 |
INTRODUCTION |
The mitogen-activated protein kinases (MAP
kinases)1 play a central
role in signaling pathways initiated by extracellular stimuli such as
growth factors, cytokines, and various forms of environmental stress
(1-3). MAP kinase cascades are conserved in organisms ranging from
yeast to human. The three best-characterized MAP kinases are the
extracellular signal-regulated kinases (ERKs), the c-Jun N-terminal
kinases, and the p38 kinases. A typical MAP kinase cascade consists of
at least three kinases, a MAP kinase, a MAP kinase/ERK kinase (MEK)
that activates the MAP kinase, and a MEK kinase (MEKK) that activates
the MEK. Although ERKs respond robustly to growth factors and certain
hormones, c-Jun N-terminal kinases and p38 kinases react primarily to
cytokines and stress stimuli. After activation, each MAP kinase
phosphorylates a distinct spectrum of substrates, which include key
regulatory enzymes, cytoskeletal proteins, nuclear receptors,
regulators of apoptosis, and many transcription factors. Such an array
of substrates is consistent with the observation that MAP kinases are
involved in many critical cell functions.
Like many protein kinases, the activity of MAP kinases is tightly
regulated by phosphorylation. However, unlike many other protein
kinases, whose activation requires phosphorylation of a single residue
within a structurally conserved activation loop (4), the MAP kinases
are activated by dual phosphorylation of the Thr and Tyr residues in
the TXY motif of the activation loop (where X is
Glu in ERKs, Pro in c-Jun N-terminal kinases, and Gly in p38 kinases)
(5-7). Genetic and biochemical data suggest that the phosphorylation
of both Thr and Tyr residues in each of the known MAP kinases is
catalyzed by specific MEKs, which are dual specificity kinases (8-10).
Because of its central role in signaling pathways regulating cell
growth and differentiation, the prototypic member of the MAP kinase
family ERK2 has been the subject of intense study. Biochemical studies
have shown that phosphorylation at both sites in ERK2 is required for
full kinase activity (5, 11, 12).
The kinase activity of the monophosphorylated ERK2/pT (ERK2
phosphorylated on Thr-183) and ERK2/pY (ERK2 phosphorylated on Tyr-185)
has not been accurately measured. However, it is generally believed
that the singly phosphorylated forms of ERK2 have little kinase
activity. Monophosphorylated ERK2s can be produced by the action of
MEK1, which phosphorylates ERK2 by a two-collision, distributive
mechanism (13, 14). They can also be generated through the action of
serine/threonine protein phosphatase PP2A (15) and tyrosine-specific
PTP-SL (16) and HePTP (17) on ERK2/pTpY (ERK2 phosphorylated on
both Thr-183 and Tyr-185). Indeed, it has been shown that, in addition
to the unphosphorylated ERK2 and the bisphosphorylated ERK2/pTpY, both
ERK2/pT and ERK2/pY can be detected in living cells (18, 19). Although
both of the monophosphorylated ERK2s exist in the cell, it is not clear whether they have any distinct biological functions in signaling. To
begin to assess the potential biological significance of differential ERK2 phosphorylation, we have prepared ERK2 in all phosphorylated forms
and kinetically characterized them using two protein substrates, the
myelin basic protein and Elk-1. Our results revealed that the catalytic
efficiencies of ERK2/pY and ERK2/pT are ~2-3 orders of magnitude
higher than that of the unphosphorylated ERK2 and are only 1-2 orders
of magnitude lower than that of the fully active ERK2/pTpY. This raises
the possibility that the monophosphorylated ERK2s may have distinct
biological roles in vivo.
| |
EXPERIMENTAL PROCEDURES |
ERK2 Substrates--
Two protein substrates, the myelin basic
protein (MBP, obtained from Sigma, M1891) and the glutathione
S-transferase (GST) fusion of Elk-1 C-terminal fragment
(residues 307-428) were used to study the kinase activity of ERK2. The
bacterial expression vector for GST-Elk-1-(307-428)
(pGEX-2T/Elk-1-(307-428)) was a generous gift from Dr. Kun-Liang Guan.
GST-Elk-1-(307-428) was expressed in Escherichia
coli. BL21(DE3) and purified according to standard procedures
using the affinity matrix glutathione-Sepharose 4B (Amersham
Biosciences). The protein was further purified by fast protein liquid
chromatography Mono Q column with a 100-ml gradient of 0-300
mM NaCl in 20 mM MOPS, pH 7.4, 1 mM
EDTA. Fractions containing GST-Elk-1-(307-428) were collected and
concentrated with a Centriprep-10 filtration unit (Amicon). Protein
concentration was determined using the Bradford dye binding assay
(Bio-Rad) diluted according to the manufacture's recommendations using
bovine serum albumin as standard. The purified protein were made to
20% glycerol and stored at 
80 °C.
Protein Phosphatases--
The tyrosine-specific HePTP, the
Ser/Thr protein phosphatase PP2C
, and the dual specificity
phosphatase MKP3 were used to prepare the monophosphorylated ERK2/pT
and ERK2/pY and to determine the stoichiometry of ERK2 phosphorylation.
The expression vector for GST-HePTP (pGEX-3X-HePTP360) was a generous
gift from Dr. Brent Zanke. GST-HePTP was expressed in E. coli BL21/DE3 and purified according to standard procedures using
the affinity matrix Glutathione-Sepharose 4B. The protein purity was
judged to be greater than 90% by SDS-PAGE. The purified protein were
made to 20% glycerol and stored at 80 °C. For the production of
(His)6-tagged HePTP, the coding sequence for HePTP was
amplified by PCR using the oligonucleotides
GCCCATATGACCCAGCCTCCGCCTGA (NdeI site
underlined) and GCGGATCCTCAGGGGCTGGGTTCCT (BamHI
site underlined) as the 5' and 3' primers, respectively, using
pGEX-3X-HePTP360 as a template. The PCR product containing a 5'
NdeI site and 3' BamHI site was subcloned into a
pET28a vector (Novagen), and the His6-tag in the vector was
fused to the N terminus of HePTP. The N-terminal
His6-tagged HePTP was expressed in E. coli
BL21(DE3) and purified using standard procedures of nickel chelate
affinity chromatography. The protein purity was over 90% judged by
SDS-PAGE. The purified protein were made to 20% glycerol and stored at
80 °C. The human N-terminal His6-tagged PP2C
expression vector pET28a-His6-PP2C was a generous gift
form Dr. Mark Solomon. His6-PP2C was expressed in
E. coli BL21/DE3 and purified using standard procedures of nickel chelate affinity chromatography. The protein purity was judged
to be greater than 90% by SDS-PAGE. The purified protein were made to
20% glycerol and stored at 80 °C. MKP3 with a C-terminal His6 tag was expressed in E. coli and purified
as described (20).
Unphosphorylated ERK2--
The pET15b plasmid containing rat
ERK2 was a generous gift from Dr. Chao-Feng Zheng. The N-terminal
His6-tagged ERK2 was expressed in E. coli
BL21/DE3 and purified using standard procedures of Ni2+-nitrilotriacetic acid metal affinity chromatography
(Qiagen). The protein was further purified by fast protein liquid
chromatography anion exchange Mono Q column (Amersham Biosciences).
ERK2 was eluted by a NaCl gradient from 50 to 300 mM in 20 mM MOPS buffer, pH 7.4, containing 0.1 mM EDTA
and 1 mM dithiothreitol at 4 °C. As observed previously
(21, 22), the chromatography trace at 280 nm showed two ERK2 peaks. The
kinase activities of fractions of peak 1 were determined as follows. 20 µl of each fraction was incubated with 10 µM MBP, 1 mM [
-32P]ATP (200 cpm/pmol), 10 mM MgCl2 in 50 mM MOPS, pH 7.0, 100 mM NaCl, 0.1 mM dithiothreitol (50-µl total
volume) for 1 h at 30 °C. 32P incorporation in MBP
was determined as described under "Kinase Assay" in this section.
The early factions of peak 1, which were free of the high kinase
activity (22), were used in this study. The chosen fractions were
concentrated with a Centriprep-10 filtration unit (Amicon). Analysis by
SDS-PAGE showed that the protein purity was greater than 95%. The
protein concentration was determined from absorbance measurement at 280 nm using an absorbance coefficient 1.1 for 1 mg/ml ERK2. The purified
protein were made to 20% glycerol and stored at 80 °C.
Bisphosphorylated ERK2/pTpY--
The plasmid
pET-His6-ERK2-MEK1(R4F) (a generous gift of Dr. Melanie
Cobb) was used to co-express a constitutively active MEK1 and an
N-terminal His6-tagged ERK2 in E. coli
BL21(DE3). The expression and purification of ERK2/pTpY were carried
out following the procedure described by Wilsbacher and Cobb (23).
After the final fast protein liquid chromatography step, about 3 mg of
ERK2/pTpY were obtained from 6 liters of culture.
Monophosphorylated ERK2/pT--
ERK2/pT was
prepared by treating ERK2/pTpY with GST-HePTP. In a 100-µl reaction,
7.8 µM ERK2/pTpY and 0.36 µM GST-HePTP were incubated in 50 mM MOPS, pH 7.0, 100 mM NaCl,
0.1 mM EDTA (MOPS buffer) at 30 °C. Dephosphorylation of
Tyr(P) in ERK2/pTpY by GST-HePTP was monitored by measuring the
ERK2 kinase activity. At different incubation time, 1 µl of the
reaction mixture was withdrawn and diluted into 200 µl of ice-cold
MOPS buffer. Then 5 µl of the diluted solution was added to a 50-µl
kinase reaction mixture containing 5 µM MBP, 1 mM [-32P]ATP (200 cpm/pmol), and 10 mM MgCl2 to initiate the kinase reaction. After
incubating at 30 °C for 10 min, the reaction was terminated by 1.5%
phosphoric acid. The ERK2 kinase activity was determined using the
procedure described under "Kinase Assay" in this section. When no
further decrease in kinase activity was observed after GST-HePTP
treatment, 200 µl of 50% Ni2+-nitrilotriacetic acid
resin slurry was added to the reaction mixture. After incubation at
4 °C for 1 h, the resin was washed with 1 ml of 20 mM Tris, pH 7.9, 500 mM NaCl, and 5 mM imidazole 4 times to remove the GST-HePTP. ERK2/pT was
eluted from the resin by 500 µl of 20 mM Tris, pH 7.9, 500 mM NaCl, and 200 mM imidazole. The elute
was concentrated, and the buffer was changed to 20 mM MOPS,
pH 7.4, 100 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol with a Centriprep-10 filtration unit
(Amicon). The purified protein was made to 20% glycerol and stored at
80 °C.
Monophosphorylated ERK2/pY--
ERK2/pY was
prepared by treating ERK2/pTpY with PP2C. In a 100-µl reaction, 6 µM ERK2/pTpY and 0.2 µM PP2C was
incubated in the MOPS buffer containing 5 mM
MnCl2 at 30 °C. Dephosphorylation of Thr(P) in ERK2/pTpY
by PP2C was monitored by following the ERK2 kinase activity. At
different incubation times, 1 µl of the solution was withdrawn and
diluted into 200 µl of ice-cold MOPS buffer. The residual kinase
activity was measured as described above. When no further decrease in
kinase activity was observed after PP2C treatment, the reaction
mixture was dialyzed against 20 mM MOPS, pH 7.4, 100 mM NaCl, 1 mM EDTA, and 1 mM
dithiothreitol to remove MnCl2, which is essential for
PP2C activity. ERK2/pY was made to 20% glycerol and stored at
80 °C.
Kinase Assay--
The kinase activity of various forms of ERK2
was monitored by a radioisotope assay in which the rate of
incorporation of 32P from [-32P]ATP into a
substrate was directly measured. Reactions were carried out in 50 µl
of 50 mM MOPS buffer, pH 7.0, containing 100 mM
NaCl, 0.1 mM EDTA, 10 mM MgCl2, 1 mM [-32P]ATP (PerkinElmer Life Sciences;
BLU502A) (200 cpm/pmol), and varied concentrations of the protein
substrate. Reactions were initiated by the addition of ERK2 (1 µM), ERK2/pY (5-70 nM), ERK2/pT (2-9
nM), or ERK2/pTpY (0.7 nM) and allowed to
proceed at 30 °C for 10 min for the phosphorylated ERK2s and 60 min
for the unphosphorylated ERK2. The reactions were terminated by the
addition of 10 µl of 9.0% (final 1.5%) phosphoric acid. The
32P-labeled product was separated from
[-32P]ATP using P81 phosphocellulose paper (Whatman,
2.1 cm), which binds to protein or peptide product but not ATP and its
metabolites. Detail procedures are as follows. 30 µl of the quenched
reaction mixture were spotted onto the 2.1-cm-sized P81 paper strips.
After washing the strips with 0.5% phosphoric acid 4 times (2 min
each, 10-15 ml of 0.5% phosphoric acid per paper strip) with gentle agitation followed by 1 wash with water and 1 wash with acetone, the
P81 papers were dried with a hair dryer and inserted into a 4-ml
scintillation tube. Three ml of scintillation liquid was added, and the
incorporation of 32P into the product was counted by liquid
scintillation spectrometry. Controls were carried out in which ERK2 and
the substrate were replaced by buffer. Each sample was measured in triplicate.
ATPase Assays--
A radioisotope assay (22) was used to
determine the ATPase activity of unphosphorylated ERK2. Reactions were
performed in 50 mM MOPS, pH 7.0, 100 mM NaCl,
0.1 mM EDTA, 10 mM MgCl2 in a total
volume of 20 µl containing varied concentrations of
[-32P]ATP (600 cpm/pmol). Reactions were initiated by
the addition of 1 µM unphosphorylated ERK2, allowed to
proceed at 30 °C for 1 h, then terminated in 1 ml of 0.1 N HCl. To determine the amount of phosphate produced, the
quenched reactions were incubated with 200 µl of charcoal solution
(10% charcoal (Sigma C-6289), 10% acetic acid, 2.5 mM
KH2PO4) for 1 h on ice and then
centrifuged at maximum speed in a microcentrifuge for 30 min.
Radioactivity in the supernatant (500 µl) was measured by
scintillation counting.
The ATPase activities of unphosphorylated ERK2, ERK2/pY, ERK2/pT, and
ERK2/pTpY were also determined using an enzyme-coupled spectrometric
assay (24) and a modified inorganic phosphate assay (25). For the
enzyme-coupled spectrometric assay, the coupling reagents (all from
Sigma) and their concentrations were 70.4 units/ml lactate
dehydrogenase, 23.2 units/ml pyruvate kinase, 1 mM
phosphoenolpyruvate, and 0.2 mM NADH. All reactions were performed in 50 mM MOPS, pH 7.0, 100 mM NaCl,
0.1 mM EDTA, 10 mM MgCl2 in a total
volume of 250 µl at 30 °C containing varied concentrations of ATP.
Reactions were initiated by the addition of ERK2 (3 µM),
ERK2/pT (0.5 µM), ERK2/pY (0.7 µM), or
ERK2/pTpY (0.07 µM). The rate of phosphate release form
ATP was determined by the decrease in absorbance at 340 nm in a 96-well
plate using a molar extinction coefficient of 6220 M
1 cm1.
For the modified inorganic phosphate assay, reactions were performed in
50 mM MOPS, pH 7.0, 100 mM NaCl, 0.1 mM EDTA, 10 mM MgCl2 in a total
volume of 100 µl at 30 °C containing varied concentrations of ATP.
Reactions were initiated by the addition of ERK2 (1.7 µM), ERK2/pT (0.4 µM), ERK2/pY (0.6 µM), or ERK2/pTpY (0.1 µM). The reaction
was quenched by the addition of 25 µl of 10% trichloroacetic acid.
After the addition of 65 µl of solution (A + B) (A: 2% ammonium molybdate·4H2O; B: 14% ascorbic acid in 50%
trichloroacetic acid) and 125 µl of solution C (2% trisodium
citrate·2H2O plus 2% sodium arsenite in 2% (v/v) acetic
acid), the phosphate released form ATP hydrolysis was determined by the
absorbance at 700 nm in a 96-well plate using a molar extinction
coefficient of 9360 M1 cm1.
Phosphorylation States of ERK2 Preparations--
Three different
methods were used to assess the stoichiometry of ERK2 phosphorylation.
(1) The phosphorylation level in ERK2 was determined by the amount
inorganic phosphate released from ERK2 upon treatment by various
phosphatases. The amount of phosphate produced was followed
continuously by a coupled enzyme procedure involving purine nucleoside
phosphorylase and its chromophoric substrate
2-amino-6-mercapto-7-methylribonucleoside (7-methyl-6-thioguanosine (MTGuo)) (26, 27). Quantitation of phosphate was determined using the
extinction coefficient of 11,200 M1
cm1 at 360 nm and pH 7.0. The assay was carried out at
25 °C in a 1.6-ml reaction mixture containing 50 mM
MOPS, pH 7.0, 100 mM NaCl, 0.1 mM EDTA, 0.1 mg/ml purine nucleoside phosphorylase (Sigma), and 50 µM
MTGuo. ERK2/pTpY was first treated with HePTP (0.05 µM)
and then with MKP3 (0.1 µM) to dephosphorylate Tyr(P) and then Thr(P) on ERK2. The spectrophotometric measurements were conducted
using a PerkinElmer Lambda 14 spectrophotometer. MTGuo was
prepared according to the procedures described by Killilea et
al. (28). The concentration of MTGuo was determined at 331 nm
using a molar extinction coefficient of 32,000 M1 cm1. (2) High performance
liquid chromatography coupled with mass spectrometry was used to
measure the mass of the phosphorylated ERK2s. An HP 1100 high
performance liquid chromatography system equipped with a degasser and a
binary pump was employed to generate acetonitrile gradient. Solvent A
was 5% acetonitrile in deionized water containing 0.1% formic acid,
and solvent B was 95% acetonitrile containing 0.1% formic acid.
Twenty µM ERK2 samples were diluted 1:10 with deionized
H2O, and 20 µl of the diluted samples were loaded onto a
Vydac (Separation Group, Hesperia, CA) 1.0 × 150-mm C4 column.
The samples were desalted at 5% solvent B for 20 min and then eluted
with a 1-min gradient from 5 to 30% solvent B followed by a 40-min
gradient from 30 to 95% solvent B. The column effluent (50 µl/min)
was delivered directly onto a Thermo Finnigan (Riviera Beach, FL) LCQ
quadruple ion trap mass spectrometer without flow splitting. The mass
spectrometer detected the intensity of the ions in the
m/z range of 700-1300. (3) The phosphorylated ERK2s were also analyzed by Western blotting experiments. Approximately 10 ng of various forms of ERK2 were loaded on 10% SDS-polyacrylamide gel. When the electrophoresis was complete, the proteins on the gel
were transferred to a nitrocellulose membrane using a Trans-Blot SD
semidry electrophoretic transfer cell (Bio-Rad) at 150 mA and room
temperature for 1 h. The proteins on the membrane were probed with
anti-ERK1/2 (New England Biolabs, Inc., #9102, 1:2000 dilution), anti-bisphosphorylated ERK1/2 (New England Biolabs, Inc., #9101S, 1:2000 dilution), and anti-phosphotyrosine PY20-HRP (Santa Cruz Biotechnology, Inc., SC-508, 1:3000 dilution) antibodies. The immunocomplexes were detected by chemiluminescence upon incubation with
ECL reagents (Amersham Biosciences). The membrane was immediately exposed to Kodak BioMax Light Film.
| |
RESULTS |
As discussed above, the phosphorylation status of ERK2 is
dependent on the balanced activities between ERK2 kinases and
phosphatases. Because of the intrinsic catalytic properties of MEK1 and
Ser/Thr-specific and Tyr-specific phosphatases, all forms of ERK2,
i.e. unphosphorylated ERK2, monophosphorylated ERK2/pT and
ERK2/pY, and bisphosphorylated ERK2/pTpY, exist in vivo.
However, only the bisphosphorylated ERK2 has been characterized and
shown to possess high kinase activity. Although the kinase activities
of monophosphorylated ERK2s have not been accurately measured, they are
assumed to be inactive and similar to that of the unphosphorylated
ERK2. Do monophosphorylated ERK2s have any biological roles in the
cell? To begin to address this question, it is important to
biochemically characterize all forms of ERK2. In this study we have
prepared sufficient quantities of ERK2, ERK2/pT, ERK2/pY, and
ERK2/pTpY. This enabled us to fully characterize the kinetic properties
of all forms of ERK2s using two different proteins and ATP as substrates.
Preparation of ERK2, ERK2/pT,
ERK2/pY, and ERK2/pTpY--
The
N-terminally (His)6-tagged ERK2 was expressed in E. coli and purified by Ni2+-nitrilotriacetic acid
chromatography followed by an anion exchange Mono Q fast protein liquid
chromatography column. Similar to observations made by others (21, 22),
two protein peaks corresponding to ERK2 were found in the anion
exchange chromatogram. Because previous structural and biochemical
studies of ERK2 were based on fractions from peak 1 (21, 22, 29), we
decided to focus on peak 1 as well. We measured the kinase activity of
each fraction from peak 1, and as observed by others (22), found that
the latter fractions displayed significantly higher activity than those
eluting earlier. The higher specific activity associated with the later fractions may be a result of ERK2 autophosphorylation during its induction and expression in E. coli (30). Consequently, only early fractions free of the higher kinase activity were pooled and used
in this study, as was an early study (22).
ERK2/pTpY was prepared by co-expression of the N-terminal
His6-tagged ERK2 and a constitutively active MEK1 encoded
on a single plasmid in E. coli and followed by purification
using Ni2+-nitrilotriacetic acid affinity and Mono Q anion
exchange chromatography (7, 23). To prepare monophosphorylated ERK2/pT,
bisphosphorylated ERK2/pTpY was treated with tyrosine-specific HePTP
(see "Experimental Procedures"). The extent of Tyr(P)
dephosphorylation in ERK2/pTpY by HePTP was followed by measuring the
residual kinase activity in ERK2. As expected, HePTP treatment of
ERK2/pTpY led to a dramatic decrease in ERK2 kinase activity. The
reaction was followed until no further decrease in ERK2 kinase activity
was observed to ensure complete tyrosine dephosphorylation (Fig.
1A). We showed previously by
phosphoamino acid analysis that exhaustive dephosphorylation of
ERK2/pTpY by HePTP or PP2A produced monophosphorylated ERK2/pT or
ERK2/pY, respectively, (31). Similarly, monophosphorylated ERK2/pY were
prepared by treating ERK2/pTpY with the serine/threonine-specific PP2C (Fig. 1B), as described under "Experimental
Procedures."
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Preparation of ERK2/pT and ERK2/pY.
A, preparation of ERK2/pT by treatment of ERK2/pTpY with
HePTP. 7.8 µM ERK2/pTpY was mixed with 0.36 µM GST-HePTP and incubated in 50 mM MOPS, pH
7.0, buffer containing 100 mM NaCl and 0.1 mM
EDTA at 30 °C. At various reaction times, 1 µl of the reaction
mixture was withdrawn and diluted into 200 µl of ice-cold, pH 7.0, MOPS buffer. Five µl of the diluted solution was used to determine
the residual ERK2 kinase activity in 5 µM MBP, 1 mM [-32P]ATP, and 10 mM
MgCl2 at 30 °C for 10 min.  , residual ERK2 kinase
activity after incubation with GST-HePTP for various time;  ,
residual ERK2 kinase activity after incubation for various time without
GST-HePTP. B, preparation of ERK2/pY by treatment of
ERK2/pTpY with PP2C. 6.0 µM ERK2/pTpY was mixed with
0.2 µM PP2C and 5 mM MnCl2,
and incubated in 50 mM MOPS, pH 7.0, buffer containing 100 mM NaCl and 0.1 mM EDTA at 30 °C. ,
residual ERK2 kinase activity after incubation with PP2C for various
time; , residual ERK2 kinase activity after incubation for various
time without PP2C.
|
|
Physical and Biochemical Characterization of ERK2,
ERK2/pT, ERK2/pY, and
ERK2/pTpY--
To characterize the molecular
properties of various forms of ERK2, we first examined the purity of
the preparations by SDS-polyacrylamide gel electrophoresis (Fig.
2). In accord with previous observations, mono- and bisphosphorylated ERK2s co-migrated on SDS-PAGE and could be
resolved from the unphosphorylated ERK2 due to gel mobility retardation. As shown in Fig. 2, ERK2, ERK2/pT, and ERK2/pTpY appeared
to migrate as single bands (greater than 95% purity as judged by
SDS-PAGE). In contrast, the ERK2/pY sample contained a minor band (less
than 10%), which migrated with the same mobility as that of the
unphosphorylated ERK2. Because ERK2/pY was derived from ERK2/pTpY upon
PP2C treatment and there were no other impurities having the same
gel mobility in the ERK2/pTpY sample, this result suggests that the
ERK2/pTpY preparation contained less than 10% of ERK2/pT (the mono-
and bisphosphorylated ERK2s cannot be resolved by SDS-PAGE because they
have similar gel mobility), which when treated with PP2C yielded the
unphosphorylated ERK2 in the ERK2/pY sample.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2.
SDS-PAGE of ERK2, ERK2/pT, ERK2/pY, and
ERK2/pTpY. Lane 1, molecular mass standards; lane
2, 1 µg of purified ERK2; lane 3, 1 µg of purified
ERK2/pTpY; lane 4, 1 µg of purified ERK2/pT; lane
5, 1 µg of purified ERK2/pY.
|
|
To further characterize the various forms of ERK2, we performed Western
blot analyses using anti-ERK2, anti-bisphosphorylated ERK2, and
anti-phosphotyrosine antibodies (Fig. 3).
When probed with an anti-ERK2 antibody, all forms of ERK2 showed
immunoreactivity. As expected, all phosphorylated ERK2s,
i.e. ERK2/pTpY, ERK2/pT, and ERK2/pY, showed similar gel
mobility, which was retarded when compared with that of ERK2,
consistent with the Coomassie staining in Fig. 2. Note that a faint
ERK2 band is also visible in the ERK2/pY sample (Fig. 3, upper
panel), supporting the assignment of this band to unphosphorylated
ERK2. In every case, treatment of the phosphorylated ERK2s by an
appropriate phosphatase (i.e. ERK2/pTpY by MKP3 (an
ERK2-specific dual specificity phosphatase (31)), ERK2/pT by PP2C,
and ERK2/pY by HePTP) produced unphosphorylated ERK2. When probed with
an anti-bisphosphorylated ERK2 antibody, only ERK2/pTpY and ERK2/pT
displayed immunoreactivity (Fig. 3, middle panel). Only
after prolonged exposure can we observe a weak signal for the ERK2/pY
sample (data not shown). No measurable immunoreactivity was apparent
with the phosphatase-treated ERK2s, indicating that the
dephosphorylation was complete. Finally, when probed with an
anti-Tyr(P) antibody, only ERK2/pTpY and ERK2/pY show immunoreactivity,
as expected (Fig. 3, lower panel). Because similar
reactivity toward the anti-Tyr(P) antibody was observed for the ERK2/pY
and ERK2/pTpY samples, the Tyr(P) levels in both samples were probably
similar. Thus, the very weak reactivity of ERK2pY toward the
anti-bisphosphorylated ERK2 antibody was probably due to the intrinsic
property of ERK2/pY and not due to a lower Tyr(P) level in the sample.
The absence of immunoreactivity in the ERK2/pT sample toward
anti-Tyr(P) antibodies indicated that there were no ERK2/pTpY or
ERK2/pY present in the sample.
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Western blot analysis of various forms
of ERK2. Approximately 10 ng of various forms of ERK2 were
transferred to nitrocellulose membrane from 10% SDS-gel and probed
with anti-ERK2, anti-bisphosphorylated ERK2, and anti-Tyr(P)
(anti-pTyr) antibodies. The immuno-activity was detected by
chemiluminescence.
|
|
We next directly and quantitatively measured the phosphorylation states
of the ERK2 preparations. Two different methods were used to determine
the stoichiometry of ERK2 phosphorylation. In the first, the
phosphorylation level in ERK2 was determined by the amount inorganic
phosphate released from ERK2 upon treatment by various phosphatases.
The amount of phosphate produced was monitored continuously by a
coupled enzyme procedure involving purine nucleoside phosphorylase and
its chromophoric substrate, MTGuo (26, 27). Quantitation of the
phosphate released from phosphorylated ERK2s was determined using the
extinction coefficient of 11,200 M1
cm1 at 360 nm and pH 7.0. As shown in Fig.
4A, the ratio of Tyr(P) (determined from HePTP treatment) to Thr(P) (determined from MKP3 treatment) in the ERK2/pTpY preparation was 0.9-1.0. Because there were no unphosphorylated ERK2 and other impurity proteins in the ERK2/pTpY sample as judged from SDS-PAGE (Fig. 2), Western blot (Fig.
3), and mass spectrometric analyses (Fig.
5, see below), this result
indicated that the ERK2/pTpY sample contains 10% ERK2/pT. Incubation
of the monophosphorylated ERK2/pT with HePTP did not produce any
inorganic phosphate, consistent with that there were no ERK2/pY in the
sample, whereas stoichiometric amounts of phosphate was released from
ERK2/pT upon the addition of MKP3 (Fig. 4B). The level of
Tyr(P) in ERK2/pY was determined by the amount of phosphate released
upon HePTP treatment, which corresponded to 90% of the protein
concentration (Fig. 4C). Further treatment with MKP3 did not
yield additional phosphate, indicating that there were no ERK2/pT in
the sample. The rest of the 10% must be ERK2, which was derived from
ERK2/pT in ERK2/pTpY upon PP2C treatment.
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 4.
Phosphorylation stoichiometry of various
phosphorylated forms of ERK2 determined by an enzyme coupled assay that
measures the amount of phosphate released from ERK2 upon treatment with
an appropriate phosphatase. The phosphate released from ERK2 was
monitored by the increase in absorbance at 360 nm in the presence of 50 µM MTGuo, 0.1 mg/ml purine nucleoside phosphorylase in 50 mM MOPS, pH 7.0, 100 mM NaCl, 0.1 mM EDTA at 25 °C. A, 0.8 µM
ERK2/pTpY was first treated with 0.05 µM HePTP and then
with 0.1 µM MKP3; B, 0.5 µM
ERK2/pT was first treated with 0.05 µM HePTP and then
with 0.1 µM MKP3; C, 0.7 µM
ERK2/pY was first treated with 0.05 µM HePTP and then
with 0.1 µM MKP3.
|
|
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
Mass spectra of ERK2, ERK2/pT, ERK2/pY, and
ERK2/pTpY. The biggest error limit for the mass measurements was
within ±5 daltons. ERK2 was derived from ERK2/pTpY treated with MKP3.
For preparation of ERK2/pT and ERK2/pY, see "Experimental
Procedures."
|
|
In the second method, the stoichiometry of ERK2 phosphorylation was
examined by electrospray mass spectrometry. To calculate the
theoretical mass of ERK2 encoded by the plasmid
pET-His6-ERK2-MEK1(R4F), we sequenced both the 5'- and
3'-ends of the ERK2 DNA sequence. The 3'-end sequence was found to be
identical to the published data (32). The 5'-end DNA sequence and the
corresponding amino acid sequence containing the His6 tag
were determined as the following.
Thus, the calculated mass of ERK2 based on the amino acid sequence
using the average residue mass is 42297.3. The deconvoluted mass
spectra obtained for the ERK2/pTpY, ERK2/pT, ERK2/pY, and ERK2 samples
are shown in Fig. 5. After complete dephosphorylation of ERK2/pTpY by
MKP3, the experimentally determined molecular mass of ERK2 was 42164, which is 133.3 units lower than that predicated based on the amino acid
sequence. This mass difference is almost identical to the mass of
methionine (131.2), suggesting that the first methionine in the
N-terminal of the His6-tagged ERK2 was cleaved during
protein expression in E. coli. Because the molecular mass of
the -PO3H2 group is 81 Da, one would expect an
increase of 81 mass units in ERK2/pT and ERK2/pY and an increase of 162 mass units in ERK2/pTpY. Table I
summarizes the molecular masses for various forms of ERK2 and the
predicted and observed mass differences between them. Given the
experimental errors (±5 Da), the observed masses matched
perfectly with the calculated masses. Consistent with the SDS-PAGE,
Western blot, and phosphorylation stoichiometry measurements with
specific phosphatases, the mass spectra of ERK2 and ERK2/pT revealed
only one species. In contrast, the mass spectra of ERK2/pY and
ERK2/pTpY each showed, in addition to the major peak, a minor peak
(~10% of the total sample) with a mass corresponding to the loss of
one phosphoryl group compared with the major peak (Fig. 5). These
results provide further support to our conclusions that the ERK2/pTpY
sample contained about 10% ERK2/pT and the ERK/pY sample contained
about 10% ERK2.
Kinetic Properties of ERK2, ERK2/pT,
ERK2/pY, and ERK2/pTpY--
After we
thoroughly characterized the physical and biochemical properties of
various forms of ERK2, we set out to measure their kinase as well as
ATPase activities. We selected two proteins, the MBP and the
transcription factor Elk-1, as ERK2 substrates. MBP is a widely used
protein substrate for several protein kinases, including ERK2 (22). The
transcription factor Elk-1 is a physiological substrate of ERK2. When
phosphorylated by ERK2, Elk-1 forms a complex with the serum response
factor and binds the serum response promoter element to enhance
transcription from the c-fos promoter. In this study we used
the C-terminal fragment of Elk-1 (residues 307-428) fused to the C
terminus of GST. The C-terminal fragment of Elk-1 (residues 307-428)
contains all the ERK2 phosphorylation sites (33), and
GST-Elk-1-(307-428) has been shown to be an excellent substrate for
ERK2 (34).
The kinase activity of ERK2 in various phosphorylation states was
determined by a radioisotope assay in which the rate of incorporation
of 32P from [-32P]ATP into a substrate was
directly measured (see "Experimental Procedures"). All steady-state
kinetic measurements were performed at pH 7.0 and 30 °C in 1 mM ATP, which is within the range of physiological ATP
concentrations. As shown in Fig. 6, the
phosphorylation of MBP and GST-Elk-1-(307-428) catalyzed by ERK2/pTpY
obeyed classical Michaelis-Menten kinetics. There was no measurable
32P incorporation into GST when GST alone was incubated
with ERK2/pTpY and [-32P]ATP (data not shown).
Similarly, MBP and GST-Elk-1-(307-428) phosphorylation by ERK2,
ERK2/pT, and ERK2/pY also followed Michaelis-Menten kinetics. We were
able to determine the kinetic parameters, kcat and Km, for all four forms of ERK2 with both MBP
(Table II) and GST-Elk-1-(307-428)
(Table III) as a substrate. The
kcat and Km for the
ERK2/pTpY-catalyzed MBP phosphorylation were 6.51 ± 0.43 s1 and 10.0 ± 1.3 µM, respectively.
Under the same conditions, the kcat and
Km for ERK2 were 0.000728 ± 0.000010 s1 and 22.9 ± 1.0 µM, respectively.
These results were similar to those obtained from earlier studies
(measured at pH 7.4 and 23 °C) in which the
kcat and Km for the ERK2/pTpY
(prepared by in vitro phosphorylation using a constitutive
active MEK1)-catalyzed MBP phosphorylation at 1 mM ATP were
found to be 6.14 ± 0.17 s1 and 5.9 ± 0.7 µM (35), whereas the kcat and
Km for the unphosphorylated ERK2 were determined to
be 0.000151 ± 0.000009 s1 and 22.4 ± 6.8 µM (22). With GST-Elk-1-(307-428) as a substrate, we
obtained a kcat of 10.22 ± 0.54 s1 and Km of 1.95 ± 0.20 µM for ERK2/pTpY. These compared with a
kcat of 1.67 ± 0.33 s1 and
Km of 1.5 ± 0.5 µM for ERK2/pTpY
(purchased from New England Biolabs) with the same GST-Elk-1-(307-428)
as a substrate at a 10-fold lower (100 µM) subsaturating
ATP concentration (34).
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6.
Dependence of the initial velocity on protein
substrate concentration in the ERK2/pTpY-catalyzed phosphorylation of
MBP (A) and GST-Elk-1-(307-428)
(B). All experiments were performed in the
presence of 1 mM [-32P]ATP, 10 mM MgCl2 and various concentrations of the
protein substrate in 50 mM MOPS, pH7.0, 100 mM
NaCl, 0.1 mM EDTA at 30 °C. The data were fitted
directly to the Michaelis-Menten equation to obtain the
Km and kcat values.
|
|
As shown in Tables II and III, both ERK2/pT and ERK2/pY exhibited
dramatically higher kinase activity than that of the unphosphorylated ERK2. For ERK2/pT, the overall substrate turnover number
kcat for MBP phosphorylation was 620-fold higher
than that of ERK2 and only 14-fold lower than that of the fully active
ERK2/pTpY. The overall catalytic efficiency, also known as substrate
specificity constant kcat/Km,
was 946-fold higher than that of ERK2 and only 22-fold lower than that
of the fully active ERK2/pTpY. Further, phosphorylation at Tyr-185
alone (ERK2/pY) resulted in a 227- and 334-fold increase in
kcat and
kcat/Km, respectively, over
those of ERK2. Interestingly, a recent study showed that a
constitutively active mutant ERK2, ERK2-L73P/S151D, which was 90%
monophosphorylated at Tyr-185 and 10% unphosphorylated, displayed 50-100-fold increase in kinase activity with MBP as a substrate (36).
With GST-Elk-1-(307-428) as a substrate (Table III), the
kcat and
kcat/Km for ERK2/pT were 126- and 368-fold higher than those of ERK2 and only 11- and 20-fold lower
than those of ERK2/pTpY. For ERK2/pY, the kcat
and kcat/Km were 40- and
91-fold higher than those of ERK2 and 34- and 82-fold lower than those
of ERK2/pTpY. Collectively, the results from both substrates indicate
that the catalytic efficiency of ERK2/pY, ERK2/pT, and ERK2/pTpY are
~2, 3, and 4 orders of magnitude higher than that of ERK2.
We next determined the ATPase activity for all forms of ERK2. For the
phosphorylated ERK2s, two different methods were used to measure the
ATPase activity. The first was an enzyme-coupled spectrometric assay
(24) that measures the ADP produced from ATP hydrolysis. The second was
a modified colorimetric inorganic phosphate assay (25) that measures
the inorganic phosphate produced from ATP hydrolysis. The ATPase
activity of unphosphorylated ERK2 was also determined using a
radioisotope assay (22) that measures directly the
32P-labeled inorganic phosphate hydrolyzed from
[-32P]ATP in addition to the enzyme-coupled
spectrometric assay and the colorimetric inorganic phosphate assay.
Similar results were obtained for each form of ERK2 regardless the
method used for the kinetic measurement (Table
IV). The kcat and
Km for the hydrolysis of ATP by ERK2/pTpY are
comparable with those determined by (22) at pH 7.4 and 23 °C.
However, the kcat and Km for
the ATPase activity of the unphosphorylated ERK2 determined at pH 7.4 and 23 °C were 0.00111 ± 0.00009 s1 and 306 ± 47 µM, respectively, which are 27-fold higher and
5-fold lower than those determined by Prowse and Lew
(kcat = 0.0025 ± 0.0003 min1
and Km = 1.6 ± 0.5 mM) (22). The
source of this discrepancy is currently unknown, but we noted that the
ERK2-catalyzed ATP hydrolysis exhibited significant substrate (ATP)
inhibition with an apparent Ki of 4 mM.2 As
summarized in Table IV, phosphorylation of Tyr-185 alone (ERK2/pY) resulted only in a 2-fold increase in the ATPase activity. In contrast,
phosphorylation of Thr-183 alone (ERK2/pT) led to a 16-fold increase in
the ATPase activity. Phosphorylation of both Thr-183 and Tyr-185
(ERK2/pTpY) increased the ATPase activity by 62-fold.
It should be kept in mind that because the kinase activity of ERK2/pT
is 11-14-fold lower than that of ERK2/pTpY, the small amount (~10%)
of ERK2/pT in the ERK2/pTpY sample do not affect the kinetic parameters
determined for ERK2/pTpY. Indeed, we have recently obtained a new batch
of bisphosphorylated ERK2 that is free of ERK2/pT. The newly prepared
ERK2/pTpY displayed similar kinetic properties to those reported in
this study.3 Similarly,
because the activity of ERK2 is much lower than that of ERK2/pY, the
small amount of ERK2 in the ERK2/pY sample is insignificant to alter
the kinetic properties of ERK2/pY.
Is the Observed High Kinase Activity in the Monophosphorylated
ERK2s Due to a Small Amount of Contaminating Bisphosphorylated
ERK2?--
In addition to the data presented (phosphoamino acid
analysis (31), specific phosphatase treatments (Figs. 1 and 4), Western blot analysis (Fig. 3), and mass spectrometry (Fig. 5)), three additional lines of evidence suggest that the high kinase activity observed for the monophosphorylated ERK2s are intrinsic to ERK2/pY and
ERK2/pT, not from contaminating ERK2/pTpY. First, when the purified
ERK2/pT and ERK2/pY, which were derived from treatment of ERK2/pTpY by
HePTP and PP2C (Fig. 1), respectively, were treated with fresh,
additional HePTP or PP2C, no further decrease in ERK2 kinase
activity was observed. Second, we have established, based on Western
blot analysis with anti-Tyr(P) antibodies, that if the ERK2/pT sample
contains ERK2/pTpY, its content must be less than 0.1% of the total
protein content. This amount cannot account for the
kcat values determined for ERK2/pT, which amount to 6.9-9.2% that of ERK2/pTpY. Finally, if the observed activity in
the monophosphorylated samples were due to the more active ERK2/pTpY, then the Km should reflect that of
ERK2/pTpY. As can be seen in Tables II-IV, the Km
values of ERK2/pT and ERK2/pY are substantially different from those of
ERK2/pTpY.
To exclude the possibility that the observed higher kinase activity of
the monophosphorylated ERK2s was originated from bisphosphorylated ERK2
resulting from autophosphorylation of the monophosphorylated forms of
ERK2 during the kinase reaction, we determined the level of
autophosphorylation in ERK2, ERK2/pT, ERK2/pY, and ERK2/pTpY in the
presence of Mg2+-[-32P]ATP (Fig.
7). It is known that ERK2 can
autophosphorylate weakly at Thr-183, Tyr-185 (30, 37, 38), and Ser-39
(38), and the mechanism of ERK2 autophosphorylation is intramolecular
(36). The stoichiometry of autophosphorylation is generally less than 1% but could approach 15-20% after extended incubation with
Mg2+-ATP. Autophosphorylation of ERK2 was slow, and the
increase in ERK2 kinase activity was small (less than 1%) compared
with that occurring in the presence of ERK2 kinase activator (38). As shown in Fig. 7, within the incubation time for kinase activity measurements (10 min for the phosphorylated ERK2s and 60 min for unphosphorylated ERK2), there was no significant autophosphorylation for ERK2/pY, ERK2/pTpY, and ERK2. Interestingly, ERK2/pT displayed the
highest autophosphorylation activity. We determined that the stoichiometry of ERK2/pT autophosphorylation reached 14% after a
10-min incubation with Mg2+-[-32P]ATP.
However, autophosphorylation of ERK2/pT did not alter its kinase
activity (Table V). Furthermore, Western
blot analysis of the ERK2/pT samples withdrawn after incubation with
Mg2+-ATP at various time points with anti-Tyr(P) antibodies
did not reveal tyrosine phosphorylation, suggesting that ERK2/pT
autophosphorylation occurs at residue(s) other than Tyr-185. Similarly,
we also found that the kinase activity of ERK2, ERK2/pY, and ERK2/pTpY
did not change with or without Mg2+-ATP preincubation (60 min for ERK2 and 10 min for ERK2/pY and ERK2/pTpY). Thus, the kinase
activity of the monophosphorylated ERK2s are intrinsic to the proteins
and not due to autophosphorylation. Collectively, our data suggest that
the observed kinetic parameters for ERK2/pT and ERK2/pY are intrinsic
properties of the monophosphorylated ERK2s, not from contaminated
ERK2/pTpY.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
Autophosphorylation of ERK2 (), ERK2/pY
( ), ERK2/pT ( ), and ERK2/pTpY (). The level of
autophosphorylation in ERK2, ERK2/pY, ERK2/pT, or ERK2/pTpY was
determined under the following conditions. 1.1 µM
phosphorylated or unphosphorylated ERK2 was incubated with 1 mM [-32P]ATP (200 cpm/pmol) and 10 mM MgCl2 in 50 mM MOPS, pH 7.0, 100 mM NaCl, 0.1 mM EDTA at 30 °C. At different
incubation times, 50 µl of the reaction mixture was withdrawn and
mixed with 10 µl of 9% phosphoric acid to terminate the
autophosphorylation reaction. The incorporated 32P in ERK2
was measured by filter binding and scintillation counting.
|
|
View this table:
[in this window]
[in a new window]
|
Table V
Kinetic parameters of ERK2/pT as a function of pre-incubation time with
Mg2+-ATP
ERK2/pT was incubated with [-32P]ATP and at the indicated
time, an aliquot of ERK2/pT was withdrawn, and its kinase activity
measured using MBP as a substrate.
|
|
| |
DISCUSSION |
Monophosphorylation in the Activation Loop Produces Intermediate
Activity States in ERK2--
The activities of many protein kinases,
which catalyze protein phosphorylation reactions, are themselves
regulated by phosphorylation (4). Most protein kinases are activated
through phosphorylation of amino acid residue(s) within the activation
loop. Full activation of MAP kinases requires the phosphorylation of
both Thr and Tyr in the TXY motif in the activation loop. It
has been shown that MEK1 carries out its dual phosphorylation of ERK2
by a distributive mechanism (13, 14). Interestingly, the
dephosphorylation of ERK2/pTpY by MKP3 is also distributive (31). In
addition, because bisphosphorylated MAP kinases contain both Thr(P) and
Tyr(P), they could serve as substrates for all classes of protein
phosphatases. Thus, dephosphorylation of the bisphosphorylated MAP
kinase by serine/threonine protein phosphatases should produce MAP
kinase phosphorylated on Tyr, whereas dephosphorylation of the
bisphosphorylated MAP kinase by protein-tyrosine phosphatases should
yield MAP kinase phosphorylated only on Thr. Consequently, it is
expected that monophosphorylated MAP kinases would be generated through
the combined action of MEKs and various MAP kinase phosphatases.
Indeed, recent evidence indicates that both forms of the
monophosphorylated ERK2 exist in the cell in addition to the
bisphosphorylated and unphosphorylated ERK2 (18, 19). However, it is
widely accepted in the literature that only the bisphosphorylated MAP
kinase is active, whereas the monophosphorylated MAP kinases are
inactive. Thus, the biological roles (if any) for the
monophosphorylated MAP kinases are currently unknown.
Do monophosphorylated MAP kinases have biological functions in
vivo? To begin to address this question, we need to biochemically characterize all forms of MAP kinase. Using previously published procedures, we obtained recombinant ERK2 and ERK2/pTpY. We then prepared ERK2/pT and ERK2/pY by treating ERK2/pTpY with
tyrosine-specific HePTP and serine/threonine-specific PP2C,
respectively. We determined the kinetic parameters for the
phosphorylation of both MBP and Elk-1 catalyzed by all forms of ERK2.
Our results revealed that the kinase activity and catalytic efficiency
of ERK2/pY and ERK2/pT are only 1-2 orders of magnitude lower than
those of the bisphosphorylated ERK2. More importantly, the kinase
activity and catalytic efficiency of ERK2/pY and ERK2/pT are 2-3
orders of magnitude higher than those of the unphosphorylated ERK2
(Fig. 8). Thus, our results show that
monophosphorylation in the activation loop produces intermediate
activity states in ERK2. Phosphorylation of Tyr-185 increases the
overall catalytic efficiency by 2 orders of magnitude, and
phosphorylation of Thr-183 increases the overall catalytic efficiency
by nearly 3 orders of magnitude. Dual phosphorylation of Thr-183 and
Tyr-185 increases the overall catalytic efficiency by 4 orders of
magnitude. It is important to point out that the kinetic properties for
ERK2/pY and ERK2/pT reported here are different from those measured for
ERK2/T183A/pY and ERK2/Y185F/pT (38, 39), indicating that ERK2/T183A/pY
and ERK2/Y185F/pT are not accurate models for the native
monophosphorylated ERK2s.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 8.
Schematic presentation of the relative kinase
activity (A) and catalytic efficiency
(B) between various forms of ERK2. Open
bar, with MBP as a substrate; solid bar, with GST-Elk-1
as a substrate.
|
|
Structural and Functional Correlation--
The three-dimensional
structures for the low activity, unphosphorylated ERK2, and the fully
active bisphosphorylated ERK2/pTpY were solved, and a comparison of the
two structures suggested a structural basis of ERK2 activation induced
by the dual phosphorylation in the activation loop (7, 29). Like many
other protein kinases, the activation loop in ERK2 plays a critical
role in modulating its activity. In inactive ERK2, the two lobes in the
kinase domain exist in an open conformation, and the conformation of
the activation loop is incompatible with substrate binding and/or
catalysis. ERK2 activation is triggered by a conformational change that
is initiated by dual phosphorylation of Thr-183 and Tyr-185 within the
activation loop. Phosphorylation of Tyr-183 promotes rotation of the
two lobes toward each other, and the phosphate on Tyr-183 makes ionic
contacts with three Arg residues, Arg-68 in helix C, Arg-146 in the
catalytic loop, and Arg-170 in the activation loop. One of the major
consequences of these interactions is the optimization of the alignment
of the invariant residues, Lys-52, which coordinates to the - and
-phosphates of ATP, and Glu-69, which stabilizes Lys-52 in
ERK2/pTpY. Mutagenesis studies of Lys-52 indicate that its primary
function is to facilitate phosphoryl group transfer (40). In addition,
domain rotation brings Lys-52 and the phosphate binding loop closer to
Asp-147, which is the catalytic base that accepts a proton from the
hydroxyl group of substrate Ser, and Asp-165, which plays a role in
Mg2+ ion coordination. Tyr-185 is buried and inaccessible
to solvent in unphosphorylated ERK2. Upon Tyr-185 phosphorylation, the
activation loop is refolded, which enables the phosphate on Tyr-185 to
interact with Arg-189 and Arg-192, leading to the formation of the P + 1 binding site for substrate recognition.
Determination of the kinetic parameters associated with various forms
of ERK2 for substrate processing allows a direct correlation of
structural changes with catalytic activation induced by
phosphorylation. Our results show that phosphorylation in ERK2
activation loop primarily increases kcat (2-4
orders of magnitude), with only a moderate decrease in
Km (2-5-fold). Previous kinetic studies establish
that the overall rate of substrate processing by both ERK2 and
ERK2/pTpY is largely limited by the rate of the phospho-transfer step
(22, 35). Thus, in comparison to the unphosphorylated ERK2,
bisphosphorylation of ERK2 increases the rate of phosphoryl transfer
8,940-fold from ATP to MBP and 1,370-fold from ATP to
GST-Elk-1-(307-428). In addition, ERK2/pTpY also displays an ATPase
activity that is 62-fold higher than that of the unphosphorylated ERK2.
Interestingly, phosphorylation of Tyr-183 alone results in a 16-fold
increase in the ATPase activity. Moreover, the kinase activity of
ERK2/pT is 2-3 orders of magnitude higher than that of the
unphosphorylated ERK2 and only 11-14-fold lower than that exhibited by
ERK2/pTpY. These results are consistent with the structural
observations that Tyr-183 phosphorylation orchestrates the correct
positioning of the active site for efficient phospho-transfer. The fact
that the extent of activation in the ATPase reaction is significantly
less than that observed in the kinase reaction suggests that Tyr-183
phosphorylation contributes to the stabilization of both the ATP moiety
and the protein phospho-acceptor substrate in the transition state
of the kinase reaction.
Unlike Tyr-183, which is equivalent to Thr-160 in
cyclin-dependent kinase 2 and Thr-197 in protein kinase A,
Tyr-185 is unique to the MAP kinases. We discovered that
phosphorylation of Tyr-185 alone does not have significant effect on
the ATPase activity, which is in accord with the structural data that
Tyr-185 is not involved in alignment of Lys-52 and Glu-69. Strikingly,
phosphorylation of Tyr-185 dramatically augments the rate of phosphoryl
transfer from ATP to protein substrates. The
kcat values for the ERK2/pY-catalyzed phosphorylation of MBP and GST-Elk-1-(307-428) are 227- and 40.5-fold higher than those of the unphosphorylated ERK2. In fact, ERK2/pY is
only 3-fold less active than ERK2/pT. These results support the notion
that phosphorylation of Tyr-185 is responsible for P + 1 site
recognition in protein substrates. Because catalytic activation of the
ERK2/pY kinase activity results primarily from a large increase in the
rate of the phosphoryl transfer from ATP to the protein substrates,
phosphorylation of Tyr-185 serves primarily to position the
phospho-acceptor for phosphoryl transfer.
Biological Implications--
Activation of ERK2 is
involved in cellular proliferation, transformation, and
differentiation. It is well known that both the magnitude and duration
of ERK2 activation are important in determining the cell fate (1-3).
For example, in PC12 cells, transient induction of ERK2 activity
promotes cell proliferation, whereas sustained activation of ERK2
drives cells into neuronal differentiation (41). The only known
mechanism for ERK2 activation is through dual phosphorylation of the
Thr and Tyr residues in the activation loop by MEK1 (5-7). In fact,
the dual phosphorylation of ERK2 has been proposed as an on-off switch,
increasing the basal activity by more than 1,000-fold. Intriguingly,
ERK2/pTpY can be dephosphorylated by multiple phosphatases, including
the Ser/Thr phosphatases, the tyrosine-specific protein-tyrosine
phosphatases, and the dual specificity phosphatase MKPs. The action of
different phosphatases on ERK2/pTpY would inevitably generate
monophosphorylated ERK2s in addition to the unphosphorylated ERK2.
However, in much of the literature investigating ERK2 signaling, there
has been the implicit assumption that the monophosphorylated ERK2s
are inactive. Thus, the significance for the need of multiple
phosphatases to down-regulate the ERK2 kinase activity is not clear.
Our observation that a single phosphorylation in the activation loop of
ERK2 produces an intermediate activity state challenges the current
accepted view that only the bisphosphorylated ERK2 has biological
functions. It has been proposed that multi-site phosphorylations could
correlate with the generation of a variety of protein forms in which
one or more properties are altered (42, 43). For example, different
phosphorylations could be linked to distinct protein functions or
graded effects on a single function. Our data suggest a more graded
change in kinase activity induced by phosphorylation of the ERK2
activation loop than from a simple off versus on switch for
kinase activation. Recent studies indicate that significant amounts of
monophosphorylated ERK2s exist in vivo and the
monophosphorylated ERK2s have distinct subcellular localizations (18,
19). More importantly, results from a constitutive active mutant of
ERK2, ERK2-L73P/S151D, suggest that only a 50-100-fold increase in
ERK2 activity is sufficient to sustain ERK2 function and establish the
threshold of ERK2 activity needed for in vivo signaling
(36). Our results that monophosphorylated ERK2s possess kinase
activities that are 2-3 orders of magnitude higher than that of the
unphosphorylated ERK2 raise the possibility that ERK2/pY and ERK2/pT
may indeed have distinct in vivo functions. Although less
active than the bisphosphorylated species, monophosphorylated ERK2s may
differentially phosphorylate pathway components.
One possibility that the biological importance of the
monophosphorylated ERK2s has not been appreciated may be linked to the fact that most assays used for assessing ERK2 activation rely heavily
on the use of gel mobility shift and anti-phospho-ERK2 antibodies. As
shown in this work and by others (14, 18, 19, 36), one cannot
differentiate the bisphosphorylated ERK2 from the monophosphorylated
proteins using these methods/reagents. Thus, activities of the
monophosphorylated ERK2s may have gone undetected because they were
attributed to the bisphosphorylated ERK2.
Finally, because the MAP kinase phosphorylation sites and the machinery
for MAP kinase phosphorylation are conserved, it seems plausible that
the monophosphorylated forms of other MAP kinases would display
intermediate levels of activity as well. The fact that multiple
phosphatases are involved in the regulation of MAP kinase activity
suggests that phosphatases may play a crucial role in determining
cellular responses to external stimuli. The involvement of multiple
phosphatases for MAP kinase inactivation may also have an impact on the
time course, the threshold for activation, and the efficiency of
regulation of the MAP kinase pathways.
In summary, this study reveals that monophosphorylated ERK2s have
intermediate activities in between the basal unphosphorylated and the
fully activated bisphosphorylated states. The results illustrate the
flexibility of phosphorylation and its ability to exquisitely regulate
activity states. This may be important for the ability of ERK2 to
integrate diverse biological stimuli and permit more intricate
regulatory circuits to operate. In the context of our findings,
monophosphorylated forms of ERK2 may have as yet unidentified, distinct
biological functions.
TOP
ABSTRACT
INTRODUCTION
An Irma T. Hirschl Career Scientist. To whom correspondence should
be addressed: Dept. of Molecular Pharmacology, Albert Einstein College
of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Tel.: 718-430-4288; Fax: 718-430-8922; E-mail: zyzhang@aecom.yu.edu.
![v=<FR><NU>V<SUB><UP>max</UP></SUB></NU><DE>1+<FR><NU>K<SUB>m</SUB></NU><DE>[<UP>S</UP>]</DE></FR>+<FR><NU>[<UP>S</UP>]</NU><DE>K<SUB>i</SUB></DE></FR></DE></FR>](/content/vol277/issue16/fulltext/13889/img002.gif)
