![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 17, 14933-14941, April 26, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, December 12, 2001
CasL/HEF1 belongs to the
p130Cas family. It is tyrosine-phosphorylated
following CasL (also known as HEF1) was originally identified as a highly
phosphorylated protein of 105-kDa in human lymphocytes after Since Cas was the first characterized member of the Cas family
proteins, the study of Cas is most advanced, and it has established a
framework for the studies of the other family members. In fibroblasts, Cas has been shown to reside primarily at focal adhesions and along
adhesion-proximal regions of stress fibers (7, 8), where Cas associates
with focal adhesion kinase
(FAK)1 (9). When cells attach
to extracellular matrix proteins such as fibronectin, laminin, or
vitronectin through integrin molecules, they form focal adhesion
structures (also simply called "focal adhesions") at the adhesion
sites. At focal adhesions, stress fibers are tethered, and a variety of
molecules that mediate many cellular functions such as proliferation
and migration are integrated (10, 11). Cas, localizing at focal
adhesions, plays important roles in the integrin-induced signaling. By
generating and examining Cas knockout mice, we have demonstrated that
Cas is essential for bundling actin filaments and cellular
transformation induced by the oncogenic Src (12).
Cytoskeletal system is essential for maintaining various cellular
functions. In the mammalian cells, there are three types of
cytoskeletal filaments, actin-containing microfilaments,
tubulin-containing microtubules, and intermediate filaments (IFs).
Among them, IFs are important for structure and mechanical integration
of cellular space, and they are composed of cell type-specific proteins
(13-17). Vimentin is one of such proteins and is a major component of
IFs in cells of mesenchymal tissues.
Recently, an increasing number of studies are reported on the
CasL-mediated functions. As suggested by its structural similarity to
Cas, CasL is considered to be important for These CasL (or Cas)-mediated functions are carried out by its
interaction with many molecules. CasL has several domains that interact
with other molecules, such as the SH3 and the substrate domain. The SH3
domain of CasL interacts with FAK or Pyk2/Cak Cells and Reagents--
The human T cell lines H9, Jurkat, and
other hematopoietic cell lines HL60 and HEL cells were cultured in RPMI
1640 containing 10% heat-inactivated fetal calf serum. COS7, HeLa, and
293 cells were cultured in Dulbecco's modified Eagle's medium with
10% fetal calf serum.
Rabbit antisera against MICAL C1 and C2 were obtained as described
below. Polyclonal antibodies were purified from these antisera by
affinity chromatography (HiTrap NHS-activated, Amersham Biosciences, described below). Mouse monoclonal antibody (mAb) V9 against vimentin and mAb M2 against the FLAG epitope were purchased from Sigma. Rabbit
polyclonal antibody HA.11 against the hemagglutinin (HA) epitope was
obtained from Babco. Goat polyclonal antibodies C-20 against vimentin
and N-17 against CasL/HEF1 were purchased from Santa Cruz
Biotechnology. The mAb 9E10 against the Myc epitope was obtained by
culturing 9E10 hybridomas in the non-serum culture system. Fluorescein
isothiocyanate-conjugated anti-rabbit donkey antibody and Texas
Red-conjugated anti-goat donkey antibody were purchased from The
Jackson Laboratories. The human thymus 5'-STRETCH PLUS cDNA library
(HL5010b) was purchased from CLONTECH and was used
in the far Western screening.
Far Western Screening--
The cDNA fragment encoding the
human CasL SH3 domain (amino acid residues 2-66) was generated by PCR
using customized primers. BglII and EcoRI sites
were added to the 5'- and 3'-ends and subcloned into the
BamHI/EcoRI sites of pGEX-2TK (Amersham
Biosciences) to generate pGEX2TK-CasL SH3. This plasmid was transfected
into Escherichia coli cells, and the expressed proteins were
purified using the glutathione-Sepharose 4B beads (Amersham
Biosciences). They were labeled with 32P isotope by bovine
heart kinase (Sigma) and used as the first probe.
Competent E. coli cells were infected with phages from the
cDNA library (20,000 plaque-forming units/plate) and were incubated for 3 h at 43 °C. Then the Hybond-C-extra membranes (Amersham Biosciences) soaked in 10 mM
isopropyl-1-thio- Screening of a PAC Library and a Radiation Hybrid Panel
Containing MICAL Gene--
To obtain a genomic fragment containing the
MICAL gene, a PAC library, RPCI-1 (Roswell Park
Cancer Institute) was screened by the PCR method with a pair of MICAL
cDNA-specific primers, P1 and P2 (described below), and we obtained
clone 231G18.
To identify the chromosomal location of the MICAL gene, we
screened a Radiation Hybrid Panel, GeneBridge 4 (Research Genetics), by
PCR with the same primers P1 and P2. The results were analyzed by the manufacturer.
Reverse Transcriptase-PCR--
Total RNA was extracted from
freshly prepared H9 cells by the acid guanidine/phenol chloroform
method, and a poly(A) RNA-rich fraction was prepared by the poly(A)
selection procedure (Oligotex-dT30 super, Roche Molecular
Biochemicals). This RNA fraction was subjected to reverse transcription
reaction with a gene-specific primer P3 by heat-resistant reverse
transcriptase (Thermoscript, Invitrogen) at 62 °C. We carried out
the first PCR on this synthesized cDNA with primers P4 and P6
followed by the second PCR with primers P5 and P6 at the presence of
5% Me2SO.
The following MICAL gene-specific primers were used:
P1, CTGCCCCAGTACCACAAGAT (corresponding to nucleotides 445-464); P2, GAGAACTTGGTGCGCTTTTC (nucleotides 652-671); P3,
AGGTGGAGCACGTTGTGGCGAGAG (nucleotides 669-692); P4,
CCCAAGACTGTCCCCGCTGGAG (nucleotides 1-22); P5, GCTGGAGGCGGTAGAGGGAT
(nucleotides 16-35); and P6, CAGCAGCTGGGCAGAGACGAGT (nucleotides
272-293).
Northern Blotting--
A poly(A) RNA fraction was obtained from
freshly prepared murine tissues or cultured cells as described above.
Two µg of this RNA fraction was loaded, electrophoresed, and
hybridized with the isotope-labeled MICAL cDNA fragment.
Generation of Antibodies against Bacterially Expressed
MICAL--
The cDNA fragments corresponding to the amino acid
residues 884-1063 (C1) and 999-1063 (C2) of MICAL were generated by
PCR, and they were inserted into pGEX1 (Amersham Biosciences) to
generate GST-MICAL C1 and GST-MICAL C2 constructs. These plasmids were transfected into E. coli cells, and expressed fusion
proteins were purified. Rabbits were immunized with these fusion
proteins, and antisera against these antigens were raised (anti-MICAL
C1 and anti-MICAL C2). The antisera were purified by affinity
chromatography. At first, the antisera were passed through the
GST-conjugated column removing anti-GST antibodies. The flow-through
fraction was then applied onto the antigen-conjugated column, and
specific antibodies bound to the column were eluted out and collected.
