|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 15, 12810-12815, April 12, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Program in Cell and Molecular Biosciences, Department of
Animal and Dairy Sciences, Auburn University,
Auburn, Alabama 36849
Received for publication, January 8, 2002
p68 RNA helicase, a nuclear RNA helicase, was
identified 2 decades ago. The protein plays very important roles in
cell development and organ maturation. However, the biological
functions and enzymology of p68 RNA helicase are not well
characterized. We report the expression and purification of recombinant
p68 RNA helicase in a bacterial system. The recombinant p68 is an
ATP-dependent RNA helicase. ATPase assays demonstrated that
double-stranded RNA (dsRNA) is much more effective than single-stranded
RNA in stimulating ATP hydrolysis by the recombinant protein.
Consistently, RNA-binding assays showed that p68 RNA helicase binds
single-stranded RNA weakly in an ATP-dependent manner. On
the other hand, the recombinant protein has very high affinity for
dsRNA. Binding of the protein to dsRNA is ATP-independent. The data
indicate that p68 may directly target dsRNA as its natural substrate.
Interestingly, the recombinant p68 RNA helicase unwinds dsRNA in both
3' The nuclear p68 RNA helicase was first identified by
cross-reaction with a monoclonal antibody PAb204 that was originally raised against SV40 large T antigen 2 decades ago (1, 2). The helicase
plays very important roles in cell proliferation and organ maturation
(2-4). p68 is highly conserved throughout evolution. The human protein
shows 98% sequence identity with mouse p68 (5). The
Saccharomyces cerevisiae and Schizosaccharomyces pombe "p68"-Dbp2p share 55% identity with the human protein
(6). The growth defect in a DBP2 yeast mutant strain can be
rescued by human p68 (7), suggesting that the biological functions of
the p68 RNA helicase are conserved among different species.
The p68 RNA helicase belongs to a large family of highly evolutionarily
conserved proteins, the so-called Asp-Glu-Ala-Asp (DEAD)1 box family of
putative ATPases and helicases (for reviews see Refs. 8 and 9). The RNA
helicases are found in almost all organisms, from bacteria to human.
This family of proteins is involved in almost every process of RNA
metabolism in cells such as pre-mRNA splicing, translation, RNA
degradation, and ribosome biogenesis (10). RNA helicases are enzymes
that catalyze the separation of strands of duplex RNA by utilization of
the energy derived from hydrolysis of NTP (generally ATP). Unlike the
previously defined DNA helicase, which processively unwinds long
stretches of dsDNA, most RNA helicases probably modulate only a short
duplex region in a long RNA molecule. In addition, recent studies also suggest that members of DEAD/DExH superfamily of RNA
helicase may also be involved in dissociation of protein-RNA
interactions (11, 12) and/or modulation of other RNA secondary
structures (13).
Despite a rapidly growing number of identified putative RNA helicases,
only a handful of these putative RNA helicases, including eIF-4A,
U5-200K, HCV-NS3, Brr2p, Prp16p, and vaccinia virus NPH-II, have
demonstrated RNA unwinding activity in vitro (14-19). The ATPase and the RNA unwinding activities of p68 RNA helicase were documented (15, 20, 21) with the protein that was purified from human
239 cells. ATPase activity of the purified p68 RNA helicase is
stimulated by RNA polynucleotides and to a lesser extent by DNAs. The
RNA unwinding assay showed that the p68 RNA helicase was able to unwind
a partial dsRNA with a long 162-bp duplex (15). This indicated that p68
RNA helicase unwinds RNA with high processivity. In addition to
unwinding RNA, p68 RNA helicase was also suggested to catalyze RNA
annealing (13). Due to the difficulty in expression and purification of
recombinant p68 RNA helicase in an appropriate expression
system, the biological functions and enzymatic activities of p68 RNA
helicase are not well characterized (10, 22).
By using a unique methylene blue-mediated cross-linking technique (MB
cross-linking) (23), p68 RNA helicase was detected interacting with the
U1:5'-ss duplex during the splicing process (24). The protein is
essential for pre-mRNA
splicing.2 In this article,
we report the expression and purification of recombinant His tag p68
RNA helicase from Escherichia coli. We analyzed the
ATPase and RNA unwinding activities of the recombinant His tag p68. Our
data show that the ATPase activity of the protein was
polynucleotide-dependent. dsRNA is much more efficient than ssRNA in stimulating the ATPase activity of the protein. We demonstrate here that p68 RNA helicase unwound RNA in both 3' RNA Substrates and Transcriptions--
RNAs were synthesized by
run-off transcriptions of the linearized transcription vectors that
carry appropriate DNA inserts in the transcription region using T7 or
SP6 RNA polymerase. The RNAs were uniformed labeled with
[ Expression and Purification of Recombinant p68 RNA
Helicase--
According to the GenBankTM sequence
(GenBankTM accession number AF015812), a pair of primers,
5'GCGGATCCTCGAGTGACCGAGACCGC3' and 5'ATTGGGAATATCCTGTTG3', was
used. The open reading frame (ORF) that encodes p68 RNA helicase was
amplified from a cDNA library (Stratagene). The PCR products were
cloned into pBluescript SK(+) vector. The obtained DNA clones were
examined by auto-DNA sequencing, and the sequences of resultant DNA
completely match the DNA sequences of p68 RNA helicase retrieved from
GenBankTM. The ORF of p68 RNA helicase was subcloned into
an expression vector pET-30a by BamHI/HindIII
sites. The expression clones were transformed to E. coli.
Bacteria were grown in LB medium to A600 nm = 0.6. The expression of recombinant protein was induced by IPTG for
5 h. To purify the recombinant protein, the harvested bacterial cells were subjected to one freeze/thaw cycle at Assays--
ATPase activities were determined by measuring the
released inorganic phosphate during ATP hydrolysis using a direct
colorimetric assay (25, 26). The method is based on the change in
absorbance (A623 nm) of malachite
green-molybdenum complex in the presence and absence of inorganic
phosphate. A typical ATPase assay was carried out in 50-µl reaction
volumes, containing 20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM MgCl2, 5 mM DTT, ~1-2 µg of appropriate RNA, 40 units of
RNasin, 4 mM NTP, and 10 µl of helicase. The ATPase
reactions were incubated at 37 °C for 30 min. After incubation, 1 ml
of malachite green-molybdenum reagent was added to the reaction
mixture, and reactions were further incubated at room temperature for
exactly 5 min. The absorption (A) at 630 nm was then
measured. The concentrations of inorganic phosphate were determined by
matching the A630 nm in a standard curve of
A630 nm versus known phosphate concentrations.
RNA unwinding activities were determined by the method similar to that
described by Rozen and co-workers (14). Briefly, the RNA unwinding
reactions were carried out in a 20-µl reaction volume containing 70 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM MgCl2, 5 mM DTT, 2.5 fmol of
partial dsRNA, 40 units of RNasin, 16 mM ATP, and 2-4 µl
of helicase. Reactions were incubated at 37 °C for 60 min. The
reaction mixtures were directly loaded onto the appropriate percentage
of SDS-PAGE, and the gel was subjected to autoradiography.
RNA bindings were analyzed by gel-mobility shift assays and MB-mediated
dsRNA-protein cross-linking (23, 27). In a typical gel mobility shift
assay, 100 ng of recombinant proteins were mixed with 5 fmol of
appropriate RNA in buffer solution containing 30 mM
Tris-HCl, pH 7.5, 100 mM NaCl, 2 mM
MgCl2, 1 mM DTT, and 20 units of RNasin with or
without ATP as indicated. After 15 min of incubation at room
temperature, the reaction mixtures were loaded on to 6% native-PAGE
(acrylamide:bis = 40:1). The methylene blue mediated
cross-linkings were carried out as described previously (23, 24). The
same protein:RNA reaction mixtures used in the gel mobility shift
assays were used in the cross-linking experiments. After RNase mixture
(RNase A, T1, and V1) digestion, the cross-linking mixture was
separated by the appropriate percentage of SDS-PAGE and subjected to autoradiography.
Western Blot Analyses--
The Western blot analyses were
performed with various sources of bacterial lysates, the purified
recombinant p68, and the recombinant HCV-NS3 using the commercial ECL
Western blot and detection kits. The antibody pAb204 was used in the
blot as a 5:1 dilution and pAbN1 was used as a 3000:1 dilution.
Expression and Purification of Recombinant His Tag p68 RNA Helicase
in E. coli--
Previous data demonstrated that p68 RNA helicase is an
essential splicing factor acting at the U1 small nuclear RNA and
5'-splice site duplex (24).2 According to the
cDNA sequence of human p68 RNA helicase from GenBankTM
(accession number AF015812), the open reading frame (ORF) of p68 RNA
helicase was cloned, and the recombinant His tag protein was
overexpressed in E. coli (BL21) and purified over a Ni-NTA column (Fig. 1A, lane 5). The
concentration of the recombinant protein was estimated to be about 250 ng/µl (estimated by Bradford method, Bio-Rad). We noted that to keep
the recombinant protein in a soluble form, it is necessary to maintain
the protein in a buffer solution containing at least 100 mM
imidazole (data not shown). To verify whether the obtained recombinant
protein is p68 RNA helicase, we performed Western blot analyses using a
monoclonal antibody pAb204 and a polyclonal antibody pAbN1 (raised
against a peptide that spans 15 amino acids residues at the N-terminal region of human p68). It is evident that the purified recombinant protein was recognized by both antibodies in the Western blot analyses
(Fig. 1, B, lane 1, and C,
lane 1). No bacterial proteins were recognized by these two
antibodies (Fig. 1, B, lane 3, and C, lane 3). The data suggested that a soluble
recombinant His tag p68 RNA helicase was expressed and purified in a
bacterial expression system.
ATPase Activity of p68 RNA Helicase Is Stimulated by ssRNA and
dsRNA--
To determine enzymatic activities of the bacterially
expressed recombinant p68 RNA helicase, we first examined the ATPase activity of the His-p68 by measuring the released inorganic phosphate during ATP hydrolysis using a direct colorimetric assay (25, 26). The
ATPase assays demonstrated that the recombinant protein hydrolyzed ATP
in a polynucleotide-dependent manner (Fig.
2A). As a control, no ATP
hydrolysis was observed in the same assay using BSA (Fig.
2A). We also tested the acceptance of other nucleotide triphosphates by the recombinant p68. Our experiments showed that the
protein only hydrolyzed ATP and dATP but not CTP, UTP, and GTP (data
not shown). To examine the nucleic acid-dependent ATPase activity of the bacterially expressed recombinant p68 RNA helicase, we
carried out ATPase assays in the presence of ssRNA (RNA 9, Table
I), ssDNA (DNA oligonucleotides, 24 nt),
dsRNA (RNA 7 versus RNA 8, Table I), or dsDNA (pGEM-3Z,
linearized with EcoRI). Consistent with previous
analyses (20) carried out with p68 purified from human 239 cells, the
ATPase activity of the bacterially expressed p68 RNA helicase was
activated by both the ssRNA and the dsDNA and to much less extent by
the ssDNA (Fig. 2B). Interestingly, the ATPase activity of
the recombinant protein was greatly enhanced by the dsRNA. The ATPase
activity of the protein was more than doubled in the presence of the
dsRNA compared with that in the presence of the same molar amounts of
the ssRNA (Fig. 2B). Because doubling the amounts of each
individual ssRNA that formed the duplex RNA did not have a similar
effect on the ATPase activity of p68 (data not shown), it was less
likely that the enhancement of the ATPase activity by the dsRNA was the
result of the residues of ssRNAs that did not form duplex in our
annealing conditions. The dsRNA used in our test contains a 67-bp
duplex, a 4-nt 5'-overhang on one side, and an 1-nt 5'-overhang on the
other side (Table I). It is unlikely that the very short ssRNA tails on
both sides of the RNA duplex are responsible for the ATPase activity
enhancement. Thus our conclusion is that the ATPase activity of the
recombinant p68 RNA helicase is strongly stimulated by dsRNA.
p68 RNA helicase Binds dsRNA--
The preceding data showed that
the ATPase activity of the recombinant p68 was strongly enhanced by
dsRNA. We reasoned that the recombinant p68 RNA helicase may bind
dsRNA, and the affinity of the protein for dsRNA may be higher than
that for ssRNA. To measure the RNA-binding properties of the
recombinant p68 RNA helicase, we employed the gel mobility shift assay.
The same ssRNA and dsRNA substrates used in the ATPase assays were
utilized here to examine the ssRNA and dsRNA binding activities of the
recombinant p68 RNA helicase. A weak mobility-shifted band was observed
with the recombinant p68 RNA helicase and the ssRNA (Fig.
3A, lane 2), and
the shifted band was ATP-dependent (Fig.
3A, compare lane 2 to lane 4). A
similar ssRNA binding property was also observed with another RNA
helicase derived from NS3 of HCV (Fig. 3A, lane 3). However, a very strong mobility-shifted band was observed with
the recombinant p68 RNA helicase and the dsRNA substrate, and the
formation of this slow mobility RNA-protein complex band is
ATP-independent (Fig. 3A, lanes 8 and
9). In contrast, no mobility shift band was observed with
the HCV-NS3 RNA helicase and the same dsRNA substrate (Fig.
3A, lane 6). Quantitative analyses of both the
free RNA bands and RNA-protein complex bands indicate that less than
10% of the ssRNA was associated with the ssRNA-p68 complex. On the
other hand, more than 90% of the labeled dsRNA was associated with the
shifted dsRNA-protein complex band. The data suggested that the
recombinant p68 has higher affinity for dsRNA compared with that for
ssRNA.
To verify further the dsRNA binding by the recombinant p68 RNA
helicase, we utilized the MB cross-linking technique, an RNA-protein photocross-linking method that has high preference for mediating cross-links between dsRNA and dsRNA-binding proteins (23). The same
ssRNA and dsRNA substrates used in gel mobility shift assays were used
in the MB cross-linking tests. It is evident that the recombinant p68
RNA helicase was cross-linked to the dsRNA target in an ATP-independent
manner (Fig. 3B, lanes 1 and 2). The
cross-linking signal was not observed with the ssRNA:p68 or with
HCV-NS3:dsRNA (Fig. 3B, lanes 3 and
4). The results from the cross-linking experiments were
completely consistent with the data obtained from gel mobility shift
assays. Our experimental data strongly suggested that the recombinant
p68 RNA helicase has high affinity for dsRNA compared with that for
ssRNA. This dsRNA binding property is not a common characteristic to
all members of DEAD box family of RNA helicases.
The Recombinant p68 RNA Helicase Unwinds RNA Duplex in Both 3'
A member of the DEAD box family, translational initiation factor eIF-4A
has been shown to unwind RNA duplex in both 3' We presented in this report the expression and purification of
recombinant p68 RNA helicase from an E. coli expression
system, and we demonstrated that the protein is an
ATP-dependent RNA helicase. We have shown that the ATPase
activity of the recombinant protein is greatly enhanced by dsRNA. The
RNA-binding assays demonstrated that p68 RNA helicase binds ssRNA
weakly in an ATP-dependent manner. On the other hand, the
recombinant protein has very strong affinity for dsRNA. The binding of
the protein to dsRNA is ATP-independent. Interestingly, the bacterially
expressed recombinant p68 helicase unwinds dsRNA in both 5' It has been observed previously (31) that the ATPase activity of
so-called DEAD/DExH box of ATPases is
polynucleotide-dependent. More detailed characterization
carried out with eIF-4A suggested that ATP binding and hydrolysis are
tightly coupled to polynucleotide binding by the protein (32, 33).
Thus, it is believed that binding and hydrolysis of ATP, in return, has
great effects on the polynucleotides binding by a DEAD/DExH
box protein. Consistent with the previous observations (15, 20),
the ATPase activity of the recombinant p68 is strictly
polynucleotide-dependent. We also observed that the ssRNA
binding affinities of the recombinant p68 RNA helicase in the presence
and absence of ATP are different. In the absence of ATP, the ssRNA
binding by the recombinant protein is not detectable by our gel
mobility shift assay. Thus, the data from the experiments support the
notion that ATP binding and hydrolysis change the RNA-binding
properties of an RNA helicase.
The dsRNA-binding property of p68 is unique in the
DEAD/DExH box family. It was assumed that RNA helicases,
especially those that act as monomer, should recognize dsRNA substrate
(9, 34). Although sequence alignments revealed that a number of
other RNA helicases, including human helicase A, Drosophila
maleless, and Caenorhabditis elegans ORF T20G5, contained
sequence motifs that closely resemble the dsRNA-binding motif (34),
none of the RNA helicases have demonstrated dsRNA binding. What is the
functional role of this dsRNA-binding property of p68? Because the
dsRNA substrate is much more effective than an ssRNA substrate in
stimulating the ATPase activity, it is likely that the dsRNA binding is
functional relevant to the enzymatic activity of the protein. The best
explanation for the functional role of the dsRNA binding is that,
unlike many other DEAD/DExH box proteins that load on the
RNA substrate at the single-stranded 5'- or 3'-overhangs (35), p68 RNA
helicase may directly load on a dsRNA substrate. To test this
possibility, we reasoned that the 3' or 5' single-stranded overhangs of
RNA substrate may not be required for RNA unwinding. Thus, we carried out unwinding experiments using a dsRNA substrate with only a 1-nt
3'-overhang on the one side and a 2-nt 3'-overhang on the other side.
However, due to quick annealing of the separated ssRNA, we were
unable to reach unambiguous conclusions (data not shown). Because p68
RNA helicase was shown to potentially have RNA annealing activities
(13), an alternative possibility is that the dsRNA-stimulated ATPase
activity is required for the RNA annealing activity of the protein. Our
data showed the strong dsRNA-binding properties by p68 in the presence
and absence of ATP. The effects of ATP binding and hydrolysis on the
dsRNA binding are, however, not determined under our current
experiments. It will be interesting to perform further experiments to
determine what are the effects of the ATP binding and hydrolysis on the
dsRNA binding. It is conceivable that ATP binding and hydrolysis would
have opposite effects on the dsRNA binding in the above two alternative possibilities.
The modes and mechanisms of RNA binding by the DEAD/DExH box
RNA helicases are not well understood. The three-dimensional structure
of the HCV-NS3:oligonucleotide complex revealed that the nucleic acid
is bound in the second cleft between the domain 1-2 and domain 3 (36,
37). However, this nucleic acid binding cleft of HCV-NS3 is not clearly
defined in the assembled three-dimensional structure of translation
initiation factor, eIF-4A (38-40). Mutational analyses and RNA binding
studies with a number of DEAD/DExH boxes of RNA helicases
revealed weak RNA binding by the common sequence motif VI in the
DEAD/DExH box. The weak RNA-binding property of this motif
is believed to play an important catalytic role in RNA unwinding (41).
In addition to the RNA binding by motif VI, many DEAD/DExH
boxes of RNA helicases also bind RNA with additional RNA-binding motifs
(13, 42, 43). Nevertheless, the relationship between the enzymatic
activities and the RNA-binding by these additional RNA binding
motifs has not yet been demonstrated. An interesting question regarding
the strong dsRNA binding by the recombinant p68 is whether the dsRNA
substrate is bound by the sequence motif VI in the DEAD box or by any
other sequence motifs outside of the DEAD box. If the dsRNA substrate
is bound outside of the DEAD box, how are the enhancement effects of
dsRNA binding on the ATPase activity explained? It was noted previously
(15) that p68 RNA helicase contained sequence motifs at its C terminus that resemble the RGG repeats. Is it possible that this sequence motif
contributes to dsRNA binding? The amino acid sequence of p68 RNA
helicase does not contain any recognizable double-stranded RNA-binding
motif. Thus, the dsRNA binding by p68 RNA helicase may represent a new
dsRNA recognition mechanism.
The bacterially expressed recombinant p68 RNA helicase unwinds dsRNA in
both 3' We thank Frances Fuller-Pace for providing
hybridoma cells for the antibody PAb204 and Roger Bridgeman for
antibody PAb204 production. We are also grateful to Dr. D. L. Peterson for providing the vector for expression of HCV-NS3. We thank
Jenny Yang, Liuqing Yang, R. L. Rill, Mariano A. Garcia-Blanco,
Christopher W. J. Smith, and Becky Tarleton for detailed critical
comments on the manuscript.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, January 31, 2002, DOI 10.1074/jbc.M200182200
2
Z.-R. Liu, unpublished results.
The abbreviations used are:
DEAD, Asp-Glu-Ala-Asp;
dsRNA, double-stranded RNA;
ssRNA, single-stranded
RNA;
DTT, dithiothreitol;
Ni-NTA, nickel-nitrilotriacetic acid;
IPTG, isopropyl-1-thio-
The ATPase, RNA Unwinding, and RNA Binding Activities of
Recombinant p68 RNA Helicase*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
5' and 5' 3' directions. This is the second example of a
Asp-Glu-Ala-Asp (DEAD) box RNA helicase that unwinds RNA duplexes in a
bi-directional manner.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
5' and 5' 3'
directions. In addition, our data demonstrate that p68 RNA helicase
bound strongly to dsRNA, and the binding was ATP-independent.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-32P]UTP. The DNA vectors for transcribing each RNA
substrate are listed in Table I. The partial dsRNAs were prepared by
annealing each pair of complementary transcripts at a 3-fold excess of
unlabeled strand over labeled strand. The dsRNA substrate for both
ATPase assays and RNA binding assays is the hybridization of equal
molar amounts of two complementary strands. Annealing solution
contained 30 mM Tris-HCl, pH 7.5, 100 mM NaCl,
and 80% formamide. The RNA annealing mixture was heated to 85 °C
for 10 min and was then slowly cooled down to room temperature. The RNA
hybrids were used without further treatments.
80 °C. After digestion with lysozyme in lysis buffer (50 mM Tris-HCl, pH
7.5, 100 mM NaCl, 1 mM DTT, 0.5 mM
EDTA) at 30 °C for 40 min, the bacterial cells were further
disrupted by ultrasonication. After centrifugation, the soluble
bacterial lysates were passed through a Ni-NTA column, and the
recombinant proteins were eluted with 200 mM imidazole in
protein buffer (50 mM Tris-HCl, pH 7.5, 200 mM
NaCl, 0.5 mM DTT, 10% glycerol). The protein was further
dialyzed against the same buffer with only 100 mM imidazole.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (67K):
[in a new window]
Fig. 1.
A, expression and purification of
recombinant His tag p68 RNA helicase. Coomassie staining the SDS-PAGE
of bacterial cell lysates before IPTG inducing (lane 1),
bacterial cell lysates after IPTG inducing (lane 2), the
soluble lysates from IPTG-induced bacterial cells that were passed
Ni-NTA column (lane 3), and elution fractions from Ni-NTA
column (lanes 4 and 5). Western blot analyses of
bacterially expressed His tag p68 by the monoclonal antibody pAb204
(B) and the polyclonal antibody pAbN1 (C). His
tag p68 RNA helicase (lane 1), His tag HCV-NS3 that was
expressed in the same bacterial strain (lane 2), and
bacterial cell lysates before IPTG inducing (lane 3).
View larger version (9K):
[in a new window]
Fig. 2.
ATPase activities of the recombinant His tag
p68 RNA helicase. The ATPase activity is expressed as
µM (concentrations) of released inorganic phosphate in
the 50 µl of reaction volume. A, the ATPase activity
is measured in the presence of 1 µg of yeast total RNA (Sigma) unless
otherwise specified. The ATP hydrolysis reactions were carried out at
room temperature for 30 min containing 4 mM ATP + 2.5 µg
of His tag p68 (A), 4 mM ATP alone
(B), 4 mM ATP + RNA (C), 4 mM ATP + 2.5 µg of BSA (D), and 4 mM ATP + 2.5 µg of His tag p68 without RNA
(E). B, dependence of ATPase activity of p68
RNA helicase on the nucleic acids. Assays were carried out with 4 mM ATP and 10 µl of helicase (~2.5 µg) in 50-µl
reactions containing 0.5 µg of RNA 9 (ssRNA), 0.1 µg of RNA7/RNA8
(dsRNA), 0.2 µg of 24-nt synthetic DNA oligonucleotides (ssDNA), and
1 µg of pGEM-3Z linearized by EcoRI (dsDNA).
Transcripts used in ATPase, RNA unwinding, and RNA-binding assays
View larger version (55K):
[in a new window]
Fig. 3.
RNA binding analyzed by gel mobility shift
assays (A) and MB cross-linking assays
(B). A, lanes 1-5 are the
gel mobility shift assays of the recombinant p68 RNA helicase with 5 fmol of ssRNA (RNA7, Table I), RNA 7 alone (lane 1), 100 ng
of p68 + 2 mM ATP (lane 2), 100 ng of His tag
HCV-NS3 + 2 mM ATP (lane 3), 100 ng of p68
without ATP (lane 4), and 100 ng of HCV-NS3 without ATP
(lane 5). Lanes 6-10 are the gel mobility shift
assays of p68 with 5 fmol of dsRNA (5 fmol RNA7/5 fmol RNA8, Table I),
dsRNA alone (lane 10), 100 ng of p68 without ATP (lane
9), 100 ng of p68 + 2 mM ATP (lane 8), 100 ng of His tag HCV-NS3 + 2 mM ATP (lane 7), and 2 µg of BSA + 2 mM ATP (lane 6).
B, MB cross-linking of the mixture of His tag p68 or
His tag NS3 with RNAs. 5 fmol of either ssRNA (RNA7, Table I) or dsRNA
(RNA7/RNA8, Table I) were used in the cross-linking. The cross-linking
reactions were carried out with 100 ng of His-p68 + dsRNA without ATP
(lane 1), 100 ng of His-p68 + dsRNA + 2 mM ATP
(lane 2), 100 ng of His-NS3 + dsRNA + 2 mM ATP
(lane 3), and 100 ng of His-p68 + ssRNA + 2 mM
ATP (lane 4).
5' and 5' 3' Directions--
To examine the RNA unwinding
activities of the recombinant His tag p68, we carried out an RNA
unwinding assay using a procedure similar to that described by Rozen
and co-workers (14). The RNA substrate for the RNA unwinding assay was
a partial dsRNA containing a short RNA duplex (~22 bp in length) and
long 186- and 88-nt 3'-overhangs on both sides (RNA 1 versus
RNA 2, Table I and Fig. 4).
Consistent with previous studies (13, 15), the partial
dsRNA-containing 3'-overhang was unwound in the presence of 25 ng/µl
of the His tag p68 (Fig. 4A, lane 4). In the
control reactions, the unwinding was not observed in the absence of ATP and in the absence of the recombinant protein (lanes 3 and
5). The RNA duplex was also not unwound by a nonspecific
protein, BSA (lane 6). The p68 RNA helicase purified from
human 239 cells was able to unwind a partial dsRNA with a long 162-bp
RNA duplex (15). This feature is unique to very few members of
DEAD/DExH RNA helicases. It is generally believed that,
unlike DNA helicases, the majority of so-called RNA helicases work only
on a short stretch of RNA duplex or local RNA structures (8). NPH-II
from vaccinia virus is another example of unwinding long RNA duplex
(28). To test whether the bacterially expressed p68 RNA helicase is able to unwind the long RNA duplex, we employed another partial dsRNA
substrate in the unwinding assays. The partial dsRNA contains a 69-bp
duplex and a 186-nt 3'-overhang on one side and a 88-nt 3'-overhang on
the other side (RNA 3 versus RNA 4, Table I and Fig. 4). In
contrast to the observations made by Hirling and co-workers (15), our
unwinding experiments showed that very small fractions of the partial
dsRNA substrate were unwound by the recombinant p68 (Fig. 4B,
lane 8). Our observations are, however, consistent with
observations made by Rossler and co-workers (13). The above unwinding
data indicated that the recombinant p68 is a weak processive RNA
helicase.
View larger version (39K):
[in a new window]
Fig. 4.
RNA unwinding analyzed by SDS-PAGE. The
RNA duplex is annealed as described under "Materials and Methods."
The unwinding reactions are carried out with 0.5 µg of His tag p68 in
20 µl at 37 °C for 30 min. RNA duplex formed with 0.4 ng of
labeled RNA was used in 20 µl of unwinding reaction.
A, unwinding 3'-overhang RNA substrate. The unwinding
reactions contain the radiolabeled RNA alone (lane 1), the
partial dsRNA (lane 2), the partial dsRNA + His-p68 without
ATP (lane 3), the partial dsRNA + His-p68 + 2 mM
ATP (lane 4), the partial dsRNA + 2 mM ATP
without protein (lane 5), and the partial dsRNA + 2 mM ATP + 2 µg of BSA (lane 6).
B, lanes 1-4 are the assays of unwinding
3'-overhang RNA substrate. The unwinding reactions contain the
radiolabeled RNA alone (lane 1), the partial dsRNA
(lane 2), the partial dsRNA + His-p68 without ATP
(lane 3), and the partial dsRNA + His-p68 + 2 mM
ATP (lane 4). Lanes 5-8 are the assays of
unwinding 69-bp long RNA duplex with 3'-overhang. The unwinding
reactions contain the radiolabeled RNA alone (lane 5), the
partial dsRNA (lane 6), the partial dsRNA + His-p68 without
ATP (lane 7), the partial dsRNA + His-p68 + 2 mM
ATP (lane 8). C, unwinding 5'-overhang RNA
substrate. The unwinding reactions contain the radiolabeled RNA alone
(lane 1), the partial dsRNA (lane 2), the partial
dsRNA + His-p68 without ATP (lane 3), and the partial dsRNA + His-p68 + 2 mM ATP (lane 4).
5' and 5' 3'
directions. It was suggested that this unwinding property of the
protein helps the melting of the mRNA structure during the
translational initiation process (14, 29, 30). To investigate the
polarity of RNA unwinding by the p68 RNA helicase, we synthesized a
partial dsRNA containing a 22-bp duplex and a 71-nt 5'-overhang on the
one side and a 6-nt 5'-overhang on the other side (RNA 5 versus RNA 6, Table I and Fig. 4). The RNA unwinding assay was carried out with this RNA substrate. In contrast to the
observations made by Rossler and co-workers (13), we have repeatedly
observed that this partial dsRNA with the 5'-overhang was completely
unwound by the bacterially expressed p68 RNA helicase (Fig.
4C, lane 4). Thus our RNA unwinding assays have
demonstrated that the bacterially expressed recombinant p68 RNA
helicase unwound RNA duplex in both 3' 5' and 5' 3' directions.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
3' and
3' 5' directions. This is the second example of the DEAD box family
of RNA helicases that unwinds RNA in both directions.
5' and 5' 3' directions. To date, the bi-directional
RNA unwinding activities are peculiar to two DEAD box helicases. The
DEAD box of RNA helicase eIF-4A in complex with eIF-4B unwound dsRNA in
a bi-directional manner (14). The exact functional relevance of this
bi-directional RNA unwinding is not clear. It was suggested that
this bi-directional RNA unwinding property of eIF-4A played an
important role in helping the ribosome land on the 5'-untranslated
region of mRNA for translation initiation. p68 RNA helicase was
suspected to be involved in a number of biological processes (8),
including pre-mRNA splicing,2 RNA degradation
(44), ribosome biogenesis (45), and transcriptional regulation (46,
47). It would be expected that p68 must be able to work on wide spectra
of nucleic acids targets. The wide variety of putative RNA substrates
may require the protein to be able to unwind RNA duplex in both
directions. An alternative possibility is that, as discussed above, p68
may directly target dsRNA for its unwinding substrate. The
single-stranded overhangs are really not required. Therefore, the
dsRNAs with 3' or 5' or without single-stranded overhangs are the equal
unwinding substrates for the protein. Unlike eIF-4A, which mainly
unwinds dsRNA by complex with eIF-4B, p68 RNA helicase does not need a
helper to unwind RNA. Although the functional relevance of the
bi-directional RNA unwinding by p68 is not clear, the RNA unwinding by
the protein will potentially provide an excellent model system to
characterize the mechanism and functional relevance of this
bi-directional RNA unwinding.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: 210 Upchurch
Hall, Auburn University, Auburn, AL 36849. E-mail:
zrliu@acesag.auburn.edu.
ABBREVIATIONS
-D-galactopyranoside;
ORF, open reading
frame;
nt, nucleotide;
MB, methylene blue;
BSA, bovine serum albumin;
HCV, hepatitis c virus.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Crawford, L.,
Leppard, K.,
Lane, D.,
and Harlow, E.
(1982)
J. Virol.
42,
612-620 2.
Lane, D. P.,
and Hoeffler, W. K.
(1980)
Nature
288,
167-170[CrossRef][Medline]
[Order article via Infotrieve] 3.
Stevenson, R. J.,
Hamilton, S. J.,
MacCallum, D. E.,
Hall, P. A.,
and Fuller-Pace, F. V.
(1998)
J. Pathol.
184,
351-359[CrossRef][Medline]
[Order article via Infotrieve] 4.
Mahal, B.,
and Nellen, W.
(1994)
Biol. Chem. Hoppe Seyler
375,
759-763[Medline]
[Order article via Infotrieve] 5.
Kitajima, Y.,
Yatsuki, H.,
Zhang, R.,
Matsuhashi, S.,
and Hori, K., A.
(1994)
Biochem. Biophys. Res. Commun.
199,
748-754[CrossRef][Medline]
[Order article via Infotrieve] 6.
Iggo, R. D.,
Jamieson, D. J.,
MacNeill, S. A.,
Southgate, J.,
McPheat, J.,
and Lane, D. P.
(1991)
Mol. Cell. Biol.
11,
1326-1333 7.
Barta, I.,
and Iggo, R.
(1995)
EMBO J.
14,
3800-3808[Medline]
[Order article via Infotrieve] 8.
Luking, A.,
Stahl, U.,
and Schmidt, U.
(1998)
Crit. Rev. Biochem. Mol. Biol.
33,
259-296[CrossRef][Medline]
[Order article via Infotrieve] 9.
Schmid, S. R.,
and Linder, P.
(1992)
Mol. Microbiol.
6,
283-291[Medline]
[Order article via Infotrieve] 10.
de la Cruz, J.,
Kressler, D.,
and Linder, P.
(1999)
Trends Biochem. Sci.
24,
192-198[CrossRef][Medline]
[Order article via Infotrieve] 11.
Jankowsky, E.,
Gross, C. H.,
Shuman, S.,
and Pyle, A. M.
(2001)
Science
291,
121-125 12.
Chen, J. Y.,
Stands, L.,
Staley, J. P.,
Jackups, R. R., Jr.,
Latus, L. J.,
and Chang, T. H.
(2001)
Mol. Cell
7,
227-232[CrossRef][Medline]
[Order article via Infotrieve] 13.
Rossler, O. G.,
Straka, A.,
and Stahl, H.
(2001)
Nucleic Acids Res.
29,
2088-2096 14.
Rozen, F.,
Edery, I.,
Meerovitch, K.,
Dever, T. E.,
Merrick, W. C.,
and Sonenberg, N.
(1990)
Mol. Cell. Biol.
10,
1134-1144 15.
Hirling, H.,
Scheffner, M.,
Restle, T.,
and Stahl, H.
(1989)
Nature
339,
562-564[CrossRef][Medline]
[Order article via Infotrieve] 16.
Raghunathan, P. L.,
and Guthrie, C.
(1998)
Curr. Biol.
8,
847-855[CrossRef][Medline]
[Order article via Infotrieve] 17.
Wang, Y.,
Wagner, J. D.,
and Guthrie, C.
(1998)
Curr. Biol.
8,
441-451[CrossRef][Medline]
[Order article via Infotrieve] 18.
Warrener, P.,
and Collett, M. S.
(1995)
J. Virol.
69,
1720-1726[Abstract] 19.
Shuman, S.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10935-10939 20.
Iggo, R. D.,
and Lane, D. P.
(1989)
EMBO J.
8,
1827-1831[Medline]
[Order article via Infotrieve] 21.
Ford, M. J.,
Anton, I. A.,
and Lane, D. P.
(1988)
Nature
332,
736-738[CrossRef][Medline]
[Order article via Infotrieve] 22.
Heinlein, U. A.
(1998)
J. Pathol.
184,
345-347[CrossRef][Medline]
[Order article via Infotrieve] 23.
Liu, Z. R.,
Wilkie, A. M.,
Clemens, M. J.,
and Smith, C. W.
(1996)
RNA (New York)
2,
611-621 24.
Liu, Z. R.,
Sargueil, B.,
and Smith, C. W.
(1998)
Mol. Cell. Biol.
18,
6910-6920 25.
Chan, K.-M.,
Delfert, D.,
and Junger, K. D.
(1986)
Anal. Biochem.
157,
375-380[CrossRef][Medline]
[Order article via Infotrieve] 26.
Pugh, G. E.,
Nicol, S. M.,
and Fuller-Pace, F. V.
(1999)
J. Mol. Biol.
292,
771-778[CrossRef][Medline]
[Order article via Infotrieve] 27.
Liu, Z. R.,
Laggerbauer, B.,
Luhrmann, R.,
and Smith, C. W.
(1997)
RNA (New York)
3,
1207-1219 28.
Jankowsky, E.,
Gross, C. H.,
Shuman, S.,
and Pyle, A. M.
(2000)
Nature
403,
447-451[CrossRef][Medline]
[Order article via Infotrieve] 29.
Jaramillo, M.,
Dever, T. E.,
Merrick, W. C.,
and Sonenberg, N.
(1991)
Mol. Cell. Biol.
11,
5992-5997 30.
Pause, A.,
and Sonenberg, N.
(1993)
Curr. Opin. Struct. Biol.
3,
953-959[CrossRef] 31.
Linder, P.,
and Daugeron, M. C.
(2000)
Nat. Struct. Biol.
7,
97-99[CrossRef][Medline]
[Order article via Infotrieve] 32.
Lorsch, J. R.,
and Herschlag, D.
(1998)
Biochemistry
37,
2194-2206[CrossRef][Medline]
[Order article via Infotrieve] 33.
Lorsch, J. R.,
and Herschlag, D.
(1998)
Biochemistry
37,
2180-2193[CrossRef][Medline]
[Order article via Infotrieve] 34.
Gibson, T. J.,
and Thompson, J. D.
(1994)
Nucleic Acids Res.
22,
2552-2556 35.
Tanner, N. K.,
and Linder, P.
(2001)
Mol. Cell
8,
251-262[CrossRef][Medline]
[Order article via Infotrieve] 36.
Kim, J. L.,
Morgenstern, K. A.,
Griffith, J. P.,
Dwyer, M. D.,
Thomson, J. A.,
Murcko, M. A.,
Lin, C.,
and Caron, P. R.
(1998)
Structure
6,
89-100[Medline]
[Order article via Infotrieve] 37.
Yao, N.,
Hesson, T.,
Cable, M.,
Hong, Z.,
Kwong, A. D., Le, H. V.,
and Weber, P. C.
(1997)
Nat. Struct. Biol.
4,
463-467[CrossRef][Medline]
[Order article via Infotrieve] 38.
Johnson, E. R.,
and McKay, D. B.
(1999)
RNA (New York)
5,
1526-1534 39.
Benz, J.,
Trachsel, H.,
and Baumann, U.
(1999)
Struct. Fold. Des.
7,
671-679[Medline]
[Order article via Infotrieve] 40.
Caruthers, J. M.,
Johnson, E. R.,
and McKay, D. B.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
13080-13085 41.
Pause, A.,
Methot, N.,
and Sonenberg, N.
(1993)
Mol. Cell. Biol.
13,
6789-6798 42.
Lorkovic, Z. J.,
Herrmann, R. G.,
and Oelmuller, R.
(1997)
Mol. Cell. Biol.
17,
2257-2265[Abstract] 43.
Fuller-Pace, F. V.,
Nicol, S. M.,
Reid, A. D.,
and Lane, D. P.
(1993)
EMBO J.
12,
3619-3626[Medline]
[Order article via Infotrieve] 44.
He, F.,
and Jacobson, A.
(1995)
Genes Dev.
9,
437-454 45.
Nicol, S. M.,
Causevic, M.,
Prescott, A. R.,
and Fuller-Pace, F. V.
(2000)
Exp. Cell Res.
257,
272-280[CrossRef][Medline]
[Order article via Infotrieve] 46.
Watanabe, M.,
Yanagisawa, J.,
Kitagawa, H.,
Takeyama, K.,
Ogawa, S.,
Arao, Y.,
Suzawa, M.,
Kobayashi, Y.,
Yano, T.,
Yoshikawa, H.,
Masuhiro, Y.,
and Kato, S.
(2001)
EMBO J.
20,
1341-1352[CrossRef][Medline]
[Order article via Infotrieve] 47.
Endoh, H.,
Maruyama, K.,
Masuhiro, Y.,
Kobayashi, Y.,
Goto, M.,
Tai, H.,
Yanagisawa, J.,
Metzger, D.,
Hashimoto, S.,
and Kato, S.
(1999)
Mol. Cell. Biol.
19,
5363-5372
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  D. W. Salzman, J. Shubert-Coleman, and H. Furneaux P68 RNA Helicase Unwinds the Human let-7 MicroRNA Precursor Duplex and Is Required for let-7-directed Silencing of Gene Expression J. Biol. Chem., November 9, 2007; 282(45): 32773 - 32779. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Shen, L. Zhang, and R. Zhao Biochemical Characterization of the ATPase and Helicase Activity of UAP56, an Essential Pre-mRNA Splicing and mRNA Export Factor J. Biol. Chem., August 3, 2007; 282(31): 22544 - 22550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Yang, C. Lin, S. Zhao, H. Wang, and Z.-R. Liu Phosphorylation of p68 RNA Helicase Plays a Role in Platelet-derived Growth Factor-induced Cell Proliferation by Up-regulating Cyclin D1 and c-Myc Expression J. Biol. Chem., June 8, 2007; 282(23): 16811 - 16819. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nie, G. L. Hammond, and J.-H. Yang Double-Stranded RNA Deaminase ADAR1 Increases Host Susceptibility to Virus Infection J. Virol., January 15, 2007; 81(2): 917 - 923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Buszczak and A. C. Spradling The Drosophila P68 RNA helicase regulates transcriptional deactivation by promoting RNA release from chromatin Genes & Dev., April 15, 2006; 20(8): 977 - 989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Matsui, K. Hogetsu, J. Usukura, T. Sato, T. Kumasaka, Y. Akao, and N. Tanaka Structural insight of human DEAD-box protein rck/p54 into its substrate recognition with conformational changes Genes Cells, April 1, 2006; 11(4): 439 - 452. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Lin, L. Yang, J. J. Yang, Y. Huang, and Z.-R. Liu ATPase/Helicase Activities of p68 RNA Helicase Are Required for Pre-mRNA Splicing but Not for Assembly of the Spliceosome Mol. Cell. Biol., September 1, 2005; 25(17): 7484 - 7493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. E. Giles and K. L. Beemon Retroviral Splicing Suppressor Sequesters a 3' Splice Site in a 50S Aberrant Splicing Complex Mol. Cell. Biol., June 1, 2005; 25(11): 4397 - 4405. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Yang, C. Lin, and Z.-R. Liu Phosphorylations of DEAD Box p68 RNA Helicase Are Associated with Cancer Development and Cell Proliferation Mol. Cancer Res., June 1, 2005; 3(6): 355 - 363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Chamot, K. R. Colvin, S. L. Kujat-Choy, and G. W. Owttrim RNA Structural Rearrangement via Unwinding and Annealing by the Cyanobacterial RNA Helicase, CrhR J. Biol. Chem., January 21, 2005; 280(3): 2036 - 2044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kikuma, M. Ohtsu, T. Utsugi, S. Koga, K. Okuhara, T. Eki, F. Fujimori, and Y. Murakami Dbp9p, a Member of the DEAD Box Protein Family, Exhibits DNA Helicase Activity J. Biol. Chem., May 14, 2004; 279(20): 20692 - 20698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. C. Ogilvie, B. J. Wilson, S. M. Nicol, N. A. Morrice, L. R. Saunders, G. N. Barber, and F. V. Fuller-Pace The highly related DEAD box RNA helicases p68 and p72 exist as heterodimers in cells Nucleic Acids Res., March 1, 2003; 31(5): 1470 - 1480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Minczuk, J. Piwowarski, M. A. Papworth, K. Awiszus, S. Schalinski, A. Dziembowski, A. Dmochowska, E. Bartnik, K. Tokatlidis, P. P. Stepien, et al. Localisation of the human hSuv3p helicase in the mitochondrial matrix and its preferential unwinding of dsDNA Nucleic Acids Res., December 1, 2002; 30(23): 5074 - 5086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-G. Lee RH70, a Bidirectional RNA Helicase, Co-purifies with U1snRNP J. Biol. Chem., October 11, 2002; 277(42): 39679 - 39683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ishizuka, M. C. Siomi, and H. Siomi A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins Genes & Dev., October 1, 2002; 16(19): 2497 - 2508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-R. Liu p68 RNA Helicase Is an Essential Human Splicing Factor That Acts at the U1 snRNA-5' Splice Site Duplex Mol. Cell. Biol., August 1, 2002; 22(15): 5443 - 5450. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |