HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 14, 12109-12117, April 5, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/14/12109    most recent M111341200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hong, S.-K. Articles by Kim, I.-H. Search for Related Content PubMed PubMed Citation Articles by Hong, S.-K. Articles by Kim, I.-H. Social Bookmarking                      What's this?

Msn2p/Msn4p Act as a Key Transcriptional Activator of Yeast Cytoplasmic Thiol Peroxidase II^*

Seung-Keun Hong, Mee-Kyung Cha, Yong-Soo Choi, Won-Cheol Kim, and Il-Han Kim

From the Department of Biochemistry, Paichai University, Taejon 302-735, Republic of Korea

Received for publication, November 28, 2001, and in revised form, January 22, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Aerobically growing cells are continuously challenged by reactive oxygen species. Reactive oxygen species are potent oxidants capable of damaging all cellular components including DNA, protein, and membrane lipid. To protect against the toxicity of reactive oxygen species, aerobic organisms are equipped with an array of defense mechanisms (1). Among these, a new type of peroxidase, named thiol peroxidase, thioredoxin peroxidase (TPx),¹ protector protein, thiol-specific antioxidant protein (TSA), or peroxiredoxin, has been known to eliminate H₂O₂ and alkyl hydroperoxides using a thiol-reducing equivalent (2-7). The new type of peroxidase with cysteine as the primary site of catalysis has been discovered from prokaryotes to eukaryotes (2-22). The TPx family, also referred to as the TSA/alkyl hydroperoxide reductase family or peroxiredoxin family, is a large family of a new type of peroxidase. In mammalian tissue, at least six types of TPx isoenzymes have been identified. Recently, in addition to two types of TPx isoenzymes (TSA I, YML028W (2); TSA II/alkyl hydroperoxide reductase 1, YLR109W (15, 16)) described previously as yeast members of the TSA/alkyl hydroperoxide reductase family, we have characterized three TPx homologues (YDR453C, YBL064C, and YIL010W) as a new member of the yeast TPx family (22). Evidence from our recent work indicates that different TPx isoenzymes are localized in distinct cellular organelles, where they are likely to serve diverse functions in yeast cells (22). TSA I and TSA II (Ahp1) were described as a general hydroperoxide peroxidase to remove H₂O₂ and alkyl hydroperoxide (2, 15, 16, 22). Three novel isoforms showed a distinct thiol peroxidase activity supported by thioredoxin and appeared to be distinctively localized in the cytoplasm, mitochondria, and nucleus. Each isoform was named after its subcellular localization such as cytoplasmic TPx I (cTPx I or TSA I), cTPx II (YDR453C), cTPx III (TSA II/alkyl hydroperoxide reductase 1), mitochondrial TPx (YBL064C), and nuclear TPx (YIL010W) (22). Unlike other TPx-null mutants, the cTPx II-null mutant showed a slow growth phenotype (22). In contrast to other cTPx-null mutants, the cTPx II-null mutant did not recover growth comparable with that of its parent type during the longer cultivation. Transcriptional activities of the TPx isoenzyme genes during the yeast growth cycle from log phase to stationary phase were quite different from each other. Expression of the cTPx II gene appeared to be elevated gradually as yeast cells grew and highly induced in response to various oxidative stresses (22). Taken together, these results suggested that cTPx II is involved in yeast growth as an antioxidant, although the antioxidant function is not clearly understood.

Many cells are able to adapt to oxidative stress by increasing the level of antioxidant proteins. The Saccharomyces cerevisiae transcription factor Yap1p plays an important role in oxidative stress response by activating target genes involved in cellular defense against oxidative damage. Yap1p activates transcription by binding to a specific DNA sequence located in the promoter of its targets (23). Yap1p targets involved in oxidative stress response include TRx2 (thioredoxin) (24), TRR1 (thioredoxin reductase) (25), GPx2 (glutathione peroxidase) (26), GLR1 (glutathione reductase) (27), TSA1 (cTPx I), cTPx II (27, 28), and AHP1 (cTPx III) (16). The transcriptional factor Yap1 is a bZIP DNA binding protein of the AP1 family (29) that binds the sequence T(T/G)ACTAA, named the Yap1 response element (YRE) (24, 30, 31). Yap1-mediated transcription can be activated by oxidative stress (24), and the activation is attributed to oxidative stress-induced nuclear localization of Yap1 involving the nuclear export receptor Crm1 (Xpo 1) (32, 33). Another important transcriptional factor in S. cerevisiae Msn2p and the partially redundant factor Msn4p are key regulators of oxidative stress-responsive genes expression (34). In addition to their involvement in the oxidative stress response, they are also implicated in control of the multiple stress responses to carbon source starvation, osmotic stress, and heat stress (34). Msn2p and Msn4p, Cys₂His₂ zinc finger proteins, recognize and bind to STRE (CCCCT) (35, 36). The activation is attributed to the accumulation of both factors in the nucleus under these stress conditions. The nuclear localization of Msn2p/Msn4p is down-regulated by protein kinase A (PKA) activity or increasing levels of cAMP and up-regulated by stress (37). PKA, which has been implicated in the coordination of several essential events such as cell growth (38), entry into cell division (inhibition of G₁ cyclin activity) (39, 40), and reprogramming of transcription at diauxic transition during yeast growth (41), acts as a potent repressor of STRE-mediated transcription.

