HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 17, 14408-14416, April 26, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/17/14408    most recent M109671200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Uddin, S. Articles by Platanias, L. C. Search for Related Content PubMed PubMed Citation Articles by Uddin, S. Articles by Platanias, L. C. Social Bookmarking                      What's this?

Protein Kinase C- (PKC-) Is Activated by Type I Interferons and Mediates Phosphorylation of Stat1 on Serine 727^*

Shahab Uddin, Antonella Sassano, Dilip K. Deb, Amit Verma, Beata Majchrzak^§, Arshad Rahman^¶, Asrar B. Malik^¶, Eleanor N. Fish^§, and Leonidas C. Platanias

From the  Section of Hematology-Oncology, Department of Medicine, University of Illinois at Chicago and West Side Veterans Administration Medical Center, Chicago, Illinois 60607, the ^¶ Department of Pharmacology, University of Illinois at Chicago, Chicago, Illinois 60612, and the ^§ Division of Cell and Molecular Biology, Toronto General Research Institute, University Health, Network and Department of Immunology, University of Toronto, Toronto ON M5G2M1, Canada

Received for publication, October 5, 2001, and in revised form, February 1, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

It is well established that engagement of the Type I interferon (IFN) receptor results in activation of JAKs (Janus kinases), which in turn regulate tyrosine phosphorylation of STAT proteins. Subsequently, the IFN-dependent tyrosine-phosphorylated/activated STATs translocate to the nucleus to regulate gene transcription. In addition to tyrosine phosphorylation, phosphorylation of Stat1 on serine 727 is essential for induction of its transcriptional activity, but the IFN-dependent serine kinase that regulates such phosphorylation remains unknown. In the present study we provide evidence that PKC-, a member of the protein kinase C family of proteins, is activated during engagement of the Type I IFN receptor and associates with Stat1. Such an activation of PKC- appears to be critical for phosphorylation of Stat1 on serine 727, as inhibition of PKC- activation diminishes the IFN- or IFN-dependent serine phosphorylation of Stat1. In addition, treatment of cells with the PKC- inhibitor rottlerin or the expression of a dominant-negative PKC- mutant results in inhibition of IFN- and IFN-dependent gene transcription via ISRE or GAS elements. Interestingly, PKC- inhibition also blocks activation of the p38 MAP kinase, the function of which is required for IFN-dependent transcriptional regulation, suggesting a dual mechanism by which this kinase participates in the generation of IFN responses. Altogether, these findings indicate that PKC- functions as a serine kinase for Stat1 and an upstream regulator of the p38 MAP kinase and plays an important role in the induction of Type I IFN-biological responses.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Type I IFNs¹ (IFN , , ) are pleiotropic cytokines that exhibit antiproliferative, antiviral, and immunomodulatory effects in vitro and in vivo (1-5). For Type I interferons to elicit their biological effects on target cells, binding to the multisubunit Type I interferon receptor is required (1-5). This results in activation of the receptor-associated Tyk-2 and Jak-1 kinases (reviewed in Refs. 2-5), the activation of which regulates phosphorylation of multiple signaling elements and engagement of several downstream pathways, including the STAT pathway (reviewed in Refs. 1-5), the IRS-PI3'-kinase pathway (6-9), the Crk pathway (10-12), and pathways involving mitogen-activated protein (MAP) kinases (13-16). Thus, multiple signaling cascades are regulated by the Type I IFN receptor, a finding consistent with the pleiotropic biological effects of Type I interferons in vitro and in vivo.

JAK-STAT pathways play critical roles in interferon-dependent gene regulation. The activated JAK kinases regulate tyrosine phosphorylation of STAT proteins and the formation of different STAT complexes that translocate to the nucleus to initiate gene transcription via binding to distinct elements in the promoters of IFN-activated genes. There is strong evidence that, in addition to tyrosine phosphorylation, phosphorylation on serine is required for the transcriptional properties of Stat1 and Stat3 (reviewed in Ref. 17). Stat1 has a phosphorylation site in its C terminus, serine 727, which plays a critical role in the induction of gene transcription. Previous studies have established that phosphorylation of Ser-727 in Stat1 is essential for Type II IFN (IFN)-dependent transcriptional activation (18-22). Similarly, phosphorylation of Stat3 on Ser-727 is required for the full transcriptional activity of this protein without modifying its DNA-binding properties (21). The functional relevance of serine phosphorylation of Stat1 has been demonstrated in studies in which it was shown that complementation of Stat1-deficient cells with a Ser-727 mutant fails to restore induction of the antiproliferative and antiviral properties of IFN, whereas re-expression of the wild type protein restores such defects (23, 24). Most of the studies evaluating the functional relevance of serine phosphorylation of Stat1 have been performed in the Type II IFN-system. However, there is evidence that Stat1 is also phosphorylated on serine during engagement of the Type I IFN (IFN) receptor (16, 25), suggesting a role for such phosphorylation of Stat1 in the generation of Type I IFN responses.

