JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M110474200 on February 11, 2002

J. Biol. Chem., Vol. 277, Issue 16, 13840-13847, April 19, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/16/13840    most recent
M110474200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kishore, N.
Right arrow Articles by Tripp, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kishore, N.
Right arrow Articles by Tripp, C. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

IKK-i and TBK-1 are Enzymatically Distinct from the Homologous Enzyme IKK-2

COMPARATIVE ANALYSIS OF RECOMBINANT HUMAN IKK-i, TBK-1, AND IKK-2*

Nandini KishoreDagger§, Q. Khai HuynhDagger, Sumathy Mathialagan, Troii Hall, Sharon Rouw, David Creely, Gary Lange, James Caroll, Beverley Reitz, Ann Donnelly, Hymavathi Boddupalli, Rodney G. Combs, Kuniko Kretzmer, and Catherine S. Tripp

From the Department of Arthritis and Inflammation Pharmacology, Discovery Research, Pharmacia Corporation, St. Louis, Missouri 63167

Received for publication, October 31, 2001, and in revised form, January 7, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

NF-kappa B is sequestered in the cytoplasm by the inhibitory Ikappa B proteins. Stimulation of cells by agonists leads to the rapid phosphorylation of Ikappa Bs leading to their degradation that results in NF-kappa B activation. IKK-1 and IKK-2 are two direct Ikappa B kinases. Two recently identified novel IKKs are IKK-i and TBK-1. We have cloned, expressed, and purified to homogeneity recombinant human (rh)IKK-i and rhTBK-1 and compared their enzymatic properties with those of rhIKK-2. We show that rhIKK-i and rhTBK-1 are enzymatically similar to each other. We demonstrate by phosphopeptide mapping and site-specific mutagenesis that rhIKK-i and rhTBK-1 are phosphorylated on serine 172 in the mitogen-activated protein kinase kinase activation loop and that this phosphorylation is necessary for kinase activity. Also, rhIKK-i and rhTBK-1 have differential peptide substrate specificities compared with rhIKK-2, the mitogen-activated protein kinase kinase activation loop of IKK-2 being a more favorable substrate than the Ikappa Balpha peptide. Finally, using analogs of ATP, we demonstrate unique differences in the ATP-binding sites of rhIKK-i, rhTBK-1, and rhIKK-2. Thus, although these IKKs are structurally similar, their enzymatic properties may provide insights into their unique functions.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

NF-kappa B1 is a ubiquitous transcription factor that plays an important role in the regulation of a wide variety of genes involved in immune, inflammatory, and stress responses (1-4). In resting cells, NF-kappa B is sequestered in the cytoplasm in an inactive state by association with members of the Ikappa B family of inhibitory proteins (Ikappa Balpha , Ikappa Bbeta , or Ikappa Bepsilon ), the best characterized being Ikappa Balpha (5-8). Stimulation of cells with an agonist results in phosphorylation, ubiquitination, and degradation of Ikappa Bs, thus releasing NF-kappa B for nuclear translocation and activation of gene transcription (9-11). Two Ikappa B kinases (IKK-1 or IKKalpha and IKK-2 or IKKbeta ), which specifically phosphorylate the critical serines in Ikappa Bs, have been cloned and characterized by several laboratories (12-22). A third adapter protein, NEMO (NF-kappa B essential modulator, also called IKKgamma ) is necessary for IKK phosphorylation and activation by upstream kinases (23-25). IKK-1 and IKK-2 are ubiquitously expressed in most human tissues and appear to be the converging point in the activation of NF-kappa B by a diverse array of agonists (15, 19).

IKK-1 is an 85-kDa, 745-amino acid protein that contains an N-terminal serine/threonine kinase catalytic domain, a leucine zipper-like amphipathic helix, and a C-terminal helix-loop-helix domain (13, 26). IKK-2 is an 87-kDa, 756-amino acid protein with the same overall structure as IKK-1. IKK-1 and IKK-2 are 52% identical overall, with 65% identity in the kinase domain and 44% identity in the C-terminal region, which contains the leucine zipper and helix-loop-helix domains. The kinase activities of IKK-1 and IKK-2 are regulated by phosphorylation. Both enzymes contain canonical mitogen-activated protein kinase kinase (MAPKK) activation loops, which are the targets for phosphorylation and hence activation by upstream kinases (14, 28, 29). Several experimental approaches from different laboratories have indicated that IKK-2, rather than IKK-1, is essential for NF-kappa B activation in response to a wide range of inflammatory and stress stimuli including tumor necrosis factor alpha  and interleukin-1beta (14, 21, 29). Additionally, IKK-2 also demonstrates a significantly more potent kinase activity using Ikappa Balpha or Ikappa Bbeta as substrates.

Recently, two homologs of IKK-1 and IKK-2 have been described, called IKK-i (also known as IKK-epsilon ) and TBK-1 (also known as T2K or NAK), and activation of either of these kinases results in NF-kappa B activation (30-34). IKK-i and TBK-1 show 30% amino acid identity to IKK-2 in the N-terminal kinase domain and an overall similar topology in the C terminus including a leucine zipper-like domain as well as a helix-loop-helix region (30-34). Additionally, the canonical activation loop motif of IKK-i and TBK-1 differ from IKK-2 with a glutamic acid being present instead of a serine (EXXXS) (30-32). IKK-i and TBK-1 also differ from IKK-2 in several other respects. First, they both specifically phosphorylate serine 36 in Ikappa Balpha and not serine 32. Second, IKK-i is predominantly expressed in immune cells and tissues, including peripheral blood leukocytes, spleen, and thymus, respectively (30). TBK-1 is constitutively and ubiquitously expressed, with the highest level of expression in the testis (32). Third, mRNA for IKK-i, but not IKK-2, can be induced in multiple cell lines in response to several agonists including cytokines and lipopolysaccharide (30). Finally, IKK-i and TBK-1 show significant kinase activity when overexpressed in and isolated from nonstimulated mammalian cells, and both associate with TRAF/TANK proteins within the cell (35, 36). In contrast, IKK-2 and IKK-1 demonstrate significant kinase activity only when isolated from mammalian cells that have been stimulated with agonists (14, 21). Taken together, it is clear that the IKK isoforms activate NF-kappa B via distinct mechanisms, have differential tissue distribution, associate within distinct signaling complexes in cells, and differ in their enzymatic properties as well as their substrate recognition.