In addition to two YREs, the promoter of the cTPx II gene contains two potential STREs, which suggests that Msn2p/Msn4p control expression of cTPx II. It has been suggested that both stress-related transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II in response to oxidative stress (28). In the present study, we have demonstrated for the first time that cTPx II is a transcriptional target of Msn2p/Msn4p. Furthermore, we have shown that transactivation of the cTPx II promoter by Msn2p/Msn4p is attributed to stress-responsive down-regulation of the Ras/cAMP and TOR signaling pathways.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Strains and Media-- S. cerevisiae strains used in this study were grown in rich medium (YPD, 1% yeast extract, 2% Bactopepton, and 2% glucose; YPGE; 1% yeast extract, 2% Bactopepton, 3% glycerol, and 1% ethanol) or in synthetic minimal medium (SD) supplemented with the appropriate nutrients. The tor1 mutant strain NH349-3d (MAT, leu2-3,112, ura3-52, rme1, trp1, his4, GAL⁺, HMLa, tor1::LEU2-4), the tor2 mutant strain JK350-18a (MAT, leu2-3,112, ura3-52, rme1, trp1, his4, GAL⁺, HMLa, ade2, tor2::ADE2-3/YCplac111::tor2-21ts), and their parent strain JK9-3da (MAT leu2-3,112, ura3-52, rme1, trp1, his4, GAL⁺, HMLa) were kindly provided by Dr. Michael N. Hall (University of Basel Biozentrum). The ras1 mutant (MAT, leu2-1, ura3-52, trp1-63, ade2-101, lys2-801, ras1::LEU2-4), the ras2 mutant (MAT, leu2-1, ura3-52, trp1-63, ade2-101, lys2-801, ras2::LEU2-4), and their parent strain YPK9 (MAT, leu2-1, ura3-52, trp1-63, ade2-101, lys2-801) were kindly donated by Dr. S. Michal Jazwinski (Louisiana State University, New Orleans, LA). Wild-type strain SEY6210 (MAT, leu2-3, ura3-52, his3-200, lys2-801, trp1-901, suc2-9, mel) and its isogenic yap1 mutant, SM13 (yap1::HisG), were kindly provided by Dr. Stean T. Coleman (University of Iowa). Wild-type strain JD7-7C (MAT, ura3-52, leu2, trpA, K⁺) used in the promoter study is from our laboratory stock. The msn2/4 double mutant strain YM24 (MAT, ade2, can1, leu2, ura3, msn2-3::HIS3, msn4-1::TRP1) and its wild-type strain, W303-1A, were kindly provided by Dr. Michael Jacquet (Universite Paris-Sud). The skn7 mutant strain (Mat , ade2-1 trp1-1 can100leu2-3112 his3-11 ura3 skn7::HIS3) and its parent strain, W303-1a, were kindly donated by Dr. Desmond Raid (Division of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Harvard Medical School).

Construction of Wild-type and Mutant cTPx II Promoter--Galactosidase (lacZ) Fusion-- A cTPx II promoter-lacZ fusion plasmid was constructed using a PCR-amplified DNA fragment. A putative promoter sequence of cTPx II was identified by the analysis with the SGD program (Stanford University). The promoter sequence (position 601 to 1) was amplified using genomic DNA from a yeast strain (JD7-7C) and oligonucleotides TF (5"-CGGGGTACCTGTAGCCCTATATA GACATTACC) (forward primer) and TR (5"-CGCGGATTCGATTGGTTTTTT ACGTTCTTGTAA) (reverse primer). These primers introduce a KpnI (forward) and BamHI (reverse) site (underlined) for in-frame directional cloning into plasmid digested with KpnI and BamHI. To make -galactosidase-fused promoter sequences, the lacZ gene was amplified with primers 5'-CGCGGATCCATGACCATGATTACGGATTCACT (forward primer) and 5'-GGTGAAGCTTATATTATTTTTGACACCAGACC (reverse primer), digested with BamHI and HindIII, and cloned into YEG-HIR525 digested with the same enzymes to produce pYLac. The PCR products of the cTPx II promoter were digested with KpnI and BamHI and cloned into pYLac digested with KpnI and BamHI to give pYcTPxIIP-LacZ fusion vector. DNA sequencing confirmed that no mutation had been introduced in the promoter during PCR amplification. Site-directed mutagenesis was carried out using an overlap extension PCR method. The TF and TR primers for amplification of the cTPx II promoter were used as external primers. Four internal primers (5"- CGGGGTACCTGTAGCCCTATATAGACAAAAGAAAGTATG, YRE1 forward; 5"-CCAGGTACATACTTTCTTTTGTCTA, YRE1 reverse; 5"- GTTTTTTTTGAAAGAAAGCGCTACGAC, YRE2 forward; and 5"-GTCGTAGCGCTTTCTTTCAAAAAAAAC, YRE2 reverse) were designed to introduce substitutions (TTACTAA, YRE1 site to AAAGAAA, TTAGTAA, and YRE2 site to AAAGAAA) in each of the two YREs present in the cTPx II promoter. Four internal primers (5"-CTATATGCGAACATCTAGTTTACAAG, STRE1 forward; 5"-CTTGTAAACTAGATGTTCGCATATAG, STRE1 reverse; 5'-GGGCTGATCCAACATTACAATTGG, STRE2 forward; and 5"-CCAATTGTAATGTTGGATCAGCCC, STRE2 reverse) were designed to introduce substitutions (CCCCT to AACAT) in each of the two STRES (STRE1 and STRE2) present in the promoter. Each of the PCR products was digested with KpnI and BamHI and cloned into pYLac digested with KpnI and BamHI to give pYcTPxIIP-Mutant-LacZ fusion vector. DNA sequencing confirmed that mutation had been introduced in the corresponding STRE and YRE sites in the TPx II promoter. All kinds of STRE and YRE mutants (double, triple, and quadruple mutants) were made using the appropriate pYcTPxIIP-Mutant-LacZ vector and the combination of internal and external primers. The location of the respective YREs and STREs with reference to the cTPx II start codon is shown in Fig. 1.

Assay for -Galactosidase Activity-- Cells were harvested and disrupted by vortexing with glass beads, and -galactosidase activity was assayed using O-nitrophenyl--D-galactoside essentially as described previously (42). The -galactosidase activity is expressed as unit (increase in A_412 nm resulting from O-nitrophenyl--D-galactoside hydrolyzed by -galatosidase/10 min/mg protein).