The mechanisms regulating Type I IFN-inducible phosphorylation of Stat1 on serine 727 have not been elucidated, and the serine kinase regulating such phosphorylation remains unknown. A good candidate kinase would have been the p38 MAP kinase, as the STAT-serine phosphorylation site is in a conserved motif, which is a potential site for phosphorylation by proline-directed kinases of the MAP kinase family (17). Furthermore, previous studies had shown that pharmacological or molecular inhibition of the p38 MAP kinase pathway blocks interferon-dependent gene transcription (14, 15). However, extensive studies by us and others have established that p38 does not function as a serine kinase for Stat1 in response to IFN (16) or IFN (26) and that its regulatory effects on Type I IFN-dependent gene transcription are unrelated to modification of components of the STAT-pathway (16).

In the present study we provide evidence that a member of the PKC family of proteins, PKC-, is phosphorylated during engagement of the Type I IFN receptor, and its kinase domain is induced. Our data demonstrate that PKC- interacts with Stat1 in an IFN-dependent manner and regulates its phosphorylation on serine 727. In addition, specific pharmacological inhibitors of PKC-, or a dominant-negative PKC- mutant, inhibit IFN-dependent gene transcription in luciferase reporter assays. Interestingly, engagement of PKC- also appears to be required for downstream activation of the p38 MAP kinase, suggesting the existence of a dual mechanism by which this PKC isoform participates in the regulation of IFN-dependent responses.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cells and Reagents-- The U-266 and Molt-4 cell lines were grown in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics. U2OS cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. Human recombinant IFN2 was provided by Hoffmann-La Roche. Human recombinant consensus IFN was provided by Amgen Inc. Human recombinant IFN was provided by Biogen Inc. Antibodies against the phosphorylated forms of p38 and Erk-2 were obtained from New England Biolabs and were used for immunoblotting. Polyclonal antibodies against PKC-, p38, and Stat1 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against the phosphorylated/activated form of PKC- at threonine 505 and against the phosphorylated form of the p38 MAP kinase at threonine 180 and tyrosine 182 were obtained from New England Biolabs (Beverly, MA). Antibodies that specifically recognize the phosphorylated forms of Stat1 at serine 727 and tyrosine 701 and an anti-phosphotyrosine monoclonal antibody (4G-10) were obtained from Upstate Biotechnology Inc. and were used for immunoblotting. The pan-PKC inhibitor H7, the PKC- inhibitor rottlerin, and the p38 MAP kinase inhibitor SB203580 were purchased from Calbiochem.

Cell Lysis, Immunoprecipitation, and Immunoblotting-- Cells were stimulated with 1 × 10⁴ units/ml of the indicated interferons for the indicated times and lysed in phosphorylation lysis buffer as described previously (6-9). Immunoprecipitations and immunoblotting using an ECL (enhanced chemiluminescence) method were performed as described previously (6-9). In the experiments in which pharmacological inhibitors of PKC- or p38 were used, the cells were pretreated for 60 min with the indicated concentrations of the inhibitors and subsequently treated for the indicated times with interferons prior to lysis in phosphorylation lysis buffer.

PKC- Kinase Assays-- Immune complex kinase assays to detect PKC- activation were performed as described previously (14, 27). Briefly, cells were treated for the indicated times with IFN, and the cells were lysed in phosphorylation lysis buffer. Cell lysates were immunoprecipitated with an anti-PKC- antibody, and immunoprecipitates were washed three times with phosphorylation lysis buffer and two times with kinase buffer (25 mM Tris-HCl (pH 7.4), 5 mM MgCl₂, 0.5 mM EDTA, 1 mM dithiothreitol, 20 µg of phosphatidylserine, 20 µM ATP) and were resuspended in 30 ml of kinase buffer containing 5 µg of histone H1 as an exogenous substrate, to which 20-30 µCi of [-³²P]ATP was added. The reaction was incubated for 15-30 min at room temperature and was terminated by the addition of SDS-sample buffer. Proteins were analyzed by SDS-PAGE, and the phosphorylated form of histone H1 was detected by autoradiography. In some experiments recombinant active PKC- kinase (obtained from Upstate Biotechnology Inc.) was added directly in the kinase buffer together with Stat1 immunoprecipitated from cell lysates of U-266 cells, and after completion of the in vitro kinase assay reaction, the phosphorylation of Stat1 was detected by SDS-PAGE analysis followed by immunoblotting with an anti-Ser-727 Stat1 antibody.

p38 MAP Kinase Assays-- The activation of the p38 kinase in response to IFN was evaluated by in vitro kinase assays as described previously (14).

Genomic DNA Affinity Chromatography (GDAC) Studies-- These assays were performed using the methodology described in our previous studies (9, 11).

Production of GST Fusion Proteins-- The Stat1 wild type cDNA (provided by Dr. James Darnell, Rockefeller University, New York, NY) was amplified by PCR. The primers that were used were: N terminus, 5'-CGCGGATCCGCGATGTCTCAGTGGTACGAACTTC-3'; C terminus, 5'-CGCGGATCCGCGCTATACTGTGTTCATCATACTGTC-3'. A BamHI restriction site was attached in both sites of the primers. The amplified product was digested with BamHI and cloned in BamHI-digested PGEX 4T1 vector. The orientation of the open reading frame was then determined by restriction digestion analysis. The correct orientation of the open reading frame containing the clone was subsequently selected and used to produce the GST-Stat1 fusion by isopropyl-1-thio--D-galactopyranoside induction (6). The GST-Stat1 fusion protein was subsequently used as an exogenous substrate in in vitro kinase assays using anti-PKC- immunoprecipitates from lysates of IFN-treated cells.

Luciferase Reporter Assays-- Cells were transfected with a -galactosidase expression vector and either an ISRE luciferase construct or a luciferase reporter gene containing eight GAS elements linked to a minimal prolactin promoter (8X-GAS) using the Superfect transfection reagent in accordance with the manufacturer's recommended procedure (Qiagen). The ISRE-luciferase construct (14) included the wild type ISG15 ISRE (TCGGGAAAGGGAAACCGAAACTGAAGCC) cloned via cohesive ends into the BamHI site of the pZtkLuc vector and was provided by Dr. Richard Pine (Public Health Research Institute, New York, NY). The 8X-GAS construct (28) was kindly provided by Dr. Christopher Glass (University of California San Diego). Forty-eight hours after transfection, triplicate cultures were either left untreated or treated with 5 × 10³ units/ml IFN or IFN as indicated. In the experiments in which the effects of overexpression of a kinase-defective PKC- mutant were determined, the cells were transfected with a PKC- mutant in which arginine 376 was replaced with lysine, therefore lacking a functional catalytic domain (29) (provided by Dr. I. Bernard Weinstein, Columbia University College of Physicians and Surgeons, New York, NY). The cells were washed twice with cold phosphate-buffered saline, and after cell lysis, luciferase activity was measured using the manufacturer's protocol (Promega). The measured luciferase activities were normalized for -galactosidase activity for each sample.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We first determined whether during IFN treatment of sensitive cells, PKC- is phosphorylated/activated. U-266 or Molt-4 cells were incubated in the presence or absence of IFN, and cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of PKC- on threonine 505. As shown in Fig. 1, treatment of cells with IFN resulted in strong phosphorylation of the protein, whereas there was no change in the amount of protein detected prior to and after IFN treatment (Fig. 1, A-D). Similarly, treatment of cells with IFN also resulted in strong phosphorylation of PKC- (Fig. 2), suggesting that this kinase is a common element in the signaling pathways of all different Type I IFNs.

View larger version (38K): [in this window] [in a new window]   Fig. 1.   IFN induces phosphorylation of PKC-. A, Molt-4 cells were treated with IFN for the indicated times. The cells were lysed, and equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of PKC-. B, the blot shown in A was stripped and reprobed with an antibody against PKC-. C, U-266 cells were treated with IFN for 30 min as indicated. The cells were lysed, and equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of PKC-. D, the blot shown in C was stripped and reprobed with an antibody against PKC-.

View larger version (23K): [in this window] [in a new window]   Fig. 2.   IFN-dependent phosphorylation of PKC-. A, Molt-4 cells were treated with IFN for the indicated times. The cells were lysed, and equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of PKC-. B, the blot shown in A was stripped and reprobed with an antibody against PKC-.

We subsequently determined whether the kinase domain of PKC- is activated by IFN stimulation. Cells were incubated in the presence or absence of IFN, and after cell lysis and immunoprecipitation with an anti-PKC- antibody, in vitro kinase assays were carried out on the immunoprecipitates using histone H1 as an exogenous substrate. IFN treatment resulted in strong induction of the kinase activity of PKC- as evidenced by the phosphorylation of histone H1 (Fig. 3). Such phosphorylation of histone H1 in the kinase assay was blocked by pretreatment of cells with rottlerin, a pharmacological inhibitor that selectively blocks activation of PKC- (30, 31) but not other PKC isoforms (27, 30-33) (Fig. 3). On the other hand, pretreatment of cells with SB203580 (an inhibitor of the p38 MAP kinase) or LY379196 (a selective inhibitor of PKC-) had no effects on the activation of PKC- and phosphorylation of histone H1 in the kinase assays (data not shown), further demonstrating the specificity of the process. Thus, during engagement of the Type I IFN receptor, PKC- is phosphorylated and its kinase activity is induced, strongly suggesting that this member of the PKC family of proteins plays a role in the generation of signals by the Type I IFN receptor.

View larger version (52K): [in this window] [in a new window]   Fig. 3.   IFN induces activation of the kinase domain of PKC-. Molt-4 cells were treated with IFN in the presence or absence of rottlerin (1 µM) as indicated. Cell lysates were immunoprecipitated with an antibody against PKC- and subjected to an in vitro kinase assay using histone H1 as an exogenous substrate. Proteins were analyzed by SDS-PAGE and transferred to Immobilon membrane, and phosphorylated proteins were detected by autoradiography (upper panel). The membrane was subsequently immunoblotted with an anti-PKC- antibody to control for equal loading (lower panel).

It is well known that PKC- exhibits serine kinase activity in other systems. Our data that this serine kinase is activated during engagement of the Type I IFN receptor raised the possibility that it may function as a STAT kinase and regulate phosphorylation of Stat1 on serine 727. To investigate such a hypothesis, experiments were performed in which cells were pretreated in the presence or absence of PKC inhibitors, and the IFN-inducible phosphorylation of Stat1 on serine 727 was examined by immunoblotting with an antibody against the phosphorylated form of Stat1 on serine 727. We first used H7, a pan-PKC pharmacological inhibitor, which in addition to PKC-, inhibits activation of the various other PKC isoforms. Molt-4 or U-266 cells were preincubated in the presence or absence of H7, and the IFN-dependent phosphorylation of Stat1 on Ser727 was examined in the continuous presence or absence of the inhibitor. As shown in Fig. 4, pretreatment of cells with H7 diminished the serine phosphorylation of Stat1, suggesting that PKC activity is required for such an event (Fig. 4). We subsequently performed similar experiments, using the PKC--specific inhibitor rottlerin (27, 30-34). Pretreatment of cells with rottlerin also blocked the IFN-induced Stat1 serine phosphorylation (Fig. 5 A, B, D, and E), whereas it had no effects on the IFN-dependent tyrosine phosphorylation of Stat1 on Tyr-701 (Fig. 5, C and F).

View larger version (45K): [in this window] [in a new window]   Fig. 4.   The pan-PKC inhibitor H7 blocks the IFN-inducible phosphorylation of Stat1 on serine 727. A, Molt-4 cells were preincubated for 60 min in the presence or absence of H7 and subsequently treated with IFN for 20 min as indicated. Total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of Stat1 on serine 727. B, the blot shown in A was stripped and reprobed with an anti-Stat1 antibody to control for loading. C, U-266 cells were preincubated for 60 min in the presence or absence of H7 and subsequently treated with IFN for 20 min as indicated. Total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of Stat1 on serine 727. D, the blot shown in C was stripped and reprobed with an anti-Stat1 antibody to control for loading.

View larger version (30K): [in this window] [in a new window]   Fig. 5.   IFN-dependent phosphorylation of Stat1 on serine 727 is PKC--dependent. Molt-4 (A-C) or U-266 (D-F) cells were preincubated for 60 min in the presence or absence of rottlerin (1 µM) as indicated. The cells were subsequently treated with IFN for 20 min as indicated. Total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated form of Stat1 on serine 727 (A and D). The blots were subsequently stripped and reprobed with an anti-Stat1 antibody to control for loading (B and E). Equal amounts of total cell lysates from the same experiments shown in A and D were analyzed separately by SDS-PAGE and immunoblotted with an antibody against the tyrosine-phosphorylated form of Stat1 on Tyr-701 (C and F).

Similarly, the IFN-inducible phosphorylation of Stat1 on serine 727 was also inhibited by pretreatment of cells with H7 or rottlerin (Fig. 6). On the other hand, treatment of cells with LY3791196, a selective inhibitor of PKC- but not PKC-, had no effects on the serine phosphorylation of Stat1 (Fig. 7), further establishing the specificity of these findings. Thus, the function of PKC- appears to be essential for the IFN- and IFN-dependent phosphorylation of Stat1 on Ser-727, suggesting that either this PKC isoform functions as the Type I IFN-dependent serine kinase for Stat1 or regulates activation of a downstream serine kinase that directly phosphorylates Stat1.

View larger version (18K): [in this window] [in a new window]   Fig. 6.   IFN-dependent serine phosphorylation of Stat1 is PKC--dependent. Molt-4 cells were incubated with the PKC- inhibitor rottlerin (1 µM) or the pan-PKC inhibitor H7 for 60 min as indicated. The cells were subsequently treated with IFN for 20 min as indicated. Total cell lysates were analyzed by SDS-PAGE and immunoblotted with an anti-serine 727 Stat1 antibody (left panel). The same blot was stripped and reprobed with an anti-Stat1 antibody to control for loading (right panel).

View larger version (16K): [in this window] [in a new window]   Fig. 7.   Activation of PKC-, but not PKC-, is required for serine phosphorylation of Stat1 by IFN. A, Molt-4 cells were either not preincubated or preincubated with the PKC- inhibitor rottlerin (1 µM, lane 2, or 5 µM, lane 3) or the PKC- inhibitor LY379196 (10 nM, lane 4, or 50 nM, lane 5) for 60 min. The cells were subsequently treated with IFN for 20 min, and equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an anti-serine 727 Stat1 antibody. B, the blot shown in A was stripped and reprobed with an anti-Stat1 antibody to control for loading.

The data using the pharmacological inhibitors of PKC- strongly suggested that this kinase regulates phosphorylation of Stat1 on serine 727. To directly determine whether the protein phosphorylates Stat1, in vitro kinase assays experiments were performed in which exogenous recombinant active PKC- protein was added to Stat1, immunoprecipitated from lysates of untreated cells. As shown in Fig. 8, A and B, the addition of the active PKC- protein resulted in strong phosphorylation of Stat1 on serine 727. Similarly, in studies in which a GST-Stat1 fusion protein was used as a substrate for PKC- immunoprecipitated from lysates of IFN-treated cells, we found that Stat1 acts as a substrate for the kinase activity of PKC- (Fig. 8, C and D).

View larger version (26K): [in this window] [in a new window]   Fig. 8.   Phosphorylation of Stat1 on serine 727 by PKC-. A, U-266 cells were lysed in phosphorylation lysis buffer and immunoprecipitated with either control rabbit IgG (RIgG) or an anti-Stat1 antibody as indicated. Immunoprecipitated proteins were resuspended in kinase assay buffer, and recombinant active PKC- was added to the reaction. Proteins were subsequently analyzed by SDS-PAGE, and phosphorylation of Stat1 was detected by immunoblotting with an anti-Ser-727 Stat1 antibody. B, the blot shown in A was stripped and reprobed with an anti-Stat1 antibody to control for protein loading. C, U-266 cells were incubated in the presence or absence of IFN for 30 min as indicated. Cell lysates were immunoprecipitated with either control RIgG or an anti-PKC- antibody and subjected to an in vitro kinase assay using a GST-Stat1 fusion protein as a substrate. Proteins were analyzed by SDS-PAGE and immunoblotted with an anti-Ser-727 Stat1 antibody to detect the phosphorylated form of Stat1 on serine 727. D, the blot shown in C was stripped and reprobed with an anti-PKC- antibody to control for protein loading.

To obtain further information on the role that PKC- plays in Stat1 serine phosphorylation in vivo, we examined whether it interacts with Stat1 in intact cells. U-266 cells were incubated in the presence or absence of IFN, and the cells were lysed in phosphorylation lysis buffer. Cell lysates were immunoprecipitated with an anti-Stat1 antibody and, after SDS-PAGE analysis, immunoblotted with an anti-PKC- antibody. PKC- was clearly detectable in anti-Stat1 immunoprecipitates after IFN treatment of cells (Fig. 9, A and B), suggesting that it associates with PKC- to act as a substrate for its kinase activity. Consistent with this finding, in experiments in which cell lysates from IFN-treated cells were immunoprecipitated with an anti-PKC- antibody and immunoprecipitates were immunoblotted with an anti-Stat1 antibody, we found that Stat1 protein can be detected in anti-PKC- immunoprecipitates in an IFN-dependent manner (Fig. 9, C and D). We also determined whether the IFN-inducible association of Stat1 with PKC- and its subsequent phosphorylation on serine 727 plays any role in its nuclear translocation and DNA binding activity. Molt-4 cells were preincubated in the presence or absence of rottlerin and then treated with IFN in the continuous presence or absence of the PKC- inhibitor. Nuclear extracts were then obtained and analyzed by GDAC. As shown in Fig. 9E, Stat1 translocated to the nucleus and bound DNA in an IFN-dependent manner. Rottlerin had no effect on the DNA binding of Stat1, indicating that the PKC--mediated serine 727 phosphorylation of the protein does not affect its DNA binding activity (Fig. 9E).

View larger version (31K): [in this window] [in a new window]   Fig. 9.   Stat1 associates with PKC- in an IFN-dependent manner, but the nuclear translocation and DNA binding of Stat1 is PKC-independent. A, U-266 cells were incubated in the presence or absence of IFN for 20 min. The cells were lysed, and cell lysates were immunoprecipitated with an antibody against Stat1. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against PKC-. B, the blot shown in A was stripped and reprobed with an antibody against Stat1 to control for loading. C, U-266 cells were incubated in the presence or absence of IFN for 15 min. The cells were lysed, and cell lysates were immunoprecipitated with an antibody against PKC-. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat1. D, the blot shown in C was stripped and reprobed with an antibody against PKC- to control for loading. E, Molt-4 cells were pretreated for 30 min with rottlerin as indicated and subsequently treated with IFN for 30 min as indicated. Nuclear extracts were subsequently prepared and analyzed by GDAC. GDAC eluates were resolved by SDS-PAGE and after Western blotting probed with an anti-Stat1 antibody.

In subsequent studies, we sought to determine the functional consequences of the IFN-induced PKC--dependent Stat1 serine phosphorylation. We examined whether inhibition of PKC- activation has negative regulatory effects on IFN-dependent gene transcription via ISRE or GAS elements. Cells were transfected with ISRE or 8X-GAS-luciferase constructs and treated with IFN in the presence or absence of the PKC- inhibitor rottlerin. Luciferase activity was subsequently measured. IFN induced strong luciferase activity via either ISRE or GAS elements, but preincubation with rottlerin significantly decreased such activities (Fig. 10). In parallel studies in which IFN was used instead of IFN, rottlerin, and also H7, inhibited the IFN-induced luciferase activity, whereas the PKC- inhibitor LY379196 did not (Fig. 11). To further establish the role of PKC- in Type I IFN-dependent transcriptional regulation, we determined the effects of a dominant-negative PKC- mutant, created by the substitution of arginine 376 with lysine and therefore lacking a functional catalytic domain (27, 29), on IFN-induced transcriptional activity in luciferase promoter assays. As shown in Fig. 12, overexpression of the dominant-negative PKC- mutant diminished IFN-dependent induction of luciferase activity, using either the ISRE-Luc or the 8X-GAS-Luc constructs (Fig. 12, A and B). On the other hand, overexpression of a dominant-negative/kinase-inactive PKC- mutant, created by substitution of arginine 437 to lysine (27, 29), had no effects on IFN-dependent luciferase promoter activity (Fig. 12C), suggesting that this PKC isoform plays no role in IFN-induced transcriptional activation and further demonstrating the specificity of these findings.

View larger version (17K): [in this window] [in a new window]   Fig. 10.   The PKC--specific inhibitor rottlerin blocks IFN-dependent gene transcription via ISRE or GAS elements. U2OS cells were transfected with an ISRE-luciferase (upper panel) or an 8X-GAS (lower panel) construct as indicated. Forty-eight hours after transfection the cells were treated for 60 min in the presence or absence of rottlerin (5 µM). Subsequently, the cells were incubated for 6 h in the presence or absence of IFN, and luciferase activity was measured. Data are expressed as fold increase in response to IFN treatment over control untreated samples for each condition. The mean ± S.E. values of three independent experiments in each panel are shown.

View larger version (10K): [in this window] [in a new window]   Fig. 11.   Effects of PKC inhibitors on IFN-dependent gene transcription. U2OS cells were transfected with an ISRE-luciferase construct as indicated. Forty-eight hours after transfection, the cells were treated for 60 min in the presence or absence of rottlerin (5 µM), H7 (50 µM), or LY3791196 (LY379, 50 nM). Subsequently, the cells were incubated for 6 h in the presence or absence of IFN, and luciferase activity was measured. Data are expressed as fold increase in response to IFN treatment over control untreated samples for each condition. The mean ± S.E. values of two independent experiments are shown.

View larger version (13K): [in this window] [in a new window]   Fig. 12.   Inhibition of Type I IFN-dependent gene transcription via ISRE or GAS elements by a dominant-negative PKC mutant. U2OS cells were transfected with an ISRE-luciferase construct (A) or an 8X-GAS-luciferase construct (B) and with either pCDNA3 empty vector or a PKC- kinase-defective mutant. The cells were subsequently incubated for 6 h in the presence or absence of IFN, and luciferase activity was measured. Data are expressed as fold increase in response to IFN treatment over control untreated samples for each condition. The mean ± S.E. values of two independent experiments in each panel are shown. C, U2OS cells were transfected with an 8X-GAS luciferase construct with either pCDNA3 empty vector or with a dominant-negative PKC- kinase-defective mutant as indicated. Data are expressed as fold increase in response to IFN treatment over control-untreated samples for each condition. The mean ± S.E. of two independent experiments are shown.

Recent work from our group has demonstrated that the p38 MAP kinase pathway is activated by IFN and that its function is essential for IFN-dependent gene transcription, independently of STAT activation (14, 16). We have also recently shown that PKC- regulates downstream activation of p38 in response to thrombin (27). This prompted us to determine whether the regulatory effects of PKC- on transcriptional activation of interferon-sensitive genes are mediated in part via effects on the IFN- or IFN-inducible activation of p38. Cells were treated with IFN or IFN in the presence or absence of the PKC- inhibitor rottlerin, and total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody that recognizes the phosphorylated/activated form of p38 (14, 16). As shown in Fig. 13, rottlerin inhibited activation of p38 in response to either IFN (Fig. 13, A and B) or IFN (Fig. 13, C and D) treatment, suggesting that PKC- functions as an upstream regulator of p38 activation by IFN. Consistent with this finding, pretreatment of cells with rottlerin also inhibited the activation of the MAPKapK-2 kinase (Fig. 14A), which we have previously shown to be activated downstream of p38 in response to IFN (14). To exclude the possibility that rottlerin has nonspecific effects on the kinase domain of p38, the effect of rottlerin on the kinase domain of p38 was directly determined. The addition of rottlerin directly to anti-p38 immunoprecipitates from IFN-treated cells had no effect on the kinase activity of p38 (Fig. 14B), whereas as expected, addition of the p38-inhibitor SB203580 inhibited such an activation (Fig. 14B). These data strongly suggest that activation of PKC- is essential for Type I IFN-dependent activation of p38 and are consistent with the findings of a recent study (27) demonstrating that the thrombin-dependent activation of p38 is PKC--dependent.

View larger version (37K): [in this window] [in a new window]   Fig. 13.   The Type I IFN-dependent activation of the p38 MAP kinase is PKC--dependent. A, Molt-4 cells were either not preincubated or preincubated with the PKC- inhibitor rottlerin (1 µM, lane 3, or 5 µM, lane 4) for 60 min as indicated. The cells were subsequently treated with IFN for 30 min, and equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated/activated form of p38. B, the blot shown in A was stripped and reprobed with an anti-p38 antibody to control for loading. C, Molt-4 cells were either not preincubated or preincubated with the PKC- inhibitor rottlerin (5 µM) or the pan-PKC inhibitor H-7 (50 µM) for 60 min as indicated. The cells were subsequently treated with IFN for 20 min, and equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against the phosphorylated/activated form of p38. D, the blot shown in C was stripped and reprobed with an anti-p38 antibody to control for loading.

View larger version (34K): [in this window] [in a new window]   Fig. 14.   Activation of PKC- by IFN mediates downstream engagement of the p38/MapKapK-2 signaling cascade. A, Molt-4 cells were incubated for 30 min in the presence or absence of rottlerin as indicated. The cells were subsequently treated for 30 min with IFN in the continuous absence or presence of rottlerin. Cell lysates were immunoprecipitated with an anti-MapKapK-2 antibody and subjected to an in vitro kinase assay using Hsp25 as an exogenous substrate. B, Molt-4 cells were incubated with IFN for the indicated times. The cells were subsequently lysed, and lysates were immunoprecipitated with an antibody against p38. The beads were then resuspended in kinase reaction buffer, and SB203580 or rottlerin was added directly in the beads for 60 min as indicated. Subsequently [-32P]ATP and ATF-2 were added in the reaction mixture. After completion of the kinase assay, immunoprecipitates were analyzed by SDS-PAGE, and the phosphorylated form of ATF-2 was detected by autoradiography.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Our data provide the first evidence that PKC- is activated during engagement of the Type I IFN receptor and functions as a serine kinase for Stat1. They also demonstrate that the function of this PKC isoform is essential for transcriptional regulation of interferon-sensitive genes. PKC- is a member of the PKC family of serine-threonine kinases, which play important roles in signaling for various cytokine receptors (reviewed in Refs. 32-34). The different protein kinase C isoforms are classified based on their requirements for activation. The first group includes the conventional PKC (cPKC) isoforms (PKC-, , ), which require increases in both intracellular calcium and phorbol esters for their activation (32-34). The second group, in which PKC- is included, is the group of novel PKCs (nPKC), which do not require Ca²⁺ for their activation (PKC-, , , , µ) but are activated by phorbol esters (32-34). Finally, a third group of atypical PKCs (aPKC) has been recently identified (PKC-, ), which are not activated in response to phorbol esters, the typical PKC activators (32-34).

Members of the PKC family have previously been shown to participate in the regulation of several important cellular responses such as differentiation, cell growth, and apoptosis (32-34). Interestingly, different PKC isoforms appear to exhibit opposing effects on cell growth and proliferation. For instance, PKC- promotes cell growth and functions as an oncogene (35), whereas PKC- exhibits antiproliferative effects and suppresses cell growth in various systems (35-37). Our finding that PKC- is activated by the Type I IFN receptor to participate in the generation of IFN-signals is consistent with the fact that this kinase mediates antiproliferative responses (35-37), as Type I IFNs are potent inhibitors of normal and neoplastic cell growth.

Although it is well known that the kinase domains of members of the PKC family exhibit serine-threonine kinase activity, very little is known about their ability to function as serine kinases for STAT proteins. Prior to the present study, evidence had been provided that PKC- plays a role in IL-6-dependent phosphorylation of Stat3 on serine 727 (30). That study demonstrated that PKC- associates with Stat3 in an IL-6-dependent manner and that pharmacological inhibition of PKC- with rottlerin abrogates the IL-6-induced phosphorylation of serine 727 in Stat3 (30). In addition, another study demonstrated that during engagement of the IL-6 receptor, PKC- is activated downstream of Rac1 and SEK1/MKK-4 to regulate Stat3 phosphorylation on serine 727 (38). Interestingly, our previous studies have shown that the small GTPase Rac1 is also activated by the Type I IFN receptor to regulate downstream engagement of p38 (16, 39), suggesting that activation of PKC- by IFN may occur downstream of Rac1. Thus, it is likely that the Type I IFN receptor regulates activation of a Rac1  PKC-  p38 signaling cascade, which plays a critical role in the induction of gene transcription.

An important and outstanding issue in the field of cytokine signaling, which is required to complete our understanding of the IFN-activated JAK-STAT pathway, is the identification of the Type I IFN-dependent serine kinase for Stat1. Serine 727 in Stat1 is located in the C terminus of the protein in a PSP motif. Previous studies have established that the phosphorylation of this site during engagement of the IFN receptor requires upstream activation of the Jak-2 tyrosine kinase (19), and the IFN-activated Pyk-2 tyrosine kinase has been also implicated (40). A more recent study has provided evidence that the IFN-dependent serine phosphorylation of Stat1 on serine 727 is regulated by a serine kinase downstream of the PI3'-kinase and Akt, or possibly by the Akt kinase itself (41). Such phosphorylation appears to be dependent on upstream activation of the Jak1 kinase (41), which is associated with the Type II IFN receptor and plays an important role in the generation of IFN biological responses. Although the Type I IFN receptor also induces serine phosphorylation of Stat1 (16), the serine kinase that mediates such effects remains unknown. In fact, the Pyk-2 tyrosine kinase, which regulates IFN-inducible phosphorylation of Stat1 on serine 727, does not mediate IFN-dependent phosphorylation of the protein (40). We have previously also established that the p38 MAP kinase does not function as a serine kinase for Stat1 in a large number of cell lines (16), indicating that it is not the IFN-activated serine kinase that phosphorylates Stat1. Also, although the Type I IFN receptor activates the PI3-kinase pathway (6-8), it does not appear to induce the kinase activity of Akt (42), which is the downstream effector for PI3-kinase-dependent Stat1 serine phosphorylation by the IFN receptor (41). Thus, it is possible that the Type I and II interferon receptors utilize different pathways to regulate serine phosphorylation of Stat1, a finding that is not surprising when the heterogeneity of the pathways that regulate STAT serine phosphorylation in response to other cytokines and extracellular stimuli is taken into account (43-47). However, it is possible that IFN also activates PKC- or another member of the PKC superfamily to act as a Stat1 serine kinase downstream of PI3'-kinase, especially when the regulatory effects that the PI3'-kinase pathway exhibits on the activation of members of the PKC family in other systems are taken into account (48-54); this remains to be determined in future studies. Nevertheless, it is possible that, in contrast to the Type II IFN system, the positive regulatory effects of PKC- on the Type I IFN activation of p38 may be more important than the phosphorylation of Stat1 on serine 727 for the generation of some Type I IFN biological responses. This is because p38 exhibits strong regulatory effects on IFN-dependent gene transcription via the promoters of essentially all Type I IFN-dependent genes, as all of them contain ISRE or GAS elements or both in their promoters. On the other hand, serine phosphorylation of Stat1 is important for Type I IFN-dependent gene transcription via GAS elements but may not be essential for ISGF3-dependent gene transcription, in which case the Stat2 transactivation domain plays the predominant role and the C terminus of Stat1 is not required (17). Thus, the suppressive effects of PKC- inhibition on Type I IFN-dependent gene transcription via ISRE elements may be mediated primarily via blockade of downstream activation of the p38 pathway, and this remains to be determined in future studies.

Future studies should also define the motifs in Stat1 that are required for its interaction with PKC- during IFN-stimulation, as well as the role that the Type I IFN-receptor associated JAK kinases play in the induction of such events. A recent study has demonstrated that PP2, a Src kinase inhibitor, blocks the IFN/-induced serine phosphorylation of Stat1 (25), suggesting that an Src kinase is involved in the pathway that ultimately regulates PKC- activation and Stat1 serine phosphorylation. Other studies have shown that two members of the Src family of kinases, Fyn (55) and Lyn (56), interact via their SH2 (Src homology 2) domains with the Type I IFN receptor associated Tyk-2 kinase to be engaged in IFN signaling. Thus, it is possible that the regulation of PKC- pathway in response to IFN-stimulation is ultimately regulated by the Tyk-2 kinase via activation of Fyn, Lyn, or other Src kinases, but this remains to be determined in future studies.

	ACKNOWLEDGEMENTS

We thank Drs. Richard Pine and Christopher Glass for providing us with the ISRE and 8X-GAS luciferase constructs, respectively. We also thank Dr. I. Bernard Weinstein for providing the PKC- and PKC- kinase-inactive mutant cDNAs.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants CA77816 and CA73381 (to L. C. P.), a Merit Review grant from the Department of Veterans Affairs (to L. C. P.), and Canadian Institutes of Health Research Grant MOP15094 (to E. N. F.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Section of Hematology-Oncology, University of Illinois at Chicago, MBRB, MC-734, Rm. 3150, 900 S. Ashland Ave, Chicago, IL 60607. Tel.: 312-355-0155; Fax: 312-413-7963; E-mail: Lplatani@uic.edu.

Published, JBC Papers in Press, February 11, 2002, DOI 10.1074/jbc.M109671200

	ABBREVIATIONS

The abbreviations used are: IFN, interferon; JAK, Janus kinase; STAT, signal transducer and activator of transcription; MAP, mitogen-activated protein; PKC, protein kinase C; ISRE, interferon-stimulated response element; GAS, IFN-activated site; GDAC, genomic DNA affinity chromatography; IL-6, interleukin 6; PI3'-kinase, phosphatidylinositol 3'-kinase; MAP, mitogen-activated protein kinase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES