 |
INTRODUCTION |
A major role of steroid hormones in human physiology is to
regulate gene expression during development, differentiation, and homeostasis. The mechanism used to achieve these objectives is basically the same for all members of the steroid receptor superfamily. Ligand enters the cell by passive diffusion and binds to an
intracellular receptor protein. After a still poorly understood step
called activation, the receptor steroid complexes acquire an increased affinity for DNA and bind to specific DNA sequences called hormone response elements. These DNA-bound receptor complexes recruit an
ever increasing number of coactivators, corepressors, and comodulators, the combination of which interacts with the transcriptional machinery to increase or decrease the magnitude of gene transcription (1, 2).
The levels of circulating steroids in mammals are usually well below
that required for maximal induction of the regulated genes and much
closer to that which is required, according to the dose-response curve,
to afford half-maximal induction of most genes (i.e. the
EC50). This permits relatively small differences in steroid
hormone concentration to cause major changes in the levels of gene
activation or repression. Conversely, any process that modifies the
position of the dose-response curve (or the value of the
EC50) will also affect the levels of gene expression (3,
4). In extreme conditions, the dose-response curves of two regulated
genes can be so different that a physiological concentration of steroid
will cause full induction, or repression, of one gene and have no
effect on the other. Thus, processes or factors that modify the
dose-response curve or EC50 represent an additional
mechanism for achieving differential control of gene expression by
steroid hormones in cells and organisms.
A major clinical application of steroid hormones involves antisteroids,
which block the actions of the endogenous hormones. Antisteroids, or
antagonists, have found widespread use in endocrine therapy of such
conditions as breast cancer (5), pregnancy (6), and prostate cancer
(7). However, a puzzling feature of antisteroids is that they often
display residual amounts of agonist activity that can vary between
genes and among cells (8-10) for the same gene (10-13). Clearly an
understanding of the parameters that affect the partial agonist
activity of antisteroids would be of major assistance in their clinical uses.
Several years ago, we described the first cis-acting element
that could modify both the dose-response curve of agonist steroids and
the partial agonist activity of antisteroids. This element, which we
named the glucocorticoid modulatory element
(GME),1 is located at 
3.6
kb of the rat liver tyrosine aminotransferase gene (14, 15). The
GME is fully active with a heterologous enhancer, promoter, and
reporter gene in non-liver cells (14, 16-21). The binding of a
trans-acting factor to the GME correlates with biological
activity in that mutations of the GME that reduce binding also inhibit
the biological activity (14, 16). Unexpectedly, the GME-binding factor
(GMEB) was found to be a heteromeric complex of two new proteins,
GMEB-1 and -2 (16, 22-24). Many of the properties of the GMEBs are
consistent with their being key components in the modulation of GR
transcriptional properties. The GMEBs possess intrinsic transactivation
activity, they interact with each other in addition to GRs and CBP,
they bind to DNA, they inhibit GR total transactivation, and they cause
both a right shift in the dose-response curve of agonists and a
decrease in the partial agonist activity of antagonists, presumably due
to squelching (16, 22,
24).2
Interestingly, GMEB-1 and -2 each possess a region of 93 amino acids
that is 80% identical (24). Furthermore, several other molecules with
transcriptional activity have been found to have a high degree of
homology with this 93-amino acid region and thus may comprise a family
of related molecules (24). The two best characterized members of this
possible superfamily are Suppressin (25) and the Drosophila
protein called DEAF-1 (26). Suppressin has been described as a global
negative regulator of human cell proliferation, and especially the
immune system, and appears to be the short form of a protein called
NUDR (27). DEAF-1 is a transcriptional cofactor from
Drosophila that is required for the activity of a 120-bp
response element of the Deformed gene.
To further define the mechanism of action of the GME, we sought to
identify those molecules that the GMEBs contact and could thus be
involved in modulating GR transcriptional properties. In view of the
known ability of the GMEBs to homo- and hetero-oligomerize (16),2 it is possible that the GMEBs might also
heterooligomerize with other members of the KDWK superfamily, such as
Suppressin and DEAF-1. Alternatively, a currently unidentified protein
may be involved. In this study, we examined Suppressin and DEAF-1 for their ability to interact with the GMEBs and used a yeast two-hybrid screen to isolate other potential interacting proteins. One of the
proteins identified in the yeast two-hybrid screen is Ubc9, which is a
human homolog of the E2 ubiquitin-conjugating enzymes of yeast. Ubc9
often conjugates an ubiquitin-like molecule, called small
ubiquitin-like modifier-1 (SUMO-1), to proteins in vertebrate cells
(28, 29). Sumoylation of proteins can have a variety of effects, such
as inhibiting the ubiquitin-mediated proteolysis of Mdm2 (30),
increasing the nuclear translocation of RanGAP1 (31, 32) and Dorsal
(33), and regulating the transcriptional activity of androgen receptor
(AR) (34) and HIPK2 (35). However, Ubc9 also displays many of the same
activities with other proteins in a manner that is independent of
sumoylation, for example enhancing the transcriptional activity of ETS1
(36) and AR (37) but repressing the activity of TEL (38) and promoting
the nuclear translocation of Vsx-1 (39). Thus, Ubc9 appears to have
both enzymatic and non-enzymatic effects in cells. Ubc9 also binds to a
large number of proteins, possibly due to electrostatic interactions that are mediated by the presence of patches of both positive and
negative charges on the surface of Ubc9 (40).
Our studies indicate that neither Suppressin nor a mammalian homolog of
DEAF-1 are involved in GME action. Conversely, Ubc9 exhibits all of the
characteristics expected for an intermediate that would participate in
the ability of the GME to modulate the dose-response curve and partial
agonist activity of GR complexes. These effects occur in the absence of
sumoylation by Ubc9.
| |
MATERIALS AND METHODS |
Unless otherwise indicated, all operations were performed at
0 °C.
Chemicals--
Yeast media (Bio 101 Inc., Vista, CA),
3-amino-1,2,4-triazole (Sigma), and 5-fluroorotic acid
(Invitrogen) were all commercially available. Dexamethasone
(Dex) was obtained from Sigma. Dex-Ox (41) and Dex-Mes (42) were
prepared as described. Restriction enzymes and digestions were
performed according to the manufacturer's specifications (New England
Biolabs, Beverly, MA).
Antibodies--
Anti-GMEB antibody, which detects both native
and recombinant GMEB-1 and -2, has been described (22, 24). Anti-DEAF-I antibody (rabbit polyclonal) and anti-Suppressin antibody (mouse monoclonal) were gifts from William McGinnis (University of California, San Diego, CA) and Robert LeBoeuf (University of Alabama at Birmingham, Birmingham, AL), respectively.
Plasmids--
The following plasmid constructs (pM/GMEB-1,
pVP16/GMEB-1, pCMVSport/GMEB-1, FLAG/GMEB-1, pcDNA3.1/HisA/GMEB-1,
pM/GMEB-2, pVP16/GMEB-2, pCR II/GMEB-2, pcDNA3.1/HisA/GMEB-2,
FLAG/GMEB-2, pcDNA3.1/HisC/GR, pRBalI17, pM/GR, pVP16/GR,
pM, and pVP16) (24), along with GR-407C (43), have already been
described. pSG5/GMEB-1 was prepared by cloning the
EcoRI-XbaI fragment of pM/GMEB-1 into pSG5.
pSG5/GMEB-2 was made by cloning the BamHI fragment from pcDNA3.1/HisA/GMEB-2 into pSG5. pM/Suppressin and pVP16/Suppressin were
constructed by cloning a PCR product (obtained after amplification of
rat Suppressin-pET15b from Robert LeBoeuf, University of Alabama at
Birmingham) with Pfu polymerase into the BamHI
and HindIII sites of pM and pVP16. Similarly, pM/DEAF-1 and
pVP16/DEAF-1 constructs were prepared by cloning the PCR amplified
product from DEAF-1-pET15b (William McGinnis, University of California,
San Diego, CA) into the MluI and XbaI sites of pM
and pVp16. mouse Ubc9 (mUbc9) constructs VP16/mUbc9, pFLAGCMV2/mUbc9,
and the mutant pFLAGCMV2/mUbc9[C93S] were kind gifts from Olli
Jänne (University of Helsinki, Finland). GAL/mUbc9 was prepared
by cloning a SalI-BamHI fragment of VP16/mUbc9 into pM (CLONTECH, Palo Alto, CA). RanGap-pET15b
was generously provided by Mary Dasso (NCI, National Institutes of
Health). Renilla TS was a gift from Nasreldin M. Ibrahim, Otto
Fröhlich, and S. Russ Price (Emory University School of Medicine).
GAL/GR-525C was constructed using PCR amplification of pSVLGR
with the 5' primer of 5'-CGGGATCCGTGGAGTCTCACAAGACACTTCGGAAAATCCT-3' and the 3' primer of 5'-GCTCTAGATTCATTTTTGATGAAACAGAAGCTTTTTGATA-3'. The resulting PCR products were purified using a Wizard direct gel
purification kit, digested with BamHI and
XbaI, and ligated into the pM (CLONTECH)
vector using the same restriction sites. GAL/GR-407C was similarly
prepared using the 5' primer of 5'-ATGGATCCGGTCAGTGTTTTCTAATG-3' and
the 3' primer of 5'-TATCTAGAGTCATTTTTGATGAAACAG-3'. The PCR products were cut with BamHI and XhoI and ligated
with pM vector at the BamHI/XhoI site.
pPC86/Ubc9[1003] is the original clone isolated from the yeast
two-hybrid screen using GMEB-1 (in pDB-Leu) as the bait and an adult
rat liver cDNA library (Invitrogen) in pPC86. The full-length rat
Ubc9 (rUbc9) was excised as a SalI-NotI fragment
and cloned into the corresponding sites of pCMVSport (Invitrogen) to
give pCMVSport/rUbc9. The EcoRI-BamHI fragment of
pCMVSport/Ubc9 was cloned into the corresponding sites of pSG5 to
provide pSG5/rUbc9.
GAL/GMEB-1/pDBleu--
The open reading frame of GMEB-1 was
PCR-amplified with Pfu polymerase for high fidelity
using oligonucleotides SK200 (5'-CT GAA TTC ATG TCG ACG ATG GCT
AAT GCA G-3') and SK201 (5'-CCC TGC GGC CGC CAG TTA ATC CTC TAA GAC-3')
and pM/GMEB-1 as the template. The above oligonucleotides were
designed to create SalI and NotI at 5' and 3'
ends of the PCR fragment. The amplified fragment was cloned in the
above sites of pDB-Leu. The clones obtained were sequenced to confirm
the correct frame with Gal-4 DBD of the plasmid.
pVP16/GMEB-1/pPC86--
GMEB-1 cDNA from GAL/GMEB-1 was
cloned into the SalI and NotI sites of pPC86.
GAL/GMEB-2/pDB-Leu--
GMEB-2 was cloned into the
NcoI and SpeI sites of pDB-Leu from pCRII/GMEB2
(22).
pVP16/GMEB-2/pPC86--
GMEB-2 cDNA from GAL/GMEB-2 was
cloned into the SalI and SpeI sites of pPC86.
pSG5/rUbc9(C93S)--
pSG5/rUbc9 was modified using the
QuikChange site-directed mutagenesis kit. Two
mutagenic oligonucleotides (UBC1, GGCACAGTGTCCCTGTCCATCCTGG; UBC2,
CCAGGATGGACAGGGACACTGTGCC) were used in the amplification reaction with pSG5/rUbc9 as the template. The mutation of C93S was
determined by sequencing.
hSA/pSG5--
The 2.3-kb hSA cDNA (Stratagene Liver catalog
number 937224), cloned into the EcoRI and XhoI
sites of pBluescript SK, was excised with EcoRI and
KpnI and inserted into the pFLAG/CMV2 vector. The hSA insert
was then excised from hSA/pFLAG/CMV2 using EcoRI and
BamHI and ligated into the EcoRI and
BamHI sites of pSG5 to yield hSA/pSG5.
Cell Culture--
COS-7 cells were grown in Dulbecco's modified
Eagle's medium (Invitrogen) supplemented with 5% fetal calf serum
(Biofluids Inc., Rockville, MD) at 37 °C in a humidified incubator
(5% CO2). Transient transfections were achieved using 10 µl of LipofectAMINE reagent (Invitrogen) or 5 µl of FuGENE 6 (Roche
Diagnostics) in 3 ml of Opti-MEM I (Invitrogen) without serum in 60-mm
dishes (10-fold less in 24-well plates). The total transfected DNA was adjusted to 300 ng/well of a 24-well plate (or 3 µg/60-mm dish) with
pBluescriptII SK+ (Stratagene). Renilla TS (5-10 ng/well of a 24-well
plate) was included as an internal control. Cells were incubated with
plasmid DNA, Opti-MEM I, and LipofectAMINE reagent for 24 h, after
which this mixture was replaced by the normal media (5% fetal calf
serum, Dulbecco's modified Eagle's medium). The cells were induced
with steroids 24 h after the start of transfection and then
harvested after an additional 24 h. The cells were lysed and
assayed for reporter gene activity using the Dual Luciferase assay
reagents according to manufacturer's instruction (Promega,
Madison, WI). Luciferase activity was measured by an EG & G
Berthhold's luminometer (Microlumat LB 96 P).
Yeast Two-hybrid Assay--
Small scale and library scale
transformations of yeast Mav203 cells with GAL or VP16 constructs of
GMEB-1 or -2 were performed using the competent and highly competent
cells from Invitrogen as per the manufacturer's instructions. Yeast
two-hybrid selection was conducted with GAL/GMEB-1 or -2 and an adult
rat liver cDNA library fused to VP16 (Invitrogen). Plasmids were
obtained from putative yeast clones according to the instructions for
the Proquest two-hybrid system, and the DNA thus obtained was
transformed into Escherichia coli (Electromax DH10B) by
electroporation according to manufacturer's instructions. Quantitation
of 
-galactosidase activity was accomplished according to the
protocol of the Hybrid Hunter version kit (Invitrogen).
In Vitro Transcription and Translation--
pCMVSport/GMEB-1
(SP6), PCR 2.1/GMEB-2 (T7), pET15b/Suppressin (T7), and pET15b/DEAF-I
(T7) were transcribed/translated using the RNA polymerase indicated in
parentheses in the TNT reticulocyte lysate system (Promega) according
to the manufacturer's instructions.
Gel Shift Assays--
Gel shift assays to detect the binding of
GMEB-1, GMEB-2, DEAF-I, Suppressin, and HTC cytosol to a GME
oligonucleotide were conducted as described (22). The sequences of the
GME and mutant oligonucleotides (M1, M2, and M3) have been described
(14). Gel shift assays with the deformed response element were
conducted according to Gross et al. (26).
Sumolyation Assay--
GMEB-1 or GMEB-2 and RanGAP were in
vitro transcribed and translated in absence or presence of
purified SUMO-1 or GST-SUMO-1 and Xenopus Ubc9 (gifts from
Mary Dasso, NCI) (44). The products were run on a standard 10%
SDS-PAGE gel.
Overexpression of GMEBs in Baculovirus--
GMEB-1 and GMEB-2
fusion proteins with a FLAG tag at the NH2 terminus were
expressed in Sf9 insect cells using the BAC to BACTM baculovirus expression system according to
manufacturer's instructions (Invitrogen).
Pull-down Assay--
M2-agarose beads (anti-FLAG monoclonal
antibody conjugated to agarose, Sigma) were prepared by treating them
with 100 mM glycine·HCl buffer (pH 2.5, 10 volumes) for
2-3 min, which was then neutralized with 1 M Tris·HCl (pH
8.0, 10 volumes). The beads were washed once with phosphate-buffered
saline, pH 7.4 (BioWhittaker, Walkersville, MD) and once with
extraction buffer (10% glycerol, 20 mM Tris·HCl, 0.4 mM EDTA, 0.2% Tween, 10 mM mercaptoethanol,
and 500 mM KCl). Aliquots (100 µl) of Sf9
cell extracts containing baculovirus-expressed FLAG-mUbc9 were
incubated with the above prepared M2-agarose beads for 2-3 h at room
temperature. The beads were then washed five times with extraction
buffer followed by one wash with elution buffer (10% glycerol, 20 mM Tris·HCl, 0.4 mM EDTA, 0.2% Tween, 10 mM mercaptoethanol, and 250 mM KCl). The
radioactive proteins (labeled with [35S]methionine during
in vitro translation in rabbit reticulocyte lysates) were
added separately to the M2 beads bound with FLAG-Ubc9 and incubated at
room temperature for 1 h and then at 4 °C for 12-16 h. The
beads were washed with elution buffer five times. Finally the beads
were resuspended in 20 µl of elution buffer and 20 µl of 2×
SDS-PAGE buffer, boiled for 3-5 min, and loaded onto SDS-PAGE gels.
Mammalian Two-hybrid Assay--
The recommended procedure for
the Mammalian Matchmaker two-hybrid assay kit
(CLONTECH) was modified slightly by changing from a
CAT reporter (pG5CAT) to a luciferase reporter pFRLuc
(Stratagene). Smaller amounts of GAL4 and VP16 chimera DNAs were used
(0.5 µg) because of the higher sensitivity of the luciferase reporter.
Statistics--
Unless otherwise noted, all experiments were
performed in triplicate several times. The error bars in graphs of
individual experiments correspond to the S.D. of the triplicate values.
Best-fit curves (R2 
0.95) for each experiment to yield a
single EC50 value were obtained with KaleidaGraph (Synergy
Software, Reading, PA). The values of n independent
experiments are analyzed for statistical significance by the two-tailed
Student's t test using the program "InStat 2.03" for
Macintosh (GraphPad Software, San Diego, CA). In paired analyses, all
comparisons in a given figure are performed at the same time with the
same seeding of cells and then analyzed for n different experiments.
| |
RESULTS |
Identification of Ubc9 as a GMEB-interacting Protein by Yeast
Two-hybrid Assays--
GMEB-1 and -2 (24), DEAF-1 (26), and Suppressin
(45) are members of the KDWK (24), or SAND domain (46), family of proteins. As GMEB-1 and -2 form heterooligomeric complexes (16, 22,
24), we asked if the GMEBs might heterooligomerize with other KDWK
family members, such as DEAF-1 and Suppressin. However, no significant
interaction of the GMEBs with either DEAF-1 or Suppressin was observed
in either mammalian two-hybrid or gel shift assays (data not shown).
Given the lack of interaction with the GMEBs by other members of the
KDWK family, we used chimeras of GAL-DBD and GMEB-1 or -2 to identify
potential interacting proteins in a yeast two-hybrid screen. One clone
containing an open reading frame of 528 nucleotides was isolated from
an adult rat liver cDNA library that was identical to rat Ubc9. The
VP16/Ubc9 chimera interacts with both GAL-DBD/GMEB constructs, but not
GAL-DBD, in yeast plate assays (data not shown). In solution assays,
VP16/Ubc9 selectively bound more avidly to GMEB-1 than to GMEB-2 (Fig.
1).
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Interaction of GMEBs and rUbc9 in a yeast
two-hybrid solution assay. MaV203 yeast cells containing the
indicated GAL4-DBD and GAL-AD chimeras were grown and assayed in
triplicate for -galactosidase as described under "Materials and
Methods." The relative activity of -galactosidase for each
combination was then plotted (±S.D.). Similar results were obtained
with three other independent clonal isolates.
|
|
The GAL/Ubc9 chimera has no intrinsic transactivation activity in a
one-hybrid assay in mammalian (COS-7) cells (data not shown).
Therefore, Ubc9 is not a candidate transcription coactivator.
Sumoylation Activity of Ubc9--
In view of the known ability of
Ubc9 to add the ubiquitin-like molecule, SUMO-1, to proteins (28, 29)
such as RanGAP1 (31), we asked whether GMEB-1 or -2 are substrates. The
addition of SUMO-1 alone in lane N of Fig.
2 causes an increase in sumoylated RanGAP1 (closed arrow, lane N versus
lane M), presumably due to endogenous Ubc9. However, in the
absence of added SUMO-1, there is negligible sumoylation by the
reticulocyte lysate (lane M), suggesting that there is
little SUMO-1 in reticulocyte lysates. As indicated by the decrease in
unmodified RanGAP1 (narrow arrow), sumoylation is further
increased by the addition of both Ubc9 and SUMO-1 (lane Q
versus lanes N and P). The situation
is even clearer with GST/SUMO-1. Here, the low level of GST-sumoylation (open arrow) in the presence of GST/SUMO-1 (lane
O versus lane M) is markedly increased with
added Ubc9 such that unmodified RanGAP1 is completely consumed
(lane R versus lane O). However, under
these same conditions, no covalent modification by Ubc9 of either
GMEB-1 (lanes A-F) or GMEB-2 (lanes G-L) is
observed in the presence of either SUMO-1 or GST/SUMO-1. Therefore,
Ubc9 does not appear to sumoylate either GMEB-1 or -2. It should be noted that neither GMEB-1 nor GMEB-2 contain the consensus sequence for
SUMO-1 modification that is found in many sumoylated proteins (47).
View larger version (43K):
[in this window]
[in a new window]
|
Fig. 2.
In vitro sumoylation activity of
Ubc9. GMEB-1 or -2 and RanGAP-1 cDNAs were in vitro
translated with [35S]methionine in the absence or
presence of purified preparations of bacterially expressed GST-SUMO,
SUMO, or rUbc9. Aliquots of the reactions were separated by SDS-PAGE
and visualized by autoradiography to determine the presence of SUMO-1
or GST-SUMO-1 covalently attached to the 35S-labeled
proteins. See "Results" for details.
|
|
Interaction of Ubc9 with GMEBs and GR--
Pull-down assays using
immobilized, overexpressed FLAG/Ubc9 were used to obtain direct
evidence for Ubc9 binding to GMEB-1 and -2 (Fig.
3A). We also examined the
mutant Ubc9/C93S. Ubc9/C93S is unable to sumoylate proteins (29, 48),
because Cys-93 is required to form a thiolester bond with the COOH
terminus of SUMO-1, which is a necessary step in sumoylation (38). Both
GMEB-1 and -2 specifically bound to Ubc9 in a manner that is
independent of Cys-93 (compare lanes 1, 2,
5, and 6 to lanes 9, 10,
17, and 18). Therefore, the ability of Ubc9 to
sumoylate proteins does not appear to be necessary for its interaction
with GMEB-1 or -2. Unexpectedly, Ubc9 also binds to GR (lane
3 versus lanes 11 and 19). rGR
contains three consensus SUMO-1 modification sites of the sequence
KXE ( = hydrophobic, X = any
amino acid) (47) at amino acids 296, 312, and 720. Nevertheless, GR
binding to Ubc9 is undiminished with the mutant Ubc9/C93S (lane
7 versus lane 3). We suspect that the
binding of Ubc9 to GR, like that to the GMEBs, is independent of the
sumoylation activity of Ubc9 (Fig. 3A). This binding is
specific, as seen from the lack of binding of CREB (lanes 4 and 9 versus lanes 16 and
20).
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
Cell-free and whole cell interactions of Ubc9
with GMEBs and GR. A, binding of GMEBs and GR to Ubc9
in cell free pull-down assays. [35S]Methionine-labeled,
in vitro translated GMEB-1, GMEB-2, and rGR were added to
M2-agarose columns containing immobilized FLAG-tagged mUbc9 (wild type
and C93S mutant) that had been overexpressed from baculovirus vectors
in insect cells. The proteins remaining after washing were eluted,
separated on SDS-polyacrylamide gels, and visualized as described under
"Materials and Methods." In vitro translated CREB was
used to assay nonspecific retention. The "10% Input"
panel displays one-tenth of the in vitro translated,
full-length proteins that were assayed. The "Mock" panel
shows the amount of each protein that was retained in the absence of
Ubc9. Similar results were obtained in two others experiments. See
"Results" for details. B, interaction of Ubc9 and
GR in mammalian two-hybrid assays. Triplicate dishes of CV-1 cells
containing the indicated GAL4 and VP16 chimeras of mUbc9 were
cotransfected with the FRLuc reporter and treated with EtOH ± 1 µM Dex or 1 µM Dex-Mes. The induced levels
of luciferase were determined as described under "Materials and
Methods" and plotted ± S.D. Similar results were obtained in a
second experiment.
|
|
Mammalian two-hybrid assays were used to obtain evidence for an
interaction of Ubc9 with GR in intact cells. A steroid- and Ubc9-dependent association between VP16/Ubc9 and a fusion
of GAL-DBD with the full-length GR (GAL/GR = pM/GR) was seen in
CV-1 cells (Fig. 3B). Interestingly, the response with Ubc9
was equally robust for GR bound by the antiglucocorticoid Dex-Mes and
the glucocorticoid Dex.
Modulatory Activity of Ubc9 in Intact Cells--
The sequence to
which the GMEBs bind (i.e. the GME (14, 16, 22, 24))
modulates both the dose-response curve of glucocorticoid agonists and
the partial agonist activity of antiglucocorticoids (14, 17, 18).
Therefore, we asked if Ubc9 can further augment the modulatory activity
of the GME. When low concentrations of GR plasmid (4 ng/well of a
24-well plate) are used so that the receptor is a limiting factor for
transactivation (20, 21, 24, 43, 49), 150 ng of pSG5/Ubc9 plasmid
causes a concentration-dependent increase in the total
activity (2.5 ± 0.4-fold, S.D., n = 4, p = 0.0044) and a decrease in the fold induction
(0.51 ± 0.11-fold, S.D., n = 4, p = 0.0033) for 1 µM Dex with a GMEGREtkLUC reporter (data
not shown). However, there is little effect of added Ubc9 on either the
position of the dose-response curve or the partial agonist activity of
antisteroids relative to a control vector expressing hSA (Fig.
4A).
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 4.
Whole cell modulatory activity of Ubc9 with
limiting versus nonlimiting amounts of GR.
Triplicate samples of CV-1 cells in 24-well plates were transiently
transfected with 100 ng of GMEGREtkLuc and 4 ng (A) or 90 ng
(B) of wild type GR with either 180 ng of pSG5/hSA or 150 ng
of pSG5/rUbc9. In C, 90 ng of wild type GR with either 180 ng of pSG5/hSA, 150 ng of pSG5/rUbc9, or 150 ng of pSG5/rUbc9 (C93S)
mutant was used. After treating the samples with the indicated
concentrations of Dex, 1 µM Dex-Mes, or 1 µM Dex-Ox, the induced luciferase activities above basal
levels (EtOH), normalized for Renilla activity, were determined and
expressed as percentage of maximal activity with 1 µM
Dex, as described under "Materials and Methods," and plotted
(±S.D). The left-hand panels depict the dose-response
curves, while the right-hand panels display the partial
agonist activity of the antisteroids ± Ubc9. Similar results were
obtained in at least two additional experiments.
|
|
We have previously established that the GME, and changing
concentrations of GR, act through a common rate-limiting step or intermediate X that is saturated at high GR concentrations (20). Therefore, as long as GR is present at low concentrations, the presence
of other intermediates downstream of X are kinetically invisible. To
overcome this limitation, and to reveal the involvement of steps
downstream of X, we asked whether the presence of saturating concentrations of GR (90 ng (20)) would make a Ubc9-mediated step now
become limiting and responsive to added Ubc9. Under these conditions,
150 ng of Ubc9 plasmid causes a 1.3 fold increase in total Dex activity
and a concentration-dependent decrease in the fold
induction (0.32 ± 0.07-fold, S.D., n = 5, p = < 0.0001). More significantly, 150 ng of Ubc9 now
produces a 3.5 ± 0.7-fold (S.D., n = 3, p = 0.023) left shift of the dose-response curve to a
lower EC50 and increases in the partial agonist activity of
Dex-Mes (2.1 ± 0.5-fold, S.D., n = 5, p = 0.01) and Dex-Ox (1.25 ± 0.14-fold, S.D.,
n = 4, p = 0.34) (Fig. 4B).
The lack of statistical significance for increases in Dex-Ox activity
appears to be due to the fact that Dex-Ox already displays nearly full agonist activity (about 90%) with 90 ng of GR plasmid in the absence of Ubc9. In summary, these data indicate that Ubc9 has little effect on
the dose-response curve and partial agonist activity when GR is
limiting but does change GR induction properties when some factor other
than GR becomes limiting. In contrast, other GR induction properties,
such as the total transactivation, are affected by Ubc9 even when GR is
not limiting. This suggests that the effects of Ubc9 on the total
transactivation and the position of the dose-response curve occur via
different mechanisms.
Modulation of GR Activity by Ubc9 Does Not Require Protein
Sumoylation--
Ubiquitination of transactivation domains has
recently been found to be essential for transcriptional activation by
some factors (50). Thus, it seemed possible that the modulation of GR
activity by Ubc9 might involve sumoylation of selected proteins, like
RanGAP1, even though the GMEBs are not substrates (Fig. 2), and Ubc9
binding to the GMEBs, or GR, appears to be independent of Ubc9
sumoylation activity (Fig. 3A). We therefore asked whether
the C93S mutant of Ubc9, which is defective for sumoylation (29, 38,
48), can still modify GR properties. As seen in Fig. 4C,
elimination of the sumoylation activity of Ubc9 has little effect on
the ability of Ubc9 to modulate the EC50 of agonists or the
partial agonist activity of antagonists. We conclude that these
properties of Ubc9 are independent of its ability to sumoylate proteins.
GR Sequences Required for Modulation of Transactivation Properties
by Ubc9--
To determine which domains of GR are needed to respond to
the effects of added Ubc9, we first examined the properties of the rat
GR lacking the amino-terminal 406 amino acids. This truncated GR
(GR-407C; Fig. 5A) lacks the
activation domain (AF1) that is present in the amino-terminal half of
the receptor but maintains the DBD and ligand binding domain (LBD).
Added Ubc9 still causes a left shift in the dose-response curve for Dex
induction of the GMEGREtkLUC reporter by GR-407C (average = 1.67 ± 0.09-fold; n = 2) and increased partial
agonist activity of Dex-Mes and Dex-Ox (Fig. 5B).
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
GR domains required for modulation of
transcriptional activity by Ubc9 in intact cells. A,
diagram of GR constructs used. The individual GR domains, identified by
the letters A-E, and the GAL-DBD, are differentially
shaded. The precise amino acids from each receptor are shown
above the segment in each construct. B and C,
effect of Ubc9 on the properties of GR-407C (B) and
GAL/GR-525C (C). Triplicate samples of CV-1 cells were
transiently transfected with 100 ng of GMEGREtkLuc and 4 ng of GR-407C
(B) or 100 ng of FRLuc and 4 ng of Gal/GR-525C
(C), with either 180 ng pSG5/hSA or 150 ng of pSG5/rUbc9.
After treating the samples with the indicated concentrations of Dex, 1 µM Dex-Mes, or 1 µM Dex-Ox, the induced
luciferase activities above basal levels (EtOH), normalized for Renilla
activity, were determined and expressed as percentage of maximal
activity with 1 µM Dex, as described under "Materials
and Methods," and plotted (±S.D). The left-hand panels
depict the dose-response curves, while the right-hand panels
display the partial agonist activity of the antisteroids ± Ubc9.
Similar results were obtained in at least one additional
experiment.
|
|
To answer whether the GR DBD is required for the above responses, we
replaced the GR DBD, and part of the hinge region, with the GAL4-DBD to
give the chimera GAL/GR-525C (Fig. 5A), which contains amino
acids 525-795 of GR. We then assayed the ability of added Ubc9 to
alter the properties of GAL/GR-525C induction of FRLuc, which is a
luciferase reporter driven by five tandem repeats of the GAL4 binding
site, UAS. As for the full-length GR and GR-407C, overexpressed Ubc9
produces a left shift of the dose-response curve for GAL/GR-525C (Fig.
5C, average = 2.0 ± 0.5-fold, S.D.,
n = 4, p = 0.026) and an increase in
the partial agonist activity of Dex-Mes (1.96 ± 0.20-fold, S.D.,
n = 4, p = 0.0003). Furthermore, added
Ubc9 increases both the total activity (4.6 ± 1.8-fold, S.D.,
n = 4, p = 0.027) and the fold
induction (1.77 ± 0.39-fold, S.D., n = 4, p = 0.028) of GAL/GR-525C with 1 µM Dex.
Therefore, the region of rGR encompassing the COOH-terminal half of the
hinge region and the LBD is sufficient to respond to Ubc9.
Role of GME in Mediating Ubc9 Modulation of GR Transactivation
Properties--
The ability of the GME to modulate GR transactivation
properties is linked to the binding of the GMEBs to GME
oligonucleotides (14, 16). Because Ubc9 was isolated by its binding to
GMEB-1 in a yeast two-hybrid screen, the modulation of GR
transcriptional properties by Ubc9 might be expected to require the
presence of the GME element in the reporter construct. However, the
ability both of Ubc9 to interact with GR (Fig. 3) and of overexpressed Ubc9 to alter the properties for GAL/GR-525C induction of the FRLuc
reporter, which does not contain a GME (Fig. 5B), suggests that the GME is not required for Ubc9 activity. This was confirmed by
showing that Ubc9 affects a concentration-dependent left
shift in the dose-response curve and increased partial agonist activity for Dex-Mes (averages = 2.7 ± 0.2-fold, S.D.,
n = 3, p = 0.0056, and 1.57 ± 0.16-fold, S.D., n = 3, p = 0.024, respectively) with wild type GR on a simple GREtkLUC reporter (Fig.
6). Therefore, Ubc9 can modulate GR
induction properties in the absence of the GME.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 6.
Ubc9 modulation of GR transactivation
properties with reporters lacking a GME. Triplicate samples of
CV-1 cells were transiently transfected with 100 ng of GREtkLuc and 90 ng of wild type GR with either 180 ng of pSG5/hSA or 150 ng of
pSG5/rUbc9. The samples were treated with steroids and assayed for
luciferase activity, after which the data were calculated and plotted
(±S.D.). The left-hand panel depicts the dose-response
curves, while the right-hand panel displays the partial
agonist activity of 1 µM Dex-Mes ± Ubc9. Similar results
were obtained in at least one additional experiment.
|
|
| |
DISCUSSION |
The purpose of this study was to identify proteins that
participate in the modulation of GR transactivation properties by the
GME. The GME is a cis-acting element that modulates both the dose-response curve of GR-agonist complexes and the partial agonist activity of GR-antagonist complexes (14-21). These effects appear to
be mediated by a heteromeric complex of two proteins, GMEB-1 and -2, that we have cloned and found to have limited homology with other
members of the KDWK family of proteins (16, 22-24). Selected members
of this family are unable to interact with the GMEBs and thus are
unlikely to mediate the effects of the GME. However, a yeast two-hybrid
assay was used to isolate a protein, Ubc9, which displays all of the
criteria expected for an intermediary protein in the modulation of
selected GR transcriptional properties. Ubc9 preferentially interacts
with GMEB-1 in yeast two-hybrid assays. In pull-down assays with
partially purified Ubc9, GMEB-1 and -2 are bound with apparently
similar affinity. This discrepancy between whole cell and cell-free
assays is not unusual (51) and probably reflects low affinity
interactions that are not abundant in intact cells with low
concentrations of proteins. Overexpression of Ubc9 in CV-1 cells has no
effect on the GR dose-response curve when GR is present in low
concentrations and is limiting. However, when GR is overexpressed to
levels where GR is no longer limiting, Ubc9 now causes both a left
shift in the dose-response curve for agonist complexes and an increase
in the partial agonist activity of antagonist complexes. Therefore,
Ubc9 has all of the characteristics of a transcriptional cofactor for
GR (34-38).
Unexpectedly, Ubc9 also interacts with GR both in pull-down assays and
mammalian two-hybrid assays. Furthermore, Ubc9 is able to modulate GR
induction properties independent of the presence of a GME. This is most
likely due to the binding of Ubc9 directly to GR (Fig. 3). Ubc9 is
known to transfer SUMO-1 to a variety of substrates (28, 29, 47).
However, no sumoylation of the GMEBs was observed (Fig. 2), Ubc9
sumoylation activity is not required for the binding of either the
GMEBs or GR (Fig. 3A), and the modulation of GR
transcriptional properties does not require protein sumoylation by Ubc9
(Fig. 4C). This ability of Ubc9 to modulate the induction
parameters of a steroid receptor represents a new activity of Ubc9.
Ubc9 has no intrinsic transactivation activity on a
GAL4-regulated reporter when fused to a GAL-DBD. By this criterion,
Ubc9 is neither a coactivator nor a corepressor. However, Ubc9 does increase the total transactivation elicited by GR from GR-regulated reporters and decrease the fold induction, due to greater effects on
basal level activity. Thus, Ubc9 qualifies as a transcriptional adaptor. Interestingly, these effects on fold induction and total activity are independent of GR concentration, while the ability of Ubc9
to modulate the dose-response curve and partial agonist activity of
antisteroids is seen only with high and saturating concentrations
of GR. This indicates that the effects of Ubc9 on the magnitude of GR
transactivation are mechanistically distinct from those on the GR
dose-response curve and partial agonist activity. In these respects,
Ubc9 is reminiscent of other factors (e.g. TIF2, CBP, SMRT,
NCoR, GME) that alter the dose-response curve and partial agonist
activity of GR complexes in a manner that is independent of their
effects on total activity (19-21, 43, 49, 52).
Ubc9 has been found to interact with a variety of transcription
factors, such as HIPK2 (35), ETS1 (36), and TEL (38), but reports of
effects on steroid receptors are much less common. The first report was
by Gottlicher et al. (53), who briefly mentioned that Ubc9
interacts with the glucocorticoid receptor but did not describe any
details or biological consequences. More recently, Poukka et
al. (34, 37) found that Ubc9 interacts with AR via the nuclear
translocation sequence in a mammalian two-hybrid assay and pull-down
assays and that Ubc9 overexpression increased transactivation by AR in
the presence of steroid in a manner that can be, depending upon the
conditions, both independent (37) and dependent (34) on the SUMO-1
ligating activity of Ubc9. The effect of Ubc9 on the total
transactivation of GR is the same as that seen with AR. However, it is
not yet known if Ubc9 also affects the dose-response curve and partial
agonist activity of AR complexes. Furthermore, in marked contrast to
the AR, the nuclear translocation sequence at amino acids 496-517 of
the rat GR is not required for any of the responses of GR to Ubc9;
amino acids 525-795 are sufficient (Fig. 5C). In addition, Ubc9 binding to GR does not appear to involve sumoylation (Fig. 3A), although putative sumoylation consensus sequences (47) exist in rGR. These differences may derive from several properties of
AR that diverge from GR, including a relatively inactive AF-2 domain in
AR, the reduced binding of coactivators to the AR LBD, and significant
interactions between the NH2- and COOH-terminal domains
of AR (54-58).
Our previous studies of the mechanisms by which both the GME and
changing concentrations of GR or coactivator (TIF2) can modulate GR
transcriptional properties (i.e. the dose-response curve and partial agonist activity of antisteroids) indicated the involvement of
a rate-limiting step, or intermediate, X. This conclusion
was based on the combined observations of 1) a limit to the increase of
both GR transcription properties in the presence of high concentrations of GR (90 ng) or TIF2 plasmids and 2) the inability of one component (GME, GR, or TIF2) to cause any further increase when added to saturating concentrations of a second component (20). In contrast, Ubc9
is able to modify the GR dose-response curve only in the presence of
saturating concentrations of GR (Fig. 4). This requirement of high
concentrations of GR to permit the actions of Ubc9 is strong kinetic
evidence that Ubc9 exerts its effects without proceeding through the
intermediate X (Fig. 7A). The
observation that Ubc9 alters GR activities even in the absence of the
GME (Fig. 6) further argues that the modulation of GR transactivation
properties by Ubc9 can proceed via a pathway that initially involves
steps or intermediates other than X (Fig. 7A). Thus, there
appear to be at least two different cellular mechanisms for
manipulating these induction properties of GR. This diversity would be
very beneficial for the differential control of gene expression by the
concentration of circulating hormone during development,
differentiation, and homeostasis. A 10-fold shift in the dose-response
curve is sufficient to increase the induction by the usually
subsaturating concentrations of steroid from 10 to 50% of the maximal
response. Similarly, endocrine therapies would benefit from changes in
the partial agonist activity of antisteroids that could cause near
normal levels of induction, or prevent induction entirely, depending on
the direction of the changes.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 7.
Proposed model for modulation of GR
properties by Ubc9. A, new pathway for Ubc9 action.
Previous data established that GME, GR, and coactivators modulate GR
properties via a rate-limiting step, or intermediate, X (20). The
inability of excess GR to inhibit Ubc9 activity indicates that Ubc9
affects steps downstream of X. See "Discussion"
for details. B, proposed molecular model for interactions of
Ubc9, GR, and GME with various components of the transcriptional
machinery to affect different steps in the model in A. See
"Discussion" for details.
|
|
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed: Steroid Hormones
Section, Bldg. 8, Rm. B2A-07, NIDDK/LMCB, NIH, Bethesda, MD
20892. Tel.: 301-496-6796; Fax: 301-402-3572; E-mail:
steroids@ helix.nih.gov.