Plasmid Construction of Expressing Vectors and Transient
Transfection--
The cDNA for HA tag or FLAG tag was added to the
3' terminus of the coding sequence of MICAL, and this was inserted into
pUC-CAGGS (27) or pSSR
These expression vectors were transfected into COS7 cells by the
DEAE-dextran method essentially as described previously (29).
Cell Lysis, Immunoprecipitation, and Immunoblotting--
Cells
were lysed in 1% Triton X-100 buffer (10 mM Tris-HCl (pH
7.4), 5 mM EDTA, 150 mM NaCl, 1% Triton
X-100). Cell lysates were incubated with indicated antibodies for
1 h at 4 °C, followed by additional incubation with the protein
A- or protein G-Sepharose beads (Amersham Biosciences). The beads were
washed with 1% Triton X-100 buffer and treated with sample buffer (2%
SDS, 10% glycerol, 60 mM Tris-HCl (pH 6.8), 0.001%
bromphenol blue). Samples were subjected to SDS-PAGE. The
electrophoresed proteins were transferred to polyvinylidene difluoride
filters (Millipore) and were subjected to immunoblotting, followed by
detection with the alkaline phosphatase-conjugated secondary antibody (Promega).
Immunofluorescence Microscopy--
Cells were grown on a cover
glass. They were fixed with 3.7% formaldehyde and permeabilized with
0.2% Triton X-100, and they were blocked in phosphate-buffered saline
with 1% bovine serum albumin (Nacalai Tesque, Kyoto, Japan). After
incubation with the primary and the secondary antibodies for 1 h
at room temperature, the samples were mounted in a 1:1 mixture of 2.5%
1,4-diazabicyclo[2.2.2]octane (Sigma) in phosphate-buffered saline
and glycerol. The cells were observed under the MRC1024 confocal
microscopic system (Bio-Rad).
In Vitro Pull-down Assay--
For pull-down assay, expressed GST
fusion proteins were incubated with the glutathione-Sepharose 4B beads
(Amersham Biosciences) for 1 h at 4 °C for immobilization. We
prepared aliquots of cell lysates from COS7 cells transfected with
MICAL and mMICAL constructs, and these aliquots were incubated with the
beads for 1 h, and the proteins bound to the beads were analyzed
by immunoblotting. Ten percent of the immobilized proteins were
subjected to Coomassie Brilliant Blue stain, and we confirmed that an
almost equal volume of GST fusion proteins was loaded. The
GST-p130Cas SH3 fusion protein encodes amino acid residues
6-64 of p130Cas. The details of the GST-Crk SH3, GST-Abl
SH3, GST-Grb2 SH3, and GST-Src SH3 constructs were described previously
(29).
Isolation and Structure Analysis of
MICAL--
Isotope-labeled GST-CasL SH3 fusion protein was used as a
probe for the far Western screening to screen a
The cDNA of this newly isolated gene consists of ~3700-bp
nucleotides, which corresponds to the result of the Northern blotting described below. Molecular mass of the translated protein is predicted to be 118 kDa composed of 1067 amino acids. Search of the
GenBankTM data base showed that this isolated gene encodes
a novel molecule, and its amino acid sequence has prominent homology
with that of KIAA0750 (35~65% homology) which had been isolated from
the human brain (Fig. 1B) (31). This data base also told us
that MICAL has homology with KIAA1364 derived from human brain by
50-63%. At present, the complete cDNA sequence of KIAA1364 is not determined.
Sequence analysis of this novel molecule indicates that it contains a
calponin homology (CH) domain in the central region followed by a LIM
domain. In addition, a proline-rich region (Pro-Pro-Lys-Pro-Pro, PPKPP)
and a putative leucine zipper (L-Zip) motif are located at the COOH
terminus. Because this novel molecule interacts with CasL (described
below), we named this novel molecule "MICAL," for a
Molecule Interacting with
CasL. We also call the KIAA0750 molecule
"MICAL-2" based on its homology. Whereas the MICAL-2/KIAA0750 molecule has a CH domain and a LIM domain, it does not have any L-Zip
motifs or PPKPP sequences.
To determine the chromosomal location of the MICAL gene, we
screened a Radiation Hybrid Panel following the manufacturer's instruction. The result showed that MICAL is located on the
long arm of chromosome 6, 6q16.
MICAL Is Expressed in Hematopoietic Cells and Other Specific
Tissues--
To assess the expression profile of the MICAL mRNA,
we examined various hematopoietic cell lines and murine tissues by
Northern blotting. We detected a single discrete transcript of ~3.7
kb in the hematopoietic cell lines Jurkat, HL60, and HEL (Fig.
2A). Although we could find
another larger transcript in HEL cells, the main transcript was ~3.7
kb. Northern blotting of the various murine tissues revealed that MICAL
mRNA expression is restricted to the several specific tissues; we
could find prominent expression in the thymus, lung, spleen, and testis
and faint expression in the kidney (Fig. 2B), whereas no
obvious expression was detected in the brain, heart, and liver. Even
though the size of the transcript in the testis seemed to be slightly
larger than 3.7 kb, this may be a spliced variant.
It has been reported that CasL is expressed prominently in the lung,
kidney, placenta, and lymphocytes (2, 3). The expression pattern of
MICAL corresponds to that of CasL, and this accordance supports the
biological relationship between the two molecules.
Generation of Polyclonal Antibodies and Detection of MICAL
Proteins--
To characterize MICAL protein, we generated polyclonal
antibodies against MICAL. We used COOH-terminal regions as immunogens, C1 region spanning amino acid residues 884-1063 and C2 region spanning
residues 999-1063. We immunized rabbits and obtained antisera to each
antigen (anti-MICAL C1 and anti-MICAL C2). The antisera were purified
by affinity chromatography, and we generated specific antibodies. To
check the quality of these antibodies and to detect MICAL proteins, we
performed an immunoblot assay. We used lysates from COS7 cells
transiently transfected with pSSR MICAL Interacts with the CasL SH3 Domain through the PPKPP
Proline-rich Sequence--
To test the in vivo interaction
between MICAL and CasL, we analyzed their interaction by transiently
coexpressing MICAL and CasL proteins in COS7 cells. When we
cotransfected the FLAG-tagged MICAL (MICAL-FLAG) together with the
Myc-tagged CasL (Myc-CasL), we could detect CasL in the anti-FLAG
immunoprecipitates containing MICAL proteins (Fig.
4A). Alternatively, we were
able to find MICAL in the anti-Myc immunoprecipitates containing CasL
proteins (Fig. 4A). These results indicate that these two
proteins can make a complex in mammalian cells in vivo.
To confirm that MICAL and CasL interact with each other through the
CasL SH3 domain, we cotransfected MICAL-FLAG together with the
Myc-tagged CasL whose SH3 domain was deleted (Myc-
This interaction was also demonstrated by the in vitro
pull-down assay. We immobilized various GST-SH3 fusion proteins on the
glutathione-Sepharose beads and incubated them with COS7 cell lysates
expressing MICAL-FLAG. As shown in Fig. 4D, we could detect prominent existence of MICAL in the complex that contains the CasL SH3
domain or Cas SH3 domain, whereas only faint MICAL bands were observed
in the Src SH3, Grb2 SH3, Abl SH3, or Crk SH3 containing complex. This
result shows that MICAL preferentially interacts with the CasL (or
p130Cas) SH3 domain.
It has been reported that the Cas SH3 domain preferentially binds to
"Pro-X-Lys-Pro, PXKP" (X, any amino acid)
sequence (25). Because MICAL has a consensus sequence of "PPKPP" at
the COOH terminus, we examined whether MICAL interacts with the CasL
SH3 domain through this proline-rich sequence. We constructed a mutant, mMICAL-FLAG, whose proline-rich sequence PPKPP (amino acid residues 830-834) was mutated into PPAPP (Fig. 4C). When we
incubated the immobilized GST-CasL SH3 and GST-Cas SH3 fusion proteins
with lysates of COS7 cells expressing mMICAL-FLAG, we could not find mMICAL proteins in the complexes (Fig. 4D). These results
indicate that MICAL interacts with the CasL and Cas SH3 domains through the PPKPP sequence.
MICAL Is a Cytoplasmic Protein and Colocalizes with CasL at the
Perinuclear Region--
To examine the intracellular distribution of
the MICAL molecule, we performed immunofluorescence staining with the
purified anti-MICAL C2 antibody. MICAL localized in the cytoplasm like filaments or meshes, and this filamentous structure spread from the
perinuclear area toward the cell periphery (Fig.
5, a and e). When
we stained the CasL molecule, CasL also localized all over the
cytoplasm but distributed preferentially to the perinuclear area and
the edge of the cell periphery (Fig. 5b). We could readily find the colocalization signals of MICAL and CasL at the perinuclear area (Fig. 5c). These results suggest that there are
biological interactions between MICAL and CasL in living cells.
MICAL Also Colocalizes with Vimentin Intermediate
Filaments--
MICAL is distributed in the cytoplasm-like filaments in
HeLa cells. Because this staining pattern was similar to that of
cytoskeletal structures, we examined subcellular localization of
microfilaments (F-actin), microtubules ( MICAL Associates with Vimentin through Its COOH-terminal
Region--
To examine the possible interaction between MICAL and
vimentin, we performed immunoprecipitation and immunoblotting. Prior to
these experiments, we generated five deletion mutants of MICAL, M1-M5
(Fig. 6A). At first, we
transfected COS7 cells with these mutants or wild-type (Wt) MICAL-HA
constructs, and the cell lysates were subjected to immunoprecipitation
with the anti-vimentin antibody. In this experiment, we could find
M3-M5 and Wt molecules in the anti-vimentin immunoprecipitates (Fig.
6B, lanes 8-10 and 13), whereas M1 and M2
mutants were not found in these immunocomplexes (Fig. 6B, lanes
3 and 4). This result indicates that MICAL interacts with vimentin through its COOH-terminal region.
To confirm this interaction between MICAL and vimentin, we
cotransfected COS7 cells with FLAG-tagged vimentin and MICAL M2 or Wt
constructs, and the cell lysates were immunoprecipitated with the
anti-HA antibody. As a result, we identified the Wt molecule in the
anti-FLAG immunoprecipitate (Fig. 6C, lane 5), whereas M2
molecule was not found in the complex (Fig. 6C, lane 4).
These results clearly show that MICAL and vimentin make complexes in
living cells and that this interaction is mediated through the
COOH-terminal region of MICAL.
In this study, we identified a novel molecule, MICAL, as a
potential CasL-interacting protein by far Western screening. MICAL is
preferentially expressed in hematopoietic cells and several specific
tissues. MICAL contains some discrete domains that include a CH domain,
a LIM domain, and a proline-rich motif. We cannot predict any
enzymatically functional domains from its primary sequence.
SH3 domains bind proline-rich motifs with the core consensus sequence
PXXP (32). Amino acid residues immediately adjacent to the
proline residues seem to be significant for binding specificity to
different SH3 domains (33, 34). Several consensus sequences binding to
the Cas SH3 domain have been reported, and one of them is PPKPP
(25). MICAL has this sequence at the COOH terminus, and we demonstrated
their in vivo interaction. Moreover, in this screening, we
identified other molecules, PTP-1B, PTP-PEST, FAK, and C3G, as CasL
SH3-binding partners. These molecules have already been shown to
interact with the Cas SH3 domain (9, 23-25). Because the SH3 domain of
Cas and that of CasL have amino acid homology by more than 80%, this
similarity in their binding partners seems reasonable.
CasL is a molecule that belongs to the Cas family and is important for
TCR- and In lymphocytes, ligation of TCR, B cell receptor, or In addition to the interaction with CasL, we demonstrated that MICAL
associates with vimentin molecules and colocalizes with vimentin IFs
in vivo. In mammalian cells, IFs belong to one of the three
major classes of cytoskeletal filaments, and they are important for
maintaining mechanical integration. There are many kinds of IF
proteins, and their expression is tissue-specific. Among them, vimentin
is a major component of IFs in cells of mesenchymal origin. Even though
the exact roles of vimentin are not determined yet, the analyses of the
null mutant mice have revealed several defective phenotypes as follows:
deficiencies in the modulation of vascular tuning (40), deficiencies in
the mechanotransduction of shear stress (41), a cerebellar defect and
impaired motor coordination (42), and impaired migration of fibroblasts
into the wound sites (43). These results show that vimentin is
necessary for maintaining mechanical flexibility of a cell.
Immunostaining demonstrated that the localization pattern of MICAL
overlaps significantly with vimentin filaments in HeLa and 293 cells.
Therefore, it is strongly suggested that MICAL is associated with
vimentin filaments and that MICAL is one of the vimentin
filament-associated proteins. There are many IF-associated proteins.
Among them are plectin (44), fimbrin (45), calponin (46), MAP-2 (47),
and bullous pemphigoid antigen-1 (BPAG-1) (48). These molecules have a
binding capacity to IFs and are supposed to be important for
maintaining cytoskeletal integrity. MICAL is also expected to be a
member of these "IF-associated cytoskeletal integrators."
