JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M111842200 on February 4, 2002

J. Biol. Chem., Vol. 277, Issue 17, 14933-14941, April 26, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/17/14933    most recent
M111842200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suzuki, T.
Right arrow Articles by Hirai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suzuki, T.
Right arrow Articles by Hirai, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

MICAL, a Novel CasL Interacting Molecule, Associates with Vimentin*

Takahiro SuzukiDagger , Tetsuya NakamotoDagger , Seishi OgawaDagger , Sachiko SeoDagger , Tomoko MatsumuraDagger , Kouichi Tachibana§, Chikao Morimoto, and Hisamaru HiraiDagger ||

From the Dagger  Department of Hematology and Oncology, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-8655, the § Laboratory of Gene Function Analysis, Institute of Molecular and Cell Biology, National Institute of Advanced Industrial Science and Technology, Central-2 OSL-C2, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8568, and the  Department of Clinical Immunology and AIDS Research Center, Institute of Medical Science, University of Tokyo, 4-6-1 Shiroganedai, Minato-ku, Tokyo 108-8639, Japan

Received for publication, December 12, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

CasL/HEF1 belongs to the p130Cas family. It is tyrosine-phosphorylated following beta 1 integrin and/or T cell receptor stimulation and is thus considered to be important for immunological reactions. CasL has several structural motifs such as an SH3 domain and a substrate domain and interacts with many molecules through these motifs. To obtain more insights on the CasL-mediated signal transduction, we sought proteins that interact with the CasL SH3 domain by far Western screening, and we identified a novel human molecule, MICAL (a Molecule Interacting with CasL). MICAL is a protein of 118 kDa and is expressed in the thymus, lung, spleen, kidney, testis, and hematopoietic cells. MICAL has a calponin homology domain, a LIM domain, a putative leucine zipper motif, and a proline-rich PPKPP sequence. MICAL associates with CasL through this PPKPP sequence. MICAL is a cytoplasmic protein and colocalizes with CasL at the perinuclear area. Through the COOH-terminal region, MICAL also associates with vimentin that is a major component of intermediate filaments. Immunostaining revealed that MICAL localizes along with vimentin intermediate filaments. These results suggest that MICAL may be a cytoskeletal regulator that connects CasL to intermediate filaments.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

CasL (also known as HEF1) was originally identified as a highly phosphorylated protein of 105-kDa in human lymphocytes after beta 1 integrin stimulation (1-3). CasL is expressed preferentially in lymphocytes and several epithelial cells. It belongs to the p130Cas (Cas) family that includes Cas, CasL/HEF1, and Efs/Sin (4-6). They contain an SH3 domain at the NH2 terminus, followed by a substrate domain composed of a cluster of potential SH2-binding sites, and a COOH-terminal domain, which contains consensus binding motifs for the SH3 and SH2 domains of c-Src (CasL does not have binding motifs for c-Src SH3 domain). This structural profile indicates that the Cas family proteins serve as docking molecules that assemble and transduce intracellular signals.

Since Cas was the first characterized member of the Cas family proteins, the study of Cas is most advanced, and it has established a framework for the studies of the other family members. In fibroblasts, Cas has been shown to reside primarily at focal adhesions and along adhesion-proximal regions of stress fibers (7, 8), where Cas associates with focal adhesion kinase (FAK)1 (9). When cells attach to extracellular matrix proteins such as fibronectin, laminin, or vitronectin through integrin molecules, they form focal adhesion structures (also simply called "focal adhesions") at the adhesion sites. At focal adhesions, stress fibers are tethered, and a variety of molecules that mediate many cellular functions such as proliferation and migration are integrated (10, 11). Cas, localizing at focal adhesions, plays important roles in the integrin-induced signaling. By generating and examining Cas knockout mice, we have demonstrated that Cas is essential for bundling actin filaments and cellular transformation induced by the oncogenic Src (12).

Cytoskeletal system is essential for maintaining various cellular functions. In the mammalian cells, there are three types of cytoskeletal filaments, actin-containing microfilaments, tubulin-containing microtubules, and intermediate filaments (IFs). Among them, IFs are important for structure and mechanical integration of cellular space, and they are composed of cell type-specific proteins (13-17). Vimentin is one of such proteins and is a major component of IFs in cells of mesenchymal tissues.

Recently, an increasing number of studies are reported on the CasL-mediated functions. As suggested by its structural similarity to Cas, CasL is considered to be important for beta 1 integrin-induced signal transduction and cytoskeletal regulation (18). In T lymphocytes, CasL also plays a critical role in T cell receptor (TCR)-induced migration (19).

These CasL (or Cas)-mediated functions are carried out by its interaction with many molecules. CasL has several domains that interact with other molecules, such as the SH3 and the substrate domain. The SH3 domain of CasL interacts with FAK or Pyk2/Cakbeta /RAFTK/CADTK, and this interaction is considered to be one of the triggers of the signal transduction following beta 1 integrin stimulation (3, 20-22). In the case of Cas, however, not only FAK or Pyk2 but also several other molecules such as PTP-1B (23), PTP-PEST (24), C3G (25), and CIZ (26) are demonstrated to interact with its SH3 domain, and they mediate cellular functions. Therefore, there may exist other unknown SH3-binding molecules and pathways in the CasL-mediated signal transduction. With this point of view, we sought molecules that interact with the CasL SH3 domain by far Western screening, and we identified a novel molecule that interacts with CasL. We also found that this molecule associates with vimentin and that it could be a regulational component of vimentin filaments.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cells and Reagents-- The human T cell lines H9, Jurkat, and other hematopoietic cell lines HL60 and HEL cells were cultured in RPMI 1640 containing 10% heat-inactivated fetal calf serum. COS7, HeLa, and 293 cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal calf serum.

Rabbit antisera against MICAL C1 and C2 were obtained as described below. Polyclonal antibodies were purified from these antisera by affinity chromatography (HiTrap NHS-activated, Amersham Biosciences, described below). Mouse monoclonal antibody (mAb) V9 against vimentin and mAb M2 against the FLAG epitope were purchased from Sigma. Rabbit polyclonal antibody HA.11 against the hemagglutinin (HA) epitope was obtained from Babco. Goat polyclonal antibodies C-20 against vimentin and N-17 against CasL/HEF1 were purchased from Santa Cruz Biotechnology. The mAb 9E10 against the Myc epitope was obtained by culturing 9E10 hybridomas in the non-serum culture system. Fluorescein isothiocyanate-conjugated anti-rabbit donkey antibody and Texas Red-conjugated anti-goat donkey antibody were purchased from The Jackson Laboratories. The human thymus 5'-STRETCH PLUS cDNA library (HL5010b) was purchased from CLONTECH and was used in the far Western screening.