Both homodimers and heterodimers of rhIKK-1 and rhIKK-2 have been purified to homogeneity and characterized enzymatically by a number of laboratories (14-22). However, neither rhIKK-i nor rhTBK-1 has been purified and characterized. In this report, we have cloned, expressed in a baculovirus expression system, and purified rhIKK-i and rhTBK-1 to compare and contrast their enzymatic properties to each other and rhIKK-1 and rhIKK-2 homodimers. We show that rhIKK-i and rhTBK-1 exhibit a significantly higher catalytic activity compared with rhIKK-1 or rhIKK-2 using Ikappa Balpha as the substrate. However, the Km for Ikappa Balpha peptide with respect to IKK-i and TBK-1 is >40-fold higher than the Ikappa Balpha Km for IKK-1 and >200-fold higher than that for IKK-2. In contrast, the Km for the MAPKK activation loop peptide of rhIKK-2 is significantly lower for both rhTBK-1 and rhIKK-i. We demonstrate that rhIKK-i and rhTBK-1, like rhIKK-1 and rhIKK-2, are phosphorylated during their expression and that this phosphorylation is necessary for kinase activity. We demonstrate by peptide mapping that both rhIKK-i and rhTBK-1 are phosphorylated on serine 172 in the MAPKK activation loop and that substitution of this serine to either alanine or glutamic acid results in decreased kinase activity. Additionally, we show that, as previously reported for rhIKK-1 and rhIKK-2 (22), ADP is a competitive inhibitor of both rhIKK-i and rhTBK-1 but with unique IC50 values of inhibition. Using a panel of ATP and ADP analogs, we further demonstrate that the ATP-binding sites for rhIKK-i and rhTBK-1 are distinct from each other and from either rhIKK-1 or rhIKK-2. These observations suggest the possibility of developing selective inhibitors of each kinase to better understand their roles in NF-kappa B activation. Thus, the characterization of rhIKK-i and rhTBK-1 defines unique biochemical properties that provide insight into their roles within the NF-kappa B activation pathway.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Materials

All reagents used were of the highest grade commercially available. Anti-FLAG M2 affinity resin, FLAG peptide, antibodies specific for the FLAG peptide, ATP and ADP and their analogs, bovine serum albumin, Nonidet P-40, protease inhibitors, and dithiothreitol (DTT) were obtained from Sigma-Aldrich. Anti-TBK-1 antibody (M-375) was from Santa Cruz Biotechnologies. Recombinant lambda  protein phosphatase was from New England Biolabs. Peptides were either purchased from American Peptide Co. or made in the peptide synthesis laboratory at Pharmacia. [gamma -33P]ATP (2500 Ci/mmol) was purchased from Amersham Pharmacia Biotech. cDNA used to obtain full-length clones of IKK-i and TBK-1 and Advantage cDNA polymerase mix for PCRs were from CLONTECH (Palo Alto, CA).

Cloning and Expression

Cloning hIKK-i cDNA-- Human T cell Jurkat cDNA was used as a template for PCR (Advantage cDNA polymerase mix) and primers (Sigma-Genosys, Houston, TX) homologous to the areas containing the initiation codon or the termination codon according to the published sequence of IKK-i (GenBankTM accession number AB016590). Those primers also contained a BamHI site at the 5' end of the forward oligonucleotide or a EcoRI site at the 5' end of the reverse oligonucleotide. The sequences of the oligonucleotides of IKK-i were: forward, 5'-ACGTACGGATCCATGCAGAGCACAGCCAATTACCTGTGGCACACAGATGA, and reverse, 5'-ACGTACGAATTCTTAGACATCAGGAGGTGCTGGGACTCTATTTAGCCGTT.

The PCR was run on a 1% agarose gel, and a band of ~2 kb was gel-purified. The purified DNA was cut with BamHI and EcoRI and cloned into pFASTBAC (Invitrogen) containing an N-terminal FLAG-coding region (pMON46007) to yield pMON48029.

Cloning of hTBK-1 cDNA-- Human placenta cDNA was used as a template for a PCR using elongase enzyme (Invitrogen) and primers (Midland Certified Reagent Company, Midland, TX) homologous to the areas containing the initiator methionine or the terminal stop codon according to the published sequence of TBK-1 (GenBankTM accession number AF191838.1). Those primers also contained a BamHI site at the 5' end of the forward oligonucleotide or a NotI site at the 5' end of the reverse oligonucleotide. The sequences of the oligonucleotides of TBK-1 were: forward, 5'-GATCGGATCCATGCAGAGCACTTCTAATCATCTG, and reverse, 5'-GATCGCGGCCGCTTAAAGACAGTCAACGTTGCGAAGG.

The PCR was run on a 1% agarose gel, and a band of ~2 kb was gel-purified. The purified DNA was cut with BamHI and NotI and cloned into pFASTBAC (Invitrogen) containing an N-terminal FLAG coding region (pMON46007) in frame with the initiator methionine. An isolate was obtained, fully sequenced, and identified as pMON48028.

Site-directed Mutagenesis-- The serine residues at positions 172 in IKK-i and TBK-1 were mutated to alanine or glutamic acid residues by two-step PCR-mediated mutagenesis. Briefly, the forward cloning oligonucleotide (described in the cloning sections) for each cDNA was used to prime a PCR along with the reverse mutant oligonucleotide containing the desired codon change. Simultaneously, the forward mutant oligonucleotide was used to prime a second PCR with the reverse cloning oligonucleotide as described in the cloning sections. Those products were gel-purified, and a fraction of each was used as a template in fresh PCRs containing the original cloning oligonucleotides. The products were gel-purified, restriction-digested with the appropriate enzymes, and ligated into the vectors described in the cloning sections. All oligonucleotides were from the Midland Certified Reagent Company, and the PCR reagents were from Invitrogen. The mutant oligonucleotides are shown below, where the letter following the letter S indicates the resulting amino acid residue at position 172. Entire cDNAs were sequenced to verify the desired mutations and to confirm that no other mutations had occurred. The mutant oligonucleotides are: IKK-i SEF, 5'-TGATGAGAAGTTCGTCGAAGTCTATGGGACTGAGGAG-3'; IKK-i SER, 5'-CTCCTCAGTCCCATAGACTTCGACGAACTTCTCATCA-3'; IKK-i SAF, 5'-TGATGAGAAGTTCGTCGCGGTCTATGGGACTGAGGAG-3'; IKK-i SAR, 5'-CTCCTCAGTCCCATAGACCGCGACGAACTTCTCATCA-3'; TBK-1 SEF, 5'-TGATGAGCAGTTTGTTGAACTGTATGGCACAGAAG-3'; TBK-1 SER, 5'-CTTCTGTGCCATACAGTTCAACAAACTGCTCATCA-3'; TBK-1 SAF, 5'-TGATGAGCAGTTTGTTGCTCTGTATGGCACAGAAG-3'; and TBK-1 SAR, 5'-CTTCTGTGCCATACAGAGCAACAAACTGCTCATCA-3'.

Insect Cell Expression-- TBK-1 and IKK-i were expressed in Sf9 insect cells using the commercially available Bac-to-BacTM baculovirus expression system (Invitrogen). Following the manufacturer's suggested protocols, donor plasmids pMON48028 and pMON48029 were used to generate recombinant baculovirus Bacmid DNAs containing human TBK-1 and IKK-i, respectively, via transposition in Escherichia coli. Purified bacmid miniprep DNAs were checked by restriction digestion for the presence of the correct inserts and then used to transfect Sf9 insect cells for production of recombinant viruses. Transfection was accomplished using Cell FectinTM reagent (Invitrogen) following the standard protocol for Sf9 cells. Briefly, a transfection mixture containing 5 µl of the appropriate miniprep DNA and 5 µl of Cell Fectin in 1 ml of SF-900 serum-free medium was added to cells that had been seeded in a 6-well tissue culture plates at 9 × 105 cells/well. After 5 h, the mixture was removed, and the cells were fed 3 ml of complete IPL-41 medium (Invitrogen). After 3 days, the medium containing recombinant virus was cleared of cell debris and stored at 4 °C. Infecting fresh Sf9 cells with a portion of each transfection medium made larger virus stocks, designated P1. The larger stocks were titered by plaque assay and used for production of recombinant proteins. To generate material for purification, fresh Sf9 cells at ~1 × 106 cells/ml were infected with virus at a multiplicity of infection of 0.1. The infections were allowed to proceed for 72 h, then the cells were harvested, and the resulting pellets were stored at -80 °C until needed.

Enzyme Isolation

All purification procedures were carried out at 4 °C unless otherwise noted. The buffers used were: buffer A (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% Nonidet P-40, 10% glycerol, 20 mM NaF, 20 mM beta -glycerophosphate, 5 mM benzamidine, 2.5 mM sodium metabisulfite, 1 mM DTT, 1 mM EDTA, and 0.5 mM EGTA) and buffer B (same as buffer A with the addition of 500 mM NaCl).

Isolation of rhIKK-i-- Cells from a 20-liter fermentation of baculovirus-infected cells expressing N-terminal FLAG-tagged IKK-i were microfluidized and centrifuged at 26,000 × g for 1 h. The supernatant was collected, and the pH was adjusted to 7.6 with sodium hydroxide. 25 ml of anti-FLAG M2 affinity gel, pre-equilibrated in buffer A, was added to the supernatant pool and allowed to mix overnight. The resin was batch-washed using four resin volumes of buffer A/wash, poured into a 26/20 column, and washed with 15 resin volumes of buffer B. The FLAG-tagged IKK-i was eluted using FLAG peptide in buffer A. Dithiothreitol was added to the pool to a final concentration of 5 mM, followed by concentrating in a stirred cell using an Amicon YM 30 membrane. Bovine serum albumin was added to the concentrated pool to a final concentration of 0.1%, which was then frozen at -80 °C in aliquots. Recombinant hIKK-i (Ser right-arrow Glu and Ser right-arrow Ala) mutants from a 2-liter fermentation were isolated following procedures described above.

Isolation of rhTBK-1-- Cells from a 20-liter fermentation of baculovirus-infected cells expressing FLAG-tagged TBK-1 were microfluidized, adjusted to pH 7.6, and centrifuged as described for IKK-i. 50 ml of anti-FLAG M2 antibody resin was added to the pool and allowed to mix overnight. The resin was batch-washed using 4 bed volumes of buffer A/wash, then poured into a 26/20 column, and washed with 15 volumes of buffer B. The TBK-1 protein was eluted with FLAG peptide in buffer A. Dithiothreitol was added to the pool to a final concentration of 5 mM followed by concentration with an Amicon YM 30 membrane. Bovine serum albumin was added to the concentrated pool to a final concentration of 0.1%, and the sample was aliquoted and stored at -80 °C until use. Recombinant hTBK-1 (Ser right-arrow Glu and Ser right-arrow Ala) mutants from a 2-liter fermentation were isolated following similar procedures.

SDS-PAGE and Western Blotting

Purified samples of rhIKK-i and rhTBK-1 were analyzed by SDS-PAGE (4-12% Bis Tris NuPAGE gel) run in MES buffer. The proteins were detected by Coomassie stain. For Western blot analyses, the proteins were transferred to nitrocellulose membranes (Novex) and detected by chemiluminescence (SuperSignal) using anti-FLAG antibody or anti-TBK-1 antibody for IKK-i and TBK-1, respectively.

Phosphatase Treatment

Phosphatase treatment was as previously described for rhIKK-1 and rhIKK-2 (22). Briefly, 4-8 µg of rhIKK-i or rhTBK-1 was immunoprecipitated with 40 µg of FLAG antibody followed by coupling to protein G-Sepharose beads. Immunoprecipitated rhIKK enzymes were washed and resuspended in 50 mM Tris-HCl, pH 7.6, containing 0.1 mM EDTA and 2 mM MnCl2. Following an incubation with recombinant lambda  protein phosphatase (800 units) at room temperature for 30 min, cold lysis buffer (20 mM HEPES, pH 7.6, containing 0.5% Nonidet P-40, 50 mM NaCl, 1 mM EDTA, 1 mM EGTA, 5 mM DTT, 1 mM sodium orthovanadate, and 10 mM beta -glycerophosphate) was added to the samples to stop the reaction. After several washes, 10% of the beads were removed for Western blot analysis, and the remaining material was pelleted and resuspended in 100 µl of the kinase buffer used for in vitro enzyme assay.

Phosphopeptide Analysis

IKK-i was concentrated and dialyzed into 6 M guanidine, 0.5 M Tris, pH 8.5, 5 mM dithiothreitol for 1 h. The free cysteines were alkylated with 15 mM iodoacetic acid on ice in the dark for 30 min as described (37). Alkylated protein was dialyzed against 2 M urea in 0.01 M Tris, pH 8.0. Protein was digested with trypsin (Promega, Madison, WI) at a 60:1 substrate to enzyme ratio. The resulting peptides were separated by reversed-phase HPLC using a 130 A microbore HPLC system (Applied Biosystems, Foster City, CA). 1 × 150 mm Vydac (Hesperia, CA) C-18 300, a reversed-phase column was used for the separation, employing a linear gradient of acetonitrile/water with 0.1% trifluoroacetic acid. The fractions were collected and analyzed by matrix-assisted laser desorption/ionization (MALDI) mass spectrometry using a Voyager DE-RP time-of-flight mass spectrometer (PerSeptive Biosystems, Farmingham, MA). A 0.25-µl aliquot of the collected fraction was mixed at a 1:4 ratio with matrix (50 mM solution of alpha -cyano-4-hydroxycinnamic acid) and allowed to dry. The MALDI mass spectrometry data were collected in the reflectron mode, using an average of 100 scans. The measured masses of the tryptic peptides were compared with the expected masses based on the known amino acid sequence. Potentially phosphorylated peptides were identified by the increase of 80 Da or multiples of 80 Da over the expected mass of a given tryptic peptide. To confirm the identity of the phosphopeptides and to determine the site of phosphorylation, the phosphopeptide-containing fractions were subjected to tandem mass spectrometry using a Q-T mass spectrometer (Micromass, Inc., Beverly, MA) fitted with a nano-electrospray ionization source (38, 39). 1-3 µl of the sample was transferred into a PicoTip glass nanospray emitter with a 2 µm-inner diameter tip (New Objective, Woburn, MA). Up to 20 min of fragmentation data were collected and averaged for each sample.

Enzyme Assay

Kinase activity was measured essentially as described previously for IKK-2 (22) using a 23-amino acid residue peptide derived from Ikappa Balpha (Gly-Leu-Lys-Lys-Glu-Arg-Leu-Leu-Asp-Asp-Arg-His-Asp-Ser32-Gly-Leu-Asp-Ser36-Met-Lys-Asp-Glu-Glu). The standard reaction mixture contained biotinylated Ikappa Balpha (500 µM for IKK-i, 750 µM for TBK-1, or 5 µM for IKK-2), [gamma -33P]ATP (10 µM for IKK-i, 15 µM for TBK-1, or 2 µM for IKK-2), 1 mM DTT, 50 mM KCl, 2 mM MgCl2, 2 mM MnCl2, 10 mM NaF, 25 mM Hepes buffer, pH 7.6, and 10 µl (15-20 ng of IKK-i or TBK-1 or 100 ng of IKK-2) of enzyme solution in a final volume of 50 µl. Following incubation at 25 °C for 30 min, 33P-Ikappa Balpha was separated from unincorporated [33P]ATP by the transfer of a suitable aliquot of the reaction to a SAM 96 biotin capture plate, followed by sequential washes with 2 M NaCl and 2 M NaCl containing 1% H3PO4 essentially as described (22). The plates were dried and counted in a Top-Count NXT after the addition of 25 µl of Microscint 20. Alternatively, the reaction was stopped by the addition of 150 µl of AG1XB resin in 900 mM sodium formate buffer, pH 3 (the resin is in a slurry of 1 volume resin to 2 volume of sodium formate buffer). The resin was allowed to settle, and 50 µl of supernatant was transferred to a top count plate followed by the addition of 150 µl of Microscint 40, mixed well, and counted. Both assays gave results similar to those reported earlier (22), although the background was lower with the biotin capture method. The resin capture assay was used in experiments where nonbiotinylated peptide substrates were used. Biotinylated Ikappa Balpha peptide was used in both assays and yielded similar values. One unit of enzyme activity is defined as the amount of enzyme required to catalyze the transfer of 1 nmol of phosphate from ATP to the peptide substrate/min. Specific activity is expressed as units/mg of protein.

For Km determination of purified enzymes, various concentrations of ATP or Ikappa Balpha were used in the assay at a fixed concentration of the second substrate. For ATP Km, the assays were carried out with 15 or 20 ng of IKK-i or TBK-1, respectively, with Ikappa Balpha at 500 and 750 µM, respectively, and ATP was varied from 0.31 to 10 µM. For Ikappa Balpha Km, ATP was fixed at 10 µM for IKK-i and 15 µM for TBK-1, and IKBalpha concentration was varied from 31 to 1000 µM. Experiments involving IKK-2 were essentially as described earlier (22).

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

IKK-i and TBK-1 have recently been described as isoforms of IKK-1 and IKK-2 based on similarities in their overall structure and sequence. Although rhIKK-1 and rhIKK-2 have been purified to homogeneity and enzymatically characterized by many investigators, the properties of rhIKK-i and rhTBK-1 have not been described thus far. To better understand the enzymatic similarities and differences between these four IKK isoforms, we have cloned, expressed, and purified rhIKK-i and rhTBK-1 and compared their enzymatic properties to those of rhIKK-1 and rhIKK-2.

Both rhIKK-i and rhTBK-1 containing a FLAG epitope tag at the N terminus were expressed in a baculovirus system and purified to homogeneity. Single bands at the expected molecular masses between 80-85 kDa were confirmed by SDS-PAGE followed by Coomassie staining, and the identities of rhIKK-i and rhTBK-1 were verified by Western blot analysis (Fig. 1A). Both rhIKK-i and rhTBK-1 exhibited a pH optimum between 7 and 8, similar to all other kinases. Purified enzymes were stable for at least 9 months at -80 °C when stored in buffer containing 0.1% bovine serum albumin, 0.1% Nonidet P-40, 10% glycerol, 5 mM DTT, and protease inhibitors (data not shown).


View larger version (41K):
[in this window]
[in a new window]
  		Fig. 1.   Characterization of rhIKK-i and rhTBK-1. A, Coomassie-stained SDS-PAGE (upper panel) and Western blot analysis using anti-FLAG antibody or anti-TBK-1 antibody (lower panel) of purified N-terminal FLAG-IKK-i and FLAG-TBK-1. respectively. MW, molecular mass (in kDa). B, comparison of catalytic activities of rhIKK-i (closed circles) and rhTBK-1 (closed squares) with that of IKK-2 (closed triangles).

Like IKK-1 and IKK-2, TBK-1 and IKK-i are Ikappa B kinases, because they are able to phosphorylate Ikappa Balpha as a substrate. We determined the kinetic parameters of rhIKK-i and rhTBK-1 using a 23-amino acid peptide encompassing residues 19-41 of Ikappa Balpha as the phosphoacceptor peptide and compared them with those of rhIKK-1, rhIKK-2, and rhIKK-1/IKK-2 heterodimer (Fig. 1B and Table I). Both rhIKK-i and rhTBK-1 had a dramatically higher enzymatic activity compared with rhIKK-2 under comparable assay conditions (Fig. 1B). Table I compares the kinetic parameters of rhIKK-i and rhTBK-1 to our previously published findings on rhIKK-2 homodimer, rhIKK-1 homodimer, and rhIKK-1/IKK-2 heterodimer. The values for kinetic parameters shown in Table I depict data generated concomitantly with those of IKK-i and TBK-1 to compare values under identical assay conditions. Note that the Kcat and specific activity values reported here for IKK-1 and IKK-2 and IKK-1/IKK-2 heterodimer are 2-3-fold higher than our previously published values generated with early enzyme preparations. Further optimization of storage conditions have resulted in increased stability of all IKK isoforms.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Kinetic parameters of rhIKK-i and rhTBK-1 compared with rhIKK-2, rhIKK-1, and rhIKK-1/IKK-2 heterodimer

Table I shows several key findings. First, the Kcat for rhIKK-i and rhTBK-1 are >40-50-fold higher than either rhIKK-2 homodimer or rhIKK-2/IKK-1 heterodimer and >300-fold higher than rhIKK-1 homodimer. Second, Ikappa Balpha is a significantly better substrate for rhIKK-2 homodimer and rhIKK-1/IKK-2 heterodimer with more than a 100-fold lower Km compared with rhIKK-i and rhTBK-1. Comparable results were obtained when Ikappa Balpha -GST fusion protein was used as a substrate (data not shown). Thus, the catalytic efficiency (Kcat/Km) using Ikappa Balpha peptide as the substrate is 8-10-fold higher for rhIKK-2 and rhIKK-1/IKK-2 heterodimer compared with rhIKK-i and rhTBK-1. This is an intriguing result and may indicate that Ikappa Balpha is not a preferred physiological substrate for either rhIKK-i or rhTBK-1. The data in Table I also confirm that the catalytic efficiency of rhIKK-1 is the lowest of the four isoforms by virtue of its low Kcat and its 5-10-fold higher Km for the Ikappa Balpha peptide compared with rhIKK-2. Interestingly, Zandi et al. (40) have shown that when full-length Ikappa Balpha is used as a substrate, the Km values for IKK-1 and IKK-2 are comparable. However, the catalytic efficiency of both rhIKK-2 and rhIKK-1 is reported to be significantly higher when Ikappa Balpha -NF-kappa B complex is used as a substrate instead of free Ikappa Balpha . Thus, Ikappa Balpha may be a significantly better substrate for rhIKK-i and rhTBK-1 when it is associated with other cellular proteins such as NF-kappa B.

The MAPKK activation loops of IKK-1 and IKK-2 are similar, each containing the SXXXS motif with Ser176 and Ser180 and with Ser177 and Ser181 being the phosphoacceptor serines, respectively. This sequence differs from that in either IKK-i or TBK-1, which contain an EXXXS motif, where the phosphoacceptor serine is Ser172 (Fig. 2A). Thus, we wanted to evaluate the role of phosphorylation of the MAPKK activation loop in the regulation of IKK-i and TBK-1 kinase activity (Fig. 2). Both rhTBK-1 and rhIKK-i had phosphatase-sensitive kinase activity (Fig. 2B). These data are similar to that of rhIKK-2 shown here and previously reported for rhIKK-1, rhIKK-2, and rhIKK-1/IKK-2 heterodimer (22). Note that the decrease in kinase activity after phosphatase treatment was due to dephosphorylation because heat treatment of the phosphatase abolished its ability to inactivate rhIKK-i and rhTBK-1. Likewise, the constitutively active rhIKK-2 (S177E,S181E) did not demonstrate a loss of activity with phosphatase treatment, indicating a specific effect of phosphatase on the susceptible phosphorylated IKK isoforms. Similar results were obtained with the rhIKK-i (S172E) mutant enzyme, in that the kinase activity was not sensitive to phosphatase treatment (data not shown). The Western blot analysis confirms that the amount of kinase remained constant during the phosphatase treatment and the subsequent kinase assay. To identify the specific phosphorylated residue, we subjected rhIKK-i and rhTBK-1 to tryptic digestion followed by MALDI mass spectrometry to identify the phosphopeptide. Tandem mass spectrometry of the phosphopeptide-containing fractions identified Ser172 as the phosphorylated residue in rhIKK-i (Fig. 2C) and rhTBK-1 (data not shown). Thus, like rhIKK-1 and rhIKK-2, rhTBK-1 and rhIKK-i are activated by phosphorylation of their MAPKK activation loops during expression.


View larger version (35K):
[in this window]
[in a new window]
  		Fig. 2.   Phosphorylation of rhIKK-i and rhTBK-1 is required for kinase activity; phosphorylation occurs on serine 172 in the activation loop. A, MAPKK activation loop sequence comparison between IKK-1, IKK-2, IKK-i, and TBK-1. B, FLAG-tagged rhIKK-i, rhTBK-1, and rhIKK-2 and mutated rhIKK-2 (rhIKK-2(SS-EE)) were immunoprecipitated using anti-FLAG antibody. WT, wild type. The immunoprecipitated proteins were treated with buffer (open bars), heat-inactivated recombinant lambda  protein phosphatase (hatched bars), or active recombinant lambda  protein phosphatase (filled bars) for 30 min. Kinase activity of phosphatase-treated enzyme was expressed as a percentage of kinase activity of the respective buffer-treated control. Western blot analyses post-immunoprecipitation are also shown. C, MALDI mass spectrometric scan of the principal phosphopeptide identified from tryptic digest of rhIKK-i. The HPLC fraction was mixed at 1:4 ratio of the matrix, and MALDI mass spectrometry data were collected in the reflectron mode, using an average of 100 scans. The measured mass (shown in italics) of the tryptic peptide (peak A) was compared with the calculated mass (shown in bold) based on the known amino acid sequence. Phosphorylated peptides (peak B) were identified by a 80-Da mass increase over the expected mass of the tryptic peptide. The site of phosphorylation was confirmed by subjecting the phosphopeptide-containing fraction to tandem mass spectrometry. The confirmed sequence of the phosphopeptide is shown, and the residue with the asterisk is identified to be phosphorylated.

To confirm the role of phosphorylation of IKK-i and TBK-1 in the regulation of kinase activity, we constructed mutants of IKK-i and TBK-1 in which serine 172 was replaced with either alanine or glutamic acid. Each mutant including rhIKK-i (S172A), rhIKK-i (S172E), rhTBK-1 (S172A), and rhTBK-1 (S172E) was cloned, expressed, and purified to homogeneity. The enzymatic properties of the purified mutant enzymes were compared with the respective wild type enzymes under comparable assay conditions (Fig. 3). Neither rhIKK-i (S172A) nor rhTBK-1 (S172A) had kinase activity (data not shown). These results are in agreement with the results reported by Shimada et al. (30) and Peters et al. (31), who showed that IKK-i (S172A), when overexpressed and immunoprecipitated from a mammalian system, had no kinase activity. Our results further extend these observations to TBK-1 (S172A), which has not been reported thus far. In contrast to the S172A constructs, S172E mutants of rhIKK-i and rhTBK-1 had kinase activity, although the specific activity was reduced >100-fold compared with wild type rhIKK-i (Fig. 3A) or wild type rhTBK-1 (Fig. 3B). However, the Km values for ATP and Ikappa Balpha of the rhIKK-i (S172E) and rhTBK-1 (S172E) mutants were comparable with the respective wild type enzymes (Table II). Thus, the reduced specific activity of the mutant (S172E) enzymes is mainly due to the rate of catalysis rather than altered substrate binding. These results are similar to our previous finding with rhIKK-2 (S177E,S181E) reported earlier and shown in Table II for comparison. Although our results show significant kinase activity of rhIKK-i (S172E), these results may still be in agreement with those reported by Shimada et al. (30), who showed a loss of kinase activity of the S712E mutant, and Peters et al. (31), who showed a highly reduced kinase activity of the IKK-i (S172E) mutant enzyme. Note that purified rhIKK-i (S172E) and rhTBK-1 (S172E) mutants have 68- and 226-fold lower activity, respectively, than their respective wild type kinases. Thus, this decreased level of kinase activity may not have been detectable using the immunoprecipitated kinase in an SDS-PAGE assay reported previously (30, 31). Interestingly, the specific activity of both rhIKK-i and rhTBK-1 with the (S172E) mutation have higher kinase activities than the comparable mutation of IKK-2 (S177E, S181E). However, all of the Ser right-arrow Glu mutants have decreased activities compared with their respective wild type kinases.


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 3.   Comparison of enzymatic activity of wild type and S172E mutant rhIKK-i and rhTBK-1 A, [gamma -33P]ATP and biotinylated Ikappa Balpha peptide were incubated with increasing amounts of either rhIKK-i (S172E) (dashed lines) or rhIKK-i wild type and kinase activity determined as described under "Experimental Procedures." B, [gamma -33P]ATP and Ikappa Balpha peptide were incubated with increasing concentrations of rhTBK-1 (S172E) (dashed line) or rhTBK-1 wild type (solid line), and the kinase activity was measured as for IKK-i. WT, wild type.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Kinetic parameters of activation loop mutants

Both rhIKK-i and rhTBK-1 overexpressed in mammalian cells have been shown to specifically phosphorylate serine 36 of Ikappa Balpha , whereas IKK-1 and IKK-2 phosphorylate both serine 32 and serine 36 (15, 30-34). This suggests that the peptide substrate requirements for the IKK isoforms may be different. Table III shows several unique differences in the peptide substrate specificity of rhIKK-i and rhTBK-1 compared with rhIKK-2. We did not evaluate these substrates against IKK-1 because of its low specific activity and thus low signal to noise ratio in the resin assay. First, rhIKK-i and rhTBK-1 specifically phosphorylate serine 36 of Ikappa Balpha with Km and Kcat values comparable with the parent Ikappa Balpha peptide (Table III, peptide series A). Thus, peptide variants in which serine 36 was substituted with alanine (Ser32-Ala36) or with a phosphoserine (Ser32-Ser(P)36) were not substrates for rhIKK-i and rhTBK-1 but were comparable substrates to the parent (Ser32-Ser36) peptide with respect to rhIKK-2. In contrast, serine 32 peptide variants containing alanine (Ala32-Ser36) or phosphoserine (Ser(P)32-Ser36) were efficient substrates for rhIKK-i, rhTBK-1, and rhIKK-2 with catalytic efficiency comparable with that of the wild type (Ser32-Ser36) peptide. Interestingly, peptide variants containing a phosphoserine at either position 32 or 36 had comparable catalytic efficiency with respect to rhIKK-2, because the Kcat/Km ratio were 94 h-1 µM-1 and 62 h-1 µM-1, respectively. These data suggest that the phosphorylation of serine 32 and serine 36 occurs in random order. If phosphorylation occurred sequentially, one of the phosphorylated peptides would be expected to have a significantly higher catalytic efficiency. Likewise, substitution of serine 32 with either alanine or phosphoserine had minimal effect on the catalytic efficiency with respect to the specific phosphorylation of serine 36 by rhIKK-i and rhTBK-1. Thus, serine 32 in the 23-amino acid Ikappa Balpha peptide affects neither binding nor catalysis for rhIKK-i and rhTBK-1.

                              
View this table:
[in this window]
[in a new window]
 
Table III
Differential peptide substrate specificities of rhIKK-i, rhTBK-1, and rhIKK-2

The second unique difference in the peptide substrate specificity of the three IKK isoforms is that short, truncated (7 residues) peptides derived from the minimal phosphorylation motif of Ikappa Balpha were efficient substrates for rhIKK-i and rhTBK-1 but were not substrates for rhIKK-2, up to a concentration of 1 mM (Table III, peptide series B). The Kcat/Km ratio for rhIKK-i with respect to the short peptide represented by the sequence, DSGLDSM was 8.7 h-1 µM-1 and thus comparable with the Kcat/Km ratio for the Ikappa Balpha parent peptide, which was 9.7 h-1 µM-1. Likewise, the Kcat/Km ratio of the truncated peptide for rhTBK-1 was 2.6 h-1 µM-1 compared with 6.4 h-1 µM-1 for the parent Ikappa Balpha peptide. Additionally, both rhIKK-i and rhTBK-1 maintained their specificity for serine 36, even in the truncated peptide. However, unlike peptide series A, when phosphoserine was substituted for serine 32 in peptide series B, it was no longer a substrate for rhIKK-i or rhTBK-1. This may be because the additional negative charge contributed by the phosphoserine residue in the truncated peptide may interfere with binding or phosphotransfer to the acceptor serine 36. In contrast to the 7-amino acid truncated Ikappa Balpha peptide, the larger 23-amino acid Ikappa Balpha peptide has several positively charged amino acids such as lysines and arginine that could compensate for a negatively charged phosphoserine residue.

To further define peptide substrate specificity, we tested a dozen diverse peptides containing serines that were substrates for other kinases (e.g. c-Jun peptide, HSP-27, CREB-tide, Fos peptide, etc.), and none of these peptides were substrates for either rhIKK-i, rhTBK-1, or rhIKK-2 (data not shown). Finally, we examined a 17-amino acid peptide (residues 170-187) derived from the activation loop of IKK-2. This peptide was indeed a more efficient substrate than Ikappa Balpha for both rhIKK-i and rhTBK-1 (Table III, peptide C). Tojima et al. (32) have reported that overexpressed TBK-1 activates the IKK complex in mammalian cells by phosphorylating IKK-2 in the activation loop and thus acting as an upstream kinase. Note that the Kcat/Km values obtained for the IKK-2 loop peptide are 34, 41, and 43 h-1 µM-1 for rhIKK-i, rhTBK-1, and rhIKK-2, respectively. This suggests that the IKK-2 loop peptide is an equally efficient substrate for the three IKK isoforms. In contrast to the loop peptide, the Kcat/Km values for the Ikappa Balpha peptide are 9.7, 6.4, and 63 h-1 µM-1 for rhIKK-i, rhTBK-1, and rhIKK-2, respectively, thus confirming that the IKK-2 loop peptide is a better substrate for rhIKK-i and rhTBK-1, as compared with Ikappa Balpha . Phosphorylation of the IKK-2 loop peptide by rhIKK-2 itself is not surprising because it has been postulated to undergo activation by autophosphorylation (29). Note that the Kcat/Km value (43 h-1 µM-1) is comparable with the values measured for rhIKK-i and rhTBK-1. Taken together, these results clearly demonstrate that the peptide substrate specificities of rhIKK-i and rhTBK-1 are similar to each other and clearly distinct from that of rhIKK-2.

We have previously demonstrated that ADP is a competitive inhibitor of rhIKK-2 at the ATP site with an IC50 value in the range of 1-2 µM. ADP also inhibits both rhIKK-i and rhTBK-1, but with different IC50 values (Fig. 4A). The >10-fold difference in the IC50 of ADP inhibition against rhIKK-i and rhTBK-1 is interesting given the fact that the Km for ATP is comparable for the two enzymes. Like IKK-2, ADP is competitive at the ATP site for both rhIKK-i as well as rhTBK-1 (Fig. 4, B and C). To further extend these observations, we determined the IC50 values for various ATP and ADP analogs for rhIKK-i and rhTBK-1 and compared them to previously reported results for rhIKK-1 and rhIKK-2 (Table IV). Note that the IC50 values were comparable between rhIKK-2 and rhIKK-1. Interestingly, selective inhibition of rhIKK-i, rhTBK-1, and rhIKK-2 was noted with minor differences in the ATP analog structure. For example, alpha ,beta -methylene-adenosine 5'-triphosphate and 2'-deoxyadenosine 5'-triphosphate showed comparable IC50 values against rhIKK-2, rhIKK-i, and rhTBK-1, whereas 2,3-dideoxyadenosine 5'-triphosphate was >10-fold more potent against rhIKK-i and rhTBK-1 compared with rhIKK-2. In contrast, adenylyl-imidodiphosphate was >10-fold more potent against rhIKK-2 than either rhIKK-i or rhTBK-1. Interestingly, beta ,gamma -methylene adenosine triphosphate, which only differs from the close analog alpha ,beta -methylene adenosine triphosphate with respect to the position of the methylene bridge, gave selective inhibition of rhTBK-1. Additionally, ADP analogs such as adenosine 5'-O-(2-thiodiphosphate), like ADP, were 10-fold more potent against rhIKK-2 compared with rhIKK-i and 100-fold more potent compared with rhTBK-1. These observations demonstrate that the ATP-binding sites of rhIKK-2, rhIKK-i, and rhTBK-1 are indeed unique and amenable for the design of selective inhibitors.


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 4.   Differential inhibition of rhIKK-i, rhTBK-1, and rh1KK-2 by ADP. A, kinase activity of each enzyme was determined following incubation with increasing concentration of ADP using [gamma -33P]ATP and Ikappa Balpha peptide concentrations that were 2.5-3 times their respective Km values for each enzyme. Closed squares, IKK-2; closed triangles, IKK-i; closed circles, TBK-1. B, competitive inhibition of rhIKK-i by ADP with respect to the ATP site. The concentrations of ADP used were 6.25,12.5, and 25 µM. C, competitive inhibition of rhTBK-1 by ADP with respect to the ATP site. The concentrations of ADP used were 50, 100, and 200 µM.

                              
View this table:
[in this window]
[in a new window]
 
Table IV
Selective inhibition of rhIKK-i, rhTBK-1, and rhIKK-2 by analogs of ATP

In summary, in the present report, we have cloned, expressed, and purified rhIKK-i and rhTBK-1 and compared their enzymatic properties with those of rhIKK-2 and rhIKK-1. Despite the overall structural similarity to IKK-1 and IKK-2, IKK-i and TBK-1 are enzymatically distinct. rhIKK-i and rhTBK-1 share several similarities. The catalytic rate of rhIKK-i and rhTBK-1 are 50-100-fold higher than that of rhIKK-2. They clearly differ from rhIKK-2 with respect to their peptide substrate specificity. The fact that the best substrate identified for rhIKK-i and rhTBK-1 is the activation loop peptide of IKK-2 confirms several reports indicating that both of these kinases biochemically map upstream of IKK-2 in the NF-kappa B activation pathway. Thus, both TBK-1 and IKK-i may act as IKK-2 activating kinases. Additionally, both IKK-i and TBK-1 interact with complexes of TANK and TRAF proteins (35, 36). Baud et al. (41) previously demonstrated that the oligomerization of TRAF proteins was sufficient to activate the IKK signalosome complex.

The ATP analog studies show distinct differences in the ATP sites of the three isoforms. This is indeed intriguing because the ATP Km values do not reflect these active site differences. Differential inhibition of rhIKK-2, rhIKK-i, and rhTBK-1 is particularly interesting, because ADP is a product inhibitor. The unique IC50 values may reflect differences in enzyme mechanism, with potential differences in the product inhibition patterns. IKK-1 and IKK-2 have been demonstrated to exhibit a classical random sequential mechanism (17, 18), but IKK-i and TBK-1 deviate from the classical random sequential mechanism.2 Finally, the selective inhibition of the IKK isoforms with analogs of ATP opens up the possibility of using selective inhibitors of IKK-i and TBK-1 to understand their roles in NF-kappa B activation.

    ACKNOWLEDGEMENTS

We thank Kam Fok and Mark Nagy of the Peptide Core Laboratory, Pharmacia Corporation for the synthesis of peptide substrates used in this study. We also thank Robin Weinberg, Cindy Sommers, and Scott Hauser for critical evaluation of this manuscript and for useful discussions. We thank Victoria Young for help in the preparation of this manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger These authors contributed equally to this work.

§ To whom correspondence should be addressed: Arthritis and Inflammation Pharmacology, Pharmacia Corporation, MailZone T3P, 800 North Lindbergh Blvd., St. Louis, MO 63167. Tel.: 314-694-4325; Fax: 314-694-3415; E-mail: Nandini.N.Kishore@pharmacia.com.

Published, JBC Papers in Press, February 11, 2002, DOI 10.1074/jbc.M110474200

2 Khai Huynh, Q., Kishore, N., Mathialagan, S., Donnelly, A. M., and Tripp, C. S. (2002) J. Biol. Chem. 277, in press.

    ABBREVIATIONS

The abbreviations used are: NF-kappa B, nuclear factor kappa B; IKK, Ikappa B kinase; TBK-1, TANK-binding kinase 1; IKK-i, inducible IKK; MAPKK, mitogen-activated-protein kinase kinase; rh, recombinant human; DTT, dithiothreitol; MES, 4-morpholineethanesulfonic acid; HPLC, high pressure liquid chromatography; MALDI, matrix-assisted laser desorption/ionization.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Karin, M., and Ben-Neriah, Y. (2000) Annu. Rev. Immunol. 18, 621-663[CrossRef][Medline] [Order article via Infotrieve]
2. Mercurio, F., and Manning, A. M. (1999) Oncogene 18, 6163-6171[CrossRef][Medline] [Order article via Infotrieve]
3. Zandi, E., and Karin, M. (1999) Mol. Cell. Biol. 19, 4547-4551[Free Full Text]
4. Karin, M. (1999) J. Biol. Chem. 274, 27339-27342[Free Full Text]
5. Brown, K., Gerstberger, S., Carlson, L., Franzoso, G., and Siabenlist, U. (1995) Science 267, 1485-1488[Abstract/Free Full Text]
6. Chen, Z., Hagler, J., Palombella, V. J., Melandri, F., Scherer, D., Ballard, D., and Maniatis, T. (1995) Genes Dev. 9, 1586-1597[Abstract/Free Full Text]
7. DiDonato, J., Mercurio, F., Rosette, C., Wu-Li, J., Suyang, H., Ghosh, S., and Karin, M. (1996) Mol. Cell. Biol. 16, 1295-1304[Abstract]
8. Alkalay, I., Yaron, A., Hatzubai, A., Jung, S., Avraham, A., Gerlitz, O., Pashut-Lavon, I., and Ben-Neriah, Y. (1995) Mol. Cell. Biol. 15, 1294-1301[Abstract]
9. DiDonato, J. A., Mercurio, F., and Karin, M. (1995) Mol. Cell. Biol. 15, 1302-1311[Abstract]
10. Scherer, D. C., Brockman, J., Chen, Z., Maniatis, T., and Ballard, D. (1995) Proc. Natl. Acad. Sci., U. S. A. 92, 11259-11263[Abstract/Free Full Text]
11. Spencer, E., Jiang, J., and Chen, Z. J. (1999) Genes Dev. 13, 284-294[Abstract/Free Full Text]
12. Regnier, C., Song, H., Gao, X., Goeddel, D., Cao, Z., and Rothe, M. (1997) Cell 90, 373-383[CrossRef][Medline] [Order article via Infotrieve]
13. DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E., and Karin, M. (1997) Nature 388, 548-554[CrossRef][Medline] [Order article via Infotrieve]
14. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J., Young, D. B., Barbosa, M., Mann, M., Manning, A. M, and Rao, A. (1997) Science 278, 860-866[Abstract/Free Full Text]
15. Zandi, E., Rothwarf, D. M., Delhase, M., Hayakawa, M., and Karin, M. (1997) Cell 91, 243-252[CrossRef][Medline] [Order article via Infotrieve]
16. Li, J., Peet, G. W., Pullen, S. S., Schembri-King, J., Warren, T. C., Marcu, K. B., Kehry, M. R., Barton, R., and Jakes, S. (1998) J. Biol. Chem. 273, 30736-30741[Abstract/Free Full Text]
17. Burke, J. R., Miller, K. R., Wood, M. K., and Meyers, C. A. (1998) J. Biol. Chem. 273, 12041-12046[Abstract/Free Full Text]
18. Peet, G. W., and Li, J. (1999) J. Biol. Chem. 274, 32655-32661[Abstract/Free Full Text]
19. Hu, M. C., and Wang, Y. (1998) Gene (Amst.) 222, 31-40[CrossRef][Medline] [Order article via Infotrieve]
20. Heilker, R., Freuler, F., Vanek, M., Pulfer, R., Kobel, T., Peter, J., Zerwes, H. G., Hofsetter, H., and Eder, J. (1999) Biochemistry 38, 6231-6238[CrossRef][Medline] [Order article via Infotrieve]
21. Woronicz, J. D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D. V. (1997) Science 278, 866-869[Abstract/Free Full Text]
22. Huynh, Q. K., Boddupalli, H., Rouw, S. A., Koboldt, C. M., Hall, T., Sommers, C., Hauser, S. D., Pierce, J. L., Combs, R. G., Reitz, B. A., Diaz-Collier, J. A., Weinberg, R. A., Hood, B. L., Kilpatrick, B. F., and Tripp, C. S. (2000) J. Biol. Chem. 275, 25883-25891[Abstract/Free Full Text]
23. Yamaoka, S., Curtois, G., Bessia, C., Whiteside, S. T., Weil, R., Agou, F., Kirk, H. E., Kay, R. J., and Israel, A. (1998) Cell 93, 1231-1240[CrossRef][Medline] [Order article via Infotrieve]
24. Rothwarf, D. M., Zandi, E., Natoli, G., and Karin, M. (1998) Nature 395, 297-300[CrossRef][Medline] [Order article via Infotrieve]
25. Mercurio, F., Murray, B. W., Shevchenko, A., Bennet, B. L., Young, D. B., Li, J. W., Pascual, G., Motiwala, A., Zhu, H., Mann, M., and Manning, A. M. (1999) Mol. Cell. Biol. 19, 1526-1538[Abstract/Free Full Text]
26. Connelly, M., and Marcu, K. (1995) Cell. Mol. Biol. Res. 41, 537-549[Medline] [Order article via Infotrieve]
27. Baud, V., Liu, Z. G., Bennett, B., Suzuki, N., Xia, Y., and Karin, M. (1999) Genes Dev. 13, 1297-1308[Abstract/Free Full Text]
28. Johnson, L. N., Noble, M. E., and Owen, D. J. (1996) Cell 85, 149-158[CrossRef][Medline] [Order article via Infotrieve]
29. Delhase, M., Hayakawa, M., Chen, Y., and Karin, M. (1999) Science 284, 309-313[Abstract/Free Full Text]
30. Shimada, T., Kawai, T., Takeda, K., Matsumoto, M., Inoue, J., Tatsumi, Y., Kanamaru, A., and Akira, S. (1999) Int. Immunol. 11, 1357-1362[Abstract/Free Full Text]
31. Peters, R. T., Liao, S., and Maniatis, T. (2000) Mol. Cell. 5, 513-522[CrossRef][Medline] [Order article via Infotrieve]
32. Tojima, Y., Fujimoto, A., Delhase, M., Chen, Y., Hatakeyama, S. T., Nakayama, K., Kaneko, Y., Nimura, Y., Motoyama, N., Ikeda, K., Karin, M., and Nakanishi, M. (2000) Nature 404, 778-782[CrossRef][Medline] [Order article via Infotrieve]
33. Bonnard, M., Mirtoss, C., Suzuki, S., Graham, K., Huang, J., Ng, M., Itie, A., Wakeham, A., Shahinian, A., Henzel, W. J., Elia, A. J., Shillinglaw, W., Mak, T. W., Cao, Z., and Yeh, W. (2000) EMBO J. 19, 4976-4985[CrossRef][Medline] [Order article via Infotrieve]
34. Peters, R. T., and Maniatis, T. (2001) Biochim. Biophys. Acta 1471, 57-62
35. Pomerantz, J. L., and Baltimore, D. (1999) EMBO J. 18, 6694-6704[CrossRef][Medline] [Order article via Infotrieve]
36. Nomura, F., Kawai, T., Nakanishi, K., and Akira, S. (2000) Genes Cells 5, 191-202[Abstract]
37. Crestfield, A. M., Moore, S., and Stein, W. H. (1963) J. Biol. Chem. 238, 622-627[Free Full Text]
38. Annan, R. S., and Carr, S. A. (1996) Anal. Chem. 68, 3413-3421[Medline] [Order article via Infotrieve]
39. Wilm, M., and Mann, M. (1996) Anal. Chem. 68, 1-8[Medline] [Order article via Infotrieve]
40. Zandi, E., Chen, Y., and Karin, M. (1998) Science 281, 1360-1363[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.