MICAL associates with CasL and vimentin. CasL is a downstream mediator
of integrin-mediated signals and is important for cytoskeletal regulation. Although the exact biological functions of MICAL remain to
be determined, the results suggest that MICAL could be a regulatory mediator that may transduce signals for IF regulation. Until now, several reports (49-51) have been made concerning the
relationship between the integrin-mediated signal transduction and the
regulation of IFs. Wu et al. (49) reported that
integrin-associated protein (IAP/CD47) and proteins linking IAP with
cytoskeleton mediate signals between integrins and vimentin IFs.
Modulation of these molecules influences the distribution pattern of
vimentin and cell spreading. Plectin is also known as a linker molecule
bridging integrins and IFs and is essential for hemidesmosome integrity and stabilization (50). Moreover, Sin et al. (51) suggested that vimentin IFs may be the reservoir of RhoA-binding kinase We showed that MICAL associates with vimentin through the
COOH-terminal region. Biological functions of other motifs, the CH
domain and the LIM domain, remain to be elucidated. The CH domain was
originally identified as a conserved motif in the calponin family
proteins, and this motif is also present in a variety of other
molecules, e.g. Vav and IQGAP-1 or -2. (52). Although our
consensus for its biological function has not been completely settled,
this domain is thought to be important as an actin-binding or
IF-binding motif (45, 46, 52, 53), and it is suggested that a single CH
domain may work as the interaction site with vimentin or other IF
proteins. However, as for MICAL, the interpretation for this hypothesis
is somewhat dazzling. We have found that bacterially expressed
GST-MICAL CH domain fusion proteins can effectively make complexes with
vimentin molecules in vitro (data not shown), whereas in the
immunoprecipitation assay, we found that this region is not necessary
for their interaction. Although we do not know the exact reason, their
interaction may be interfered with by the structural conformation of
other regions.
MICAL has one LIM domain in its central region. The LIM domain is a
member of the Zn2+ finger motifs, and it is specified by
its cysteine richness. LIM domains are found in many cytoplasmic and
nuclear proteins, and they are supposed to be important for
protein-protein interactions. Among the cytoplasmic LIM-containing
proteins, many cytoskeletal regulatory molecules such as Paxillin,
Zyxin, or Enigma are known, and it is anticipated that some biological
functions of these molecules are mediated through LIM domains. Because
MICAL is expected to be a possible cytoskeletal player, further
investigation on this domain may reveal novel insights on this molecule.
In this study, we identified a novel molecule, MICAL, which may connect
CasL and vimentin IFs. Until now, other related molecules, KIAA0750
(MICAL-2) and KIAA1364, have been identified from the human brain.
Because these molecules show significant homology, we may call them
"MICAL family proteins." At present, we know little about these
molecules, and we are making further studies to clarify their
functions. Finding more about the MICAL family proteins must provide
important insights into the cellular biology.
We thank Dr. Masaki Inagaki (Aichi Cancer
Center Research Institute, Japan) for kindly providing us with murine
vimentin cDNA.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB048948.
Published, JBC Papers in Press, February 4, 2002, DOI 10.1074/jbc.M111842200
The abbreviations used are:
FAK, focal adhesion
kinase;
SH, Src homology;
GST, glutathione S-transferase;
IFs, intermediate filaments;
TCR, T cell receptor;
HA, hemagglutinin;
CH, calponin homology;
Wt, wild type;
mAb, monoclonal antibody;
L-Zip, leucine zipper.
MICAL, a Novel CasL Interacting Molecule, Associates with
Vimentin*
,
,
,
,
,
Department of Hematology and Oncology,
Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo,
Bunkyo-ku, Tokyo, 113-8655, the § Laboratory of Gene
Function Analysis, Institute of Molecular and Cell Biology, National
Institute of Advanced Industrial Science and Technology, Central-2
OSL-C2, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8568, and the
¶ Department of Clinical Immunology and AIDS Research Center,
Institute of Medical Science, University of Tokyo, 4-6-1 Shiroganedai,
Minato-ku, Tokyo 108-8639, Japan
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 integrin and/or T cell receptor stimulation and is thus considered to be important for immunological reactions. CasL has several structural motifs such as an SH3 domain and a substrate domain and interacts with many molecules through these motifs. To obtain more insights on the CasL-mediated signal
transduction, we sought proteins that interact with the CasL SH3 domain
by far Western screening, and we identified a novel human molecule,
MICAL (a Molecule Interacting with
CasL). MICAL is a protein of 118 kDa and is
expressed in the thymus, lung, spleen, kidney, testis, and
hematopoietic cells. MICAL has a calponin homology domain, a LIM
domain, a putative leucine zipper motif, and a proline-rich PPKPP
sequence. MICAL associates with CasL through this PPKPP sequence. MICAL is a cytoplasmic protein and colocalizes with CasL at
the perinuclear area. Through the COOH-terminal region, MICAL also
associates with vimentin that is a major component of intermediate
filaments. Immunostaining revealed that MICAL localizes along with
vimentin intermediate filaments. These results suggest that MICAL may
be a cytoskeletal regulator that connects CasL to intermediate filaments.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 integrin stimulation (1-3). CasL is expressed
preferentially in lymphocytes and several epithelial cells. It belongs
to the p130Cas (Cas) family that includes Cas, CasL/HEF1,
and Efs/Sin (4-6). They contain an SH3 domain at the NH2
terminus, followed by a substrate domain composed of a cluster of
potential SH2-binding sites, and a COOH-terminal domain, which contains
consensus binding motifs for the SH3 and SH2 domains of c-Src (CasL
does not have binding motifs for c-Src SH3 domain). This structural
profile indicates that the Cas family proteins serve as docking
molecules that assemble and transduce intracellular signals.
1
integrin-induced signal transduction and cytoskeletal regulation (18).
In T lymphocytes, CasL also plays a critical role in T cell receptor
(TCR)-induced migration (19).
/RAFTK/CADTK, and this
interaction is considered to be one of the triggers of the signal
transduction following
1 integrin stimulation (3, 20-22). In the case of Cas, however, not only FAK or Pyk2 but also several other molecules such as PTP-1B (23), PTP-PEST (24), C3G (25),
and CIZ (26) are demonstrated to interact with its SH3 domain, and they
mediate cellular functions. Therefore, there may exist other unknown
SH3-binding molecules and pathways in the CasL-mediated signal
transduction. With this point of view, we sought molecules that
interact with the CasL SH3 domain by far Western screening, and we
identified a novel molecule that interacts with CasL. We also found
that this molecule associates with vimentin and that it could be a
regulational component of vimentin filaments.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-galactopyranoside were overlaid on
phage plaques for 4 h at 37 °C, and these membranes were
blocked in TBST buffers (10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.05% Tween 20) containing 5% skim milk. The
membranes were incubated with 0.75 µg of the isotope-labeled GST-CasL
SH3 probe for 2 h at 25 °C, washed, and then autoradiographed
(Eastman Kodak Co.).
bsr (28) vectors, generating
pUC-CAGGS/MICAL-HA and pSSR
bsr/MICAL-FLAG. To make mMICAL
mutant, the cDNA sequence CCACCCAAGCCT (corresponding to amino acid
sequence PPKP) was mutated to CCACCGGCGCCT (PPAP) by in
vitro mutagenesis with the Chameleon Double-stranded,
Site-directed Mutagenesis Kit (Stratagene). The FLAG tag sequence was
added to its 3' terminus, and mMICAL-FLAG was inserted into the
pSSR
bsr vector. To generate M1, M2, M3, and M4 mutants, cDNA
fragments corresponding to each mutant protein were generated by PCR
using specific primers, and the M5 mutant was generated by PCR-based
mutagenesis (ExSite PCR-based Site-directed Mutagenesis Kit,
Stratagene). Generated cDNA fragments were ligated with the HA tag
sequence, and they were inserted into the pSSR
bsr vector. The
generation of c-Myc-tagged CasL was described previously (20). To
generate the FLAG-tagged vimentin expression vector, the FLAG tag
sequence was ligated to the end of the murine vimentin sequence, and
this DNA fragment was inserted into the pUC-CAGGS vector.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
gt11 cDNA
expression library (CLONTECH) that was derived from
normal human thymuses. Approximately 1.5 million phages were screened,
and we obtained 8 discrete positive clones. Among them, one clone was
identified as FAK, one as PTP-1B, two clones as PTP-PEST, and two as
C3G; these molecules have already been known to interact with the Cas SH3 domain (9, 23-25). The other two clones contained an overlapping part of the same unknown gene. To obtain more information on this unknown gene, we continued serial screening procedures using the identified cDNA fragments as probes by the DNA hybridization
method. Consequently, we could obtain one conceptional cDNA
sequence. However, as the deduced start codon (ATG) of this cDNA
did not meet the "Kozak's rule" (30) optimally, we searched for a
potential upstream coding region. We screened a PAC genomic library,
and obtained a PAC clone, RPCI-1 231G18, that harbored this unknown gene. Sequence analysis of this genomic fragment revealed that an
intron sequence was inserted between the cDNA nucleotide 268 and
269 (Fig. 1A),
and we obtained an additional 5'-side genomic nucleotide sequence. To
examine if this 5'-side genomic region is transcribed into mRNA, we
prepared three kinds of primers, P4, P5, and P6 (described under
"Experimental Procedures"), and we carried out reverse
transcriptase-PCR for the mRNA extracted from the human T
lymphocyte cell line, H9. Because the nucleotide component around the
target region was extremely GC-rich, we carried out reverse
transcription at 62 °C with thermoresistant reverse transcriptase.
Then we performed the first PCR with P4 and P6 primers and the second
PCR with P5 and P6 primers in the presence of 5% Me2SO.
Consequently, we obtained an amplified fragment at the size of ~280
bp, and the sequence analysis of this fragment revealed that this
fragment did not contain any intron sequences. These results suggest
that this amplified fragment was derived from mRNA and that it was
a part of the cDNA. Because this cDNA sequence contained an
in-frame stop codon at the nucleotide 48 (Fig. 1A), we
concluded that we obtained the full-length coding region of this
unknown gene.


View larger version (118K):
[in a new window]
Fig. 1.
Nucleotide and predicted amino acid sequences
of human MICAL and its schematic representation. A,
nucleotide and predicted amino acid (single-letter code)
sequences of human MICAL are presented. Sequence numbers are shown on
the right. Shown in lowercase letters are
non-coding regions. Amino acid residues corresponding to the calponin
homology domain, the LIM domain, and the putative leucine zipper motif
are underlined with single
lines, bold lines, and double lines,
respectively. The boxed amino acid residues represent the
proline-rich sequence that is responsible for CasL SH3 binding. The
"/" in the 5'-side non-coding region indicates the in-frame stop
codon, and the asterisk indicates the stop codon of the open
reading frame. B, schematic representation of the human
MICAL and the KIAA0750/MICAL-2 molecules. MICAL consists of a
calponin homology domain (CH), a LIM domain
(LIM), a proline-rich region (PR), and a putative
leucine zipper motif (L-Zip). KIAA0750/MICAL-2 is a protein
composed of 1124 amino acids, and it has homology with MICAL by 65 (NH2-terminal half) to 35% (COOH-terminal region). Unlike
MICAL, MICAL-2 has neither proline rich regions nor L-Zip motifs. The
numbers in the scheme indicate amino acid numbers. The C1
and C2 lines indicate regions used for generating
polyclonal antisera.

View larger version (57K):
[in a new window]
Fig. 2.
Expression profiles of MICAL mRNA.
A, Northern blot analysis of the poly(A) RNA from several
hematopoietic cell lines. The electrophoresed poly(A) RNA was
hybridized with the 32P-labeled MICAL cDNA clone
initially isolated in the far Western screening. There is a discrete
band at ~3.7 kb (arrowhead). This probe cross-reacts with
the 18 S rRNA. The ethidium bromide (EtBr) staining of the
electrophoresed RNA is shown in the lower panel. B, Northern
blot analysis of the poly(A) RNA from adult murine tissues hybridized
by the same MICAL cDNA probe. MICAL mRNA is detected in the
thymus, lung, spleen, kidney, and testis (arrowhead).
bsr/MICAL and lysates from
normally growing HeLa, 293, H9, and Jurkat cells. By using both
antibodies, we could find endogenous expression of MICAL at the size of
~120 kDa in the HeLa, 293, H9, and Jurkat cells and prominent
expression in the transfected COS7 cells (Fig. 3).

View larger version (76K):
[in a new window]
Fig. 3.
Detection of the MICAL proteins. Cell
lysates from COS7 (lane 1), COS7 transfected with
pSSR
/MICAL (lane 2), HeLa (lane 3), 293 (lane 4), H9 (lane 5), and Jurkat (lane
6) cells were subjected to immunoblotting with affinity-purified
anti-MICAL C2 antibody. MICAL is detected as a single band of
~120 kDa (arrowhead). In the COS7 cells transfected with
pSSR
/MICAL, prominent expression can be detected. WB,
Western blot.

View larger version (39K):
[in a new window]
Fig. 4.
MICAL and CasL associate with each other
through their PPKPP sequence and SH3 domain, respectively.
A, COS7 cells were transiently transfected with the
MICAL-FLAG and/or the Myc-CasL expression vectors, and cell lysates
were immunoprecipitated (IP) with the anti-FLAG or the
anti-Myc antibodies. In the cells transfected with both constructs
(lane 4), CasL was detected in the anti-FLAG
immunoprecipitate (black arrowheads), and MICAL was detected
in the anti-Myc immunoprecipitate (white arrowhead).
B, COS7 cells were transiently transfected with the
MICAL-FLAG and/or the Myc-
SH3 CasL expression vectors, and cell
lysates were immunoprecipitated with the anti-FLAG or the anti-Myc
antibodies. We could find neither
SH3 CasL in the anti-FLAG
immunoprecipitate nor MICAL in the anti-Myc immunoprecipitate
(lane 4). C, schematic representation of the
MICAL-FLAG and the mutated MICAL-FLAG (mMICAL-FLAG) molecules. In the
mMICAL-FLAG molecule, the single lysine residue in the proline-rich
region is replaced by alanine. D, several GST-SH3 fusion
proteins were incubated with cell lysates containing MICAL-FLAG or
mMICAL-FLAG, and they were subjected to immunoblotting. MICAL was
clearly detected (arrow) in the complexes containing the
GST-CasL SH3 (lane 6) and the GST-Cas SH3 (lane
5) fusion proteins. However, only faint volume of MICAL was found
in the complexes containing the GST-Src SH3 (lane 1),
GST-Grb2 SH3 (lane 2), GST-Abl SH3 (lane 3), and
GST-Crk SH3 (lane 4) fusion proteins. In the mMICAL-FLAG
lysate, no complex formation was detectable (lanes 8-10).
In lanes 11 and 12, total cell lysates containing
MICAL- and mMICAL-FLAG were loaded. Lower panel shows the
Coomassie Brilliant Blue staining of the GST-SH3 fusion proteins. This
shows that almost equal volume of GST fusion proteins were loaded in
the reaction. WB, Western blot.
SH3 CasL) and
performed immunoprecipitation. In this experiment, we could not find
Myc-
SH3 CasL in the anti-FLAG immunoprecipitates nor MICAL-FLAG in
the anti-Myc immunoprecipitates (Fig. 4B). This result
indicates that MICAL and CasL interact through the CasL SH3 domain.

View larger version (30K):
[in a new window]
Fig. 5.
MICAL localizes in the cytoplasm and
colocalizes with CasL and vimentin. Cells were costained with the
purified anti-MICAL C2 antibody and the anti-CasL/HEF1 or the
anti-vimentin antibodies. In HeLa cells, MICAL localizes in the
cytoplasm-like filaments or meshes, and this filamentous structure
spreads from the perinuclear area toward the cell periphery
(a and e). Similarly, CasL localizes all over the
cytoplasm, and it is distributed preferably to the perinuclear area and
the cell periphery (b). In the merged image,
yellow colocalization signal is readily detected at the
perinuclear area (c). In HeLa cells, vimentin is found in
the cytoplasm as filamentous or mesh-like structures (f),
and this localization pattern clearly overlaps with that of MICAL
(g, yellow signal). This colocalization was most
clear in 293 cells (i, j, and k). When
cells were stained only with the second antibodies, no significant
signals were observed (d, h, and
l).
-tubulin), or intermediate
filaments (vimentin) by costaining these cytoskeletal molecules with
MICAL. Double staining of these proteins revealed that the staining
pattern of MICAL was mostly consistent with that of vimentin (Fig. 5, middle panel). This colocalization pattern was more apparent
in 293 cells; MICAL was stained like mesh composed of fine filaments in
the cytoplasm, and in many cells, strong signals were observed in the
cell process areas (Fig. 5, lower panel). Therefore, MICAL was supposed to be an integrated component of vimentin intermediate filaments.

View larger version (30K):
[in a new window]
Fig. 6.
MICAL interacts with vimentin molecule
through its COOH-terminal region. A, schematic
representation of the MICAL-HA mutants. Five HA-tagged mutants
(M1-M5) and an HA-tagged wild-type MICAL (Wt) construct
were generated. M1, NH3-terminal fragment to the
CH domain; M2, NH3-terminal fragment to the LIM
domain; M3, COOH-terminal fragment from the CH domain;
M4, COOH-terminal fragment from the end of the LIM domain;
M5, fragment from which the CH domain and the LIM domain are
deleted. Numbers on the lines represent
corresponding amino acid numbers. B, COS7 cells were
transiently transfected with expression vectors encoding HA-tagged
mutants, and cell lysates were subjected to immunoprecipitation
(IP) with the anti-HA or the anti-vimentin antibodies.
M3-M5 and Wt proteins were detected in the
anti-vimentin immunoprecipitates (lanes 8,
13, 9, and 10), whereas M1 and M2 mutants
were not found in the anti-vimentin immunoprecipitates (lanes
3 and 4). No Wt proteins were found in the fraction
nonspecifically bound to the protein G-Sepharose (lane 11).
Lanes 1, 2, 5-7, and 12 show expressed HA-tagged proteins, and black arrowheads in
the lower panel point at the vimentin proteins in the
immunoprecipitates (lanes 14-19). The white
arrowhead in the lanes 12 and 13 indicates
the M4 mutant. C, COS7 cells were transiently transfected
with HA-tagged MICAL mu- tants (Wt or M2) and/or FLAG-tagged
vimentin (Vim) expression vectors, and cell lysates were
subjected to immunoprecipitation with the anti-HA antibody. In the
cells transfected with Wt and vimentin (lane 5), vimentin
was detected in the anti-HA immunoprecipitate (upper panel, black
arrow), whereas in the cells expressing M2 and vimentin
(lane 4), vimentin was not identified in the anti-HA
immunoprecipitate. In the cells transfected with vimentin, M2, or M3
alone (lanes 1-3), we could not find any vimentin signals
in the anti-HA immunoprecipitates. The black arrow in the
middle panel indicates the expressed vimentin proteins
(lanes 1, 4, and 5), and the lower
panel shows the expression of Wt (lanes 3 and
5) or M2 (lanes 2 and 4) proteins.
WB, Western blot.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 integrin-induced immunological reactions such
as interleukin-2 production (35) and migratory response (19). In HeLa
cells, CasL localizes around the nucleus and at the cell periphery.
Various reports have suggested that the Cas family proteins transduce
signals to downstream pathways including mitogen-activated protein
kinase and other cytoskeletal regulatory pathways (12, 18, 19, 36-38).
In this report, we showed that a fraction of MICAL localizes at the
perinuclear area and colocalizes with CasL. This result suggests that
MICAL may play roles in the CasL-mediated signaling pathways.
1
integrin induces prominent phosphorylation of CasL at its substrate domain. This is considered to be important for many immunological reactions (19, 21, 22, 35, 39). Therefore, we examined whether MICAL
could be phosphorylated at tyrosine residues after TCR or
1 integrin ligation. However, we could not find any
obvious tyrosine phosphorylation (data not shown). MICAL may not be a target of phosphorylation by tyrosine kinases.
(ROK
), which is a putative effector of RhoA, and may be regulated by
integrin-mediated signals. Because our immunofluorescence study did not
identify MICAL at the cell periphery, it may be difficult to expect the
close biological interactions between MICAL and integrins. However, it
is possible that MICAL may mediate further downstream signals via CasL.
![]()
ACKNOWLEDGEMENT
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of
Hematology and Oncology, Graduate School of Medicine, University of
Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-8655, Japan. Tel.:
81-3-5800-6421; Fax: 81-3-5689-7286; E-mail:
hhirai-tky@umin.ac.jp.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Nojima, Y.,
Rothstein, D. M.,
Sugita, K.,
Schlossman, S. F.,
and Morimoto, C.
(1992)
J. Exp. Med.
175,
1045-1053 2.
Minegishi, M.,
Tachibana, K.,
Sato, T.,
Iwata, S.,
Nojima, Y.,
and Morimoto, C.
(1996)
J. Exp. Med.
184,
1365-1375 3.
Law, S. F.,
Estojak, J.,
Wang, B.,
Mysliwiec, T.,
Kruh, G.,
and Golemis, E. A.
(1996)
Mol. Cell. Biol.
16,
3327-3337[Abstract] 4.
Sakai, R.,
Iwamatsu, A.,
Hirano, N.,
Ogawa, S.,
Tanaka, T.,
Mano, H.,
Yazaki, Y.,
and Hirai, H.
(1994)
EMBO J.
13,
3748-3756[Medline]
[Order article via Infotrieve] 5.
Ishino, M.,
Ohba, T.,
Sasaki, H.,
and Sasaki, T.
(1995)
Oncogene
11,
2331-2338[Medline]
[Order article via Infotrieve] 6.
Alexandropoulos, K.,
and Baltimore, D.
(1996)
Genes Dev.
10,
1341-1355 7.
Petch, L. A.,
Bockholt, S. M.,
Bouton, A.,
Parsons, J. T.,
and Burridge, K.
(1995)
J. Cell Sci.
108,
1371-1379[Abstract] 8.
Nakamoto, T.,
Sakai, R.,
Honda, H.,
Ogawa, S.,
Ueno, H.,
Suzuki, T.,
Aizawa, S.,
Yazaki, Y.,
and Hirai, H.
(1997)
Mol. Cell. Biol.
17,
3884-3897[Abstract] 9.
Polte, T. R.,
and Hanks, S. K.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10678-10682 10.
Burridge, K.,
Fath, K.,
Kelly, T.,
Nuckolls, G.,
and Turner, C.
(1988)
Annu. Rev. Cell Biol.
4,
487-525[CrossRef][Medline]
[Order article via Infotrieve] 11.
Clark, E. A.,
and Brugge, J. S.
(1995)
Science
268,
233-239 12.
Honda, H.,
Oda, H.,
Nakamoto, T.,
Honda, Z.,
Sakai, R.,
Suzuki, T.,
Saito, T.,
Nakamura, K.,
Nakao, K.,
Ishikawa, T.,
Katsuki, M.,
Yazaki, Y.,
and Hirai, H.
(1998)
Nat. Genet.
19,
361-365[CrossRef][Medline]
[Order article via Infotrieve] 13.
Steinert, P. M.,
and Roop, D. R.
(1988)
Annu. Rev. Biochem.
57,
593-625[CrossRef][Medline]
[Order article via Infotrieve] 14.
Robson, R. M.
(1989)
Curr. Opin. Cell Biol.
1,
36-43[CrossRef][Medline]
[Order article via Infotrieve] 15.
Fuchs, E.,
and Weber, K.
(1994)
Annu. Rev. Biochem.
63,
345-382[Medline]
[Order article via Infotrieve] 16.
Fuchs, E.,
and Cleveland, D. W.
(1998)
Science
279,
514-519 17.
Galou, M.,
Gao, J.,
Humbert, J.,
Mericskay, M., Li, Z.,
Paulin, D.,
and Vicart, P.
(1997)
Biol. Cell
89,
85-97[CrossRef][Medline]
[Order article via Infotrieve] 18.
Sattler, M.,
Salgia, R.,
Shrikhande, G.,
Verma, S.,
Uemura, N.,
Law, S. F.,
Golemis, E. A.,
and Griffin, J. D.
(1997)
J. Biol. Chem.
272,
14320-14326 19.
Ohashi, Y.,
Iwata, S.,
Kamiguchi, K.,
and Morimoto, C.
(1999)
J. Immunol.
163,
3727-3734 20.
Tachibana, K.,
Urano, T.,
Fujita, H.,
Ohashi, Y.,
Kamiguchi, K.,
Iwata, S.,
Hirai, H.,
and Morimoto, C.
(1997)
J. Biol. Chem.
272,
29083-29090 21.
Manie, S. N.,
Beck, A. R.,
Astier, A.,
Law, S. F.,
Canty, T.,
Hirai, H.,
Druker, B. J.,
Avraham, H.,
Haghayeghi, N.,
Sattler, M.,
Salgia, R.,
Griffin, J. D.,
Golemis, E. A.,
and Freedman, A. S.
(1997)
J. Biol. Chem.
272,
4230-4236 22.
Astier, A.,
Manie, S. N.,
Avraham, H.,
Hirai, H.,
Law, S. F.,
Zhang, Y.,
Golemis, E. A., Fu, Y.,
Druker, B. J.,
Haghayeghi, N.,
Freedman, A. S.,
and Avraham, S.
(1997)
J. Biol. Chem.
272,
19719-19724 23.
Liu, F.,
Hill, D. E.,
and Chernoff, J.
(1996)
J. Biol. Chem.
271,
31290-31295 24.
Garton, A. J.,
Burnham, M. R.,
Bouton, A. H.,
and Tonks, N. K.
(1997)
Oncogene
15,
877-885[CrossRef][Medline]
[Order article via Infotrieve] 25.
Kirsch, K. H.,
Georgescu, M. M.,
and Hanafusa, H.
(1998)
J. Biol. Chem.
273,
25673-25679 26.
Nakamoto, T.,
Yamagata, T.,
Sakai, R.,
Ogawa, S.,
Honda, H.,
Ueno, H.,
Hirano, N.,
Yazaki, Y.,
and Hirai, H.
(2000)
Mol. Cell. Biol.
20,
1649-1658 27.
Niwa, H.,
Yamamura, K.,
and Miyazaki, J.
(1991)
Gene (Amst.)
108,
193-199[CrossRef][Medline]
[Order article via Infotrieve] 28.
Ueno, H.,
Hirano, N.,
Kozutsumi, H.,
Sasaki, K.,
Tanaka, T.,
Yazaki, Y.,
and Hirai, H.
(1995)
J. Biol. Chem.
270,
20135-20142 29.
Nakamoto, T.,
Sakai, R.,
Ozawa, K.,
Yazaki, Y.,
and Hirai, H.
(1996)
J. Biol. Chem.
271,
8959-8965 30.
Kozak, M.
(1986)
Cell
44,
283-292[CrossRef][Medline]
[Order article via Infotrieve] 31.
Nagase, T.,
Ishikawa, K.,
Suyama, M.,
Kikuno, R.,
Miyajima, N.,
Tanaka, A.,
Kotani, H.,
Nomura, N.,
and Ohara, O.
(1998)
DNA Res.
5,
277-286[Abstract] 32.
Ren, R.,
Mayer, B. J.,
Cicchetti, P.,
and Baltimore, D.
(1993)
Science
259,
1157-1161 33.
Yu, H.,
Chen, J. K.,
Feng, S.,
Dalgarno, D. C.,
Brauer, A. W.,
and Schreiber, S. L.
(1994)
Cell
76,
933-945[CrossRef][Medline]
[Order article via Infotrieve] 34.
Sparks, A. B.,
Rider, J. E.,
Hoffman, N. G.,
Fowlkes, D. M.,
Quillam, L. A.,
and Kay, B. K.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
1540-1544 35.
Kamiguchi, K.,
Tachibana, K.,
Iwata, S.,
Ohashi, Y.,
and Morimoto, C.
(1999)
J. Immunol.
163,
563-568 36.
Knudsen, B. S.,
Feller, S. M.,
and Hanafusa, H.
(1994)
J. Biol. Chem.
269,
32781-32787 37.
Smit, L.,
van der Horst, G.,
and Borst, J.
(1996)
J. Biol. Chem.
271,
8564-8569 38.
Tanaka, S.,
Morishita, T.,
Hashimoto, Y.,
Hattori, S.,
Nakamura, S.,
Shibuya, M.,
Matuoka, K.,
Takenawa, T.,
Kurata, T.,
Nagashima, K.,
and Matsuda, M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
3443-3447 39.
Kanda, H.,
Mimura, T.,
Morino, N.,
Hamasaki, K.,
Nakamoto, T.,
Hirai, H.,
Morimoto, C.,
Yazaki, Y.,
and Nojima, Y.
(1997)
Eur. J. Immunol.
27,
2113-2117[Medline]
[Order article via Infotrieve] 40.
Terzi, F.,
Henrion, D.,
Colucci-Guyon, E.,
Federici, P.,
Babinet, C.,
Levy, B. I.,
Briand, P.,
and Friedlander, G.
(1997)
J. Clin. Invest.
100,
1520-1528[Medline]
[Order article via Infotrieve] 41.
Henrion, D.,
Terzi, F.,
Matrougui, K.,
Duriez, M.,
Boulanger, C. M.,
Colucci-Guyon, E.,
Babinet, C.,
Briand, P.,
Friedlander, G.,
Poitevin, P.,
and Levy, B. I.
(1997)
J. Clin. Invest.
100,
2909-2914[Medline]
[Order article via Infotrieve] 42.
Colucci-Guyon, E.,
Gimenez, Y. R. M.,
Maurice, T.,
Babinet, C.,
and Privat, A.
(1999)
Glia
25,
33-43[CrossRef][Medline]
[Order article via Infotrieve] 43.
Eckes, B.,
Colucci-Guyon, E.,
Smola, H.,
Nodder, S.,
Babinet, C.,
Krieg, T.,
and Martin, P.
(2000)
J. Cell Sci.
113,
2455-2462[Abstract] 44.
Foisner, R.,
Traub, P.,
and Wiche, G.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3812-3816 45.
Correia, I.,
Chu, D.,
Chou, Y. H.,
Goldman, R. D.,
and Matsudaira, P.
(1999)
J. Cell Biol.
146,
831-842 46.
Mabuchi, K., Li, B., Ip, W.,
and Tao, T.
(1997)
J. Biol. Chem.
272,
22662-22666 47.
Hirokawa, N.,
Hisanaga, S.,
and Shiomura, Y.
(1988)
J. Neurosci.
8,
2769-2779[Abstract] 48.
Yang, Y.,
Dowling, J., Yu, Q. C.,
Kouklis, P.,
Cleveland, D. W.,
and Fuchs, E.
(1996)
Cell
86,
655-665[CrossRef][Medline]
[Order article via Infotrieve] 49.
Wu, A. L.,
Wang, J.,
Zheleznyak, A.,
and Brown, E. J.
(1999)
Mol. Cell
4,
619-625[CrossRef][Medline]
[Order article via Infotrieve] 50.
Rezniczek, G. A.,
de Pereda, J. M.,
Reipert, S.,
and Wiche, G.
(1998)
J. Cell Biol.
141,
209-225 51.
Sin, W. C.,
Chen, X. Q.,
Leung, T.,
and Lim, L.
(1998)
Mol. Cell. Biol.
18,
6325-6339 52.
Castresana, J.,
and Saraste, M.
(1995)
FEBS Lett.
374,
149-151[CrossRef][Medline]
[Order article via Infotrieve] 53.
Gimona, M.,
and Mital, R.
(1998)
J. Cell Sci.
111,
1813-1821[Abstract]
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
H. Ishida, M. A. Borman, J. Ostrander, H. J. Vogel, and J. A. MacDonald Solution Structure of the Calponin Homology (CH) Domain from the Smoothelin-like 1 Protein: A UNIQUE APOCALMODULIN-BINDING MODE AND THE POSSIBLE ROLE OF THE C-TERMINAL TYPE-2 CH-DOMAIN IN SMOOTH MUSCLE RELAXATION J. Biol. Chem., July 18, 2008; 283(29): 20569 - 20578. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuda, E. Kanno, K. Ishibashi, and T. Itoh Large Scale Screening for Novel Rab Effectors Reveals Unexpected Broad Rab Binding Specificity Mol. Cell. Proteomics, June 1, 2008; 7(6): 1031 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nakatsuji, N. Nishimura, R. Yamamura, H.-o. Kanayama, and T. Sasaki Involvement of Actinin-4 in the Recruitment of JRAB/MICAL-L2 to Cell-Cell Junctions and the Formation of Functional Tight Junctions Mol. Cell. Biol., May 15, 2008; 28(10): 3324 - 3335. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yamamura, N. Nishimura, H. Nakatsuji, S. Arase, and T. Sasaki The Interaction of JRAB/MICAL-L2 with Rab8 and Rab13 Coordinates the Assembly of Tight Junctions and Adherens Junctions Mol. Biol. Cell, March 1, 2008; 19(3): 971 - 983. [Abstract] [Full Text] [PDF] |
||||