Western, Northern, and RT-PCR Analysis-- Immunoblot analysis was performed using rabbit polyclonal antibodies against cTPx II. Transfer of proteins from 12% SDS-PAGE gels to nitrocellulose and processing of nitrocellulose blots were carried out according to a standard protocol. Northern blot analysis of cTPx II mRNA was carried out according to a standard protocol. Yeast total RNA (20 µg) was fractionated in a 1.5% formaldehyde-agarose gel and transferred to a nylon membrane, and the resultant blot was hybridized with ³²P-labeled cTPx II structural gene. For RT-PCR analysis of cTPx II mRNA, 2 µg of yeast total RNA was reverse-transcribed with a forward primer of the cTPx II structural gene according to a standard protocol. Amplifications of cDNAs of cTPx II and control ACT1 (actin 1) were performed for 15 cycles, and the PCR products were electrophoresed in 1.5% agarose gels and visualized with ethidium bromide.

Other Methods-- Protein concentration was determined using the Bradford protein assay kit (Bio-Rad). Yeast transformation, DNA, protein extraction from yeast, and other methods not mentioned were carried out according to the supplier's manual or a standard protocol described previously (43).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The Transcription of cTPx II Is Induced in Response to Oxidative Stress-- Previously, we reported that exposure of yeast cells harboring the cTPx II-lacZ gene fusion vector to oxidative stress increases the -galactosidase activities (22). To investigate the cTPx II transcriptional response to oxidative stress, exponentially growing cells were exposed to varying concentrations of H₂O₂ (0.1, 0.2, and 0.5 mM) and diamide (0.5, 1, and 1.5 mM) for 30 min, and the intracellular levels of the cTPx II protein and mRNA were analyzed. The immunoblot analysis for cTPx II in late log-phase cells grown in a rich media (YPD; cell density, A_600 nm = 20) indicates that the protein level is very low (about 0.02% of total soluble protein) compared with that of cTPx I (Fig. 1A). There are very similar types of cytoplasmic TPxs in yeasts (i.e. cTPx I and cTPx II) (i.e. 86% identities, 96% positives) (22). Cytoplasmic TPx I (TSA1) is an abundant protein even under noninduced conditions (0.7% of total soluble protein), and its synthesis rate was constant throughout yeast life but increased upon exposure to oxidative stress (3, 22). Cytoplasmic TPx II is also an inducible protein in response to oxidative stress, but in contrast to cTPx I, cTPx II was elevated as a function of yeast growth (Fig. 1B) (22). A gradual increase of band intensity as a function of cell growth was consistent with the previous observation of growth-dependent increase of transcriptional activity in terms of the -galactosidase activity under control of the cTPx II promoter (22). Comparative Western blot (Fig. 1B) and RT-PCR (Fig. 1C) analyses showed that the protein and mRNA levels in early log-phase cells (cell density, A_600 nm = 5) were very low but that the expression of cTPx II was dramatically induced in response to exposure of the yeasts to H₂O₂ and diamide.

View larger version (38K): [in this window] [in a new window]   Fig. 1.   cTPx II expression in response to oxidative stress and during yeast growth. A, Western blot analysis of the expression level of cTPx II. The total soluble proteins from the log-phase cells (A600 nm = 20) (Crude Protein) were used for the analysis (from the left, 50, 100, and 200 µg), and cTPx II protein as a standard was loaded for the Western blot (from the left, 50, 100, and 200 ng). B, Western blot analysis of cTPx II expression in response to oxidative stress and during yeast growth. To investigate the expression level of cTPx II as a function of yeast growth, each of the total soluble proteins obtained from yeast cells grown in a rich media (YPD) to A600 nm = 1 (lane 2), 5 (lane 3), 10 (lane 4), and 15 (lane 5) was used for the Western blot (Growth). Lane 1 indicates the Northern blot for 200 ng of cTPx II as a standard. In YPD media, the yeast cells can grow to about A600 nm = 25. To investigate the induction of cTPx II in response to oxidative stress, increasing concentrations of H2O2 (from the left, 0.1, 0.2, and 0.5 mM) and diamide (from the left, 0.5, 1.0, and 1.5 mM) were exposed to exponentially growing cell (A600 nm = 5) for 30 min. Throughout this experiment, 200 µg of soluble proteins was separated on a 12% SDS-PAGE gel for Western blot analysis. C, RT-PCR analysis of the mRNA level of cells exposed to H2O2 and diamide. Total RNA was prepared from half of the amount of cells used for Western blot. For RT-PCR analyses of cTPx II mRNA and ACT1 mRNA, 2 µg of the total RNA was reverse-transcribed, and the resultant cDNA was amplified in a 20-µl reaction volume for 15 cycles of PCR. Each 20-µl sample of the cTPX II PCR products and 5-µl sample of the ACT1 PCR products was electrophoresed in a 1.5% agarose gel and stained with ethidium bromide. The PCR product of ACT1 was loaded to examine total RNA variation. Lane S shows a DNA size marker (from the top, 2, 1.6, 1.2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, and 0.4 kb).

Taken together, these results demonstrate that expression of cTPx II is increased as a function of yeast growth and that cTPx II is an inducible protein in response to oxidative stress.

