of water was added, and
the mixture was extracted with 2 volumes of hexane. The extracts of
media and cellular lipids with or without saponification were taken to
dryness under argon, derivatized to trimethylsilyl ethers by treatment
with Sigma Sil-A for 1 h at 60 °C, redissolved in hexane, and
analyzed by gas chromatography/mass spectrometry. The amount of
cholesterol in the original sample was determined using a standard curve.
Gas Chromatography/Mass Spectrometry--
Gas
chromatography/mass spectrometry was performed using a ThermoQuest GCQ
instrument equipped with an RTX-5MS column (30 m × 0.25 mm inner
diameter, 0.25-µm phase thickness; Restek Corp., Bellefonte, PA). The
gas chromatography program was 180 °C for 1 min, followed by a
temperature gradient of 20 °C/min to 290 °C and a final elution
at 290 °C for 20 min. The injector was operated in the split mode
(1:10 split), and the temperature was kept at 275 °C. Helium was
used as the carrier gas at a constant flow rate of 1 ml/min. The
instrument was operated in the electron ionization mode with the
electron energy set to 70 eV. The ion trap was used for the selected
ion monitoring of m/z 458 and 464 for
determination of cholesterol and
[26,27-2H6]cholesterol, respectively.
Transactivation Assays--
Expression constructs were prepared
by inserting the ligand binding domain of human LXR Measurement of mRNA Levels by Real Time Quantitative Reverse
Transcription-PCR (TaqMan)--
Real time quantitative PCR analysis
(21) was used to determine the relative levels of ABCA1 and
ABCG1 mRNA. Reverse transcription and PCRs were
performed according to the manufacturer's instructions (Applied
Biosystems; TaqMan Gold reverse transcription-PCR protocol and TaqMan
Universal PCR Master Mix). Sequence-specific amplification was detected
with an increasing fluorescent signal of FAM (reporter dye) during the
amplification cycle. Amplification of the mRNA for the human 23-kDa
highly basic protein, also called ribosomal protein L13a, was performed
in the same reaction on all samples tested as an internal control for
variations in RNA amounts. Levels of the different mRNAs were
subsequently normalized to highly basic protein mRNA levels.
Oligonucleotide primers and TaqMan probes were designed using Primer
Express software (Applied Biosystems) and were synthesized by Applied
Biosystems. Sequences of forward primers, reverse primers, and
probes (respectively) were as follows: ABCA1,
TGTCCAGTCCAGTAATGGTTCTGT, AAGCGAGATATGGTCCGGATT,
6FAM-ACACCTGGAGAGAAGCTTTCAACGAGACTAACC-TAMRA; ABCG1, TGCAATCTTGTGCCATATTTGA, CCAGCCGACTGTTCTGATCA,
6FAM-TACCACAACCCAGCAGATTTTGTCATGGA-TAMRA; SREBP-1c,
GGTAGGGCCAACGGCCT, CTGTCTTGGTTGTTGATAAGCTGAA,
6FAM-ATCGCGGAGCCATGGATTGCACT-TAMRA; HBP,
GCTGGAAGTACCAGGCAGTGA, ACCGGTAGTGGATCTTGGCTTT,
VIC-TCTTTCCTCTTCTCCTCCAGGGTGGCT-TAMRA.
APD Is a Potent and Selective Ligand for LXR APD Activates LXR APD Induced ABCA1 mRNA--
It has recently been reported that
LXR controls the expression of the ABCA1 gene (12-15). We
incubated cultured THP-1 cells with APD and measured ABCA1
mRNA levels by real time quantitative reverse transcription-PCR.
The data in Fig. 4 show that APD was ~1000 times more potent than
22-(R)-hydroxycholesterol.
Induction of ABCA1 mRNA by APD was not limited to THP-1
cells. Table I shows the induction of
ABCA1 mRNA by APD in human primary hepatocytes and
Caco-2 cells. The data in Table I also show that APD induced the
ABCG1 gene (formerly ABC8 or human
white), which was recently reported to be regulated
by LXR (24).
APD Was More Effective than Cholesterol Loading for Increasing
ABCA1 mRNA Levels--
Cholesterol-loading has been reported to
increase ABCA1 mRNA levels in macrophages. It is likely
that cholesterol loading increases ABCA1 mRNA levels by
promoting the formation of endogenous LXR ligands, presumably
oxysterols. To determine the relative potency of endogenous ligands
versus APD for the stimulation of ABCA1 mRNA
levels, we incubated primary human monocyte-macrophages with acetylated
LDL and/or APD. Following these treatments, we measured cellular
content of cholesterol and mRNA levels for ABCA1 and
ABCG1. As shown in Table II,
acetylated LDL approximately doubled cellular cholesterol content and
increased mRNA levels for ABCA1 by 2-fold and
ABCG1 by 5-fold. APD increased mRNA levels for both
ABCA1 and ABCG1 dramatically and to a greater
extent than did cholesterol loading. Furthermore, the addition of APD together with acetylated LDL led to greater mRNA induction than acetylated LDL alone. These data show that the APD is a more potent LXR
agonist than the agonist(s) endogenously produced upon cholesterol loading.
APD Increased Cholesterol Efflux from Cultured Cells--
ABCA1 is
believed to function as a lipid pump, transferring cellular cholesterol
to apoA-I. To determine if APD increased cholesterol efflux, THP-1
cells were labeled with [3H]cholesterol and then
incubated with various concentrations of APD in the presence or absence
of 10 µg/ml apoA-I. The data in Fig. 5
show that APD increased cholesterol efflux, consistent with the
mRNA data in Fig. 4. Two lines of evidence support the conclusion
that APD stimulates cholesterol efflux by induction of ABCA1
expression through LXR and eliminate the possibility that APD increased
[3H]cholesterol in the medium by causing nonspecific cell
lysis or deterioration. First, the stimulation of
[3H]cholesterol efflux was dependent upon the presence of
apoA-I, which is known to be required for the action of ABCA1. Second, in the experiment shown in Fig. 5, parallel wells were labeled with
[3H]leucine rather than [3H]cholesterol but
otherwise handled exactly the same. APD had no effect on the apparent
"efflux" of 3H-protein into the medium (data not
shown), indicating that APD did not cause cellular lysis.
The ability of APD to increase cholesterol efflux was not limited to
THP-1 cells. Fig. 6 shows that APD
increased cholesterol efflux from human primary monocyte-macrophages
and Caco-2 cells. In multiple cell types and in multiple experiments,
the apparent EC50 value for stimulation of cholesterol
efflux was ~1 nM APD. This potency matches well with the
potency of APD in transactivation assays using LXR-Gal4 fusion
constructs.
APD Stimulated Cholesterol Efflux from Cholesterol-loaded Primary
Human Fibroblasts--
The data shown above indicate that APD
increased cholesterol efflux onto apoA-I from cells with a normal
cholesterol status. Cholesterol loading of fibroblasts increases
cholesterol efflux onto apoA-I, and this activity is absent in
fibroblasts from patients with Tangier disease that lack ABCA1 (7, 8).
To determine whether APD could stimulate cholesterol efflux in
cholesterol-loaded cells, primary human fibroblasts were loaded with
cholesterol, and then efflux assays were performed essentially as
described by Francis et al. (8). Under these conditions, APD
stimulated cholesterol efflux with an EC50 of ~1
nM (Fig. 7). The stimulation of cholesterol efflux by APD was completely dependent upon the presence
of apoA-I, consistent with catalysis by ABCA1.
APD Stimulated Phospholipid Efflux--
Fibroblasts from patients
with Tangier disease display a defect in phospholipid efflux as well as
cholesterol efflux. To determine whether APD increased efflux of both
classes of lipids, THP-1 cells were cholesterol-loaded and
double-labeled with [3H]cholesterol and
[3H]choline. The cells were then treated with APD, and
the efflux of lipid onto apoA-I was measured. The data in Table
III show that APD increased efflux of
cholesterol, phosphatidylcholine, and sphingomyelin. We obtained
similar results using human primary monocyte-macrophages. These data
indicate that APD stimulates typical ABCA1 action, leading to efflux of
both phospholipid and cholesterol (8, 10, 25).
APD Was More Effective than Cholesterol Loading for Stimulation of
Cellular Cholesterol Efflux--
The data shown above demonstrate that
APD increased efflux of [3H]cholesterol from multiple
cell types. Although many investigators have used
[3H]cholesterol labeling to measure cellular cholesterol
efflux, it has been shown that cellular cholesterol pools do not always label uniformly (26-28). To demonstrate that APD authentically increases efflux of endogenous cholesterol, we quantitated cholesterol efflux from human primary monocyte-macrophages by measuring the mass of
cholesterol in the cells and the medium. Human primary monocyte-macrophages were incubated with 1 µM APD or
Me2SO for 24 h in the presence of 10 µg/ml apoA-I.
Some of the cells had previously been cholesterol-loaded using
acetylated LDL. The data in Fig. 8 show
that APD stimulated efflux of endogenous cholesterol from the
macrophages, whether or not the cells had been cholesterol-loaded. APD
increased cholesterol mass in the medium, which can be viewed as the
product of the enzymatic reaction catalyzed by ABCA1. The percentage of
cellular cholesterol effluxed also increased with APD. It is
particularly noteworthy that APD was capable of stimulating cholesterol
efflux from cholesterol-loaded cells. This shows that APD is more
effective than cholesterol loading at increasing cellular cholesterol
efflux. This is consistent with the mRNA data shown in Table
II.
Comparison of APD with Exogenous Oxysterols on
Macrophages--
The data above indicate that APD is more effective at
stimulating LXR-driven responses than is cholesterol loading. We have recently shown that 27-hydroxycholesterol, the enzymatic product of the
enzyme encoded by the cyp27 gene, is an endogenous LXR ligand in cholesterol-loaded human cells (23). We directly compared APD
to exogenous 27-hydroxycholesterol and other oxysterols for the ability
to increase mRNA levels of LXR target genes and stimulate cholesterol efflux. As shown in Fig. 9,
APD was significantly more effective than exogenous
27-hydroxycholesterol for induction of ABCA1 and stimulation
of cholesterol efflux. The widely used LXR agonist
22-(R)-hydroxycholesterol was more effective than 27-hydroxycholesterol but less effective than APD. It is known that
27-hydroxycholesterol is efficiently secreted from cells (29), but
there is no information on secretion of
22-(R)-hydroxycholesterol. If the latter oxysterol is not
efficiently secreted, then it may accumulate intracellularly and
therefore be more effective than 27-hydroxycholesterol.
The most striking difference between APD and the exogenous oxysterols
was the much greater induction of expression of the LXR target genes
ABCG1 and SREBP-1c by APD (Fig. 9). This dramatic difference may have been caused by one of the pleiotropic effects of
oxysterols, specifically their ability to block the maturation of SREBP
proteins (reviewed by Schroepfer (30)). LXR activation by APD
would be expected to stimulate transcription of the SREBP-1c gene (31-33), leading to increased levels of active, mature SREBP-1c, which can feed forward and stimulate more transcription of the gene
(34). Oxysterols, on the other hand, can block maturation of SREBP-1c,
thus preventing this feed forward amplification.
Cholesterol-loaded macrophage foam cells are a hallmark of
atherosclerotic lesions (35). Although advanced human atherosclerotic lesions contain other cell types, it has been suggested that the lipid-rich portion of the lesion is most prone to rupture and cause
myocardial infarction (36). Therefore, novel therapeutic agents that
increase lipid removal from lesions might improve the outcome for
patients with coronary artery disease.
Cells that are cholesterol-loaded in cell culture can unload excess
cholesterol onto HDL or free apoA-I. Fibroblasts from patients with
Tangier disease are unable to unload cholesterol normally (7, 8). The
gene defective in Tangier disease was recently identified as
ABCA1, a member of the ATP-binding cassette superfamily of
genes (1-4). This superfamily includes many genes known to be pumps,
and it is believed that ABCA1 is a cholesterol and/or
phospholipid pump. Mutations in ABCA1 decrease HDL levels and increase the risk of coronary artery disease (6, 11). Taken
together, these data strongly suggest that ABCA1 participates in the
removal of excess cholesterol from atherosclerotic lesions.
Expression of the ABCA1 gene is increased by cholesterol
loading of cultured cells (9). This control is believed to be mediated
by LXR nuclear receptors (12-15). LXR In the present work, we have shown that APD is a potent and specific
activator of LXR. APD was effective at 1-10 nM in four different assays of LXR function: transactivation assays using LXR-Gal4
fusion constructs, ligand-dependent recruitment of
co-activator in a cell-free assay, induction of endogenous
ABCA1 mRNA, and stimulation of cholesterol efflux. Our
data are fully consistent with the previous reports that LXR regulates
ABCA1 gene expression (12-15). The present work adds to
this field of research in the four following ways. 1) Previous reports
that LXR ligands stimulate cholesterol efflux have used oxysterols as
the LXR agonists (14, 15). This requires micromolar levels of
oxysterol, which might cause changes in the physical properties of the
plasma membrane of the cells (39), especially because these
concentrations probably exceed their authentic water solubility.
Furthermore, 7-keto-cholesterol has been reported to decrease
cholesterol efflux (40). High concentrations of oxysterols may act
pleiotropically, and therefore some of the effects of oxysterols on
cholesterol efflux may not be related to LXR function (39). In
contrast, we show that APD induces ABCA1 mRNA levels and
increases cholesterol efflux at 1-10 nM, comparable with
the concentrations required for activation of LXR in transient
transfection assays. 2) The potent and selective LXR agonist T0901317
has been shown to induce expression of ABCA1 and other
LXR-responsive genes (13, 31, 32); however, an increase in cellular
cholesterol efflux in response to T0901317 was not demonstrated. Our
data indicate that the potent and selective LXR agonist APD increases
cholesterol efflux from multiple cell types. 3) Most published assays
of cholesterol efflux rely on labeling with exogenous
[3H]cholesterol to trace endogenous cellular cholesterol.
It has, however, been shown that exogenous
[3H]cholesterol does not uniformly label all cellular
cholesterol pools (26-28). We therefore used gas chromatography/mass
spectrometry to prove that APD increases efflux of endogenous cellular
cholesterol. 4) Finally, we show that APD can stimulate
ABCA1 gene expression and cholesterol efflux to a greater
extent than does cholesterol loading. This novel observation is
important because the target cells for LXR activation in human disease
are the cholesterol-loaded cells in atherosclerotic lesions. If
cholesterol loading caused a maximal increase in ABCA1
expression, then exogenous synthetic agonists might not be able to
alter the course of disease. Our data indicate the opposite, in that
synthetic LXR agonists may represent novel therapeutic agents for
coronary artery disease.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, January 14, 2002, DOI 10.1074/jbc.M108225200
The abbreviations used are:
HDL, high density
lipoprotein;
LDL, low density lipoprotein;
FCS, fetal calf serum;
APD, acetyl-podocarpic dimer.
A Potent Synthetic LXR Agonist Is More Effective than
Cholesterol Loading at Inducing ABCA1 mRNA and
Stimulating Cholesterol Efflux*
,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(NR1H3) and LXR
(NR1H2). In transient transactivation assays,
APD was ~1000-fold more potent, and yielded ~6-fold greater maximal
stimulation, than the widely used LXR agonist
22-(R)-hydroxycholesterol. APD induced ABCA1
mRNA levels, and increased efflux of both cholesterol and
phospholipid, from multiple cell types. Gas chromatography-mass spectrometry measurements demonstrated that APD stimulated efflux of
endogenous cholesterol, eliminating any possible artifacts of
cholesterol labeling. For both mRNA induction and stimulation of
cholesterol efflux, APD was found to be more effective than was
cholesterol loading. Taken together, these data show that APD is a more
effective LXR agonist than endogenous oxysterols. LXR agonists may
therefore be useful for the prevention and treatment of
atherosclerosis, especially in the context of low HDL levels.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(NR1H3) and/or LXR (NR1H2) (12-15). Cellular cholesterol loading presumably leads to the production of endogenous oxysterol ligand(s) for LXR. Both
LXR subtypes are activated by oxysterols (16). Taken together, these
data suggest that small molecule agonists of LXR might be
therapeutically useful for enhancing the removal of cholesterol from
peripheral tissues and increasing circulating HDL levels, leading to a
reduction in atherosclerosis. In the present work, we describe a
potent, specific agonist of LXR that induces ABCA1 and
increases cholesterol efflux to a greater extent than does cholesterol loading.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and
LXR cDNAs adjacent to the yeast GAL4 transcription factor DNA
binding domain in the mammalian expression vector pcDNA3 to create
pcDNA3-LXR/GAL4 and pcDNA3-LXR/GAL4, respectively. The
GAL4-responsive reporter construct, pUAS(5×)-tk-luciferase, contained
five copies of the GAL4 response element placed adjacent to the
thymidine kinase minimal promoter and the luciferase reporter gene. The
transfection control vector, pEGFP-N1, contained the green fluorescence
protein gene under the regulation of the cytomegalovirus promoter. For transient transfections, HEK-293 cells were seeded at
4 × 104 cells/well in 96-well plates in Dulbecco's
modified Eagle's medium (high glucose) containing 10% FCS, 100 units/ml penicillin G, and 100 µg/ml streptomycin sulfate at 37 °C
in a humidified atmosphere of 5% CO2. After 24 h,
transfections were performed with LipofectAMINE (Invitrogen) according
to the instructions of the manufacturer. Transfection mixes contained
0.002 µg of LXR/GAL4 or LXR/GAL4 chimeric expression vectors,
0.02 µg of reporter vector pUAS(5×)-tk-luc, and 0.034 µg of
pEGFP-N1 vector as an internal control of transfection efficiency.
Compounds were characterized by incubation with transfected cells for
48 h across a range of concentrations in phenol red-free Dulbecco's modified Eagle's medium (high glucose) containing 10% charcoal-stripped FCS (Gemini Bio-Products, Inc., Calabasas, CA), 1%
nonessential amino acids, 1% glutamine, and 100 units/ml penicillin G
and 100 µg/ml streptomycin sulfate. Cell lysates were prepared from
washed cells using cell lysis buffer (Promega Corp., Madison WI)
according to the manufacturer's directions. Luciferase activity in
cell extracts was determined using luciferase assay buffer (Promega) in
a ML3000 luminometer (Dynatech Laboratories). Green fluorescence
protein expression was determined using the Tecan Spectrofluor
Plus at an excitation wavelength of 485 nm and emission at 535 nm.
Luciferase activity was normalized to green fluorescence protein
expression to account for any variation in efficiency of transfection.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and
LXR--
APD was identified as an LXR agonist during random
screening of the Merck chemical collection. The structure of APD is
shown in Fig. 1. APD was tested in
transactivation assays of both LXR and LXR and compared with
22-(R)-hydroxycholesterol, which is an LXR agonist that has
been widely used in cell culture assays (16). As shown in Fig.
2, APD was ~1000-fold more potent than 22-(R)-hydroxycholesterol. Furthermore, the maximal
stimulation achieved with APD was at least 6-fold higher than for
22-(R)-hydroxycholesterol. APD was found to be inactive in
similar transactivation assays for the nuclear receptors PPAR,
PPAR
, PPAR
, and RXR (data not shown).
View larger version (8K):
[in a new window]
Fig. 1.
Chemical structure of APD.
View larger version (21K):
[in a new window]
Fig. 2.
APD is active on both LXR and LXR in
transactivation assays. Transactivation assays were performed
using chimeric receptors as described under "Experimental
Procedures." Data shown are mean and S.E. for a total of six wells
over two independent experiments. Squares, APD;
circles, 22-(R)-hydroxycholesterol; open
symbols, LXR; closed symbols, LXR.
Inset, expanded vertical scale for data obtained using
22-(R)-hydroxycholesterol as agonist.
and LXR in a Cell-free Assay--
To
determine whether APD interacts directly with LXR and LXR, we
used a cell-free assay of receptor activation that we have previously
described (22, 23). This assay uses homogeneous time-resolved
fluorescence to measure ligand-dependent interaction of LXR
with steroid receptor co-activator-1 (SRC-1). As shown in Fig.
3, the presence of APD causes LXR to
interact with SRC-1. APD is much more potent than
22-(R)-hydroxycholesterol in this assay and also yields a
greater extent of activation, consistent with the results from the
transactivation assay shown in Fig. 2. APD was found to be inactive in
similar assays of co-activator association for the nuclear receptors
FXR, ER, and ER (data not shown).
View larger version (18K):
[in a new window]
Fig. 3.
APD is a functional agonist for both
LXR and LXR in
cell-free assays of co-activator association. Co-activator (SRC-1)
association assays were performed as previously described (23). Data
shown are normalized such that the maximal activation of each receptor
by 22-(R)-hydroxycholesterol is set to 100%. The results
are representative of three independent experiments.
Squares, APD; circles,
22-(R)-hydroxycholesterol; open symbols, LXR;
closed symbols, LXR.
View larger version (13K):
[in a new window]
Fig. 4.
APD increased ABCA1 mRNA
levels in THP-1 macrophages. THP-1 macrophages were incubated with
various concentrations of APD or 22-(R)-hydroxycholesterol
for 24 h, and then the levels of ABCA1 mRNA were
measured as described under "Experimental Procedures." Data are the
means of duplicate wells, and the error bars
indicate the range of duplicates. In some cases, the error bars fall
within the symbols.
APD induced mRNA for ABCA1 and ABCG1 in human primary hepatocytes
and Caco-2 cells
APD increased ABCA1 mRNA levels to a greater extent than did
cholesterol loading
View larger version (15K):
[in a new window]
Fig. 5.
APD increased cholesterol efflux from THP-1
macrophages. Standard cholesterol efflux assays were performed on
THP-1 macrophages as described under "Experimental Procedures." The
efflux incubations contained the indicated amounts of APD, in the
presence (open circles) or absence (filled
squares) of 10 µg/ml of apoA-I. The values given are mean and
S.E. of quadruplicate wells. These results are representative of three
independent experiments with THP-1 macrophages.
View larger version (14K):
[in a new window]
Fig. 6.
APD stimulated cholesterol efflux from
multiple cell types. Caco-2 cells were plated at 100,000 cells/well in 48-well plates. After 4 days, the cells had reached
confluence and were then labeled with [3H]cholesterol.
Human primary monocyte/macrophages were isolated as described under
"Experimental Procedures" and then plated at 250,000 cells/well in
48-well plates, allowed to adhere overnight, and then washed and
labeled with [3H]cholesterol. Following labeling, cells
were subjected to standard cholesterol efflux assays in the presence of
10 µg/ml apoA-I as described under "Experimental Procedures."
Values given are mean and S.E. of quadruplicate wells. The results
shown are representative of multiple experiments for both cell types.
In some cases, the error bars fall within the symbols.
Filled squares, Caco-2 cells; open circles,
primary monocyte/macrophages.
View larger version (13K):
[in a new window]
Fig. 7.
APD stimulated cholesterol efflux from
cholesterol-loaded primary human fibroblasts. Primary human
fibroblasts were grown, loaded with cholesterol, and labeled with
[3H]cholesterol exactly as described by Francis et
al. (8). Following the labeling, cells were incubated with the
indicated concentrations of APD in the presence (squares) or
absence (triangles) of 10 µg/ml apoA-I. After 24 h,
radioactivity in the medium and in the cells was measured. Data given
are mean and S.E. of quadruplicate wells. In some cases, the error bars
fall within the symbols.
APD stimulated the efflux of cholesterol and phospholipids to
similar extents
View larger version (23K):
[in a new window]
Fig. 8.
APD increased cholesterol efflux from
cholesterol-loaded human primary monocyte-derived macrophages.
Macrophages (1 million cells/well in 12-well plates) were incubated
with 1 µM APD, or Me2SO (DMSO) as
control, for 24 h in the presence of 10 µg/ml apoA-I. Some of
the cells had previously been cholesterol-loaded by incubation with 200 µg/ml acetylated LDL for 48 h, which increased total cellular
cholesterol (micrograms of cholesterol/milligrams of cell protein) from
35 ± 2 to 151 ± 11 (p < 0.0001) and
increased the percentage of cholesteryl ester from 18 ± 3 to
77 ± 2 (p < 0.0001). After cholesterol loading,
cells were incubated for 18 h in serum-free medium containing 2 mg/ml bovine serum albumin, followed by the standard efflux incubation.
After 24 h of efflux, cells and media were assayed for cholesterol
content by gas chromatography/mass spectrometry. A, mass of
cholesterol effluxed into media; B, efflux expressed as a
percentage of total cholesterol in media plus cells. Filled
bars, APD-treated cells; open bars, control
(Me2SO-treated) cells. The data, expressed as mean and S.E.
of triplicate wells, are representative of three independent
experiments. *, p < 0.05 for APD versus
Me2SO. **, p < 0.007 for APD
versus Me2SO. #, p < 0.0001 for cholesterol-loaded versus normal cells.
View larger version (26K):
[in a new window]
Fig. 9.
Stimulation of LXR responses by APD or
exogenous oxysterols in primary human monocyte-derived
macrophages. A, macrophages were incubated with 1 µM APD or 5 µM oxysterol for 24 h in
serum-containing medium. After 24 h, cells were harvested, and
mRNA levels were measured as described under "Experimental
Procedures." Results shown are mean and S.E. of triplicate
incubations. B, macrophages were subjected to the standard
cholesterol efflux assay in the presence or absence of 1 µM APD or a 5 µM concentration of various
oxysterols. The graph shows the percentage of total
cholesterol effluxed during the 24-h incubation with 10 µg/ml apoA-I.
Results shown are mean and S.E. of quadruplicate incubations.
22-OH, 22-(R)- hydroxycholesterol;
25-OH, 25-hydroxycholesterol; 27-OH, 27- hydroxycholesterol.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and LXR are two very
similar nuclear receptors, both of which are activated by various
oxysterols (16). LXR has been shown to be necessary for the normal
response of mice to cholesterol feeding (37). It is likely that
cholesterol loading causes production of regulatory oxysterols that
activate LXR and thereby turn on genes necessary for removal of excess
cholesterol. We have recently shown that 27-hydroxycholesterol is the
major oxysterol that activates LXR in cholesterol-loaded human cells
(23). Other members of the ABC superfamily of genes have also been
reported to be controlled by cholesterol loading (38) or by LXR
(24).
FOOTNOTES
To whom correspondence should be addressed: Merck Research
Laboratories, Bldg. 80W, 126 E. Lincoln Ave., Rahway, NJ 07065. Tel.:
732-594-7570; Fax: 732-594-1169; E-mail: Carl_Sparrow@Merck.com.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Brooks-Wilson, A.,
Marcil, M.,
Clee, S. M.,
Zhang, L. H.,
Roomp, K.,
van Dam, M., Yu, L.,
Brewer, C.,
Collins, J. A.,
Molhuizen, H. O.,
Loubser, O.,
Ouelette, B. F.,
Fichter, K.,
Ashbourne-Excoffon, K. J.,
Sensen, C. W.,
Scherer, S.,
Mott, S.,
Denis, M.,
Martindale, D.,
Frohlich, J.,
Morgan, K.,
Koop, B.,
Pimstone, S.,
Kastelein, J. J.,
Hayden, M. R.,
et al..
(1999)
Nat. Genet.
22,
336-345[CrossRef][Medline]
[Order article via Infotrieve] 2.
Bodzioch, M.,
Orsó, E.,
Klucken, J.,
Langmann, T.,
Bottcher, A.,
Diederich, W.,
Drobnik, W.,
Barlage, S.,
Buchler, C.,
Porsch-Özcürümez, M.,
Kaminski, W. E.,
Hahmann, H. W.,
Oette, K.,
Rothe, G.,
Aslanidis, C.,
Lackner, K. J.,
and Schmitz, G.
(1999)
Nat. Genet.
22,
347-351[CrossRef][Medline]
[Order article via Infotrieve] 3.
Rust, S.,
Rosier, M.,
Funke, H.,
Real, J.,
Amoura, Z.,
Piette, J. C.,
Deleuze, J. F.,
Brewer, H. B.,
Duverger, N.,
Denefle, P.,
and Assmann, G.
(1999)
Nat. Genet.
22,
352-355[CrossRef][Medline]
[Order article via Infotrieve] 4.
Lawn, R. M.,
Wade, D. P.,
Garvin, M. R.,
Wang, X.,
Schwartz, K.,
Porter, J. G.,
Seilhamer, J. J.,
Vaughan, A. M.,
and Oram, J. F.
(1999)
J. Clin. Invest.
104,
R25-31 5.
Brousseau, M. E.,
Schaefer, E. J.,
Dupuis, J.,
Eustace, B.,
Van Eerdewegh, P.,
Goldkamp, A. L.,
Thurston, L. M.,
FitzGerald, M. G.,
Yasek-McKenna, D.,
O'Neill, G.,
Eberhart, G. P.,
Weiffenbach, B.,
Ordovas, J. M.,
Freeman, M. W.,
Brown, R. H., Jr.,
and Gu, J. Z.
(2000)
J. Lipid Res.
41,
433-441 6.
Serfaty-Lacrosniere, C.,
Civeira, F.,
Lanzberg, A.,
Isaia, P.,
Berg, J.,
Janus, E. D.,
Smith, M. P., Jr.,
Pritchard, P. H.,
Frohlich, J.,
Lees, R. S.,
et al..
(1994)
Atherosclerosis
107,
85-98[CrossRef][Medline]
[Order article via Infotrieve] 7.
Walter, M.,
Gerdes, U.,
Seedorf, U.,
and Assmann, G.
(1994)
Biochem. Biophys. Res. Commun.
205,
850-856[CrossRef][Medline]
[Order article via Infotrieve] 8.
Francis, G. A.,
Knopp, R. H.,
and Oram, J. F.
(1995)
J. Clin. Invest.
96,
78-87[Medline]
[Order article via Infotrieve] 9.
Langmann, T.,
Klucken, J.,
Reil, M.,
Liebisch, G.,
Luciani, M. F.,
Chimini, G.,
Kaminski, W. E.,
and Schmitz, G.
(1999)
Biochem. Biophys. Res. Commun.
257,
29-33[CrossRef][Medline]
[Order article via Infotrieve] 10.
Wang, N.,
Silver, D. L.,
Costet, P.,
and Tall, A. R.
(2000)
J. Biol. Chem.
275,
33053-33058 11.
Clee, S. M.,
Kastelein, J. J.,
van Dam, M.,
Marcil, M.,
Roomp, K.,
Zwarts, K. Y.,
Collins, J. A.,
Roelants, R.,
Tamasawa, N.,
Stulc, T.,
Suda, T.,
Ceska, R.,
Boucher, B.,
Rondeau, C.,
DeSouich, C.,
Brooks-Wilson, A.,
Molhuizen, H. O.,
Frohlich, J.,
Genest, J., Jr.,
and Hayden, M. R.
(2000)
J. Clin. Invest.
106,
1263-1270[Medline]
[Order article via Infotrieve] 12.
Costet, P.,
Luo, Y.,
Wang, N.,
and Tall, A. R.
(2000)
J. Biol. Chem.
275,
28240-28245 13.
Repa, J. J.,
Turley, S. D.,
Lobaccaro, J. A.,
Medina, J., Li, L.,
Lustig, K.,
Shan, B.,
Heyman, R. A.,
Dietschy, J. M.,
and Mangelsdorf, D. J.
(2000)
Science
289,
1524-1529 14.
Schwartz, K.,
Lawn, R. M.,
and Wade, D. P.
(2000)
Biochem. Biophys. Res. Commun.
274,
794-802[CrossRef][Medline]
[Order article via Infotrieve] 15.
Venkateswaran, A.,
Laffitte, B. A.,
Joseph, S. B.,
Mak, P. A.,
Wilpitz, D. C.,
Edwards, P. A.,
and Tontonoz, P.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
12097-12102 16.
Repa, J. J.,
and Mangelsdorf, D. J.
(1999)
Curr. Opin. Biotechnol.
10,
557-563[CrossRef][Medline]
[Order article via Infotrieve] 17.
Sparrow, C. P.,
Parthasarathy, S.,
and Steinberg, D.
(1989)
J. Biol. Chem.
264,
2599-2604 18.
Wright, S. D.,
and Silverstein, S. C.
(1982)
J. Exp. Med.
156,
1149-1164 19.
Hailman, E.,
Vasselon, T.,
Kelley, M.,
Busse, L. A., Hu, M. C.,
Lichenstein, H. S.,
Detmers, P. A.,
and Wright, S. D.
(1996)
J. Immunol.
156,
4384-4390[Abstract] 20.
Kritharides, L.,
Christian, A.,
Stoudt, G.,
Morel, D.,
and Rothblat, G. H.
(1998)
Arterioscler. Thromb. Vasc. Biol.
18,
1589-1599 21.
Heid, C. A.,
Stevens, J.,
Livak, K. J.,
and Williams, P. M.
(1996)
Genome Res.
6,
986-994 22.
Zhou, G.,
Cummings, R., Li, Y.,
Mitra, S.,
Wilkinson, H. A.,
Elbrecht, A.,
Hermes, J. D.,
Schaeffer, J. M.,
Smith, R. G.,
and Moller, D. E.
(1998)
Mol. Endocrinol.
12,
1594-1604 23.
Fu, X.,
Menke, J. G.,
Chen, Y.,
Zhou, G.,
MacNaul, K. L.,
Wright, S. D.,
Sparrow, C. P.,
and Lund, E. G.
(2001)
J. Biol. Chem.
276,
38378-38387 24.
Venkateswaran, A.,
Repa, J. J.,
Lobaccaro, J. M.,
Bronson, A.,
Mangelsdorf, D. J.,
and Edwards, P. A.
(2000)
J. Biol. Chem.
275,
14700-14707 25.
Fielding, P. E.,
Nagao, K.,
Hakamata, H.,
Chimini, G.,
and Fielding, C. J.
(2000)
Biochemistry
39,
14113-14120[CrossRef][Medline]
[Order article via Infotrieve] 26.
Ranganathan, S.,
Gasman, J. D.,
Matsuura, H.,
and Kottke, B. A.
(1989)
Biochem. Cell Biol.
67,
719-723[Medline]
[Order article via Infotrieve] 27.
Kritharides, L.,
Jessup, W.,
Mander, E. L.,
and Dean, R. T.
(1995)
Arterioscler. Thromb. Vasc. Biol.
15,
276-289 28.
Mendez, A. J.,
and Uint, L.
(1996)
J. Lipid Res.
37,
2510-2524[Abstract] 29.
Westman, J.,
Kallin, B.,
Bjorkhem, I.,
Nilsson, J.,
and Diczfalusy, U.
(1998)
Arterioscler. Thromb. Vasc. Biol.
18,
554-561 30.
Schroepfer, G. J., Jr.
(2000)
Physiol. Rev.
80,
361-554 31.
Schultz, J. R., Tu, H.,
Luk, A.,
Repa, J. J.,
Medina, J. C., Li, L.,
Schwendner, S.,
Wang, S.,
Thoolen, M.,
Mangelsdorf, D. J.,
Lustig, K. D.,
and Shan, B.
(2000)
Genes Dev.
14,
2831-2838 32.
Repa, J. J.,
Liang, G., Ou, J.,
Bashmakov, Y.,
Lobaccaro, J. M.,
Shimomura, I.,
Shan, B.,
Brown, M. S.,
Goldstein, J. L.,
and Mangelsdorf, D. J.
(2000)
Genes Dev.
14,
2819-2830 33.
DeBose-Boyd, R. A., Ou, J. F.,
Goldstein, J. L.,
and Brown, M. S.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
1477-1482 34.
Amemiya-Kudo, M.,
Shimano, H.,
Yoshikawa, T.,
Yahagi, N.,
Hasty, A. H.,
Okazaki, H.,
Tamura, Y.,
Shionoiri, F.,
Iizuka, Y.,
Ohashi, K.,
Osuga, J.,
Harada, K.,
Gotoda, T.,
Sato, R.,
Kimura, S.,
Ishibashi, S.,
and Yamada, N.
(2000)
J. Biol. Chem.
275,
31078-31085 35.
Gown, A. M.,
Tsukada, T.,
and Ross, R.
(1986)
Am. J. Pathol.
125,
191-207[Abstract] 36.
Ross, R.
(1999)
N. Engl. J. Med.
340,
115-126 37.
Peet, D. J.,
Turley, S. D., Ma, W.,
Janowski, B. A.,
Lobaccaro, J. M.,
Hammer, R. E.,
and Mangelsdorf, D. J.
(1998)
Cell
93,
693-704[CrossRef][Medline]
[Order article via Infotrieve] 38.
Klucken, J.,
Buchler, C.,
Orsó, E.,
Kaminski, W. E.,
Porsch-Özcürümez, M.,
Liebisch, G.,
Kapinsky, M.,
Diederich, W.,
Drobnik, W.,
Dean, M.,
Allikmets, R.,
and Schmitz, G.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
817-822 39.
Kilsdonk, E. P. C.,
Morel, D. W.,
Johnson, W. J.,
and Rothblat, G. H.
(1995)
J. Lipid Res.
36,
505-516[Abstract] 40.
Gelissen, I. C.,
Brown, A. J.,
Mander, E. L.,
Kritharides, L.,
Dean, R. T.,
and Jessup, W.
(1996)
J. Biol. Chem.
271,
17852-17860 41.
Bligh, E. G.,
and Dyer, W. J.
(1959)
Can. J. Biochem. Physiol.
37,
911-917
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Ma, L. Xu, D. Rodriguez-Agudo, X. Li, D. M. Heuman, P. B. Hylemon, W. M. Pandak, and S. Ren 25-Hydroxycholesterol-3-sulfate regulates macrophage lipid metabolism via the LXR/SREBP-1 signaling pathway Am J Physiol Endocrinol Metab, December 1, 2008; 295(6): E1369 - E1379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. P. Torra, N. Ismaili, J. E. Feig, C.-F. Xu, C. Cavasotto, R. Pancratov, I. Rogatsky, T. A. Neubert, E. A. Fisher, and M. J. Garabedian Phosphorylation of Liver X Receptor {alpha} Selectively Regulates Target Gene Expression in Macrophages Mol. Cell. Biol., April 15, 2008; 28(8): 2626 - 2636. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Buono, Y. Li, S. W. Waldo, and H. S. Kruth Liver X receptors inhibit human monocyte-derived macrophage foam cell formation by inhibiting fluid-phase pinocytosis of LDL J. Lipid Res., November 1, 2007; 48(11): 2411 - 2418. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ranalletta, N. Wang, S. Han, L. Yvan-Charvet, C. Welch, and A. R. Tall Decreased Atherosclerosis in Low-Density Lipoprotein Receptor Knockout Mice Transplanted With Abcg1-/- Bone Marrow Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2308 - 2315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Baldan, P. Tarr, C. S. Vales, J. Frank, T. K. Shimotake, S. Hawgood, and P. A. Edwards Deletion of the Transmembrane Transporter ABCG1 Results in Progressive Pulmonary Lipidosis J. Biol. Chem., September 29, 2006; 281(39): 29401 - 29410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Aravindhan, C. L. Webb, M. Jaye, A. Ghosh, R. N. Willette, N. J. DiNardo, and B. M. Jucker Assessing the effects of LXR agonists on cellular cholesterol handling: a stable isotope tracer study J. Lipid Res., June 1, 2006; 47(6): 1250 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Albers, B. Blume, T. Schlueter, M. B. Wright, I. Kober, C. Kremoser, U. Deuschle, and M. Koegl A Novel Principle for Partial Agonism of Liver X Receptor Ligands: COMPETITIVE RECRUITMENT OF ACTIVATORS AND REPRESSORS J. Biol. Chem., February 24, 2006; 281(8): 4920 - 4930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Karten, R. B. Campenot, D. E. Vance, and J. E. Vance Expression of ABCG1, but Not ABCA1, Correlates with Cholesterol Release by Cerebellar Astroglia J. Biol. Chem., February 17, 2006; 281(7): 4049 - 4057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yokoyama Assembly of High-Density Lipoprotein Arterioscler. Thromb. Vasc. Biol., January 1, 2006; 26(1): 20 - 27. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. K. Hovingh, B. A. Hutten, A. G. Holleboom, W. Petersen, P. Rol, A. Stalenhoef, A. H. Zwinderman, E. de Groot, J. J.P. Kastelein MD, and J. A. Kuivenhoven Compromised LCAT Function Is Associated With Increased Atherosclerosis Circulation, August 9, 2005; 112(6): 879 - 884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Reiss, M. M. Rahman, E. S. L. Chan, M. C. Montesinos, N. W. Awadallah, and B. N. Cronstein Adenosine A2A receptor occupancy stimulates expression of proteins involved in reverse cholesterol transport and inhibits foam cell formation in macrophages J. Leukoc. Biol., September 1, 2004; 76(3): 727 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. P. Beyer, R. J. Schmidt, P. Foxworthy, Y. Zhang, J. Dai, W. R. Bensch, R. F. Kauffman, H. Gao, T. P. Ryan, X.-C. Jiang, et al. Coadministration of a Liver X Receptor Agonist and a Peroxisome Proliferator Activator Receptor-{alpha} Agonist in Mice: Effects of Nuclear Receptor Interplay on High-Density Lipoprotein and Triglyceride Metabolism in Vivo J. Pharmacol. Exp. Ther., June 1, 2004; 309(3): 861 - 868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B. Seo, H. M. Moon, W. S. Kim, Y. S. Lee, H. W. Jeong, E. J. Yoo, J. Ham, H. Kang, M.-G. Park, K. R. Steffensen, et al. Activated Liver X Receptors Stimulate Adipocyte Differentiation through Induction of Peroxisome Proliferator-Activated Receptor {gamma} Expression Mol. Cell. Biol., April 15, 2004; 24(8): 3430 - 3444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Costet, F. Lalanne, M. C. Gerbod-Giannone, J. R. Molina, X. Fu, E. G. Lund, L. J. Gudas, and A. R. Tall Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages Mol. Cell. Biol., November 1, 2003; 23(21): 7756 - 7766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Rowe, C. A. Argmann, J. Y. Edwards, C. G. Sawyez, O. H. Morand, R. A. Hegele, and M. W. Huff Enhanced Synthesis of the Oxysterol 24(S),25-Epoxycholesterol in Macrophages by Inhibitors of 2,3-Oxidosqualene:Lanosterol Cyclase: A Novel Mechanism for the Attenuation of Foam Cell Formation Circ. Res., October 17, 2003; 93(8): 717 - 725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Bramlett, K. A. Houck, K. M. Borchert, M. S. Dowless, P. Kulanthaivel, Y. Zhang, T. P. Beyer, R. Schmidt, J. S. Thomas, L. F. Michael, et al. A Natural Product Ligand of the Oxysterol Receptor, Liver X Receptor J. Pharmacol. Exp. Ther., October 1, 2003; 307(1): 291 - 296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kaneko, M. Matsuda, Y. Yamada, Y. Tachibana, I. Shimomura, and M. Makishima Induction of Intestinal ATP-binding Cassette Transporters by a Phytosterol-derived Liver X Receptor Agonist J. Biol. Chem., September 19, 2003; 278(38): 36091 - 36098. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Le Lay, C. Robichon, X. Le Liepvre, G. Dagher, P. Ferre, and I. Dugail Regulation of ABCA1 expression and cholesterol efflux during adipose differentiation of 3T3-L1 cells J. Lipid Res., August 1, 2003; 44(8): 1499 - 1507. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Zager, A. C.M. Johnson, S. Y. Hanson, and V. O. Shah Acute Tubular Injury Causes Dysregulation of Cellular Cholesterol Transport Proteins Am. J. Pathol., July 1, 2003; 163(1): 313 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Lund, J. G. Menke, and C. P. Sparrow Liver X Receptor Agonists as Potential Therapeutic Agents for Dyslipidemia and Atherosclerosis Arterioscler. Thromb. Vasc. Biol., July 1, 2003; 23(7): 1169 - 1177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cui, L. Huang, A. Zhao, J.-L. Lew, J. Yu, S. Sahoo, P. T. Meinke, I. Royo, F. Pelaez, and S. D. Wright Guggulsterone Is a Farnesoid X Receptor Antagonist in Coactivator Association Assays but Acts to Enhance Transcription of Bile Salt Export Pump J. Biol. Chem., March 14, 2003; 278(12): 10214 - 10220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. M. Johnson, J. M. Yabu, S. Hanson, V. O. Shah, and R. A. Zager Experimental Glomerulopathy Alters Renal Cortical Cholesterol, SR-B1, ABCA1, and HMG CoA Reductase Expression Am. J. Pathol., January 1, 2003; 162(1): 283 - 291. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |