JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M108530200 on February 1, 2002

J. Biol. Chem., Vol. 277, Issue 16, 13693-13699, April 19, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/16/13693    most recent
M108530200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stephanou, A.
Right arrow Articles by Latchman, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stephanou, A.
Right arrow Articles by Latchman, D. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Antiapoptotic Activity of the Free Caspase Recruitment Domain of Procaspase-9

A NOVEL ENDOGENOUS RESCUE PATHWAY IN CELL DEATH*

Anastasis StephanouDagger §, Tiziano M. ScarabelliDagger , Richard A. Knight, and David S. LatchmanDagger

From the Dagger  Medical Molecular Biology Unit, Institute of Child Health, University College London, 30 Guilford Street, London WC1N 1EH, United Kingdom and the  National Heart and Lung Institute, Royal Brompton Hospital, London SW3 6LR, United Kingdom

Received for publication, September 5, 2001, and in revised form, January 18, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mitochondrial injury initiates proteolytic processing of procaspase-9 into the large and small subunits, leading to apoptotic cell death. Here we show that the free caspase recruitment domain (CARD) released by procaspase-9 processing activates nuclear factor kappa B expression. A procaspase-9 construct with a point mutation that abrogates the release of the CARD abolished nuclear factor kappa B activation. Most importantly, the free CARD is shown to enhance the expression of the gene encoding the antiapoptotic Bcl-x protein and to strongly inhibit apoptosis. This is the first demonstration that different domains of the same caspase protein have proapoptotic and antiapoptotic effects and suggests that the relative effects of these domains are important in regulating the balance between death and survival.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The response to many apoptotic stimuli is initiated by mitochondrial release of cytochrome c, which, together with Apaf-1 and ATP, facilitates the processing and activation of procaspase-9. Integral to this and the formation of the apoptosome is the association between Apaf-1 and procaspase-9 mediated by interaction between the respective CARDs1 of the two proteins (1, 2). Recent studies have shown that X-linked inhibitor of apoptosis binds to processed caspase-9 but not the unprocessed zymogen and inhibits caspase-9 enzymatic activity (3). This forms one mechanism whereby an injured cell can protect itself from apoptosis. However, release of another mitochondrial protein, Smac/DIABLO, displaces active X-linked inhibitor of apoptosis from caspase-9 and leads to downstream caspase activation (4). Further procaspase-9 processing by caspase-3 also leads to the removal of the N-terminal CARD by cleavage at position Asp130 (5).

The CARD proteins were first identified as peptide modules present in the prodomains of upstream caspases and adaptor molecules such as procaspase-9, Apaf-1, and RAIDD, which were shown to be important in protein-protein interactions (6). CARD-CARD interactions are generally accepted to be very selective between binding partners in mediating intracellular signaling pathways such as caspase activation. More recently, CARD-containing proteins have been shown to mediate NF-kappa B activation. For example, CARD-4 (NOD1), an Apaf-1-like protein, interacts with procaspase-9 and RICK, a CARD-containing serine threonine kinase and upstream activator of NF-kappa B-inducing kinase and Ikappa B kinase (IKKalpha and IKKbeta ), resulting in NF-kappa B activation (7, 8). Like CARD-4, Bcl-10, the cellular homologue of the equine herpesvirus E10 protein (9, 10), induces both apoptosis and NF-kappa B activation. In contrast, the truncated tumor-derived Bcl-10 mutant is unable to induce cell death but is still able to activate NF-kappa B via its CARD (10).

In unstimulated cells, NF-kappa B is found sequestered in the cytoplasm through interaction with the inhibitory Ikappa B protein. Phosphorylation of Ikappa B by IKKs leads to proteasomal degradation, thereby relieving the inhibitory effect of Ikappa B, leading to translocation of NF-kappa B to the nucleus to activate NF-kappa B-responsive genes. Very little is known about NF-kappa B regulation by the CARD proteins Apaf-1 and procaspase-9, which form the apoptosome after mitochondrial injury. Hence, in this study we have tested whether these two proteins, which mediate the activation of the caspase cascade leading to apoptosis, may also activate NF-kappa B and have an effect on apoptosis independent of proteolysis by active caspase-9. We show for the first time that the free CARD of caspase-9, released by proteolytic cleavage, activates NF-kappa B and has an antiapoptotic effect.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Constructs and Transfection-- Expression vectors containing various caspase-9 subunits were constructed by PCR using the following primers: caspase-9 long/small, P1 (GGATCCATGCCCAGACCAGTGGACATTGG) and P2 (GGTCTAGATTATGATGTTTTAAAGAAAAGG); caspase-9 large subunit, P1 and P3 (GCGGCCGCCCCACCACA GGCCTGGATGACC); and caspase-9 small subunit, P5 (GGATCCATGGAGCAGAAAGACCATGGG) and P2. All cDNAs were cloned into the expression vector pFLAG-CMV2 (Kodak). The CARD of procaspase-9 was constructed by removing the large and small subunits of procaspase-9 by restriction endonuclease digestion of pCMVdw-Caspase-9 with BstXI and EcoRI. The mutant procaspase-9 in which the aspartic acid residue was changed to an alanine at position 130 was constructed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) using the following primers: P6 (CCCAGAGGAGTGGCCATTGGTTCTGG) and P7 (CCAGAACCAATGCCCACTCCTCTGGG). The CARD of Apaf-1 (position 581 to 844) was constructed by PCR using the following primers: P8 (GGATGCAAAA GCTCGAAATTGG) and P2 (GGACGAAAGAGACAACAGGAATGCC).

cDNAs expressing various caspase-9 subunits were constructed by PCR using the following primers: caspase-9 large/small subunit, P1 (GGATCCATGCCCAGACCAGTGGACATTGG) and P2 (GGTCTAGATTATGATGTTTTAAAGAAAAG); caspase-9 large subunit, P1 and P3 (GCGGCCGCCCCACCACAGGCCTGGATGCC); and caspase-9 small subunit, P5 (GGATCCATGGAGCAGAAAGACCATGGG) and P2. All cDNAs were cloned into the expression vector pFLAG-CMV2 (Kodak). The CARD of procaspase-9 was constructed by removing the large and small subunits of procaspase-9 by restriction endonuclease digestion of pCMVdw-Caspase-9 with BstXI and EcoRI. The mutant procaspase-9 in which the aspartic acid residue was change to an alanine at position 130 (D130A) was constructed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) using the following primers: P1 (CCCAGAGGAGTGGCCATTGGTTCTGG) and P2 (CCAGAACCAATGCCCACTCCTCTGGG). The CARD of Apaf-1 (position 581 to 844) was constructed by PCR using the following primers: P1 (GGATGCAAAAGCTCGAAATTG) and P2 (GGACGAAAGAGACAACAGGAATGCC). Stable inducible expression vectors of caspase-9s or the CARD of procaspase-9 were constructed using the Tet-Off vector pBGI plasmid (CLONTECH). Transfection of reporter constructs (NF-kappa B-luciferase and Gal4-luciferase Bcl-x-luciferase) was performed by the calcium phosphate method in the ND7 neuronal cell line.

Cell Culture and Transfection-- The ND7 neuronal cell line was maintained in L-15 medium (Invitrogen) with 10% fetal bovine serum and 5 mM L-glutamine. Murine embryonic fibroblasts (MEFs) from wild-type (MEF+/+) or caspase-9-deficient cells (MEF-/-) were maintained in Dulbecco's modified Eagle's medium (Invitrogen) with 10% fetal bovine serum. Cells were grown at 37 °C with 5% CO2. Stable inducible expression vectors of caspase-9s or the CARD of procaspase-9 were constructed using the Tet-Off vector pBGI plasmid (CLONTECH) in ND7 cells, and clones were selected in the presence of neomycin. Because the pBGI construct also expressed the beta -galactosidase gene, clonal cells expressing caspase-9s and the CARD will also be beta -galactosidase-positive after the removal of doxycycline (250 ng/ml). ND7 or MEF cells were treated with 100 nM staurosporine (Sigma) or exposed to simulated ischemia in ischemic buffer (137 mM NaCl, 12 mM KCl, 0.49 mM MgCl2, 0.9 mM CaCl2H2O, 4 mM HEPES, 20 mM sodium lactate, and 10 mM deoxyglucose, pH 6.2 (Sigma)), and the cells were incubated at 37 °C in an ischemic chamber for 2 h in an atmosphere of 0% oxygen, 5% CO2, balance gas argon (BOC gases).

Transfection of reporter constructs (NF-kappa B-luciferase, Gal4-luciferase Bcl-x-luciferase) was performed by the calcium phosphate method in the ND7 neuronal cell line.

Band Shift Assays-- Cell extracts were prepared for band shift assay from ND7 cells treated with 100 nM staurosporine (Sigma) for 4 h. In separate experiments, cells were also pretreated with cucumin (Sigma) or transfected with the dominant negative expression vector for IKK (dn-IKK). A NF-kappa B DNA probe (Santa Cruz Biotechnology, Inc.) was incubated for 30 min. In some assays, an antibody to p65 or a nonspecific antibody was incubated with the cell extracts before adding the DNA probe. Samples were then run on a 4% non-SDS-polyacrylamide gel, dried, and exposed for autoradiography.

Western Blotting-- ND7 cells were exposed for 4 h in a hypoxic chamber and then returned to a normoxic environment for an additional 16 h or serum-starved for 16 h. In a separate experiment, ND7 cells were also exposed to staurosporine (100 nM) for 16 h. Approximately 1 × 106 cells were harvested in 100 µl of 2× concentrated SDS-PAGE sample buffer. Samples were then electrophoresed on an 8% SDS-polyacrylamide gel, transferred to nitrocellulose filters, and subjected to Western blotting with specific antibodies against Bcl-xL, actin, or caspase-9 (Santa Cruz Biotechnology, Inc.).

Assessing Apoptosis-- Cytoprotective effects of caspase-9s or procaspase-9 CARD after exposure to various stressful stimuli were assessed by the terminal deoxynucleotidyl transferase-mediated nick end labeling method in the ND7 stable cell lines. After exposure to hypoxia in a hypoxic chamber or serum starvation, cells were fixed in 0.5% glutaraldehyde and stained with 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside to test for beta -galactosidase activity. Terminal deoxynucleotidyl transferase-mediated nick end labeling assays were also performed on the fixed cells. The percentage of apoptotic cells was determined by calculating the fraction of cells positive for both beta -galactosidase and terminal deoxynucleotidyl transferase-mediated nick end labeling.

Caspase Activity-- Caspase-9 (LEHD) and caspase-3 (DEVD) cleavage activity was measured by the colorimetric assay according to the directions of the manufacturer (Calbiochem). Cell lysates were obtained from 1 × 106 cells after 4 h of staurosporine (100 nM) treatment. In some experiments, cells were pretreated with a caspase-9 chemical inhibitor (LEHD-CHO, 25 µM), a caspase-8 chemical inhibitor (IETD-CHO, 25 µM), or a caspase-1 chemical inhibitor (YVAD-CHO, 25 µM; Calbiochem).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Procaspase-9 Processing Activates NF-kappa B Promoter Activity-- To study whether procaspase-9 processing is able to mediate NF-kappa B activation, we examined the effect of staurosporine, a well-known inducer of procaspase-9 processing. As shown in Fig. 1A, staurosporine treatment of the neuronal cell line ND7 transfected with a NF-kappa B reporter construct resulted in the enhancement of NF-kappa B activity. To demonstrate that the enhancement of NF-kappa B activity is associated with DNA binding, we performed band shift assays with a specific NF-kappa B DNA probe. As shown in Fig. 1B, ND7 cells treated with staurosporine produced a specific band that could be abolished by pretreatment of ND7 cells with the NF-kappa B chemical inhibitor cucumin or by overexpression of the dominant negative IKK vector. In addition, cell extract incubated with an antibody to p65 also abolished the specific band, but this was not observed with a nonspecific antibody (rabbit serum). As expected, staurosporine also resulted in an increase in procaspase-9 and caspase-3 enzyme activity as assessed by LEHD and DEVD cleavage, respectively (Fig. 1C).


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 1.   Staurosporine (ST) (100 nM) causes procaspase-9 activation and NF-kappa B transactivation. A, treatment of ND7 cells with 100 nM ST causes enhancement of NF-kappa B activation as assessed from an NF-kappa B reporter construct. Pretreatment with a broad caspase inhibitor (zVAD) or a specific caspase-9 chemical inhibitor (LEHD), but not a caspase-8 (IETD) or a caspase-1 (YVAD) chemical inhibitor, reduced NF-kappa B activation after ST treatment. The data represent the means ± S.E. of three independent experiments. B, band shift assay using cell extracts from ND7 cells treated with 100 nM staurosporine for 4 h, pretreated with 100 nM curcumine (Cu), or transfected with the dominant negative expression vector for IKK (dn-IKK). Also, an antibody to p65 (anti p65) or a nonspecific antibody (anti NS) was incubated with the cell extracts before the addition of the DNA probe. C, ST treatment also caused an increase in caspase-9 and caspase-3 enzymatic activity as measured by Ac-LEHD and Ac-DEVD cleavage activity, respectively. The caspase-9 (LEHD) and zVAD chemical inhibitors also reduced enzymatic activity after ST treatment. D, ST also resulted in procaspase-9 processing as determined by Western blotting.

A broad caspase inhibitor (zVAD) or a specific caspase-9 chemical inhibitor (LEHD-CHO), but not a chemical inhibitor of caspase-8 (IETD-CHO) or caspase-1 (YVAD-CHO), abrogated NF-kappa B activation (Fig. 1A) and procaspase-9 enzymatic activity (Fig. 1C) after staurosporine treatment. In addition, procaspase-9 processing into its p37 and p12 subunits was also confirmed after staurosporine treatment (Fig. 1D). Although it has been suggested that some caspase inhibitors are somewhat promiscuous, we have used the concentration of the caspase-9 chemical inhibitor LEHD-CHO that has been reported to be specific for inhibiting caspase processing (11). These results demonstrate that procaspase-9 processing is able to mediate NF-kappa B activation.

The Free CARD of Procaspase-9 Mediates NF-kappa B and Gal4-p65 Transactivation-- To understand the relationship of procaspase-9 processing and NF-kappa B activity, we examined the effects of co-transfecting different subunits of procaspase-9 (Fig. 2A) with the NF-kappa B reporter construct. As shown in Fig. 2b, overexpression of procaspase-9 alone had no effect on NF-kappa B activity. However, overexpression of procaspase-9 plus staurosporine treatment resulted in enhanced NF-kappa B activation. Caspase-9 constructs expressing the large plus small subunit or the large or small subunit alone had no effect on enhancing NF-kappa B activity after staurosporine treatment compared with staurosporine treatment alone. However, a construct expressing the isolated CARD of procaspase-9 enhanced NF-kappa B activity without staurosporine treatment. Interestingly, overexpression of an Apaf-1 construct together with procaspase-9 enhanced NF-kappa B activation to a level greater than that of procaspase-9 alone in staurosporine-treated cells. Constructs expressing full-length Apaf-1 or the isolated CARD of Apaf-1 had no effect in promoting NF-kappa B activation in the absence of procaspase-9 (Fig. 2B).


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 2.   The CARD of procaspase-9 is essential for NF-kappa B activation. A, representation of full-length and various subunits of procaspase-9 and full-length caspase-9s. B, ND7 cells were transfected with the NF-kappa B reporter together with the following constructs: full-length procaspase-9 (C-9), large plus small subunit (C-9 L/S), small subunit (C-9 SS), CARD of procaspase-9 (C-9 CARD), caspase-9s (C9s), Apaf-1, or the CARD of Apaf-1 (Apaf-1 CARD) and assessed for NF-kappa B activation. The data represent the means ± S.E. of three independent experiments. C, endogenous expression of caspase-9 is required for maximal NF-kappa B activation. Caspase-9 wild-type MEF+/+ and caspase-9-deficient MEF-/- cells were transfected with control vector (C) or caspase-9 wild type (C9) or mutant caspase-9 D130A (C9D/A) together with the NF-kappa B reporter construct and effect left untreated or exposed to staurosporine (St; 100 nM) for 4 h or ischemia (Isch) for 2 h. The data represent the means ± S.E. of three independent experiments.

These data reveal that procaspase-9 processing mediates NF-kappa B activation, which is specifically dependent on the CARD of procaspase-9 but is also modulated by Apaf-1, presumably by increasing the level of procaspase-9 processing within the apoptosome complex. Most importantly, activation of NF-kappa B is dependent on the CARD released by caspase-9 processing because such activation is observed even in the absence of staurosporine with only the isolated CARD. This effect is specific for the isolated CARD of caspase-9 but not for the the isolated CARD of Apaf-1, thus indicating that it is unlikely to be the result of nonphysiological aggregation or nonspecific stress after overexpression of the different factors in ND7 cells.

Having established the effect of caspase-9 on NF-kappa B activation in transfected cells, we wished to test whether these effects would also be observed in untransfected cells and determine whether endogenous caspase-9 is necessary for NF-kappa B activation in response to stimuli known to promote procaspase-9 processing. To do this, we compared the responses in wild- type (MEF C9+/+) or caspase-9-deficient cells (MEF C9-/-) obtained from knockout mice lacking caspase-9. As shown in Fig. 2C, treatment of MEF C9+/+ cells with staurosporine enhanced NF-kappa B activity by ~4-fold (p < 0.05; compare the left two bars in the left panel of Fig. 2C). However, staurosporine treatment of MEF C9-/- cells did not result in any increase in activity (p > 0.10). Moreover, transfection of a caspase-9 expression vector plus staurosporine treatment enhanced NF-kappa B activity to a greater extent than treatment with staurosporine alone in MEF C9+/+ cells (p < 0.05). However, reintroducing wild-type but not the uncleavable procaspase-9 D130A mutant back into MEF C9 -/- cells plus staurosporine treatment restored the enhancement of NF-kappa B activity (p < 0.05). Similar results were also obtained when MEF C9+/+ or MEF C9-/- cells were exposed to simulated ischemia/reperfusion, a physiological stimulus known to promote caspase-9 processing (12). Thus, these results indicate that the effect we observed occurred in untransfected cells as well as in cells overexpressing caspase-9 and that endogenous caspase-9 processing is required for maximal NF-kappa B activity.

The p65 subunit of NF-kappa B has been well documented to be important in mediating the transcriptional effects after cellular signaling, which activates NF-kappa B (13). Therefore we also assessed whether the effects of procaspase-9 on NF-kappa B activation are mediated via protein-protein interaction of the CARD and the p65 subunit using a mammalian one-hybrid assay. The p65 subunit (amino acids 1-551) was fused with the heterologous Gal4 DNA-binding domain and transfected into ND7 cells together with a Gal4 reporter construct. Cells were further transfected with constructs expressing full-length procaspase-9 or the CARD of procaspase-9, and the activity of the Gal4 reporter was assessed without and with staurosporine treatment. As shown in Fig. 3A, staurosporine stimulated the activity of the Gal4 reporter in cells transfected with Gal4-p65 but had no effect on the isolated Gal4 DNA-binding domain. Gal4 activity was enhanced further in cells transfected with both Gal4-p65 and procaspase-9, but only in the presence of staurosporine to induce caspase-9 processing. Moreover, enhanced Gal4 activity was observed with the isolated CARD of procaspase-9 even in the absence of staurosporine (Fig. 3A). These data are further evidence that procaspase-9 processing or the free CARD of caspase-9 is able to mediate NF-kappa B activation via the p65 subunit.


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 3.   A, caspase processing interacts with Gal4-p65 and activates Gal4 activity. ND7 cells were transfected with a Gal4 reporter plus a Gal4-p65 construct together with full-length procaspase-9 (C-9), large plus small subunit (C-9 L/S), small subunit (C-9 SS), CARD, caspase-9s (C9s), Apaf-1, or Apaf-1 CARD and assessed for Gal4 acti- vation. The data represent the means ± S.E. of three independent experiments. In all cases, Western blot analysis (anti-FLAG) of the transfected cells indicated that each protein was expressed to similar levels (data not shown). B, the Asp130 residue is required for NF-kappa B activation after procaspase-9 processing. ND7 cells were transfected with the NF-kappa B reporter construct together with either wild-type procaspase-9 (C-9) or mutant procaspase-9 (C-9 130D/A), and NF-kappa B activity was assessed after ST treatment. C, wild-type procaspase-9 (Casp9 wt) but not mutant D130A procaspase-9 (Casp-9 mut) releases the CARD after procaspase-9 processing. 35S-labeled in vitro-translated wild-type or mutant procaspase-9 was incubated with cytoplasmic extract from ND7 cells treated with (lanes 2, 3, 5, and 6) or without (lanes 1 and 4) 100 nM staurosporine to induce procaspase-9 processing. ND7 cells were also pretreated with the caspase-3 chemical inhibitor (lanes 3 and 6). Lane 7 is 35S-labeled in vitro-translated CARD of procaspase-9.

Because procaspase-9 requires processing to induce NF-kappa B activity, we speculate that procaspase-9 processing liberates the CARD from the large subunit and exposes the region that mediates NF-kappa B activation. To test this further, we assessed the effect of the naturally occurring alternatively spliced form of procaspase-9, caspase-9s, which has the large catalytic subunit deleted but contains the CARD. Overexpression of caspase-9s enhanced NF-kappa B activity as well as Gal4-p65 activity directly, without a procaspase-9 processing stimulus (Figs. 2B and 3A). Hence, it is likely that the large subunit is indeed suppressing endogenous CARD-mediated NF-kappa B activation in intact procaspase-9.

Recently, it has been demonstrated that the site in procaspase-9 that releases the CARD from the large subunit (Asp130) is cleaved mainly by caspase-3 (5). This may explain our observation that a caspase-9 chemical inhibitor (Fig. 1), which will inhibit activation of caspase-3 by caspase-9, and a specific caspase-3 chemical inhibitor, which will inhibit further caspase-9 processing by caspase-3, both abrogated NF-kappa B activation. To test this further, we mutated the aspartic acid residue at position 130 of caspase-9 to an alanine (D130A) and tested this procaspase-9 mutant for its ability to induce NF-kappa B activity after procaspase-9 processing stimulus. Cells transfected with this mutant did not show NF-kappa B activity (Fig. 3B) or Gal4-p65 activity (data not shown) after staurosporine treatment. Hence, these data demonstrate that the Asp130 site is critical for the free CARD to be released during procaspase-9 processing, leading to NF-kappa B activation.

To confirm that the procaspase-9 D130A mutant cannot be cleaved to free the CARD after staurosporine treatment, we labeled in vitro-translated wild-type and mutant procaspase-9 protein and incubated these with cytoplasmic extracts from ND7 cells with or without staurosporine. As shown in Fig. 3C, wild-type procaspase-9 protein incubated with cytoplasmic extract from staurosporine-treated cells resulted in the appearance of the expected p35 fragment and also a p16 fragment (lane 2) that runs at a similar position to the control expressed CARD protein of procaspase-9 (lane 7). The anticipated large (p22) and small (p12) catalytic subunits were also produced with wild-type procaspase-9 protein incubated with cytoplasmic extracts from staurosporine-treated cells (lane 2). In contrast, the p16 fragment was not generated from mutant procaspase-9 incubated with cytoplasmic extract from staurosporine-treated cells (lane 5). Furthermore, pretreatment of cells with the caspase-3 chemical inhibitor also abolished the appearance of the p16 CARD fragment from wild-type procaspase-9 protein treated with staurosporine (Fig. 3C), confirming that the CARD is indeed released by caspase-3 cleavage of caspase-9 at the aspartic acid position (Asp130).

The CARD of Caspase-9 Activates the Bcl-x Promoter and Promotes Cytoprotection-- Recently, the antiapoptotic Bcl-x gene has been reported to be activated by NF-kappa B (14, 15). Therefore, we examined whether NF-kappa B activity stimulated by caspase-9s or the isolated CARD of procaspase-9 is able to activate the Bcl-x gene. As shown in Fig. 4A, overexpression of caspase-9s or the CARD of procaspase-9 together with a Bcl-x reporter construct resulted in the enhancement of Bcl-x promoter activity. Co-transfection of a dominant negative IKK construct (which is known to inhibit the activity of Ikappa B kinase subunits) abrogated caspase-9s or CARD enhancement of Bcl-x promoter activity. In addition, a chemical inhibitor of IKKs, cucumin, also abrogated caspase-9s or CARD enhancement of Bcl-x promoter activity (Fig. 4A). Overexpression of procaspase-9 alone had no effect on Bcl-x promoter activity. However, overexpression of procaspase-9 plus staurosporine enhanced Bcl-x promoter activity, again demonstrating that procaspase-9 processing and release of the CARD mediate NF-kappa B activity (data not shown). Analysis of the Bcl-x promoter revealed several putative NF-kappa B binding sites. A truncated Bcl-x promoter construct lacking the NF-kappa B binding sites did not respond to overexpression of either caspase-9s, CARD, or procaspase-9 plus staurosporine (data not shown). Hence, these results demonstrate that caspase-9 processing can result in the activation of an NF-kappa B-dependent promoter and that these effects are dependent on the activation of NF-kappa B via the upstream activator, IKK.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 4.   Caspase-9s or the CARD of procaspase-9 enhances Bcl-x promoter activity via a NF-kappa B-dependent pathway. A, ND7 cells were transfected with a Bcl-x promoter reporter construct together with either a construct expressing caspase-9s (C9s) or the CARD of procaspase-9 (C-9CARD) and a construct expressing dominant negative IKK (dn-IKK) or pretreated with 100 nM curcumine (Cu). Bcl-x promoter activity was assessed, and data represent the means ± S.E. of three independent experiments. B, conditional expression of the free CARD of procaspase-9 induced Bcl-x expression and protected cells from apoptosis. Stable ND7 cell clones conditionally expressing caspase-9s (pBI-C9s), the CARD of procaspase-9 (pBI-CARD), or a control vector (pBI-G) were induced by the removal of doxycycline (Doxy) for 48 h and transfected with the Bcl-x promoter reporter construct. The data represent the means ± S.E. of three independent experiments. C, Western blot analysis of the effect of induced expression of caspase-9s (pBI-C9s) or the CARD of procaspase-9 (pBI-CARD) on expression of Bcl-x. D, effect of serum removal (SR) or hypoxia (Hpx)-induced apoptosis in cells induced to express the CARD of procaspase-9 after removal of doxycycline (Doxy) for 48 h. The data represent the means ± S.E. of three independent experiments. Cells were stained for beta -galactosidase to confirm gene expression because the Tet-Off vector contained a bidirectional CMV promoter driving expression of the beta -galactosidase gene in one direction and the inserted gene in the opposite direction. Removal of doxycycline for 48 h resulted in >90% beta -galactosidase-positive cells (data not shown).

To demonstrate these effects in a regulatable manner, we prepared stable ND7 cell clones conditionally expressing caspase-9s or the CARD of procaspase-9 using the tetracycline-regulated system (Tet-Off) (16). Induction of caspase-9s or CARD expression resulted in the enhancement of NF-kappa B (data not shown) and Bcl-x promoter activity (Fig. 4B) and also in the induction of Bcl-x protein (Fig. 4C), indicating that the endogenous gene was being activated in these cells.

In view of the enhanced Bcl-x expression, we next tested whether inducible expression of the CARD of caspase-9 is able to enhance cell survival by assessing the level of apoptotic cell death in our stable inducible cell clone expressing the CARD. As shown in Fig. 4D, cells expressing the CARD of caspase-9 were more resistant to apoptotic cell death than control clones after either serum removal or exposure to hypoxia. Most importantly, the survival of these clones was regulated by doxycline, and enhanced survival was observed when expression of the CARD was induced by removal of doxycycline.

It is possible that the isolated CARD of caspase-9 or full-length caspase-9s may be offering cytoprotection due to inhibition of caspase-9 activation as a dominant negative by competing for Apaf-1 via CARD-CARD interaction. However, we can rule this out by demonstrating that the same effect can be observed with a mutant caspase-9s (R56A) in which an arginine at position 56 was changed to an alanine (data not shown). It has already been demonstrated that the Arg at position 56 is required for procaspase-9 to interact with Apaf-1 for procaspase-9 processing (17). Thus, these results demonstrate that the CARD of caspase-9s is able to induce the expression of Bcl-x and to enhance cell survival independent of any possible effect as a dominant negative to caspase-9.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our data demonstrate that procaspase-9 processing, in addition to the production of enzymatically active caspase-9, also releases the CARD, which activates NF-kappa B, leading to increased expression of Bcl-x and cytoprotection. Studies are under way to identify the factor(s) that interacts with the caspase-9 CARD to mediate NF-kappa B activation. One candidate adaptor protein is RICK, a CARD-containing serine threonine kinase upstream activator of NF-kappa B-inducing kinase and IKK, which is known to mediate NF-kappa B activation (7, 8). It has also been reported that CARD-CARD interaction between Bcl-10 and another recently described CARD-containing protein, CARD9, functions as an oligomerization sequence that transduces the activation signal to IKK (18). Hence, these studies strongly demonstrate that the CARD is a critical domain in mediating protein-protein interactions and is known to be present in proteins in the cell death and NF-kappa B activation pathway.

The mechanism by which the CARD of caspase-9 is able to transduce NF-kappa B transactivation is not clear. However, the ability of the CARD of caspase-9 to induce Gal4-p65 activity (Fig. 2C) also suggests that the CARD of caspase-9 interacts with and modulates the p65 subunit of NF-kappa B either directly or indirectly by recruiting other adaptor proteins. There is also evidence that another CARD-containing protein major histocompatibility complex class II transactivator, CIITA, requires the CARD for maximal transactivation of major histocompatibility complex class II genes. Thus, the CARD of CIITA serves as a regulatory domain for transcriptional activity (19). Therefore, it is possible that the released CARD of caspase-9, like the CARD of CIITA, recognizes a CARD of an unidentified protein(s), possibly a transcription factor(s), that cooperates with the CARD complexes to enhance gene transactivation.

To our knowledge, this is the first demonstration that different domains of the same caspase protein have antiapoptotic and proapoptotic activities. NF-kappa B has also been shown to activate other antiapoptotic genes, such as IAPs (20, 21), which inhibit caspase-9 enzymatic activity (22, 23). However, the release of Smac/DIABLO from damaged mitochondria displaces IAPs from caspase-9 and will therefore promote further amplification and activation of the caspase cascade (4, 24). This will result in further processing of procaspase-9 by caspase-3, with the release of more CARD fragments and augmentation of the CARD/NF-kappa B/Bcl-x protective loop (Fig. 5). Inhibition of caspase-9 by IAPs at the level of the apoptosome is therefore likely to be short-lived, whereas the activation of antiapoptotic genes by the released CARD of procaspase-9 would provide a longer-term rescue pathway. Both IAPs and the free caspase-9 CARD/NF-kappa B/Bcl-x protective pathway therefore provide opportunities for the cell to survive and potentially repair the initial effects of an apoptotic stimulus, suggesting that apoptosis after caspase activation need not be inevitable. We also have evidence that in cardiac myocytes exposed to short periods of ischemia (10-15 min), caspase-9 processing is induced without any detectable level of apoptosis.2 Hence, an acute stress response may result in the cell initiating a protective pathway such as the CARD/NF-kappa B pathway to minimize apoptosis.


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 5.   Representation of the molecular pathways leading to the release of the free CARD of procaspase-9 and cell survival. Stressful stimuli leading to mitochondrial damage result in the release of cytochrome c and the association of procaspase-9 and Apaf-1. This in turn leads to autocatalysis and processing of procaspase-9 to form active caspase-9, which leads to processing and activation of active caspase-3. Active caspase-3 cleaves Asp130 of caspase-9 to release the CARD, which mediates NF-kappa B activation and induction of prosurvival genes Bcl-x and IAP members.


    ACKNOWLEDGEMENTS

We thank D.-W. Seol for the procaspase-9 and caspase-9s expression vectors, X. Wang for Apaf-1 expression vector, M. L. Schmitz for the Gal4-p65 construct, and S. Farrow for the dominant negative IKKalpha . We also thank Richard Flavell, who kindly provided the MEF caspase-9-deficient cells.

    FOOTNOTES

* This work was supported in part by the British Heart Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ A British Heart Foundation Intermediate Fellow. To whom correspondence should be addressed. Tel.: 44-207-247-9789; Fax: 44-207-905-2301; E-mail: a.stephanou@ich.ucl.ac.uk.

Published, JBC Papers in Press, February 1, 2002, DOI 10.1074/jbc.M108530200

2 T. M. Scarabelli, unpublished data.

    ABBREVIATIONS

The abbreviations used are: CARD, caspase recruitment domain; NF-kappa B, nuclear factor kappa B; IKK, Ikappa B kinase; MEF, murine embryonic fibroblast; ST, staurosporine; CMV, cytomegalovirus; IAP, inhibitory apoptotic protein; LEHD, Leu-Glu-His-Asp; DEVD, Asp-Glu-Val-Asp; IETD, Ile-Glu-Thr-Asp; YNAD, Tyr-Val-Aln-Asp; CHO, aldehyde.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Srinivasula, S. M., Ahmad, M., Fernandes-Alnemri, T., and Alnemri, E. S. (1998) Mol. Cell 1, 949-957[CrossRef][Medline] [Order article via Infotrieve]
2. Zhou, P., Chou, J., Olea, R. S., Yuan, J., and Wagner, G. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 11265-11270[Abstract/Free Full Text]
3. Srinivasula, S. M., Hedge, R., Saleh, A., Datta, P., Shiozaki, E., Chai, J., Lee, R. A., Robbins, P. D., Fernandes-Alnemri, T., and Alnemri, E. S. (2001) Nature 410, 112-116[CrossRef][Medline] [Order article via Infotrieve]
4. Chai, J., Du, C., Wu, J. M., Kyin, S., Wang, X., and Shi, Y. (2000) Nature 406, 855-862[CrossRef][Medline] [Order article via Infotrieve]
5. Fujita, E., Egashira, J., Urase, K., Kuida, K., and Momoi, T. (2001) Cell Death Differ. 8, 335-344[CrossRef][Medline] [Order article via Infotrieve]
6. Hofmann, K., Bucher, P., and Tschopp, J. (1997) Trends Biochem. Sci. 257, 155-156
7. Bertin, J., Nir, W. R., Fischer, C. M., Tayber, O. V., Errada, P. R., Grant, J. R., Keilty, J. J., Gosselin, M. L., Robison, K. E., Wong, G. H., Glucksmann, M. A., and DiStephano, P. S. (1999) J. Biol. Chem. 274, 12955-12958[Abstract/Free Full Text]
8. Inohara, F., Ogura, Y., Chen, F. F., Muto, A., and Nunez, G. (1999) J. Biol. Chem. 274, 14560-14564[Abstract/Free Full Text]
9. Willis, T. G., Jadayel, D. M., Du, M. O., Peng, H., Perry, A. R., Abdul-Rauf, M., Price, H., Karran, L., Majekodunmi, O., Wlodarska, I., Pan, L., Crook, T., Hamoudi, R., Isaacson, P. G., and Dyer, M. J. (1999) Cell 96, 35-45[CrossRef][Medline] [Order article via Infotrieve]
10. Costanzo, A., Guiet, C., and Vito, P. (1999) J. Biol. Chem. 274, 20127-20132[Abstract/Free Full Text]
11. Nakanishi, K., Maruyama, M., Shibata, T., and Morishima, N. (2001) J. Biol. Chem. 276, 41237-41244[Abstract/Free Full Text]
12. Karin, M., and Ben-Neriah, Y. (2000) Annu. Rev. Immunol. 18, 621-663[CrossRef][Medline] [Order article via Infotrieve]
13. Stephanou, A., Brar, B. K., Scarabelli, T., Knight, R. A., and Latchman, D. S. (2001) Cell Death Differ. 8, 434-435[CrossRef][Medline] [Order article via Infotrieve]
14. Chen, C., Edelstein, L. C., and Gelinas, C. (2000) Mol. Cell. Biol. 20, 2687-2695[Abstract/Free Full Text]
15. Cheng, Q., Lee, Y., Parks, T. P., and Cheng, G. (2000) Oncogene 19, 4936-4940[CrossRef][Medline] [Order article via Infotrieve]
16. Wang, C. Y., Korneluk, R. G., Goeddel, D. V., and Baldwin, A. S. (1998) Science 281, 1680-1683[Abstract/Free Full Text]
17. LaCasse, E. C., Baird, S., Korneluk, R. G., and MacKenzie, A. E. (1998) Oncogene 17, 3247-3259[CrossRef][Medline] [Order article via Infotrieve]
18. Quin, H., Srinivasula, S. M., Wu, G., Fernandes-Alnemri, T., and Alnemri, E. S. (1999) Nature 399, 549-557[CrossRef][Medline] [Order article via Infotrieve]
19. Bertin, J., Guo, Y., Wang, L., Srinvivasula, S. M., Jacobson, M. D., Poyet, J.-L., Merriam, S., Du, M.-Q., Dyer, M. J., Robison, K. E., DiStefano, P. S., and Alnemri, E. S. (2000) J. Biol. Chem. 275, 41082-41086[Abstract/Free Full Text]
20. Nickerson, K., Sisk, T. J., Inohara, N., Tee, C. S., Kennell, J., Cho, M.-C., Yannie, P. S., Nunez, G., and Chang, C.-H. (2001) J. Biol. Chem. 276, 19089-19093[Abstract/Free Full Text]
21. Deveraux, Q. L., Leo, E., Stennicke, H. R., Welsh, K., Salvesen, G. S., and Reed, J. C. (1999) EMBO J. 18, 5242-5251[CrossRef][Medline] [Order article via Infotrieve]
22. Wu, G., Chai, J., Suber, T. L., Wu, J. W., Du, C., Wang, X., and Shi, Y. (2000) Nature 408, 1008-1012[CrossRef][Medline] [Order article via Infotrieve]
23. Verhagen, A. M., Ekert, P. G., Pakusch, M., Silke, J., Connolly, L. M., Reid, G. E., Moritz, R. L., Simpson, R. J., and Vaux, D. L. (2000) Cell 102, 43-53[CrossRef][Medline] [Order article via Infotrieve]
24. Ekert, P. G., Silke, J., Hawkins, C. J., Verhagen, A. M., and Vaux, D. L. (2001) J. Cell Biol. 152, 483-490[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Immunol.Home page
V. M. Abrahams, P. Bole-Aldo, Y. M. Kim, S. L. Straszewski-Chavez, T. Chaiworapongsa, R. Romero, and G. Mor
Divergent Trophoblast Responses to Bacterial Products Mediated by TLRs
J. Immunol., October 1, 2004; 173(7): 4286 - 4296.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
G. A. Belov, L. I. Romanova, E. A. Tolskaya, M. S. Kolesnikova, Y. A. Lazebnik, and V. I. Agol
The Major Apoptotic Pathway Activated and Suppressed by Poliovirus
J. Virol., December 6, 2002; 77(1): 45 - 56.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/16/13693    most recent
M108530200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stephanou, A.
Right arrow Articles by Latchman, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stephanou, A.
Right arrow Articles by Latchman, D. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.