Far Western Screening-- The cDNA fragment encoding the human CasL SH3 domain (amino acid residues 2-66) was generated by PCR using customized primers. BglII and EcoRI sites were added to the 5'- and 3'-ends and subcloned into the BamHI/EcoRI sites of pGEX-2TK (Amersham Biosciences) to generate pGEX2TK-CasL SH3. This plasmid was transfected into Escherichia coli cells, and the expressed proteins were purified using the glutathione-Sepharose 4B beads (Amersham Biosciences). They were labeled with 32P isotope by bovine heart kinase (Sigma) and used as the first probe.

Competent E. coli cells were infected with phages from the cDNA library (20,000 plaque-forming units/plate) and were incubated for 3 h at 43 °C. Then the Hybond-C-extra membranes (Amersham Biosciences) soaked in 10 mM isopropyl-1-thio-beta -D-galactopyranoside were overlaid on phage plaques for 4 h at 37 °C, and these membranes were blocked in TBST buffers (10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.05% Tween 20) containing 5% skim milk. The membranes were incubated with 0.75 µg of the isotope-labeled GST-CasL SH3 probe for 2 h at 25 °C, washed, and then autoradiographed (Eastman Kodak Co.).

Screening of a PAC Library and a Radiation Hybrid Panel Containing MICAL Gene-- To obtain a genomic fragment containing the MICAL gene, a PAC library, RPCI-1 (Roswell Park Cancer Institute) was screened by the PCR method with a pair of MICAL cDNA-specific primers, P1 and P2 (described below), and we obtained clone 231G18.

To identify the chromosomal location of the MICAL gene, we screened a Radiation Hybrid Panel, GeneBridge 4 (Research Genetics), by PCR with the same primers P1 and P2. The results were analyzed by the manufacturer.

Reverse Transcriptase-PCR-- Total RNA was extracted from freshly prepared H9 cells by the acid guanidine/phenol chloroform method, and a poly(A) RNA-rich fraction was prepared by the poly(A) selection procedure (Oligotex-dT30 super, Roche Molecular Biochemicals). This RNA fraction was subjected to reverse transcription reaction with a gene-specific primer P3 by heat-resistant reverse transcriptase (Thermoscript, Invitrogen) at 62 °C. We carried out the first PCR on this synthesized cDNA with primers P4 and P6 followed by the second PCR with primers P5 and P6 at the presence of 5% Me2SO.

The following MICAL gene-specific primers were used: P1, CTGCCCCAGTACCACAAGAT (corresponding to nucleotides 445-464); P2, GAGAACTTGGTGCGCTTTTC (nucleotides 652-671); P3, AGGTGGAGCACGTTGTGGCGAGAG (nucleotides 669-692); P4, CCCAAGACTGTCCCCGCTGGAG (nucleotides 1-22); P5, GCTGGAGGCGGTAGAGGGAT (nucleotides 16-35); and P6, CAGCAGCTGGGCAGAGACGAGT (nucleotides 272-293).

Northern Blotting-- A poly(A) RNA fraction was obtained from freshly prepared murine tissues or cultured cells as described above. Two µg of this RNA fraction was loaded, electrophoresed, and hybridized with the isotope-labeled MICAL cDNA fragment.

Generation of Antibodies against Bacterially Expressed MICAL-- The cDNA fragments corresponding to the amino acid residues 884-1063 (C1) and 999-1063 (C2) of MICAL were generated by PCR, and they were inserted into pGEX1 (Amersham Biosciences) to generate GST-MICAL C1 and GST-MICAL C2 constructs. These plasmids were transfected into E. coli cells, and expressed fusion proteins were purified. Rabbits were immunized with these fusion proteins, and antisera against these antigens were raised (anti-MICAL C1 and anti-MICAL C2). The antisera were purified by affinity chromatography. At first, the antisera were passed through the GST-conjugated column removing anti-GST antibodies. The flow-through fraction was then applied onto the antigen-conjugated column, and specific antibodies bound to the column were eluted out and collected.

Plasmid Construction of Expressing Vectors and Transient Transfection-- The cDNA for HA tag or FLAG tag was added to the 3' terminus of the coding sequence of MICAL, and this was inserted into pUC-CAGGS (27) or pSSRalpha bsr (28) vectors, generating pUC-CAGGS/MICAL-HA and pSSRalpha bsr/MICAL-FLAG. To make mMICAL mutant, the cDNA sequence CCACCCAAGCCT (corresponding to amino acid sequence PPKP) was mutated to CCACCGGCGCCT (PPAP) by in vitro mutagenesis with the Chameleon Double-stranded, Site-directed Mutagenesis Kit (Stratagene). The FLAG tag sequence was added to its 3' terminus, and mMICAL-FLAG was inserted into the pSSRalpha bsr vector. To generate M1, M2, M3, and M4 mutants, cDNA fragments corresponding to each mutant protein were generated by PCR using specific primers, and the M5 mutant was generated by PCR-based mutagenesis (ExSite PCR-based Site-directed Mutagenesis Kit, Stratagene). Generated cDNA fragments were ligated with the HA tag sequence, and they were inserted into the pSSRalpha bsr vector. The generation of c-Myc-tagged CasL was described previously (20). To generate the FLAG-tagged vimentin expression vector, the FLAG tag sequence was ligated to the end of the murine vimentin sequence, and this DNA fragment was inserted into the pUC-CAGGS vector.

These expression vectors were transfected into COS7 cells by the DEAE-dextran method essentially as described previously (29).

Cell Lysis, Immunoprecipitation, and Immunoblotting-- Cells were lysed in 1% Triton X-100 buffer (10 mM Tris-HCl (pH 7.4), 5 mM EDTA, 150 mM NaCl, 1% Triton X-100). Cell lysates were incubated with indicated antibodies for 1 h at 4 °C, followed by additional incubation with the protein A- or protein G-Sepharose beads (Amersham Biosciences). The beads were washed with 1% Triton X-100 buffer and treated with sample buffer (2% SDS, 10% glycerol, 60 mM Tris-HCl (pH 6.8), 0.001% bromphenol blue). Samples were subjected to SDS-PAGE. The electrophoresed proteins were transferred to polyvinylidene difluoride filters (Millipore) and were subjected to immunoblotting, followed by detection with the alkaline phosphatase-conjugated secondary antibody (Promega).

Immunofluorescence Microscopy-- Cells were grown on a cover glass. They were fixed with 3.7% formaldehyde and permeabilized with 0.2% Triton X-100, and they were blocked in phosphate-buffered saline with 1% bovine serum albumin (Nacalai Tesque, Kyoto, Japan). After incubation with the primary and the secondary antibodies for 1 h at room temperature, the samples were mounted in a 1:1 mixture of 2.5% 1,4-diazabicyclo[2.2.2]octane (Sigma) in phosphate-buffered saline and glycerol. The cells were observed under the MRC1024 confocal microscopic system (Bio-Rad).

In Vitro Pull-down Assay-- For pull-down assay, expressed GST fusion proteins were incubated with the glutathione-Sepharose 4B beads (Amersham Biosciences) for 1 h at 4 °C for immobilization. We prepared aliquots of cell lysates from COS7 cells transfected with MICAL and mMICAL constructs, and these aliquots were incubated with the beads for 1 h, and the proteins bound to the beads were analyzed by immunoblotting. Ten percent of the immobilized proteins were subjected to Coomassie Brilliant Blue stain, and we confirmed that an almost equal volume of GST fusion proteins was loaded. The GST-p130Cas SH3 fusion protein encodes amino acid residues 6-64 of p130Cas. The details of the GST-Crk SH3, GST-Abl SH3, GST-Grb2 SH3, and GST-Src SH3 constructs were described previously (29).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isolation and Structure Analysis of MICAL-- Isotope-labeled GST-CasL SH3 fusion protein was used as a probe for the far Western screening to screen a lambda gt11 cDNA expression library (CLONTECH) that was derived from normal human thymuses. Approximately 1.5 million phages were screened, and we obtained 8 discrete positive clones. Among them, one clone was identified as FAK, one as PTP-1B, two clones as PTP-PEST, and two as C3G; these molecules have already been known to interact with the Cas SH3 domain (9, 23-25). The other two clones contained an overlapping part of the same unknown gene. To obtain more information on this unknown gene, we continued serial screening procedures using the identified cDNA fragments as probes by the DNA hybridization method. Consequently, we could obtain one conceptional cDNA sequence. However, as the deduced start codon (ATG) of this cDNA did not meet the "Kozak's rule" (30) optimally, we searched for a potential upstream coding region. We screened a PAC genomic library, and obtained a PAC clone, RPCI-1 231G18, that harbored this unknown gene. Sequence analysis of this genomic fragment revealed that an intron sequence was inserted between the cDNA nucleotide 268 and 269 (Fig. 1A), and we obtained an additional 5'-side genomic nucleotide sequence. To examine if this 5'-side genomic region is transcribed into mRNA, we prepared three kinds of primers, P4, P5, and P6 (described under "Experimental Procedures"), and we carried out reverse transcriptase-PCR for the mRNA extracted from the human T lymphocyte cell line, H9. Because the nucleotide component around the target region was extremely GC-rich, we carried out reverse transcription at 62 °C with thermoresistant reverse transcriptase. Then we performed the first PCR with P4 and P6 primers and the second PCR with P5 and P6 primers in the presence of 5% Me2SO. Consequently, we obtained an amplified fragment at the size of ~280 bp, and the sequence analysis of this fragment revealed that this fragment did not contain any intron sequences. These results suggest that this amplified fragment was derived from mRNA and that it was a part of the cDNA. Because this cDNA sequence contained an in-frame stop codon at the nucleotide 48 (Fig. 1A), we concluded that we obtained the full-length coding region of this unknown gene.



View larger version (118K):
[in this window]
[in a new window]
 
Fig. 1.   Nucleotide and predicted amino acid sequences of human MICAL and its schematic representation. A, nucleotide and predicted amino acid (single-letter code) sequences of human MICAL are presented. Sequence numbers are shown on the right. Shown in lowercase letters are non-coding regions. Amino acid residues corresponding to the calponin homology domain, the LIM domain, and the putative leucine zipper motif are underlined with single lines, bold lines, and double lines, respectively. The boxed amino acid residues represent the proline-rich sequence that is responsible for CasL SH3 binding. The "/" in the 5'-side non-coding region indicates the in-frame stop codon, and the asterisk indicates the stop codon of the open reading frame. B, schematic representation of the human MICAL and the KIAA0750/MICAL-2 molecules. MICAL consists of a calponin homology domain (CH), a LIM domain (LIM), a proline-rich region (PR), and a putative leucine zipper motif (L-Zip). KIAA0750/MICAL-2 is a protein composed of 1124 amino acids, and it has homology with MICAL by 65 (NH2-terminal half) to 35% (COOH-terminal region). Unlike MICAL, MICAL-2 has neither proline rich regions nor L-Zip motifs. The numbers in the scheme indicate amino acid numbers. The C1 and C2 lines indicate regions used for generating polyclonal antisera.

The cDNA of this newly isolated gene consists of ~3700-bp nucleotides, which corresponds to the result of the Northern blotting described below. Molecular mass of the translated protein is predicted to be 118 kDa composed of 1067 amino acids. Search of the GenBankTM data base showed that this isolated gene encodes a novel molecule, and its amino acid sequence has prominent homology with that of KIAA0750 (35~65% homology) which had been isolated from the human brain (Fig. 1B) (31). This data base also told us that MICAL has homology with KIAA1364 derived from human brain by 50-63%. At present, the complete cDNA sequence of KIAA1364 is not determined.

Sequence analysis of this novel molecule indicates that it contains a calponin homology (CH) domain in the central region followed by a LIM domain. In addition, a proline-rich region (Pro-Pro-Lys-Pro-Pro, PPKPP) and a putative leucine zipper (L-Zip) motif are located at the COOH terminus. Because this novel molecule interacts with CasL (described below), we named this novel molecule "MICAL," for a Molecule Interacting with CasL. We also call the KIAA0750 molecule "MICAL-2" based on its homology. Whereas the MICAL-2/KIAA0750 molecule has a CH domain and a LIM domain, it does not have any L-Zip motifs or PPKPP sequences.

To determine the chromosomal location of the MICAL gene, we screened a Radiation Hybrid Panel following the manufacturer's instruction. The result showed that MICAL is located on the long arm of chromosome 6, 6q16.

MICAL Is Expressed in Hematopoietic Cells and Other Specific Tissues-- To assess the expression profile of the MICAL mRNA, we examined various hematopoietic cell lines and murine tissues by Northern blotting. We detected a single discrete transcript of ~3.7 kb in the hematopoietic cell lines Jurkat, HL60, and HEL (Fig. 2A). Although we could find another larger transcript in HEL cells, the main transcript was ~3.7 kb. Northern blotting of the various murine tissues revealed that MICAL mRNA expression is restricted to the several specific tissues; we could find prominent expression in the thymus, lung, spleen, and testis and faint expression in the kidney (Fig. 2B), whereas no obvious expression was detected in the brain, heart, and liver. Even though the size of the transcript in the testis seemed to be slightly larger than 3.7 kb, this may be a spliced variant.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 2.   Expression profiles of MICAL mRNA. A, Northern blot analysis of the poly(A) RNA from several hematopoietic cell lines. The electrophoresed poly(A) RNA was hybridized with the 32P-labeled MICAL cDNA clone initially isolated in the far Western screening. There is a discrete band at ~3.7 kb (arrowhead). This probe cross-reacts with the 18 S rRNA. The ethidium bromide (EtBr) staining of the electrophoresed RNA is shown in the lower panel. B, Northern blot analysis of the poly(A) RNA from adult murine tissues hybridized by the same MICAL cDNA probe. MICAL mRNA is detected in the thymus, lung, spleen, kidney, and testis (arrowhead).

It has been reported that CasL is expressed prominently in the lung, kidney, placenta, and lymphocytes (2, 3). The expression pattern of MICAL corresponds to that of CasL, and this accordance supports the biological relationship between the two molecules.

Generation of Polyclonal Antibodies and Detection of MICAL Proteins-- To characterize MICAL protein, we generated polyclonal antibodies against MICAL. We used COOH-terminal regions as immunogens, C1 region spanning amino acid residues 884-1063 and C2 region spanning residues 999-1063. We immunized rabbits and obtained antisera to each antigen (anti-MICAL C1 and anti-MICAL C2). The antisera were purified by affinity chromatography, and we generated specific antibodies. To check the quality of these antibodies and to detect MICAL proteins, we performed an immunoblot assay. We used lysates from COS7 cells transiently transfected with pSSRalpha bsr/MICAL and lysates from normally growing HeLa, 293, H9, and Jurkat cells. By using both antibodies, we could find endogenous expression of MICAL at the size of ~120 kDa in the HeLa, 293, H9, and Jurkat cells and prominent expression in the transfected COS7 cells (Fig. 3).


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 3.   Detection of the MICAL proteins. Cell lysates from COS7 (lane 1), COS7 transfected with pSSRalpha /MICAL (lane 2), HeLa (lane 3), 293 (lane 4), H9 (lane 5), and Jurkat (lane 6) cells were subjected to immunoblotting with affinity-purified anti-MICAL C2 antibody. MICAL is detected as a single band of ~120 kDa (arrowhead). In the COS7 cells transfected with pSSRalpha /MICAL, prominent expression can be detected. WB, Western blot.

MICAL Interacts with the CasL SH3 Domain through the PPKPP Proline-rich Sequence-- To test the in vivo interaction between MICAL and CasL, we analyzed their interaction by transiently coexpressing MICAL and CasL proteins in COS7 cells. When we cotransfected the FLAG-tagged MICAL (MICAL-FLAG) together with the Myc-tagged CasL (Myc-CasL), we could detect CasL in the anti-FLAG immunoprecipitates containing MICAL proteins (Fig. 4A). Alternatively, we were able to find MICAL in the anti-Myc immunoprecipitates containing CasL proteins (Fig. 4A). These results indicate that these two proteins can make a complex in mammalian cells in vivo.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4.   MICAL and CasL associate with each other through their PPKPP sequence and SH3 domain, respectively. A, COS7 cells were transiently transfected with the MICAL-FLAG and/or the Myc-CasL expression vectors, and cell lysates were immunoprecipitated (IP) with the anti-FLAG or the anti-Myc antibodies. In the cells transfected with both constructs (lane 4), CasL was detected in the anti-FLAG immunoprecipitate (black arrowheads), and MICAL was detected in the anti-Myc immunoprecipitate (white arrowhead). B, COS7 cells were transiently transfected with the MICAL-FLAG and/or the Myc-Delta SH3 CasL expression vectors, and cell lysates were immunoprecipitated with the anti-FLAG or the anti-Myc antibodies. We could find neither Delta SH3 CasL in the anti-FLAG immunoprecipitate nor MICAL in the anti-Myc immunoprecipitate (lane 4). C, schematic representation of the MICAL-FLAG and the mutated MICAL-FLAG (mMICAL-FLAG) molecules. In the mMICAL-FLAG molecule, the single lysine residue in the proline-rich region is replaced by alanine. D, several GST-SH3 fusion proteins were incubated with cell lysates containing MICAL-FLAG or mMICAL-FLAG, and they were subjected to immunoblotting. MICAL was clearly detected (arrow) in the complexes containing the GST-CasL SH3 (lane 6) and the GST-Cas SH3 (lane 5) fusion proteins. However, only faint volume of MICAL was found in the complexes containing the GST-Src SH3 (lane 1), GST-Grb2 SH3 (lane 2), GST-Abl SH3 (lane 3), and GST-Crk SH3 (lane 4) fusion proteins. In the mMICAL-FLAG lysate, no complex formation was detectable (lanes 8-10). In lanes 11 and 12, total cell lysates containing MICAL- and mMICAL-FLAG were loaded. Lower panel shows the Coomassie Brilliant Blue staining of the GST-SH3 fusion proteins. This shows that almost equal volume of GST fusion proteins were loaded in the reaction. WB, Western blot.

To confirm that MICAL and CasL interact with each other through the CasL SH3 domain, we cotransfected MICAL-FLAG together with the Myc-tagged CasL whose SH3 domain was deleted (Myc-Delta SH3 CasL) and performed immunoprecipitation. In this experiment, we could not find Myc-Delta SH3 CasL in the anti-FLAG immunoprecipitates nor MICAL-FLAG in the anti-Myc immunoprecipitates (Fig. 4B). This result indicates that MICAL and CasL interact through the CasL SH3 domain.

This interaction was also demonstrated by the in vitro pull-down assay. We immobilized various GST-SH3 fusion proteins on the glutathione-Sepharose beads and incubated them with COS7 cell lysates expressing MICAL-FLAG. As shown in Fig. 4D, we could detect prominent existence of MICAL in the complex that contains the CasL SH3 domain or Cas SH3 domain, whereas only faint MICAL bands were observed in the Src SH3, Grb2 SH3, Abl SH3, or Crk SH3 containing complex. This result shows that MICAL preferentially interacts with the CasL (or p130Cas) SH3 domain.

It has been reported that the Cas SH3 domain preferentially binds to "Pro-X-Lys-Pro, PXKP" (X, any amino acid) sequence (25). Because MICAL has a consensus sequence of "PPKPP" at the COOH terminus, we examined whether MICAL interacts with the CasL SH3 domain through this proline-rich sequence. We constructed a mutant, mMICAL-FLAG, whose proline-rich sequence PPKPP (amino acid residues 830-834) was mutated into PPAPP (Fig. 4C). When we incubated the immobilized GST-CasL SH3 and GST-Cas SH3 fusion proteins with lysates of COS7 cells expressing mMICAL-FLAG, we could not find mMICAL proteins in the complexes (Fig. 4D). These results indicate that MICAL interacts with the CasL and Cas SH3 domains through the PPKPP sequence.

MICAL Is a Cytoplasmic Protein and Colocalizes with CasL at the Perinuclear Region-- To examine the intracellular distribution of the MICAL molecule, we performed immunofluorescence staining with the purified anti-MICAL C2 antibody. MICAL localized in the cytoplasm like filaments or meshes, and this filamentous structure spread from the perinuclear area toward the cell periphery (Fig. 5, a and e). When we stained the CasL molecule, CasL also localized all over the cytoplasm but distributed preferentially to the perinuclear area and the edge of the cell periphery (Fig. 5b). We could readily find the colocalization signals of MICAL and CasL at the perinuclear area (Fig. 5c). These results suggest that there are biological interactions between MICAL and CasL in living cells.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5.   MICAL localizes in the cytoplasm and colocalizes with CasL and vimentin. Cells were costained with the purified anti-MICAL C2 antibody and the anti-CasL/HEF1 or the anti-vimentin antibodies. In HeLa cells, MICAL localizes in the cytoplasm-like filaments or meshes, and this filamentous structure spreads from the perinuclear area toward the cell periphery (a and e). Similarly, CasL localizes all over the cytoplasm, and it is distributed preferably to the perinuclear area and the cell periphery (b). In the merged image, yellow colocalization signal is readily detected at the perinuclear area (c). In HeLa cells, vimentin is found in the cytoplasm as filamentous or mesh-like structures (f), and this localization pattern clearly overlaps with that of MICAL (g, yellow signal). This colocalization was most clear in 293 cells (i, j, and k). When cells were stained only with the second antibodies, no significant signals were observed (d, h, and l).

MICAL Also Colocalizes with Vimentin Intermediate Filaments-- MICAL is distributed in the cytoplasm-like filaments in HeLa cells. Because this staining pattern was similar to that of cytoskeletal structures, we examined subcellular localization of microfilaments (F-actin), microtubules (alpha -tubulin), or intermediate filaments (vimentin) by costaining these cytoskeletal molecules with MICAL. Double staining of these proteins revealed that the staining pattern of MICAL was mostly consistent with that of vimentin (Fig. 5, middle panel). This colocalization pattern was more apparent in 293 cells; MICAL was stained like mesh composed of fine filaments in the cytoplasm, and in many cells, strong signals were observed in the cell process areas (Fig. 5, lower panel). Therefore, MICAL was supposed to be an integrated component of vimentin intermediate filaments.

MICAL Associates with Vimentin through Its COOH-terminal Region-- To examine the possible interaction between MICAL and vimentin, we performed immunoprecipitation and immunoblotting. Prior to these experiments, we generated five deletion mutants of MICAL, M1-M5 (Fig. 6A). At first, we transfected COS7 cells with these mutants or wild-type (Wt) MICAL-HA constructs, and the cell lysates were subjected to immunoprecipitation with the anti-vimentin antibody. In this experiment, we could find M3-M5 and Wt molecules in the anti-vimentin immunoprecipitates (Fig. 6B, lanes 8-10 and 13), whereas M1 and M2 mutants were not found in these immunocomplexes (Fig. 6B, lanes 3 and 4). This result indicates that MICAL interacts with vimentin through its COOH-terminal region.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6.   MICAL interacts with vimentin molecule through its COOH-terminal region. A, schematic representation of the MICAL-HA mutants. Five HA-tagged mutants (M1-M5) and an HA-tagged wild-type MICAL (Wt) construct were generated. M1, NH3-terminal fragment to the CH domain; M2, NH3-terminal fragment to the LIM domain; M3, COOH-terminal fragment from the CH domain; M4, COOH-terminal fragment from the end of the LIM domain; M5, fragment from which the CH domain and the LIM domain are deleted. Numbers on the lines represent corresponding amino acid numbers. B, COS7 cells were transiently transfected with expression vectors encoding HA-tagged mutants, and cell lysates were subjected to immunoprecipitation (IP) with the anti-HA or the anti-vimentin antibodies. M3-M5 and Wt proteins were detected in the anti-vimentin immunoprecipitates (lanes 8, 13, 9, and 10), whereas M1 and M2 mutants were not found in the anti-vimentin immunoprecipitates (lanes 3 and 4). No Wt proteins were found in the fraction nonspecifically bound to the protein G-Sepharose (lane 11). Lanes 1, 2, 5-7, and 12 show expressed HA-tagged proteins, and black arrowheads in the lower panel point at the vimentin proteins in the immunoprecipitates (lanes 14-19). The white arrowhead in the lanes 12 and 13 indicates the M4 mutant. C, COS7 cells were transiently transfected with HA-tagged MICAL mu- tants (Wt or M2) and/or FLAG-tagged vimentin (Vim) expression vectors, and cell lysates were subjected to immunoprecipitation with the anti-HA antibody. In the cells transfected with Wt and vimentin (lane 5), vimentin was detected in the anti-HA immunoprecipitate (upper panel, black arrow), whereas in the cells expressing M2 and vimentin (lane 4), vimentin was not identified in the anti-HA immunoprecipitate. In the cells transfected with vimentin, M2, or M3 alone (lanes 1-3), we could not find any vimentin signals in the anti-HA immunoprecipitates. The black arrow in the middle panel indicates the expressed vimentin proteins (lanes 1, 4, and 5), and the lower panel shows the expression of Wt (lanes 3 and 5) or M2 (lanes 2 and 4) proteins. WB, Western blot.

To confirm this interaction between MICAL and vimentin, we cotransfected COS7 cells with FLAG-tagged vimentin and MICAL M2 or Wt constructs, and the cell lysates were immunoprecipitated with the anti-HA antibody. As a result, we identified the Wt molecule in the anti-FLAG immunoprecipitate (Fig. 6C, lane 5), whereas M2 molecule was not found in the complex (Fig. 6C, lane 4).

These results clearly show that MICAL and vimentin make complexes in living cells and that this interaction is mediated through the COOH-terminal region of MICAL.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, we identified a novel molecule, MICAL, as a potential CasL-interacting protein by far Western screening. MICAL is preferentially expressed in hematopoietic cells and several specific tissues. MICAL contains some discrete domains that include a CH domain, a LIM domain, and a proline-rich motif. We cannot predict any enzymatically functional domains from its primary sequence.

SH3 domains bind proline-rich motifs with the core consensus sequence PXXP (32). Amino acid residues immediately adjacent to the proline residues seem to be significant for binding specificity to different SH3 domains (33, 34). Several consensus sequences binding to the Cas SH3 domain have been reported, and one of them is PPKPP (25). MICAL has this sequence at the COOH terminus, and we demonstrated their in vivo interaction. Moreover, in this screening, we identified other molecules, PTP-1B, PTP-PEST, FAK, and C3G, as CasL SH3-binding partners. These molecules have already been shown to interact with the Cas SH3 domain (9, 23-25). Because the SH3 domain of Cas and that of CasL have amino acid homology by more than 80%, this similarity in their binding partners seems reasonable.

CasL is a molecule that belongs to the Cas family and is important for TCR- and beta 1 integrin-induced immunological reactions such as interleukin-2 production (35) and migratory response (19). In HeLa cells, CasL localizes around the nucleus and at the cell periphery. Various reports have suggested that the Cas family proteins transduce signals to downstream pathways including mitogen-activated protein kinase and other cytoskeletal regulatory pathways (12, 18, 19, 36-38). In this report, we showed that a fraction of MICAL localizes at the perinuclear area and colocalizes with CasL. This result suggests that MICAL may play roles in the CasL-mediated signaling pathways.

In lymphocytes, ligation of TCR, B cell receptor, or beta 1 integrin induces prominent phosphorylation of CasL at its substrate domain. This is considered to be important for many immunological reactions (19, 21, 22, 35, 39). Therefore, we examined whether MICAL could be phosphorylated at tyrosine residues after TCR or beta 1 integrin ligation. However, we could not find any obvious tyrosine phosphorylation (data not shown). MICAL may not be a target of phosphorylation by tyrosine kinases.

In addition to the interaction with CasL, we demonstrated that MICAL associates with vimentin molecules and colocalizes with vimentin IFs in vivo. In mammalian cells, IFs belong to one of the three major classes of cytoskeletal filaments, and they are important for maintaining mechanical integration. There are many kinds of IF proteins, and their expression is tissue-specific. Among them, vimentin is a major component of IFs in cells of mesenchymal origin. Even though the exact roles of vimentin are not determined yet, the analyses of the null mutant mice have revealed several defective phenotypes as follows: deficiencies in the modulation of vascular tuning (40), deficiencies in the mechanotransduction of shear stress (41), a cerebellar defect and impaired motor coordination (42), and impaired migration of fibroblasts into the wound sites (43). These results show that vimentin is necessary for maintaining mechanical flexibility of a cell.

Immunostaining demonstrated that the localization pattern of MICAL overlaps significantly with vimentin filaments in HeLa and 293 cells. Therefore, it is strongly suggested that MICAL is associated with vimentin filaments and that MICAL is one of the vimentin filament-associated proteins. There are many IF-associated proteins. Among them are plectin (44), fimbrin (45), calponin (46), MAP-2 (47), and bullous pemphigoid antigen-1 (BPAG-1) (48). These molecules have a binding capacity to IFs and are supposed to be important for maintaining cytoskeletal integrity. MICAL is also expected to be a member of these "IF-associated cytoskeletal integrators."

MICAL associates with CasL and vimentin. CasL is a downstream mediator of integrin-mediated signals and is important for cytoskeletal regulation. Although the exact biological functions of MICAL remain to be determined, the results suggest that MICAL could be a regulatory mediator that may transduce signals for IF regulation. Until now, several reports (49-51) have been made concerning the relationship between the integrin-mediated signal transduction and the regulation of IFs. Wu et al. (49) reported that integrin-associated protein (IAP/CD47) and proteins linking IAP with cytoskeleton mediate signals between integrins and vimentin IFs. Modulation of these molecules influences the distribution pattern of vimentin and cell spreading. Plectin is also known as a linker molecule bridging integrins and IFs and is essential for hemidesmosome integrity and stabilization (50). Moreover, Sin et al. (51) suggested that vimentin IFs may be the reservoir of RhoA-binding kinase alpha  (ROKalpha ), which is a putative effector of RhoA, and may be regulated by integrin-mediated signals. Because our immunofluorescence study did not identify MICAL at the cell periphery, it may be difficult to expect the close biological interactions between MICAL and integrins. However, it is possible that MICAL may mediate further downstream signals via CasL.

We showed that MICAL associates with vimentin through the COOH-terminal region. Biological functions of other motifs, the CH domain and the LIM domain, remain to be elucidated. The CH domain was originally identified as a conserved motif in the calponin family proteins, and this motif is also present in a variety of other molecules, e.g. Vav and IQGAP-1 or -2. (52). Although our consensus for its biological function has not been completely settled, this domain is thought to be important as an actin-binding or IF-binding motif (45, 46, 52, 53), and it is suggested that a single CH domain may work as the interaction site with vimentin or other IF proteins. However, as for MICAL, the interpretation for this hypothesis is somewhat dazzling. We have found that bacterially expressed GST-MICAL CH domain fusion proteins can effectively make complexes with vimentin molecules in vitro (data not shown), whereas in the immunoprecipitation assay, we found that this region is not necessary for their interaction. Although we do not know the exact reason, their interaction may be interfered with by the structural conformation of other regions.

MICAL has one LIM domain in its central region. The LIM domain is a member of the Zn2+ finger motifs, and it is specified by its cysteine richness. LIM domains are found in many cytoplasmic and nuclear proteins, and they are supposed to be important for protein-protein interactions. Among the cytoplasmic LIM-containing proteins, many cytoskeletal regulatory molecules such as Paxillin, Zyxin, or Enigma are known, and it is anticipated that some biological functions of these molecules are mediated through LIM domains. Because MICAL is expected to be a possible cytoskeletal player, further investigation on this domain may reveal novel insights on this molecule.

In this study, we identified a novel molecule, MICAL, which may connect CasL and vimentin IFs. Until now, other related molecules, KIAA0750 (MICAL-2) and KIAA1364, have been identified from the human brain. Because these molecules show significant homology, we may call them "MICAL family proteins." At present, we know little about these molecules, and we are making further studies to clarify their functions. Finding more about the MICAL family proteins must provide important insights into the cellular biology.

    ACKNOWLEDGEMENT

We thank Dr. Masaki Inagaki (Aichi Cancer Center Research Institute, Japan) for kindly providing us with murine vimentin cDNA.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB048948.

|| To whom correspondence should be addressed: Dept. of Hematology and Oncology, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-8655, Japan. Tel.: 81-3-5800-6421; Fax: 81-3-5689-7286; E-mail: hhirai-tky@umin.ac.jp.

Published, JBC Papers in Press, February 4, 2002, DOI 10.1074/jbc.M111842200

    ABBREVIATIONS

The abbreviations used are: FAK, focal adhesion kinase; SH, Src homology; GST, glutathione S-transferase; IFs, intermediate filaments; TCR, T cell receptor; HA, hemagglutinin; CH, calponin homology; Wt, wild type; mAb, monoclonal antibody; L-Zip, leucine zipper.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Nojima, Y., Rothstein, D. M., Sugita, K., Schlossman, S. F., and Morimoto, C. (1992) J. Exp. Med. 175, 1045-1053[Abstract/Free Full Text]
2. Minegishi, M., Tachibana, K., Sato, T., Iwata, S., Nojima, Y., and Morimoto, C. (1996) J. Exp. Med. 184, 1365-1375[Abstract/Free Full Text]
3. Law, S. F., Estojak, J., Wang, B., Mysliwiec, T., Kruh, G., and Golemis, E. A. (1996) Mol. Cell. Biol. 16, 3327-3337[Abstract]
4. Sakai, R., Iwamatsu, A., Hirano, N., Ogawa, S., Tanaka, T., Mano, H., Yazaki, Y., and Hirai, H. (1994) EMBO J. 13, 3748-3756[Medline] [Order article via Infotrieve]
5. Ishino, M., Ohba, T., Sasaki, H., and Sasaki, T. (1995) Oncogene 11, 2331-2338[Medline] [Order article via Infotrieve]
6. Alexandropoulos, K., and Baltimore, D. (1996) Genes Dev. 10, 1341-1355[Abstract/Free Full Text]
7. Petch, L. A., Bockholt, S. M., Bouton, A., Parsons, J. T., and Burridge, K. (1995) J. Cell Sci. 108, 1371-1379[Abstract]
8. Nakamoto, T., Sakai, R., Honda, H., Ogawa, S., Ueno, H., Suzuki, T., Aizawa, S., Yazaki, Y., and Hirai, H. (1997) Mol. Cell. Biol. 17, 3884-3897[Abstract]
9. Polte, T. R., and Hanks, S. K. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10678-10682[Abstract/Free Full Text]
10. Burridge, K., Fath, K., Kelly, T., Nuckolls, G., and Turner, C. (1988) Annu. Rev. Cell Biol. 4, 487-525[CrossRef][Medline] [Order article via Infotrieve]
11. Clark, E. A., and Brugge, J. S. (1995) Science 268, 233-239[Abstract/Free Full Text]
12. Honda, H., Oda, H., Nakamoto, T., Honda, Z., Sakai, R., Suzuki, T., Saito, T., Nakamura, K., Nakao, K., Ishikawa, T., Katsuki, M., Yazaki, Y., and Hirai, H. (1998) Nat. Genet. 19, 361-365[CrossRef][Medline] [Order article via Infotrieve]
13. Steinert, P. M., and Roop, D. R. (1988) Annu. Rev. Biochem. 57, 593-625[CrossRef][Medline] [Order article via Infotrieve]
14. Robson, R. M. (1989) Curr. Opin. Cell Biol. 1, 36-43[CrossRef][Medline] [Order article via Infotrieve]
15. Fuchs, E., and Weber, K. (1994) Annu. Rev. Biochem. 63, 345-382[Medline] [Order article via Infotrieve]
16. Fuchs, E., and Cleveland, D. W. (1998) Science 279, 514-519[Abstract/Free Full Text]
17. Galou, M., Gao, J., Humbert, J., Mericskay, M., Li, Z., Paulin, D., and Vicart, P. (1997) Biol. Cell 89, 85-97[CrossRef][Medline] [Order article via Infotrieve]
18. Sattler, M., Salgia, R., Shrikhande, G., Verma, S., Uemura, N., Law, S. F., Golemis, E. A., and Griffin, J. D. (1997) J. Biol. Chem. 272, 14320-14326[Abstract/Free Full Text]
19. Ohashi, Y., Iwata, S., Kamiguchi, K., and Morimoto, C. (1999) J. Immunol. 163, 3727-3734[Abstract/Free Full Text]
20. Tachibana, K., Urano, T., Fujita, H., Ohashi, Y., Kamiguchi, K., Iwata, S., Hirai, H., and Morimoto, C. (1997) J. Biol. Chem. 272, 29083-29090[Abstract/Free Full Text]
21. Manie, S. N., Beck, A. R., Astier, A., Law, S. F., Canty, T., Hirai, H., Druker, B. J., Avraham, H., Haghayeghi, N., Sattler, M., Salgia, R., Griffin, J. D., Golemis, E. A., and Freedman, A. S. (1997) J. Biol. Chem. 272, 4230-4236[Abstract/Free Full Text]
22. Astier, A., Manie, S. N., Avraham, H., Hirai, H., Law, S. F., Zhang, Y., Golemis, E. A., Fu, Y., Druker, B. J., Haghayeghi, N., Freedman, A. S., and Avraham, S. (1997) J. Biol. Chem. 272, 19719-19724[Abstract/Free Full Text]
23. Liu, F., Hill, D. E., and Chernoff, J. (1996) J. Biol. Chem. 271, 31290-31295[Abstract/Free Full Text]
24. Garton, A. J., Burnham, M. R., Bouton, A. H., and Tonks, N. K. (1997) Oncogene 15, 877-885[CrossRef][Medline] [Order article via Infotrieve]
25. Kirsch, K. H., Georgescu, M. M., and Hanafusa, H. (1998) J. Biol. Chem. 273, 25673-25679[Abstract/Free Full Text]
26. Nakamoto, T., Yamagata, T., Sakai, R., Ogawa, S., Honda, H., Ueno, H., Hirano, N., Yazaki, Y., and Hirai, H. (2000) Mol. Cell. Biol. 20, 1649-1658[Abstract/Free Full Text]
27. Niwa, H., Yamamura, K., and Miyazaki, J. (1991) Gene (Amst.) 108, 193-199[CrossRef][Medline] [Order article via Infotrieve]
28. Ueno, H., Hirano, N., Kozutsumi, H., Sasaki, K., Tanaka, T., Yazaki, Y., and Hirai, H. (1995) J. Biol. Chem. 270, 20135-20142[Abstract/Free Full Text]
29. Nakamoto, T., Sakai, R., Ozawa, K., Yazaki, Y., and Hirai, H. (1996) J. Biol. Chem. 271, 8959-8965[Abstract/Free Full Text]
30. Kozak, M. (1986) Cell 44, 283-292[CrossRef][Medline] [Order article via Infotrieve]
31. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) DNA Res. 5, 277-286[Abstract]
32. Ren, R., Mayer, B. J., Cicchetti, P., and Baltimore, D. (1993) Science 259, 1157-1161[Abstract/Free Full Text]
33. Yu, H., Chen, J. K., Feng, S., Dalgarno, D. C., Brauer, A. W., and Schreiber, S. L. (1994) Cell 76, 933-945[CrossRef][Medline] [Order article via Infotrieve]
34. Sparks, A. B., Rider, J. E., Hoffman, N. G., Fowlkes, D. M., Quillam, L. A., and Kay, B. K. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1540-1544[Abstract/Free Full Text]
35. Kamiguchi, K., Tachibana, K., Iwata, S., Ohashi, Y., and Morimoto, C. (1999) J. Immunol. 163, 563-568[Abstract/Free Full Text]
36. Knudsen, B. S., Feller, S. M., and Hanafusa, H. (1994) J. Biol. Chem. 269, 32781-32787[Abstract/Free Full Text]
37. Smit, L., van der Horst, G., and Borst, J. (1996) J. Biol. Chem. 271, 8564-8569[Abstract/Free Full Text]
38. Tanaka, S., Morishita, T., Hashimoto, Y., Hattori, S., Nakamura, S., Shibuya, M., Matuoka, K., Takenawa, T., Kurata, T., Nagashima, K., and Matsuda, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3443-3447[Abstract/Free Full Text]
39. Kanda, H., Mimura, T., Morino, N., Hamasaki, K., Nakamoto, T., Hirai, H., Morimoto, C., Yazaki, Y., and Nojima, Y. (1997) Eur. J. Immunol. 27, 2113-2117[Medline] [Order article via Infotrieve]
40. Terzi, F., Henrion, D., Colucci-Guyon, E., Federici, P., Babinet, C., Levy, B. I., Briand, P., and Friedlander, G. (1997) J. Clin. Invest. 100, 1520-1528[Medline] [Order article via Infotrieve]
41. Henrion, D., Terzi, F., Matrougui, K., Duriez, M., Boulanger, C. M., Colucci-Guyon, E., Babinet, C., Briand, P., Friedlander, G., Poitevin, P., and Levy, B. I. (1997) J. Clin. Invest. 100, 2909-2914[Medline] [Order article via Infotrieve]
42. Colucci-Guyon, E., Gimenez, Y. R. M., Maurice, T., Babinet, C., and Privat, A. (1999) Glia 25, 33-43[CrossRef][Medline] [Order article via Infotrieve]
43. Eckes, B., Colucci-Guyon, E., Smola, H., Nodder, S., Babinet, C., Krieg, T., and Martin, P. (2000) J. Cell Sci. 113, 2455-2462[Abstract]
44. Foisner, R., Traub, P., and Wiche, G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3812-3816[Abstract/Free Full Text]
45. Correia, I., Chu, D., Chou, Y. H., Goldman, R. D., and Matsudaira, P. (1999) J. Cell Biol. 146, 831-842[Abstract/Free Full Text]
46. Mabuchi, K., Li, B., Ip, W., and Tao, T. (1997) J. Biol. Chem. 272, 22662-22666[Abstract/Free Full Text]
47. Hirokawa, N., Hisanaga, S., and Shiomura, Y. (1988) J. Neurosci. 8, 2769-2779[Abstract]
48. Yang, Y., Dowling, J., Yu, Q. C., Kouklis, P., Cleveland, D. W., and Fuchs, E. (1996) Cell 86, 655-665[CrossRef][Medline] [Order article via Infotrieve]
49. Wu, A. L., Wang, J., Zheleznyak, A., and Brown, E. J. (1999) Mol. Cell 4, 619-625[CrossRef][Medline] [Order article via Infotrieve]
50. Rezniczek, G. A., de Pereda, J. M., Reipert, S., and Wiche, G. (1998) J. Cell Biol. 141, 209-225[Abstract/Free Full Text]
51. Sin, W. C., Chen, X. Q., Leung, T., and Lim, L. (1998) Mol. Cell. Biol. 18, 6325-6339[Abstract/Free Full Text]
52. Castresana, J., and Saraste, M. (1995) FEBS Lett. 374, 149-151[CrossRef][Medline] [Order article via Infotrieve]
53. Gimona, M., and Mital, R. (1998) J. Cell Sci. 111, 1813-1821[Abstract]


Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
H. Ishida, M. A. Borman, J. Ostrander, H. J. Vogel, and J. A. MacDonald
Solution Structure of the Calponin Homology (CH) Domain from the Smoothelin-like 1 Protein: A UNIQUE APOCALMODULIN-BINDING MODE AND THE POSSIBLE ROLE OF THE C-TERMINAL TYPE-2 CH-DOMAIN IN SMOOTH MUSCLE RELAXATION
J. Biol. Chem., July 18, 2008; 283(29): 20569 - 20578.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
M. Fukuda, E. Kanno, K. Ishibashi, and T. Itoh
Large Scale Screening for Novel Rab Effectors Reveals Unexpected Broad Rab Binding Specificity
Mol. Cell. Proteomics, June 1, 2008; 7(6): 1031 - 1042.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Nakatsuji, N. Nishimura, R. Yamamura, H.-o. Kanayama, and T. Sasaki
Involvement of Actinin-4 in the Recruitment of JRAB/MICAL-L2 to Cell-Cell Junctions and the Formation of Functional Tight Junctions
Mol. Cell. Biol., May 15, 2008; 28(10): 3324 - 3335.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. Yamamura, N. Nishimura, H. Nakatsuji, S. Arase, and T. Sasaki
The Interaction of JRAB/MICAL-L2 with Rab8 and Rab13 Coordinates the Assembly of Tight Junctions and Adherens Junctions
Mol. Biol. Cell, March 1, 2008; 19(3): 971 - 983.
[Abstract] [Full Text] [PDF]