Msn2p/Msn4p Act as Key Transcription Factors to Regulate Expression of cTPx II-- Recently, it has been reported that both transcription factors Yap1p and Skn7p regulate cTPx I and cTPx II expression (28). However, the difference in expression pattern between cTPx II and cTPx I during yeast life suggests that another transcription factor could be involved in cTPx II expression. To test this possibility, the mRNA level of cTPx II was investigated in various mutant strains lacking oxidative stress-related transcription factors such as Yap1p, Skn7p, and Msn2p/Msn4p (Fig. 2). Comparative analyses of the cTPx II transcripts in yeast mutants lacking Yap1p, Skn7p, and Msn2p/Msn4p (i.e. yap1, skn7, and msn2/4, respectively) were performed. To determine whether Msn2p/Msn4p are involved in the induction of cTPx II in response to H₂O₂ and diamide, reverse transcription was carried out, followed by amplification. The fold induction in msn2/4 in response to H₂O₂ and diamide was very low compared with that of its parent strain, W303-1a (Fig. 2A). To compare the inducibility of the transcription factors in response to H₂O₂, the levels of the transcripts in yap1, skn7, and msn2/4 were analyzed using RT-PCR (Fig. 2B) and Northern blots (Fig. 2D) after treatment of the exponentially growing cells (A_600 nm = 5) with 0.5 mM H₂O₂. In wild-type cells, the cTPx II mRNA level was dramatically induced upon H₂O₂ treatment. Only in msn2/4 was a significant induction of the cTPx II mRNA level not observed. In skn7, the induced level was significantly higher compared with that in msn2/4, although the level is significantly lower when compared with that of the wild-type (W303-1a). In contrast, the induced level in yap1 was similar to that of its wild-type (SEY6210). Also, RT-PCR and Northern blots were performed using total RNA from the late log-phase wild-type and the null mutants (A_600 nm = 20) (Fig. 2, C and D). The mRNA level in msn2/4 was very low even though when compared with those of yap1 and skn7, confirming that Msn2p/Msn4p act as principal transcription factors to regulate cTPx II expression. Interestingly, the transcript of cTPx II in yap1 is rather increased compared with its wild-type. This contrary result could be explained in terms of the Msn2p/Msn4p-mediated induction by an oxidative stress caused by deletion of Yap1p. Taken together, these results suggest that Msn2p/Msn4p act as key transcription factors to regulate expression of cTPx II.

View larger version (64K): [in this window] [in a new window]   Fig. 2.   RT-PCR and Northern blot analyses for the transcription of cTPx II. A, RT-PCR analysis of the msn2/4 double mutant in response to H2O2 and diamide. Exponentially growing msn2/4 and its wild-type strain, W303-1a, were exposed to increasing concentrations of H2O2 (from the left, 0.1, 0.2, and 0.5 mM) and diamide (from the left, 0.5, 1.0, and 1.5 mM) for 30 min. The first and second lanes for ACT1 show the ACT1 RT-PCR products from untreated cells and cells treated with 0.5 mM H2O2, respectively. B, RT-PCR analyses of yap1 (yap), msn2/4 (msn), and skn7 (skn) exposed to H2O2. Exponentially growing yap1, the wild-type cells (SEY6210 (SEY)), msn2/4, skn7, and their wild-type cells (W303-1a (W303)) were exposed to 0.5 mM H2O2 for 30 min, and we performed RT-PCR analysis for the mRNA levels of cTPx II and ACT1. C, RT-PCR analyses for the cTPx II mRNA levels of yap1 (yap), msn2/4 (msn), and skn7 (skn). The late log-phase cells were harvested to analyze the transcripts of cTPx II. D, Northern blot analysis for the transcription of cTPx II upon exposure to oxidative stress and during growth. For the Northern blot, each 200-µg sample of the total RNAs was separated on a 1.5% formaldehyde-agarose gel. The mRNA samples are the same as those for the RT-PCR analysis.

The cTPx II Promoter Contains Functional STREs-- Computer-assisted analysis of the cTPx II promoter identified two potential YREs located at positions 582 (YRE1; 5'-TTACTAA) and 472 (YRE2; 5"-TTAGTAA) relative to the ATG translation initiation codon (Fig. 3). In addition, the cTPx II promoter also contains two putative STREs located at positions 316 (STRE1; 5'-CCCCT) and 267 (STRE2: 5'-CCCCT) (Fig. 3). Either or both of the two YRE sites (YRE1 and YRE2) were replaced with AAAGAAA. Also, either or both of the STRE sites were replaced with AACAT (Fig. 3). The wild-type and mutated cTPx II promoters were fused to the Escherichia coli lacZ gene in plasmid pYLac to give cTPxII-lacZ fusion vectors. The lacZ expression vectors under control of wild-type and mutated cTPx II promoters were transformed to obtain WcTPxII carrying wild-type cTPx II promoter-lacZ fusion vector and strains carrying mutated cTPx II promoter-lacZ fusion vectors (MutYRE1, MutYRE2, MutYRE1/2, MutSTRE1, MutSTRE2, and MutSTRE1/2; Fig. 3). The -galactosidase activity was assayed for each of the transformants grown in a synthetic media. The expressed -galactosidase activity under control of the cTPx II promoter was exponentially increased during late log-phase growth (Fig. 4A). The mutations in YRE1 (MutYRE1) and STRE1 (MutSTRE) resulted in a significant decrease in the transactivation level throughout yeast life. Mutation of STRE2 (MutSTRE2), which is the site closest to the initiation codon, had the most deleterious effect, causing a near complete loss of -galactosidase activity when compared with the wild-type cTPx II promoter. In contrast, the mutation of YRE2 (MutYRE2) did not show any significant change. Taken together, these results suggest that the STRE2 site acts as a pivotal binding site of Msn2p/Msn4p to regulate cTPx II expression, although the other sites (STRE1 and YRE1) can be functional.

View larger version (16K): [in this window] [in a new window]   Fig. 3.   Schematic representation of the cTPx II promoter. The potential YREs and STREs located at positions 582 (YRE1), 472 (YRE2) 316 (STRE1), and 267 (STRE2) are shown. Positions are relative to the translation initiation codon. The mutations in each binding element are named as described in the figure. The 601-bp DNA fragment spanning the region extending from next to the stop codon of YDR354C to before the initiation codon of cTPx II (YDR453C) was used to construct a cTPx II promoter-lacZ fusion vector.

View larger version (27K): [in this window] [in a new window]   Fig. 4.   YRE- and STRE-mediated transactivation of the cTPx II promoter. LacZ fusion vector containing either the wild-type cTPx II promoter (Wild) or the cTPx II promoter carrying mutations in the YRE sites (MutYRE1 and MutYRE2) and the STRE sites (MutSTRE1 and MutSTRE2) as the promoter of lacZ structural gene were transformed in strain JD7-7C and grown in a minimal media containing 2% glucose (SD) or 3% glycerol plus 1% ethanol (SGE) as a carbon source at 30 °C. The expressed -galactosidase (-Gal) activities were determined. A, late log-phase transactivation of the cTPx II promoter. The cells were cultured in SD medium and harvested to determine the activity of the expressed -galactosidase at the indicated time. The growth was determined in terms of the increase in absorbance at 600 nm. B, transactivation of the CTPx II promoter in response to H2O2 and during growth on a nonfermentable carbon source. The first and second bars ( and ) in each set of experiments indicate the expressed -galactosidase activities in cells grown in SD and SGE to a cell density of A600 nm = 8, respectively. The third bar () shows that the transcriptional response of cTPx II promoters after a 40-min exposure to 0.5 mM H2O2. before harvest at A600 nm = 8. The cells were grown in SD media. Values represent the average of five independent experiments. C and D, induction of STRE- and YRE-mediated transactivation of the cTPx II promoter in response to H2O2. The experimental procedure was as described in B. Curves 1-3 in C show the changes of -galactosidase activities in cells containing wild-type, MutYRE1/2, and MutSTRE1/2 in response to increasing concentrations of H2O2 for 40 min, respectively. To investigate the response of the promoter lacking both STRE and YRE sites (MutYRESTRE) to H2O2, exponentially growing cells were exposed to 0.5 mM H2O2 (D). The cells were grown in SD media. Values represent the average of five independent experiments.

We have demonstrated that transcription of cTPx II was induced in response to various oxidative stresses (Figs. 1 and 2). To ascertain the functionality of STREs and YREs in the transactivation of the cTPx II promoter, the transcriptional activity of the cTPx II promoter was maximized by exposure to H₂O₂. In Fig. 4B, comparison of responses to H₂O₂ treatment, which was carried out under the same conditions, showed that the mutation in YRE1 (MutYRE1), YRE2 (MutYRE2), and STRE2 (MutSTRE2) resulted in a remarkable decrease in the level of transactivation of the cTPx II promoter induced by H₂O₂, with a reduction in -galactosidase activity of 52%, 20%, and 46%, respectively, but that the mutation in STRE1 (MutSTRE1) resulted in no decrease in the transactivation level when compared with with the wild-type cTPx II promoter (Wild-type). Exposure of the cells to elevated concentrations of H₂O₂ (Fig. 4C) induced transcriptional activity of the cTPx II promoter (curve 1) and showed that STRE and YRE sites were required for full transcriptional activity upon oxidative stress (curves 2 and 3, respectively). Simultaneous mutation of all binding elements (MutYRE1/2 and STRE1/2) resulted in a near complete loss of -galactosidase activity even in the presence of 0.5 mM H₂O₂ (Fig. 4D). Fig. 4B also shows that a change of the carbon source in the media from glucose (SD) to glycerol and ethanol (SGE) resulted in a significant elevation of the transcriptional activities in MutSTRE1, MutYRE1, and MutYRE2. In contrast, MutSTRE2 did not responded to such a carbon source change from a fermentable sugar to a nonfermentable sugar, suggesting the possibility that transactivation of the cTPx II promoter was suppressed in yeast growth using a fermentable sugar as a carbon source.

Taken together, these results demonstrate that (i) all of the YREs and STREs are potentially functional; (ii) however, under non-oxidative-stress growth conditions (i.e. physiological conditions), STRE2 located closest to the initiation codon is a key binding element essential for transactivation of the cTPx II promoter; and (iii) YRE2 and STRE1 play an additive role in full transactivation of the cTPx II promoter under oxidative stress and physiological conditions, respectively.

As mentioned above, STREs and YREs in the cTPx II promoter could be functional. To test whether Msn2p/Msn4p and Yap1p participate in respective STRE- and YRE-mediated activation of cTPx II promoter, we introduced the wild-type cTPx II promoter-lacZ fusion plasmid into the Msn2p/Msn4p double mutant (msn2/4), the Yap1 mutant (yap1), and their parent strains (W3031-A and SEY6210, respectively). The resulting -galactosidase activity in msn2/4 was almost completely abolished (Fig. 5A), even under the oxidative stress conditions caused by H₂O₂ and diamide (Fig. 5C). In contrast, the -galactosidase activity in yap1 was rather increased when compared with the parent type as seen in the Northern blot (Fig. 2D), although under the oxidative stress condition and in the stationary-phase cells, -galactosidase activity in yap1 was slightly decreased when compared with the parent type (Fig. 5, B and D). The slight but significant reduction of -galactosidase activity in yap1 upon exposure to H₂O₂ (Fig. 5D) suggests that cTPx II is also a target of the Yap1 transcription factor, which is consistent with previous results (28). Based on these observations, a slight increase of the transcriptional activity in Yap1 under the non-oxidative stress condition (Fig. 5B) could be explained in terms of oxidative stress-induced Msn2p/Msn4p-mediated induction, which is caused by deletion of Yap1p. It is believed that deletion of Yap1p, acting as an important stress-responsive transcription factor in the cells, resulted in an increase of oxidative stress in the cell (34).

View larger version (30K): [in this window] [in a new window]   Fig. 5.   Transcriptional activity of the cTPx II promoter in msn2/4 double mutant and yap1 mutant cells. LacZ fusion vector containing the cTPx II promoter (wild-type) was transformed in strains W303-1a (an isogenic strain of the msn2/4 double mutant), msn2/4, SEY6210 (an isogenic strain of the yap1 mutant), and yap1 strains. A and B show the transcriptional activity of the cTPx II promoter in msn2/4 and yap1 as function of culture time. C and D show the transcriptional activity of the cTPx II promoter in msn2/4 and yap1 in response to 0.5 mM H2O2 and 1.5 mM diamide. The exponentially growing cells were exposed to the stress for 40 min and harvested for determination of the expressed -galactosidase activity. The cells were grown in YPD media at 30 °C. Values represent the average of five independent experiments.

Collectively, these results demonstrate that, as reported previously (28), both Skn7p and Yap1p participate in part in the transactivation of the cTPx II promoter, but Msn2p/Msn4p act as key transcription factors to regulate expression of cTPx II.

Msn2p/Msn4p-mediated Heat-shock Response of cTPx II-- We observed that the transcription of cTPx II is increased in response to heat-shock (Fig. 6). The -galactosidase activity in yeast cells harboring the cTPx II-lacZ fusion was increased upon the heat-shock, which is consistent with the results of Northern blot analysis. To examine the possibility that Msn2p/Msn4p or Yap1p could be involved in the heat-shock-induced increase, we introduced the wild-type cTPx II promoter-lacZ fusion plasmid into msn2/4, yap1, and their parent strains (W3031-A and SEY6210, respectively). The heat-shock response was abolished only in the msn2/4, suggesting Msn2p/Msn4p-mediated heat-shock response of cTPx II transcription (44). The Msn2p/Msn4p-dependent heat-shock response of cTPx II transcription could be taken as evidence supporting the observation that Msn2p/Msn4p act as key transcriptional activators of cTPx II.

View larger version (22K): [in this window] [in a new window]   Fig. 6.   Msn2p/Msn4p-mediated heat-shock response of the transcriptional activity of the cTPx II promoter. The exponentially growing W303-1a, msn2/4, SEY6210, and yap1 strains harboring the cTPx II-LacZ fusion vector were subjected to heat-shock from 30 °C to 42 °C. At the indicated time, the cells were harvested for determination of the expressed -galactosidase activity. Northern blot analysis of the levels of cTPx II mRNA in W303-1a was performed (inset of A). Curve 1 of A shows the time-dependent transcriptional activity of the cTPx II promoter in response to heat-shock. Curve 2 represents time-dependent -galactosidase activity as a control without the heat-shock. Values represent the average of five independent experiments. B and C show the heat-shock responses of msn2/4 and yap1, respectively.

Transcription of the cTPx II Gene Is Turned On at the Diauxic Shift-- When the cells are cultured in a liquid rich medium in which the major carbon source is a fermentable carbohydrate (e.g. YPD), they exhibit two distinct growth phases, followed by a stationary phase in which cells cease to divide. During the first phase, cells meet their energy requirements primarily by fermentation. The second growth phase is initiated when cells exhaust most of the fermentable carbon source, undergo a major physiological change, and begin to grow at a much slower rate. The shift between these two phases is called the diauxic shift (a switch from fermentative to oxidative metabolism) (45). Several genes such as HSP26 are transcriptionally induced during the diauxic shift, in which dramatic changes in gene expression occur (46). Previously, we have shown transcriptional activation of the cTPx II gene upon changing the carbon source from a fermentable carbohydrate (i.e. glucose) to a nonfermentable carbohydrate (glycerol plus ethanol) (Fig. 4B). To exactly follow growth-dependent transcription of the cTPx II gene, we examined whether transcription of cTPx II is dependent on the yeast growth cycle from log phase to stationary phase. Comparison of growth curves with their corresponding transcriptional activities (Fig. 4A) indicates that the transcriptional activity of cTPx II is not fully activated in cells carrying a cTPx II-lacZ fusion vector until the yeast cells reach the late log phase. The transcriptional activity is almost completely abolished only in the case of msn2/4 (Fig. 5A). Taken together, these results suggest the possibility that cTPx II is transcriptionally induced during the diauxic shift.

Rapamycin forms a complex with FKBP12 that inhibits components of signal transduction pathways, named the TOR (target of rapamycin) pathway. The target of the complex was first identified in yeast as Tor1p and Tor2p (48). Loss of TOR function at the diauxic shift induces several other physiological changes characteristic of starved cells entering the stationary phase. Inhibition of the TOR signaling pathway by lack of fermentable carbon induces nuclear translocation of the carbon-sensitive transcription factor Msn2p/Msn4p (49, 50).

To test the possibility that Msn2p/Msn4p mediated transactivation of the cTPx II promoter at the diauxic shift, we investigated transcription of the cTPx II gene after treatment with rapamycin. The levels of cTPx II mRNA shown in Fig. 7A and the inset of Fig. 7B show that rapamycin significantly increased the transcript in wild-type yeasts (W303-1a and SEY6210) and the yap1 strain. In contrast, rapamycin did not increase the transcript in the msn2/4 strain. Fig. 7B also shows that rapamycin increased the transcriptional activity of the wild-type cTPx II promoter about 3-fold. Mutation in YRE1/2 (MutYRE1/2) resulted in a still considerable increase in -galactosidase activity with a ~2.3-fold induction in the presence of a sufficient amount of rapamycin. In contrast, mutation in STRE1/2 (MutSTRE1/2) resulted in no significant response to rapamycin. Taken together, these results suggest that Msn2p/Msn4p-mediated transcription of the cTPx II gene is induced in response to the inhibitory action of rapamycin on the TOR pathway.

View larger version (37K): [in this window] [in a new window]   Fig. 7.   Transcriptional regulation of cTPx II under negative control of the TOR pathway. A and B, the transcriptional activity of the cTPx II promoter in response to rapamycin. Rapamycin (3 µg/ml) was added to exponentially growing cells (A600 nm = 5) on YPD medium. At 1 h after the addition of rapamycin, the cells were harvested for RT-PCR (A) and Northern blot (inset of B) analyses. Lanes 1 and 2 in A show the RT-PCR products for ACT1 in the absence and presence of rapamycin, respectively. Lanes 4 and 5 indicate the RT-PCR products for cTPx II in the absence and presence of rapamycin, respectively. Lane 3 represents 1.65-kb and 1.0-kb DNA size markers (from top). Lanes 1 and 2 in the inset of B are Northern blots for cTPx II mRNA in the absence and presence of rapamycin, respectively. LacZ fusion vectors containing the wild-type cTPx II promoter (wild-type), MutSTRE1/2, and MutYRE1/2 were transformed in W303-1a and analyzed for the induced -galactosidase activities in response to exposure of the exponentially growing cells to rapamycin for 1 h (B). The gray and black bars in each set of experiments show the -galactosidase activities in the untreated and treated cells, respectively. The white bars indicate the activity before the treatment. C, transcriptional activity of the cTPx II promoter in the tor1 mutant. Tor1 mutant (tor1) and its wild-type strain (JK9-3da) harboring LacZ fusions containing the cTPx II promoter were analyzed for the expressed levels of -galactosidase activities as a function of culture time. The black and gray bars indicate the activities of JK9-3da and tor1, respectively. Inset, Northern blot analysis showing the relative levels of cTPx II mRNA in exponentially growing JK9-3da (W) and tor1 (tor1) cells on YPD media. Values represent the average of five independent experiments.

Tor1p and Tor2p are key components of the TOR pathway. Cells lacking Tor1 exhibit only mild growth defects (51), but tor2 mutant does not survive because Tor2p is an essential protein that regulates cell growth (52). The dramatic increase of the cTPx II transcript upon exposure to rapamycin (Fig. 7, A and B) suggests that cTPx II is under down-regulation of the TOR pathway. To demonstrate the negative control on transactivation of the cTPx II promoter by the TOR pathway, we tested the transcriptional activity of the cTPx II promoter in tor1 and tor2 mutants (Tor1 and Tor2). The Tor2 mutant is a temperature-sensitive mutant (permissive and nonpermissive temperatures are 30 °C and 37 °C, respectively) (53). Fig. 7C shows that disruption of Tor1 resulted in an increase in -galactosidase activity with ~2-fold induction. Disruption of Tor2 at a nonpermissive temperature resulted in an increase in -galactosidase activity with ~1.7-fold induction when compared with the Tor2 mutant grown at a permissive temperature (data not shown). Northern blot analysis (inset of Fig. 7C) also suggests that Tor1p repressed the transcriptional activity of the cTPx II promoter. Collectively, these results demonstrate that Tor1p and Tor2p suppress transactivation of the cTPx II promoter via activation of the TOR pathway.

In S. cerevisiae, Ras proteins, which encode GTP-binding proteins, are activated by both growth signals (e.g. glucose) (54) and stress signals (e.g. UV radiation and starvation) (47, 55, 56). The unregulated Ras/cAMP pathway suppresses the activity of the stress-responsive transcription factors Msn2p/Msn4p, which are responsible for activation of a large number of stress-related genes (47, 55, 56). Ras proteins activate the cAMP-dependent PKA activity, which in turn suppresses the activation of transcription factors Msn2p and Msn4p by turning on the TOR pathway before diauxic growth. The transcriptional activity of the cTPx II promoter was significantly reduced in response to cAMP (data not shown). We have demonstrated that as a result of the negative control of the TOR signaling pathway, Msn2p and Msn4p activate the expression of cTPx II in response to glucose starvation and oxidative stress. To examine whether the Ras/cAMP pathway is involved in signal transduction leading to the suppression of Msn2p/Msn4p-mediated activation of cTPx II expression, we determined the transactivational ability of the wild-type cTPx II promoters in ras1 and ras2 mutant cells. The induction pattern of transcriptional activity as a function of yeast cell growth (Fig. 8, A and B) shows that in contrast to the wild-type cell (YPK9), transactivation of the cTPx II promoter in ras1 and ras2 occurs during early log-phase ras1 and ras2 cells. As shown in Fig. 8C, each disruption of Ras1 and Ras2 resulted in a significant increase in -galactosidase activity with ~5-fold and ~30-fold inductions, respectively, which is consistent with the Northern blot analysis (inset of Fig. 8C). Taken together with previous reports that activation of Msn2p/Msn4p at the diauxic shift is under negative control of the TOR and Ras/cAMP pathways (37, 41, 49, 50), these results suggest that transactivation of the cTPx II promoter results from activation of Msn2p/Msn4p at the diauxic shift.

View larger version (30K): [in this window] [in a new window]   Fig. 8.   Transcriptional activity of the cTPx II promoter in ras1 and ras2. LacZ fusion vector containing the wild-type cTPx II promoter as the promoter of the lacZ structural gene was transformed in ras1 mutant (ras1), ras2 mutant (ras2), and their wild-type strain (YPK9). The cells were cultured on YPD media in a fermentor at 30 °C. Cell growth (A) and the expressed -galactosidase activity (B) were determined at the indicated times. Curves 1-3 indicate the growth (A) or -galactosidase activity (B) of YPK9, ras1, and ras2, respectively. C shows the Northern blot and the expressed -galactosidase activity. The exponentially growing cells on YPD media were harvested at A600 nm = 5 for determination of the levels of expressed -galactosidase activity and cTPx II mRNA (Northern blot, inset). Values for -galactosidase activity represent an average of 10 independent experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In the present study, we have investigated Msn2p/Msn4p-mediated transactivation of the cTPx II promoter, and, based on the results of a series of the experiments (from Figs. 1-6), we have demonstrated that the expression of cTPx II in response to various stresses including oxidative stress, carbon starvation, and heat-shock is under the control of Msn2p/Msn4p transcription factors. Moreover, several lines of evidence as described below indicate the Msn2p/Msn4p-mediated transactivation of the cTPx II promoter under the negative control of the Ras/cAMP and TOR signaling pathways: (i) mutation of STRE2 abolished its transcriptional activity in response to the diauxic shift (Fig. 4A); (ii) major components of signaling pathways (Ras1p, Ras2p, Tor1p, Tor1p, and Tor2p) (Figs. 7 and 8), which negatively regulate nuclear translocation of Msn2p and Msn4p as their targets (34, 37, 47, 54-56), derepressed the transcription of cTPx II (Figs. 7 and 8); and (iii) the addition of rapamycin induces transactivation of the cTPx II promoter. Rapamycin is known to induce nuclear import of Msn2p and Msn4p and induction of the stress-inducible STRE genes negatively regulated by the TOR pathway (57).

In terms of Msn2p/Msn4p-mediated transactivation of the cTPx II promoter under negative control of the Ras/cAMP and TOR signaling pathways, we can explain a growth-dependent cTPx II transactivation phenomenon as follows. Ras proteins activate the cAMP-dependent PKA activity, which in turn suppresses the activation of transcription factors Msn2p and Msn4p by turning on the TOR pathway. At the phase of diauxic transition, glucose starvation begins to occur, which inhibits PKA activity, which leads to activation of the transcription factor Msn2p/Msn4p by turning off the TOR pathway (i.e. inhibition of TOR kinase activity and activation of protein phosphatase (PPase) activity).

In the present study, we also have shown that STREs and YREs are functionally different. The YRE2 site appears to be involved in the transactivation of the cTPx II promoter in response to oxidative stress, but it does not function as the transactivation element without the stress (see Fig. 4). YRE1 and STRE1 sites play additive roles, which are necessary for the maximum transactivation in response to various stresses including carbon starvation and oxidative stress. The STRE2 site acts as a pivotal binding element for the transactivation. Without the involvement of the binding element, significant transactivation does not occur without an oxidative stress (Fig. 4), which is consistent with the in vivo analysis of the cTPx II mRNA level in the msn2/4 strain (Fig. 2). Based on a series of in vivo and in vitro studies on the transcriptional regulation of cTPx II, we have concluded that Msn2p and Msn4p are principal transcription factors for transactivation of the cTPx II promoter in response to various stresses including oxidative stress, limitation of carbon source, and heat-shock.

Yap1p and Skn7p are two yeast transcriptional regulators in the control of oxidative stress. A previous study (28) has shown that these regulators activate cTPx II in response to oxidative stress. In the present study, we also have shown that Yap1p and Skn7p are required for the induction of cTPx II in response to oxidative stress, but their functions as transcriptional regulators to activate cTPx II are not as pivotal as those of Msn2/pMsn4p (Figs. 2 and 5). It is worthwhile to investigate the physiological functions of Yap1p and Skn7p, although they seem to be required for full transactivation of the cTPx II promoter.

Reactive oxygen species are generated and removed by all aerobic organisms, leading to either physiological concentrations required for normal cell function or excessive quantities (the state called oxidative stress). A balance between oxidant and antioxidant intracellular systems by antioxidant enzymes is hence vital for cell function, regulation, and adaptation to diverse growth conditions (1). Recently, we reported that the cTPx II-null mutant shows a slow growth phenotype and a remarkable decrease in stationary-phase growth in contrast to its parent and the other cytoplasmic TPx isoenzyme mutants (cTPx I and cTPx III) (22). Therefore, taken together with the growth phenotype of the cTPx II mutant mentioned above, the accumulation of cTPx II during the postdiauxic shift suggests the possibility that cTPx II plays an important antioxidant role, particularly in late log-phase and stationary-phase yeast cells.

Despite a clear involvement of the Ras/cAMP and TOR signaling pathways in activating the genes responsible for yeast proliferation and growth, it is also evident that another process is required to maintain yeast life between diauxic and stationary-phase growth. Cameron et al. (58) showed that cells without the regulatory subunit of PKA and containing only attenuated PKA activity exhibit apparently normal physiological processes during growth under glucose-limiting conditions. Furthermore, the expression of CDC25 and CDC35, which is under positive control of the Ras/cAMP system, strongly decreases as cells approach diauxic growth on glucose (59). The cellular protein levels of other cytoplasmic TPx isoenzymes (cTPx I and cTPx III) are higher than that of cTPx II throughout yeast life (22). Whereas cTPx II has the lowest potential of peroxidase activity to remove peroxides among the three cytoplasmic TPxs (i.e. cTPx I, cTPx II, and cTPx III), the cTPx II-null mutant executes the most growth retardation among them (22). Taken together, these observations suggest that the profound growth retardation of cTPx II did not simply result from oxidative stress due to the loss of peroxidase activity given by cTPx II. In this regard, not as a peroxidase enzyme to remove peroxides developed in stationary-phase growth, cTPx II might be implicated in a growth-related signaling pathway, although the exact physiological function of cTPx II remains to be determined. Our suggestion may be supported by a previous finding that one of the mammalian TPx isoenzymes (i.e. proliferation-associated gene product (Pag)), which is thought to be a mammalian counterpart of S. cerevisiae cTPx II (22), is an Abl SH3-binding protein and a physiological inhibitor of cAbl tyrosine kinase activity (60).

	FOOTNOTES

^* This work was supported by Grant 2001-1-20900-005-1 from the Basic Research Program of the Korea Science and Engineering Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Biochemistry, Paichai University, 439-6 Doma-2-Dong Seo-Gu, Taejon 302-735, Republic of Korea. Tel.: 82-42-520-5379; Fax: 82-42-520-5594; E-mail: ihkim@mail.pcu.ac.kr.

Published, JBC Papers in Press, January 30, 2002, DOI 10.1074/jbc.M111341200

	ABBREVIATIONS

The abbreviations used are: TPx, thiol peroxidase; YRE, Yap1 response element; STRE, stress response element; cTPx, cytoplasmic thiol peroxidase; TOR, target of rapamycin; PKA, protein kinase A; TSA, thiol-specific antioxidant protein; RT-PCR, reverse transcription-PCR.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES