|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 14, 11728-11734, April 5, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, June 21, 2001, and in revised form, December 24, 2001
Most loci that are regulated by genomic
imprinting have differentially methylated regions (DMRs). Previously,
we showed that the DMRs of the mouse Snrpn and
U2af1-rs1 genes have paternal allele-specific patterns of
acetylation on histones H3 and H4. To investigate the maintenance of
acetylation at these DMRs, we performed chromatin immunoprecipitation
on trichostatin-A (TSA)-treated and control cells. In embryonic stem
(ES) cells and fibroblasts, brief (6-h) TSA treatment induces global
hyperacetylation of H3 and H4. In ES cells only, TSA led to a selective
increase in maternal acetylation at U2af1-rs1, at lysine 5 of H4 and at lysine 14 of H3. TSA treatment of ES cells did not affect
DNA methylation or expression of U2af1-rs1, but was
sufficient to increase DNase I sensitivity along the maternal allele to
a level comparable with that of the paternal allele. In fibroblasts,
TSA did not alter U2af1-rs1 acetylation, and the parental
alleles retained their differential DNase I sensitivity. At
Snrpn, no changes in acetylation were observed in the
TSA-treated cells. Our data suggest that the mechanisms regulating
histone acetylation at DMRs are locus and developmental stage-specific
and are distinct from those effecting global levels of acetylation.
Furthermore, it seems that the allelic U2af1-rs1
acetylation determines DNase I sensitivity/chromatin conformation.
The allelic expression of imprinted genes in mammals depends on
whether the allele is inherited from the mother or the father (1).
Genetic experiments have established that allelic differences in DNA
methylation at CpG dinucleotides are essential for the correct
expression of most imprinted genes (2). The great majority of imprinted
loci have defined regulatory sequences that are methylated predominantly on one or other of the two parental alleles. At several
of these differentially methylated regions
(DMRs),1 the allelic
methylation is established in the germ line and is maintained during
embryonic and postnatal development (reviewed in Ref. 3). However, CpG
methylation cannot be the sole determinant in the somatic maintenance
of imprints. At constitutive DMRs, allelic methylation patterns must
somehow be protected from the genome-wide demethylation that occurs
following fertilization and during early stages of development
(reviewed in Ref. 4). Although some mouse DMRs lose methylation during
preimplantation development, they can regain allelic methylation
patterns at later stages (3). To account for such observations, it has
been argued that the somatic maintenance of epigenetic marks at DMRs
may involve multiple, interdependent, modifications including DNA
methylation, nonhistone protein binding, and alterations to nucleosomes
and chromatin (5-7).
Chromatin appears to be organized differently at the maternal and
paternal alleles of DMRs. Several DMRs, for instance, display differential chromatin compaction when assayed by enzymatic digestion in nuclei (5). Along the splice factor-encoding, imprinted U2af1-rs1 gene on mouse chromosome 11 (8, 9), the methylated
and repressed maternal allele is severalfold more resistant to DNase I
than the unmethylated, active, paternal allele (10). It has been
suggested that the DMR comprising exon 1 of the human SNRPN gene on chromosome 15q11-q13 (11) also has differential chromatin compaction, based on assays that map matrix attachment regions (12).
This DMR corresponds to the imprinting control center involved in the
neuro-developmental Prader-Willi Syndrome (13, 14); and both in humans
and mice, it shows increased histone H3 and H4 acetylation on the
unmethylated paternal allele (15, 16). Histone H4 associated with the
differentially methylated region-2 of the IGF2 receptor gene
(Igf2r) on mouse chromosome 17 is heavily acetylated
on the unmethylated paternal allele and underacetylated on the maternal
allele (17). The DMR encompassing the imprinted U2af1-rs1
gene also shows pronounced acetylation differences between the
methylated maternal and the unmethylated paternal allele. By using
antisera specific for particular acetylated lysines on histones H3 and
H4, we previously established that the underacetylation of H4 at the
methylated U2af1-rs1 allele is confined to lysine 5, whereas
for H3, at least three of the four acetylatable lysine residues were
underacetylated. Similar results were obtained for the constitutive DMR
comprising exon 1 of the mouse Snrpn gene (16). Furthermore,
we found that by inducing high levels of CpG methylation on the
paternal U2af1-rs1 allele, we could bring about
underacetylation of H3, but not of H4, lysine 5 (16). Thus, allelic
differences in histone acetylation can be both histone-specific and
lysine residue-specific and can be linked differently to CpG methylation.
In the present study we explore how allelic patterns of histone
acetylation are maintained at the DMRs of the imprinted mouse genes
U2af1-rs1 and Snrpn by examining the in
vivo effects of trichostatin-A (TSA), a highly specific inhibitor
of histone deacetylases (18). We used ES cells and differentiated cells
derived from interspecific hybrid embryos to compare directly the
maternal and paternal alleles of the U2af1-rs1 and
Snrpn genes in chromatin and expression assays. This
analysis demonstrates that the DMRs at the imprinted Snrpn
and the U2af1-rs1 genes are highly resistant to TSA
treatments that cause global hyperacetylation of histones H3 and H4. In
undifferentiated ES cells, but not in embryonic fibroblasts, and at the
U2af1-rs1 DMR only, TSA treatment induces selective, lysine
residue-specific changes in acetylation. These changes are associated
with altered chromatin conformation along this imprinted locus.
Mice, Cells, and in Vitro Culture--
Mice that were maternally
(Matdi11) or paternally (Patdi11) disomic for chromosome 11 were
produced by intercrossing animals heterozygous for the Robertsonian
translocation Rb(11.13)4Bnr (19). Primary embryonic fibroblasts were
derived from day 14 fetuses (line EF1; Ref. 16) and were cultured in
DMEM medium containing 20% fetal calf serum. For chromatin assays,
early passage (<passage 5) EF1 fibroblasts were used. ES line SF1-1
was cultured in ES medium with 103 units/ml of leukemia
inhibitory factor (LIF) (20). For chromatin studies,
semiconfluent early passage (<passage 15) SF1-1 cells were used that
were morphologically undifferentiated. For TSA treatment, exponentially
growing cells were cultured for 6 h in medium supplemented with
TSA (at 300 nM).
Nuclease Sensitivity Assays, Southern and Northern Hybridization,
and Reverse Transcriptase PCR--
Nuclei were isolated from tissue or
cultured cells and were resuspended in DNase I, MNase, or
MspI digestion buffer at ~107 nuclei/ml, as
described previously (10). For the DNase I assay, 200-µl
aliquots of nuclei suspension were incubated for 10 min at 25 °C at
increasing concentrations of enzyme (Roche Molecular Biochemicals). DNA
extraction and Southern hybridization were performed as described
previously (10). Hybridized filters were analyzed by
phosphorimager (FLA3000, Fuji) and intensities were determined using
the Quantity-One imaging software (Bio-Rad). Probe 7 is a 397-bp
fragment (nucleotides 3556-3953 of the sequence for
GenBankTM accession number AF309654) and probe 8 is
389-bp (nucleotides 7336-7725 of the sequence for
GenBankTM accession number AF309654). For reverse
transcriptase PCR analysis, poly(A)+ RNA was extracted from
cells using a Qiagen "Oligotex direct mRNA kit." First
strand DNA synthesis was from 100-200 ng of mRNA using random
primers and Superscript II reverse transcriptase (Invitrogen).
cDNA was used as template for U2af1-rs1 amplification (forward, cgcagatcagacatactgcgg; reverse, tgtggtacggccagcctatg) and
Snrpn amplification (forward, gagagggagccggagatg; reverse, ttgctgttgctgagaacgtc) in a mixture containing
[ ChIP and PCR-SSCP--
Histone extraction from cultured cells
and analysis of purified histones on acetic acid/urea/Triton gels were
according to Bonner et al. (21). Western blotting and
immunostaining with antisera to acetylated histones were as described
previously (22). Purification of nuclei, partial fractionation
of chromatin with MNase to obtain fragments of predominantly 1-5
nucleosomes in length, and immunoprecipitation with affinity-purified
antibodies were performed as described previously (23). The
following antisera were used: R252/16 (to H4Ac16), R41/5 (to H4Ac5),
R224/14 (to H3Ac14), and R47/9/18 (to H3Ac9/18) (24). For PCR-SSCP, 50 ng of each from the extracted DNA samples were used to PCR amplify (36 cycles; T-annealing = 60 °C) in the presence of
[32P]dCTP (1% of total dCTP) from two regions in
U2af1-rs1: a 293-bp region of the 5'-UTR (forward,
cgcagatcagacatactgcgg; reverse, tgtggtacggccagcctatg) and a 163-bp
3'-UTR region (forward, ctaattcccaaccaagttaca; reverse,
aaaacaacatgggaagccag). Snrpn primers amplified a 228-bp region at the DMR1 (forward, agttgtgactgggatcctg; reverse,
gcggcaacagaacttctacc). Denatured PCR products were resolved by SSCP gel
electrophoresis (25). Following migration, gels were dried and exposed
to x-ray films or analyzed by a phosphorimager (FLA3000, Fuji). The
relative band intensities were calculated using the Quantity-One
imaging software (Bio-Rad).
TSA Alters the Differential Acetylation of Maternal and Paternal
U2af1-rs1 Alleles in ES Cells but Not in Fibroblasts--
Acetylation
studies were performed on interspecific hybrid cell lines. In all ChIP
assays, the parental alleles were compared directly by using a
combination of PCR amplification and electrophoretic detection of SSCP
(25). For our studies, we selected a primary embryonic fibroblast line,
EF1, that is (C57BL/6 × Mus spretus)F1 for
proximal chromosome 11 on a homozygous C57BL/6 background (16) and a
(C57BL/6 × M. spretus)F1 embryonic stem (ES) cell line
(SF1-1; Ref. 20). In both cell lines, the two imprinted genes that we
analyzed, U2af1-rs1 and Snrpn, had maternal DNA methylation at their DMRs and were expressed exclusively from the
paternal allele (16, 20).
To explore the role and regulation of the paternal allele-specific H3
and H4-lysine 5 acetylation at U2af1-rs1 gene, we set out to
alter levels of acetylation by treatment of the interspecific hybrid
cells with TSA. To minimize pleiotropic or cell cycle effects of TSA
(18), we restricted the treatment time to 6 h at a concentration of 300 nM. In initial experiments, we found that in
undifferentiated SF1-1 ES cells, prolonged TSA treatment (12 or 24 h at 100 or 300 nM) led to extensive detachment of cells
from the culture dish and severe restriction of cell growth after
removal of the drug. In contrast, TSA treatment of SF1-1 ES cells (and
EF1 fibroblasts) for only 6 h did not give rise to gross
morphological changes or cell detachment, and cells continued to grow
normally after TSA removal (data not shown). We analyzed global levels
of H3 and H4 acetylation in untreated cells and in cells harvested
immediately after the 6-h treatment. In the SF1-1 ES cells, the short
treatment was sufficient to induce a major increase in histone
acetylation, detected by Coomassie Blue staining and Western blotting
of bulk histones separated on acetic acid/urea/Triton X-100 gels (Fig. 1). Gel scanning showed that ~80% of
all histone H4 in the TSA-treated ES cells was present in the tetra-,
tri-, or diacetylated forms, as compared with less than 5% before
treatment. Based on immunostaining with antisera to H3 acetylated at
either lysine 14 or lysines 9 and/or 18 (the antiserum used does not
discriminate between H3 acetylated at lysines 9 and 18), TSA treatment
also induces a dramatic increase in global levels of H3 acetylation
(Fig. 1A and data not shown). Very similar results were
obtained with the embryonic fibroblast line EF1 (Fig.
1B).
The effects of TSA on acetylation at U2af1-rs1 were
investigated by performing chromatin immunoprecipitation (ChIP) on
untreated and TSA-treated SF1-1 and EF1 cells. Antibody-bound fractions were assayed for paternal and maternal DNA from the 5'- and 3'-UTRs of
the U2af1-rs1 gene, by PCR amplification and electrophoretic detection of SSCP (Fig. 2A).
Of critical importance for the application of PCR-SSCP to allelic
acetylation studies is the demonstration that PCR amplifications from
(C57BL/6 × M. spretus)F1 genomic DNA give equal
amounts of C57BL/6 and M. spretus-specific fragments on SSCP
gels. This is shown in Fig. 2 for the U2af1-rs1 regions analyzed.
We have shown previously that, in untreated ES cells, the methylated,
maternal U2af1-rs1 allele is underacetylated at H4 lysine 5 and at H3 lysines 14 and 9/18 but not at H4 lysines 8, 12, and 16 (16).
In TSA-treated ES cells, ChIP/PCR-SSCP assays show that levels of
histone H4 acetylated at lysine 5 (H4Ac5) became similar on the
maternal and paternal U2af1-rs1 alleles at both the 5'- and
the 3'-UTR (Fig. 2, B and C, respectively). TSA
also has an effect on H3Ac14 levels; paternal/maternal ratios are about
2-fold lower in TSA-treated cells, although the paternal allele remains more highly acetylated. In contrast, TSA did not effect the relatively low levels of H3Ac9/18 on the maternal U2af1-rs1 allele. If
anything, the measured ratios of paternal over maternal H3-K9/18
acetylation were even higher than in the untreated cells (Fig. 2,
B and C). These findings, summarized in Table
I, suggest that in ES cells, TSA
induces a significant gain of maternal acetylation on H4-lysine 5 and
H3-lysine 14. In contrast to the specific effects in ES cells, in the
EF1 embryonic fibroblasts, the preferential acetylation of both H3 and
H4 on the paternal U2af1-rs1 allele remained essentially unaltered after growth for 6 h in the presence of TSA (Table I). Hence, despite its pronounced effects on global levels of H3 and H4
acetylation in these differentiated cells (Fig. 1B), TSA did not affect the relative allelic levels of acetylation along
U2af1-rs1.
U2af1-rs1 Expression and DNA Methylation Are Unaltered in
TSA-treated Cells--
TSA treatment did not affect the expression of
the U2af1-rs1 gene. Levels of U2af1-rs1 mRNA
measured by Northern hybridization were unaltered by TSA treatment of
ES cells and fibroblasts (Fig. 3A). When assayed by the more
sensitive reverse transcriptase PCR amplification technique, expression
in the TSA-treated ES cells continued to be from the paternal
chromosome exclusively (Fig. 3B). Before treatment of the
SF1-1 cells with TSA, all CpG methylation at the U2af1-rs1
locus was present on maternal chromosomes. Specifically, about 85% of
SF1-1 cells showed maternal methylation of a unique NotI
restriction site in the 5'-UTR and of 24 HpaII restriction
sites distributed along the locus. This was not altered by TSA
treatment, and U2af1-rs1 methylation in EF1 fibroblasts was
also unaltered by TSA (Fig. 3C and data not shown).
TSA Alters the Differential Sensitivity to DNase I of Maternal and
Paternal U2af1-rs1 Chromatin in ES Cells but Not Fibroblasts--
In
adult brain and liver (10), and in kidney (Fig.
4B), chromatin along the
repressed maternal U2af1-rs1 allele is severalfold less
sensitive to DNase I in vivo than its paternal counterpart. A similar differential was observed in the ES cells and the
fibroblasts, at the passages that were analyzed in this study. Hence,
when incubating nuclei purified from these cells at a range of
increasing concentrations of DNase I, the repressed maternal allele
became fully digested only at severalfold higher enzyme concentrations than the active paternal allele (Fig. 4, C and
D). To investigate whether this allelic difference in
generalized sensitivity along U2af1-rs1 is associated with
paternal allele-specific histone acetylation, we studied DNase I
sensitivity in the TSA-treated SF1-1 ES cells. Using a Southern
blotting approach, we found that the maternal U2af1-rs1 copy
invariably becomes more DNase I-sensitive upon TSA treatment, acquiring
a generalized sensitivity to DNase I similar to that of the paternal
chromosome. This was observed using a BglII + SacI restriction fragment length polymorphism (RFLP)
(Fig. 4B) that encompasses the 3'-half of the gene, in which
no hypersensitive sites are present (10). In contrast, TSA did not have
a predominant effect on the differential sensitivity in the EF1
fibroblasts, in which the maternal U2af1-rs1 allele remained
more resistant to DNase I than the paternal chromosome (Fig.
4D). This agrees with our finding of unaltered allelic
acetylation in these TSA-treated differentiated cells.
To analyze nuclease sensitivity at the opposite end of the gene, we
made use of the PCR-SSCP polymorphism at its 5' extremity (see Fig. 2),
encompassing 293 bp in which no hypersensitive sites are present (10).
Hence, nuclei from control and TSA-treated SF1-1 and EF1 cells were
incubated at increasing concentrations of DNase I, and extracted DNA
samples were used to PCR amplify from the 5'-UTR, followed by migration
of the PCR products through a nondenaturing polyacrylamide gel
(precisely as for the PCR-SSCP analysis of immunoprecipitated
chromatin, Fig. 2). This showed that in the untreated ES cells and
fibroblasts, the paternal allele was more readily digested by DNase I
than the maternal allele (Fig. 5). In the
TSA-treated ES cells, however, similar amounts of maternal and paternal
PCR products were amplified at all but the highest nuclease
concentration used, indicating that the maternal and the paternal
alleles had become much more similar in their sensitivity to DNase I. In the EF1 fibroblasts, TSA treatment did not change the differential
PCR amplification at the 5'-UTR; the repressed maternal allele remained
more resistant to DNase I digestion than the expressed paternal allele
(Fig. 5).
The differential, generalized sensitivity to DNase I seems not to be
associated with significant differences in the positioning of
nucleosomes along the maternal and paternal U2af1-rs1
alleles. This was apparent from analysis of mice that were maternally
(Matdi11) or paternally (Patdi11) disomic for chromosome 11. Purified
liver nuclei from Matdi11 and Patdi11 mice were incubated for
increasing lengths of time with micrococcal nuclease. Genomic DNA was
extracted from these MNase series, digested with the restriction enzyme HindIII, Southern blotted, and hybridized with small probes
(probes 7 and 8, respectively) from the opposite extremities of a
4.2-kb HindIII fragment that comprises most of the
U2af1-rs1 gene (Fig. 6). The
MNase digestion profiles revealed by hybridization with both these
probes appeared identical for the Matdi11 and Patdi11 nuclei (Fig. 6).
This finding agrees with our earlier observation (10) that the parental
alleles of U2af1-rs1 have a similar sensitivity in
vivo to MNase. We also analyzed nuclei from early-passage
androgenetic and parthenogenetic ES cells, and in these monoparental
cells the U2af1-rs1 MNase digestion profiles were similar
(data not shown).
In adult tissues, the U2af1-rs1 locus displays differential
sensitivity to the restriction endonuclease MspI, with
chromatin on the silent and methylated maternal chromosome being highly resistant to this methylation-insensitive enzyme (10). This difference may be attributed to the presence of methyl-CpG-binding domain (MBD) proteins on the maternal allele (16). In contrast to its
pronounced effects on the generalized DNase I sensitivity in ES cells,
TSA did not significantly alter the differential MspI
sensitivity along the U2af1-rs1 locus (data not shown).
At DMR1 of Snrpn, TSA Treatment Does Not Affect Allelic Differences
in Histone Acetylation or DNA Methylation--
The 5' part of the
imprinted Snrpn gene has a DMR (DMR1, Fig.
7A) at which methylation is
established in the female germ line and is maintained in all embryonic
lineages (26). In a previous study, we established that the DMR1 of
Snrpn has paternal allele-specific patterns of histone
acetylation. As for U2af1-rs1, the differential acetylation
at histone H4 is most pronounced at lysine 5, whereas at histone H3,
all lysine residues analyzed show paternal acetylation (Ref. 16; Fig.
7B).
We find that TSA causes no detectable change in the relative levels of
acetylation on the maternal and paternal Snrpn alleles. With
antibodies to acetylated H3 (lysines 14, 9, and 18) and H4 (lysine 5),
most of the chromatin precipitated from the DMR1 originated from the
paternal chromosome, as in the untreated cells (Fig. 7B).
The expression of Snrpn appeared also unaltered by TSA
treatment of ES cells (Fig. 7, C and D). We were
unable to perform allelic acetylation studies on the EF1 fibroblasts,
since these are homozygous C57BL/6 for chromosome 7 (where
Snrpn resides). However, TSA did not lead to any detectable
increase in Snrpn expression in these cells (Fig.
7C).
A key finding in this study is that whereas TSA induces global
hyperacetylation on core histones H3 and H4, only partial (or no)
effects are observed at the constitutive DMRs of the imprinted loci
analyzed. Only in undifferentiated ES cells, at U2af1-rs1 but not at Snrpn, did brief TSA treatment lead to a
selective increase in the relative levels of histone acetylation on the repressed maternal chromosome. The TSA-induced changes in ES cells are
confined to specific lysine residues and are associated with increased
sensitivity to DNase I along the imprinted locus. These findings raise
questions about the regulation of histone deacetylation at DMRs and its
role in chromatin organization and gene repression.
Maintenance of Differential Histone Acetylation at the U2af1-rs1
and Snrpn DMRs--
The observed effects of TSA on
U2af1-rs1 were cell type- and lysine residue-specific. In ES
cells, TSA abolished the paternal/maternal difference in H4Ac5 at
U2af1-rs1 and reduced, but did not eliminate, the difference
in H3Ac14. In contrast, there was no evidence for a gain in H3Ac9/18 on
the maternal allele, despite the fact that TSA treatment led to a major
increase in overall levels of H3-K9/18 acetylation in the ES cells. One
interpretation of this result is that continuous HDAC activity is
necessary to maintain the allelic acetylation differences in H4Ac5 and
H3Ac14 in ES cells. In contrast, in primary embryonic fibroblast cells,
TSA had no effect on the relative levels of H3Ac14, H3Ac9/18, or H4Ac5
on the maternal and paternal U2af1-rs1 alleles. Although
underlying mechanism(s) need to be determined, this difference between
the two cell types would imply that acetylation patterns at
U2af1-rs1 become somehow stabilized and resistant to TSA
upon differentiation.
In contrast to the results with U2af1-rs1, at the
constitutive DMR of the Snrpn gene, we found no evidence for
allelic changes in H3 and H4 acetylation in TSA-treated ES cells. One
possible interpretation of this finding is that, in contrast to the
regulation of global histone acetylation, which seems to involve
continuous HDAC activity, there is a strongly reduced, or possibly cell
cycle-regulated, turnover of histone acetate groups at these two DMRs.
Alternatively, the HDAC activities that maintain the allelic
acetylation patterns at U2af1-rs1 and Snrpn could
differ in their sensitivities to TSA, either because the enzymes
involved are distinct or because they are associated with different
proteins that alter their catalytic properties. For example, the
NAD-dependent deacetylase SIR2 is highly resistant to TSA
(27). The selective effect of TSA on H4-lysine 5 and H3-lysine 14 acetylation at U2af1-rs1 raises the possibility that the
enzyme(s) involved are specific for these lysine residues. Several
HDACs show preferences for specific histones or lysine residues.
Histone deacetylase Hda1p in yeast, for instance, preferentially
deacetylates H3 in vitro (28), while histone acetylation
patterns in mutants lacking this activity suggest a preference for H3
and H2B in vivo (29). Yeast HOS3p has a preference for H4Ac5
and H4Ac8 and H3Ac14 and H3Ac23 (30). Specificity can also be
substrate-dependent. HDAC1, as part of the NuRD complex, for example, deacetylates all H4 lysines in free histones, but only
lysines 5, 8, and 12 in chromatin (31). To our knowledge, so far no
HDACs have been shown to be specific for H4Ac5 or H3Ac14 in chromatin.
Histone Acetylation, Chromatin Conformation, and DNA
Methylation--
In ES cells, TSA abolished paternal/maternal
differences in generalized DNase I sensitivity along
U2af1-rs1, while at the same time, allelic differences
in H4Ac5 and H3Ac14 were reduced or abolished. In differentiated embryo
fibroblasts, in contrast, there was no detectable change in relative
levels of H3-K14 or H4-K5 acetylation and no allele-specific increase
in DNase I sensitivity. These correlations do not, in themselves,
establish H4-lysine 5 and/or H3-lysine 14 as mediators of DNase I
sensitivity. They do, however, demonstrate that DNase I sensitivity on
the maternal U2af1-rs1 allele is not dependent on global
changes in histone acetylation but may be regulated by the selective
acetylation/deacetylation of specific lysine residues on H3 and H4. Our
study did not consider core histones H2A and H2B, and we do not exclude
a possible co-involvement of acetylation at these core histones. Now
that suitable antisera are becoming available, this can be
investigated. It was reported recently that chromatin at silenced
transgenes acquires increased DNase I sensitivity in vivo
after only a few hours of TSA treatment (32), and a correlation between
histone underacetylation and chromatin compaction has also been
demonstrated at the chicken
TSA treatment did not induce methylation changes at
U2af1-rs1, and the chromatin on the methylated maternal
chromosome remained highly resistant to the restriction endonuclease
MspI (which recognizes sites that can be methylated but is
not methylation-sensitive). One possible interpretation of the
unaltered MspI resistance of chromatin is that there is
continued binding of proteins to methylated CpG dinucleotides. Several
studies have demonstrated physical association between HDACs and MBD
proteins (reviewed in Ref. 6), and in a previous study we demonstrated
in vivo association of MECP2 with the methylated maternal
U2af1-rs1 allele (16). Such association of specific MBD
proteins to methylated DNA represents an attractive targeting mechanism
that could, at least partially, account for the observed low
acetylation at histones on the maternal U2af1-rs1 allele.
We found no evidence that TSA induces expression of
U2af1-rs1 or Snrpn. A few hours of incubation
with TSA also failed to de-repress the silent parental alleles of the
imprinted Igf2 and H19 genes on mouse
chromosome 7 (39). In contrast, prolonged treatments of cultured cells
with TSA has been reported to induce expression of the normally silent
allele of the imprinted Igf2 gene and the
Igf2-receptor gene on mouse chromosome 17 (17, 40, 41). In these experiments, cells were grown for 24 h in the
presence of the HDAC inhibitor. Perhaps, passage through S phase, or
even a complete cell cycle, is necessary before the switch to a new transcriptional state can be accomplished at imprinted genes. We note,
however, that TSA treatments of up to 72 h do not lead to
de-repression of the silent maternal alleles of the
U2af1-rs1 and Snrpn genes (15, 41), and this
supports our main finding that the DMRs at these imprinted loci are
particularly resistant to the effects of this HDAC inhibitor.
We thank Yuji Goto and Colin Johnson for
stimulating discussion, Galia Konfortova for technical assistance, and
Gavin Kelsey for generating the disomy 11 mice from Rb(11.13)Bnr
translocation and PCE strains (which were a kind gift from Bruce Cattanach).
*
This work was supported by the Biotechnology and Biological
Sciences Research Council (Studentship to R. I. G.), the
Center National de la Recherche Scientifique (to R. F.), the Human
Frontier Science Program (to R. F.), the Fondation pour la
Recherche Médicale (to R. F.), and the Royal Society
(Fellowship 516002 (to L. P. O.)).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF309654.
§
Present address: Fox Chase Cancer Center, 7701 Burholme Ave.,
Philadelphia, PA 19111.
**
Present address: Wellcome/CRC Inst. of Developmental Biology and
Cancer Research, University of Cambridge, Cambridge CB2 1QR, United Kingdom.
Published, JBC Papers in Press, January 30, 2002, DOI 10.1074/jbc.M105775200
The abbreviations used are:
DMR, differentially
methylated region;
TSA, trichostatin-A;
HDAC, histone deacetylase;
ES, embryonic stem;
ChIP, chromatin immunoprecipitation;
SSCP, single
strand conformational polymorphism;
UTR, untranslated region;
MBD, methyl-CpG-binding domain.
Inhibition of Histone Deacetylases Alters Allelic Chromatin
Conformation at the Imprinted U2af1-rs1 Locus in Mouse
Embryonic Stem Cells*
§,
,**,
Institute of Molecular Genetics, CNRS UMR-5535,
IFR-24, 34293 Montpellier cedex 5, France, The
Babraham Institute, Cambridge CB2 4AT, United Kingdom, and the
¶ Chromatin and Gene Expression Group, University of Birmingham
Medical School, Birmingham B15 2TT, United Kingdom
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]dCTP, and the resulting products were migrated
through an SSCP gel. For total RNA extraction we used a Qiagen
"RNeasy kit." Northern hybridization was with a 250-bp
HindIII-PstI fragment from the 5' end of the
mouse Gapdh gene, a 499-bp fragment comprising exon 7 of
Snrpn (16), and U2af1-rs1 probe 1 (10).
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (32K):
[in a new window]
Fig. 1.
TSA increases global H3 and H4 acetylation in
ES cells and fibroblasts. Histones were extracted from untreated
( 
) and TSA-treated (+) SF1-1 ES cells (A) and EF1
embryonic fibroblasts (B) and resolved on acetic
acid/urea/Triton X-100 gels. Subsequently, gels were stained with
Coomassie Blue (left panels) or transferred to nylon filter
and immunostained with antisera to H4Ac16, H4Ac5, and H3Ac9/18
(right panels). The migration of histones is as described by
Bonner et al. (28) and was confirmed by immunostaining
View larger version (50K):
[in a new window]
Fig. 2.
In ES cells, TSA alters acetylation of
H4-lysine 5 and H3-lysine 14 acetylation along
U2af1-rs1. A, map of the
U2af1-rs1 gene, shown as a box with its coding
part in black. The line above represents the
domain of maternal DNA methylation and differential generalized DNase I
sensitivity (10). Small bars indicate the regions analyzed
by PCR-SSCP. B, acetylation at the 5'-UTR of
U2af1-rs1. ChIP was performed simultaneously on nontreated
( ) and TSA-treated (+) SF1-1 ES cells, and PCR on the corresponding
DNA samples was with primers from the 5'-UTR. The first three
lanes show PCR products (after SSCP electrophoresis) from control
liver DNAs of C57BL/6 (m), M. spretus
(s), and (C57BL/6 × M. spretus)F1
(F1), respectively. Subsequent lanes show PCR amplifications
following ChIP with antisera to H4Ac16, H4Ac5, H3Ac14, and H3Ac9/18,
respectively. Maternal (M) and paternal (P)
allele-specific fragments are indicated. C, acetylation at
the 3'-UTR of U2af1-rs1. Amplification from the same DNAs
was with primers from the 3'-UTR.
Summary of PCR-SSCP data, presented as the ratios of paternal over
maternal acetylation
View larger version (32K):
[in a new window]
Fig. 3.
U2af1-rs1 expression and methylation are
unaltered in TSA-treated cells. A, Northern analysis of
total RNA samples. Hybridization was with U2af1-rs1 probe 1 (upper panel) and a Gapdh control probe,
respectively. The latter yielded the same relative band intensities as
a probe hybridizing to 18 S and 28 S RNA (data not shown).
U2af1-rs1:Gapdh ratios of band intensities are indicated. B,
unaltered paternal U2af1-rs1 expression. The
lanes to the left show amplifications from
C57BL/6 (m), M. spretus (s), and
(C57BL/6 × M. spretus)F1 (F1) DNAs,
respectively. The lanes to the right show
expression from cDNA samples corresponding to untreated and
TSA-treated SF1-1 ES cells. To exclude possible DNA contamination, we
performed parallel assays without the addition of reverse transcriptase
( ). C, U2af1-rs1 methylation in EF1 and SF1-1
cells. BglII (B) and BglII + NotI (B+N)-digested DNA samples were analyzed by
Southern hybridization with probe 1. Lanes 1 and
2, (C57BL/6 × M. spretus)F1 liver;
lane 3, EF1 fibroblasts; lane 4, SF1-1 ES cells;
lane 5, TSA-treated SF1-1 cells. Maternal (M) and
paternal (P) specific fragments are indicated; their sizes
are given in kb. The intensity of the 2.8-kb band in lanes 4 and 5 indicates that both in SF1-1 and in TSA-treated SF1-1
cells, ~15% of the maternal chromosomes are not methylated at the
NotI restriction site. For the location of the
NotI site and probe 1, see Fig. 4A.
View larger version (28K):
[in a new window]
Fig. 4.
Southern-based analysis of DNase I
sensitivity in TSA-treated cells. A, map depicting the
strategy used to analyze parental allele-specific DNase I sensitivity
along U2af1-rs1. BglII (B), SacI
(Sa), and NotI (N) restriction sites
and probe 1 are indicated. C57BL/6 (m)- and M. spretus (s)-specific BglII + SacI
fragments are shown underneath. We submitted the nucleotide sequence of
this region to GenBankTM (accession number AF309654).
B, DNase I assay on (C57BL/6 × M. spretus)F1 kidney
cells. After purification, nuclei were incubated at increasing
concentrations of DNase I (lanes 1-8 correspond to 0, 50, 100, 200, 300, 400, 500, and 750 units of DNase I/ml, respectively).
DNA was extracted subsequently and digested with BglII + SacI, followed by Southern hybridization with probe 1. The
2.5-kb, M. musculus-specific (maternal, M) and
the 1.5-kb, M. spretus-specific (paternal, P)
bands are indicated. Measured maternal:paternal (M/P) ratios
of band intensities are indicated underneath the lanes; , bands are
too weak to determine M/P ration. The three lanes to the
left show BglII + SacI-digested
genomic DNAs from C57BL/6 (m), M. spretus
(s), and (C57BL/6 × M. spretus)F1
(F1) DNAs, respectively. C, DNase I assay on ES
cells. Nuclei from untreated and TSA-treated SF1-1 cells were incubated
at increasing concentrations of DNase I (lanes 1-7
correspond to 0, 50, 100, 200, 300, 400, and 500 units of DNase I/ml,
respectively). Southern hybridization with probe 1 was the same as in
B. Maternal:paternal ratios are indicated underneath the
lanes. D, DNase I assay on EF1 fibroblasts. Lanes
1-7 correspond to 0, 100, 200, 300, 400, 500, and 750 units/ml,
respectively. Southern hybridization with probe 1 was the same as in
B.
View larger version (34K):
[in a new window]
Fig. 5.
PCR-based analysis of DNase I sensitivity in
TSA-treated cells. Nuclei were purified from untreated and
TSA-treated SF1-1 ES cells and EF1 fibroblasts and incubated with DNase
I at increasing enzyme concentration (lanes 1-4
correspond to 0, 300, 600, and 900 units/ml, respectively). Extracted
DNA samples were used to PCR amplify with the primers from the 5'-UTR,
followed by SSCP electrophoresis of the PCR products. Maternal
(M) and paternal (P) specific bands are
indicated, and ratios of maternal:paternal band intensities are
indicated underneath the lanes. To the left are shown
control amplifications from C57BL/6 (m) and M. spretus (s) genomic DNA, respectively,
View larger version (103K):
[in a new window]
Fig. 6.
MNase digestion profiles in Matdi11 and
Patdi11 mice. Mice were analyzed that were paternally
(Patdi11) or maternally (Matdi11) disomic for
proximal chromosome 11. Liver nuclei were incubated with MNase for
increasing periods of time (lanes 1-4 correspond to 0, 30, 60, and 90 s, respectively). DNA samples were digested with
HindIII and analyzed by Southern hybridization with probes 7 (left panel) and 8 (right panel), respectively.
Hybridization with total genomic DNA established that the overall
digestion by MNase was comparable in both the panels (data not shown).
The lowest visible band is ~150 bp and corresponds to the
mononucleosome. The map indicates the 4.2-kb HindIII
(H) fragment relative to the U2af1-rs1 gene
(gray box) and probes 7 and 8 (bars
underneath).
View larger version (28K):
[in a new window]
Fig. 7.
Allelic acetylation at DMR1 of
Snrpn is unaltered by TSA. A, map of
the Snrpn gene, with exons 1-10 (filled boxes)
and the differentially methylated region comprising exon 1 (DMR1,
horizontal bar) as defined by Shemer et al. (26).
The small bar below indicates the sequences analyzed by
PCR-SSCP. B, acetylation of Snrpn in untreated
(ES) and TSA-treated (TSA+TSA) ES cells. PCR-SSCP
was performed on the same ChIP assays as described in the legend to
Fig. 2B, and amplification was with primers from the DMR1 of
Snrpn. Lanes C correspond to amplification from
input chromatin without the addition of antiserum. C,
Snrpn expression in TSA-treated ES cells. Northern blot
hybridization was with an Snrpn, exon 7 (upper panel) and a
Gapdh probe, respectively. Snrpn:Gapdh ratios of band
intensities are indicated. This yielded the same relative intensities
as compared with a probe hybridizing to 18 S and 28 S RNA (data not
shown). D, unaltered paternal Snrpn expression.
The lane to the left shows amplification (201-bp
fragment covering exons 1-3) from C57BL/6 cDNA (from liver). To
the right, amplification from cDNA samples corresponding
to untreated (ES) and TSA-treated (ES+TSA) SF1-1
cells is shown; parallel assays were performed without the addition of
reverse transcriptase ( ). After denaturation, Mus musculus
(Mus.)- and M. spretus
(Spret.)-specific amplification products were separated by
SSCP electrophoresis.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-globin chromosomal domain (33). It is
unclear how precisely deacetylation of lysine residues on H3 and H4
leads to compaction of chromatin. The N-terminal tail of histone H4
links neighboring nucleosomes in core particle crystals, and such
interactions might influence chromatin compaction in vivo
(34). Indeed, it has been established that the N terminus of H3 is
essential for the formation of condensed chromatin fibers (35), and
several recent in vitro studies show that the extent of
histone deacetylation at tail domains influences chromatin condensation
(36, 37). Alternatively, acetylation of specific residues on H3 and/or
H4 could prevent, either directly or indirectly, the association of
nonhistone proteins that are involved in chromatin compaction. Centromeric chromatin is particularly susceptible to the effects of TSA
and loses its ability to retain heterochromatin protein-1 (HP1) on
prolonged treatment with this HDAC inhibitor (38).
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed. Tel.:
33-4-67613663; Fax: 33-4-67040231; E-mail:
feil@igm.cnrs-mop.fr.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Surani, M. A.
(1998)
Cell
93,
309-312[CrossRef][Medline]
[Order article via Infotrieve] 2.
Li, E.,
Beard, C.,
and Jaenisch, R.
(1993)
Nature
366,
362-365[CrossRef][Medline]
[Order article via Infotrieve] 3.
Constância, M.,
Pickard, B.,
Kelsey, G.,
and Reik, W.
(1998)
Genome Res.
8,
881-900 4.
Haaf, T.
(2001)
Chromosome Res.
9,
263-271[CrossRef][Medline]
[Order article via Infotrieve] 5.
Feil, R.,
and Khosla, S.
(1999)
Trends Genet.
15,
431-435[CrossRef][Medline]
[Order article via Infotrieve] 6.
Bird, A. P.,
and Wolffe, A. P.
(1999)
Cell
99,
451-454[CrossRef][Medline]
[Order article via Infotrieve] 7.
Reik, W.,
and Walter, J.
(2001)
Nat. Rev. Genet.
1,
21-31 8.
Hatada, I.,
Sugama, T.,
and Mukai, T.
(1993)
Nucleic Acids Res.
21,
5577-5582 9.
Hayashizaki, Y.,
Shibata, H.,
Hirotsune, S.,
Sugino, H.,
Okazaki, Y.,
Sasaki, N.,
Hirose, K.,
Imoto, H.,
Okuizumi, H.,
Muramatsu, M.,
Komatsubara, H.,
Shiroishi, T.,
Moriwaki, K.,
Katsuki, M.,
Hatano, N.,
Sasaki, H.,
Ueda, T.,
Mise, N.,
Takagi, N.,
Plass, C.,
and Chapman, V. M.
(1994)
Nat. Genet.
6,
33-39[CrossRef][Medline]
[Order article via Infotrieve] 10.
Feil, R.,
Boyano, M. D.,
Allen, N. D.,
and Kelsey, G.
(1997)
J. Biol. Chem.
272,
20893-20900 11.
Glenn, C. C.,
Saitoh, S.,
Jong, M. T.,
Filbrandt, M. M.,
Surti, U.,
Driscoll, D. J.,
and Nicholls, R. D.
(1996)
Am. J. Hum. Genet.
58,
335-346[Medline]
[Order article via Infotrieve] 12.
Greally, J. M.,
Gray, T.,
Babriel, J. M.,
Song, L. S.,
Zemel, S.,
and Nicholls, R. D.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
14430-14435 13.
Shemer, R.,
Hersko, A. Y.,
Perk, J.,
Mostoslavsky, R.,
Tsuberi, B. Z.,
Cedar, H.,
Buiting, K.,
and Razin, A.
(2000)
Nat. Genet.
26,
440-443[CrossRef][Medline]
[Order article via Infotrieve] 14.
Bielinska, B.,
Blaydes, S. M.,
Buiting, K.,
Yang, T.,
Krajewska-Walasek, M.,
Horsthemke, B.,
and Brannan, C. I.
(2000)
Nat. Genet.
25,
74-78[CrossRef][Medline]
[Order article via Infotrieve] 15.
Saitoh, S.,
and Wada, T.
(2000)
Am. J. Hum. Genet.
66,
1958-1962[CrossRef][Medline]
[Order article via Infotrieve] 16.
Gregory, R. I.,
Randall, T. E.,
Johnson, C. A.,
Khosla, S.,
Hatada, I.,
O'Neill, L. P.,
Turner, B. M.,
and Feil, R.
(2001)
Mol. Cell. Biol.
21,
5426-5436 17.
Hu, J.-F.,
Pham, J.,
Dey, I., Li, T., Vu, T. H.,
and Hoffmann, A. R.
(2000)
Endocrinology
141,
4428-4435 18.
Yoshida, M.,
Kijima, M.,
Akita, M.,
and Beppu, T.
(1990)
J. Biol. Chem.
265,
17174-17179 19.
Cattanach, B. M.,
and Kirk, M.
(1985)
Nature
315,
496-498[CrossRef][Medline]
[Order article via Infotrieve] 20.
Dean, W. L.,
Bowden, L.,
Aitchison, A.,
Klose, J.,
Moore, T.,
Meneses, J. J.,
Reik, W.,
and Feil, R.
(1998)
Development (Camb.)
125,
2273-2282[Abstract] 21.
Bonner, W. M.,
West, M. H.,
and Stedman, J. D.
(1980)
Eur. J. Biochem.
109,
17-23[Medline]
[Order article via Infotrieve] 22.
Keohane, A. M.,
Lavender, J. S.,
O'Neill, L. P.,
and Turner, B. M.
(1995)
Dev. Genet.
22,
65-73 23.
O'Neill, L. P.,
and Turner, B. M.
(1995)
EMBO J.
14,
3946-3957[Medline]
[Order article via Infotrieve] 24.
White, D. A.,
Belyaev, N. D.,
and Turner, B. M.
(1999)
Methods
19,
417-424[CrossRef][Medline]
[Order article via Infotrieve] 25.
Gregory, R. I.,
and Feil, R.
(1999)
Nucleic Acids Res.
27,
R1-R4 26.
Shemer, R.,
Birger, Y.,
Riggs, A. D.,
and Razin, A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
10267-10272 27.
Barlow, A. L.,
van Drunen, C. M.,
Johnson, C. A.,
Tweedy, S.,
Bird, A.,
and Turner, B. M.
(2001)
Exp. Cell. Res.
265,
90-103[CrossRef][Medline]
[Order article via Infotrieve] 28.
Carmen, A. A.,
Rundlett, S. E.,
and Grunstein, M.
(1996)
J. Biol. Chem.
271,
15837-15844 29.
Wu, J.,
Suka, N.,
Carlson, M.,
and Grunstein, M.
(2001)
Mol. Cell
7,
117-126[CrossRef][Medline]
[Order article via Infotrieve] 30.
Carmen, A. A.,
Griffin, P. R.,
Calaycay, J. R.,
Rundlett, S. E.,
Suka, Y.,
and Grunstein, M.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
12356-12361 31.
Zhang, Y., Ng, H. H.,
Erdjument-Bromage, H.,
Tempst, P.,
Bird, A.,
and Reinberg, D.
(1999)
Genes Dev.
13,
1924-1935 32.
Chen, W. Y.,
and Townes, T. M.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
377-382 33.
Hebbes, T. R.,
Clayton, A. L.,
Thorne, A. W.,
and Crane-Robinson, C.
(1994)
EMBO J.
13,
1823-1830[Medline]
[Order article via Infotrieve] 34.
Luger, K.,
Mader, A. W.,
Richmond, R. K.,
Sargent, D. F.,
and Richmond, T. J.
(1997)
Nature
389,
251-260[CrossRef][Medline]
[Order article via Infotrieve] 35.
Leuba, S. H.,
Bustamante, C.,
Zlatanova, J.,
and van Holde, K.
(1998)
Biophys. J.
74,
2823-2829[Medline]
[Order article via Infotrieve] 36.
Annunziato, A. T.,
and Hansen, J. C.
(2000)
Gene Expr.
9,
37-61[Medline]
[Order article via Infotrieve] 37.
Wang, X., He, C.,
Moore, S. C.,
and Ausio, J.
(2001)
J. Biol. Chem.
276,
12764-12768 38.
Taddei, A.,
Maison, C.,
Roche, D.,
and Almouzni, G.
(2001)
Nat. Cell Biol.
3,
114-120[CrossRef][Medline]
[Order article via Infotrieve] 39.
Grandjean, V.,
O'Neill, L.,
Sado, T.,
Turner, B.,
and Ferguson-Smith, A.
(2001)
FEBS Lett.
488,
165-169[CrossRef][Medline]
[Order article via Infotrieve] 40.
Pedone, P. V.,
Pikaart, M. J.,
Cerrato, F.,
Vernucci, M.,
Ungaro, P.,
Bruni, C. B.,
and Riccio, A.
(1999)
FEBS Lett.
458,
45-50[CrossRef][Medline]
[Order article via Infotrieve] 41.
El Kharroubi, A.,
Piras, G.,
and Stewart, C. L.
(2001)
J. Biol. Chem.
276,
8674-8680
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. W. McCool, X. Xu, D. B. Singer, F. E. Murdoch, and M. K. Fritsch The Role of Histone Acetylation in Regulating Early Gene Expression Patterns during Early Embryonic Stem Cell Differentiation J. Biol. Chem., March 2, 2007; 282(9): 6696 - 6706. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Li, T. H. Vu, G. A. Ulaner, E. Littman, J.-Q. Ling, H.-L. Chen, J.-F. Hu, B. Behr, L. Giudice, and A. R. Hoffman IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch Mol. Hum. Reprod., September 1, 2005; 11(9): 631 - 640. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. H. Vu, T. Li, and A. R. Hoffman Promoter-restricted histone code, not the differentially methylated DNA regions or antisense transcripts, marks the imprinting status of IGF2R in human and mouse Hum. Mol. Genet., October 1, 2004; 13(19): 2233 - 2245. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Schumacher and W. Doerfler Influence of in vitro manipulation on the stability of methylation patterns in the Snurf/Snrpn-imprinting region in mouse embryonic stem cells Nucleic Acids Res., March 5, 2004; 32(4): 1566 - 1576. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yang, T. Li, T. H. Vu, G. A. Ulaner, J.-F. Hu, and A. R. Hoffman The Histone Code Regulating Expression of the Imprinted Mouse Igf2r Gene Endocrinology, December 1, 2003; 144(12): 5658 - 5670. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Thomas, K. Haleem, A. B. Siddique, W. J. Simmons, N. Sen, D.-J. Zhang, and V. K. Tsiagbe Regulation of Mouse Mammary Tumor Virus env Transcriptional Activator Initiated Mammary Tumor Virus Superantigen Transcripts in Lymphomas of SJL/J Mice: Role of Ikaros, Demethylation, and Chromatin Structural Change in the Transcriptional Activation of Mammary Tumor Virus Superantigen J. Immunol., January 1, 2003; 170(1): 218 - 227. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Matarazzo, M. L. De Bonis, R. I. Gregory, M. Vacca, R. S. Hansen, G. Mercadante, M. D'Urso, R. Feil, and M. D'Esposito Allelic inactivation of the pseudoautosomal gene SYBL1 is controlled by epigenetic mechanisms common to the X and Y chromosomes Hum. Mol. Genet., December 1, 2002; 11(25): 3191 - 3198. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |