 |
INTRODUCTION |
Members of the aspartate-specific cysteine family of proteases
known as caspases play a critical role in apoptosis (1). Caspases can
be divided into initiator caspases and effector caspases based on the
presence of a large prodomain at their amino-terminal region (2).
Initiator caspases generally act at the apex of a proteolytic cascade,
whereas effector caspases act downstream and are involved in the
cleavage of specific cellular proteins (death substrates) (3). Once
processed, death substrates modulate the morphological changes
characterizing the apoptotic process (4, 5). The long prodomains of the
initiator caspases trigger/facilitate the activation of the proenzymes
through the interaction with specific adaptor molecules (6). Caspase-2,
caspase-8, caspase-9, and caspase-10 are the long prodomain caspases
involved in the apoptotic process.
A plethora of studies have demonstrated that the large prodomain
caspases-8, -9, -10 play a fundamental role in transducing specific
apoptotic stimuli (7). Caspase-9 is involved in apoptotic pathways that
relay on mitochondrial dysfunction (8), whereas caspase-8 and -10 are
involved in the apoptotic pathways mediated by death receptors (9,
10).
The role of caspase-2 in a specific apoptotic pathway is
controversial. Caspase-2-deficient mice exhibit apoptotic deficit in
the oocytes, following exposure to chemotherapeutic drugs, in B
lymphoblasts following incubation with perforin and granzyme B, in
neurons when apoptosis is induced by 
-amyloid, and in macrophages during Salmonella-induced death (11-13). In addition
activation of caspase-2 could be part of a compensatory pathway of
caspase activation in the absence of the Apaf-1/caspase-9-based
apoptosome (14). More recently it has been reported (15) that
compensatory pathways can be activated also in caspase-2 null neurons,
thus raising a cautionary note regarding the interpretation of findings obtained with caspase-null animals.
A regulative function for caspase-2 is also suggested by the ability of
caspase-2-truncated isoforms, generated via alternative splicing, to
antagonize cell death induced by serum deprivation and DNA damage (16,
17). Finally, a role for caspase-2 as regulative caspase is reinforced
by its ability to induce mitochondrial dysfunction and subsequent
activation of the apoptosome through direct or indirect Bid processing
(18).
Regulated localization of proteins to specific subcellular compartments
is a common event in multiple transduction pathways including
apoptosis. Therefore, the definition of the subcellular localization of
important regulators of the apoptotic process is an important step
toward the understanding of the mechanisms regulating cell death. The
demonstration of caspase-12 localization in the endoplasmic reticulum
has supported its role in mediating apoptosis induced by signals
perturbing endoplasmic reticulum structure/function (19).
Caspase-2 has been shown to be localized in various subcellular
compartments including cytosol, mitochondria, Golgi, nucleus, and
plasma membrane (20-25). In addition, when overexpressed as a
GFP1 fusion protein, the
catalytically inactive caspase-2 mutant or the prodomain can form
higher order structures mostly in the nucleus (22, 26), similar to the
filamentous structures formed by death effector domains of
Fas-associated death domain and caspase-8 or by other proteins
(27-30). In the case of caspase-2 these structures are due to
CARD-mediated oligomerization of the protein (22). Overall these data,
sometimes controversial, still do not clarify the subcellular
localization of caspase-2 and the relative implication for its
death activity.
The goals of this work were to clarify the subcellular localization of
caspase-2 in healthy cells and to identify the regions responsible for
its subcellular targeting. Furthermore, we have investigated whether
during apoptosis caspase-2 could translocate in different subcellular
compartments and the relationship between its subcellular localization
and its ability to trigger mitochondrial dysfunction.
| |
EXPERIMENTAL PROCEDURES |
Culture Conditions--
IMR90-E1A, IMR90-E1A caspase-9 DN (31),
and 293 cells were grown in Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum, penicillin (100 units/ml), and
streptomycin (100 µg/ml) at 37 °C in 5% CO2
atmosphere. Leptomycin B (Sigma) was used at the final concentration of
5 ng/ml.
Transfection, Microinjection, and Time Lapse
Analysis--
Transfections were performed using the calcium phosphate
precipitation method. Cells were seeded 24 h before transfection at 1.2 × 104 cells/ml and analyzed 12 h after
removal of the precipitates. For caspase-2 killer activity 2 µg of
each expression plasmid were co-transfected with 400 ng of pEGFPN1
(Invitrogen) to score the transfected cells in vivo.
Microinjection was performed using the Automated Injection System
(Zeiss Germany) as described previously (32). Cells were injected with
the reported amount of expression vector for 0.5 s, at a constant
pressure of 50 hectoPascal. TRITC-dextran, 66 kDa (Sigma), was
used at a concentration of 1 mg/ml. Time-lapse studies were performed
using a laser scan microscopy Leica TCS NT in a 5% CO2
atmosphere at 37 °C.
Plasmid Construction--
pCDNA3HA
constructs expressing various caspase-2 deletion mutants were generated
by PCR using pGDSV7caspase-2 as template and the following set of
primers containing BglII/XhoI or
EcoRI/XhoI cloning sites: primer 
1-152N,
5'CATCATAGATCTATGGGTCCTGTCTGCCTTCAG3'; primer 1-104N,
5'CATCATAGATCTATGCTTTCTGGGCTTCAGCAT3'; primer 1-27N,
5'CATCATAGATCTATGGTGGTGCTAGCCAAACAG3'; primer C2C,
5'CATCATCTCGAGTCATGTGGGAGGGTGTCCTGG3'; primer 153-435N,
5'CATGAA- TTCATGGCCGCTGACAGGGGACGC3'; and primer 153-435C,
5'CATGGATCCTCAACCATCTTTATTGTCTAG3'.
In vitro mutagenesis to generate caspase2KK135136AA
mutant was performed as described previously (32). The following
sets of primer were used: primer C2N,
5'CATCATAGATCTATGGCCGCTGACAGGGGACGC3'; primer C2C,
5'CATCATCTCGAGTCATGTGGGAGGGTGTCCTGG3'; primer KKF, 5'CGACAGGCGGAGAGCAGCGTAAAGGGGACA3'; and primer KKR
TGTCCCCTTTACGCTGCTCTCCGCCTGTCG3'.
The GST-caspase-2 prodomain was obtained by subcloning the caspase-2
prodomain from pcDNA3HA caspase-2 prodomain into the EcoRI/XhoI sites of pGEX4T1 (Amersham Biosciences).
To construct pEGFP-N1-caspase-2 and pEGFP-C3-caspase-2, the
entire coding region of caspase-2 was amplified by PCR from
pGDSV7S-caspase-2 using the following primers: primer GFPC2N,
5'CATCA- TAGATCTCATGGCCGCTGACAGGGGACGC3'; primer GFPC2C,
5'CATCATAGATCTCCTGTGGGAGGGTGTCCTGGGA3'.
The amplification products were inserted in pEGFPN-1 or pEGFPC3
(Invitrogen) as BglII fragments.
To generate caspase-2NLS-(131-143) -galactosidase fusion
protein oligonucleotides encoding the caspase-2 NLS PLYKKLRLSTD were
synthesized. These oligonucleotides incorporated a KpnI site for convenient cloning. The oligonucleotides were annealed and ligated
with pcDNA3.1/HisB/lacZ (Invitrogen) to create an in-frame amino-terminal fusion of caspase-2NLS-(131-143) and
-galactosidase.
pcDNA3HA-RAIDD/CRADD was constructed by insertion of an
EcoRI/XhoI fragment containing full-length human
RAIDD into the EcoRI/XhoI sites of the
pcDNA3HA vector.
All constructs generated were sequenced to check for the respective
introduced mutations, deletions, and the translating fidelity of the
inserted PCR fragments.
Subcellular Fractionation--
Subcellular fractionation was
performed using detergent lysis or Dounce homogenization. For detergent
lysis, cells were washed twice in PBS, scraped, washed, and resuspended
in 3 volumes of ice-cold extraction buffer A (20 mM Hepes,
pH 7.5, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 0.05% Nonidet P-40, 10 µg/ml cytochalasin B, 1 mM DTT, 1 mM PMSF, and 10 µg/ml each of
chymostatin, leupeptin, antipain, and pepstatin). After 10 min of
incubation on ice, lysates were centrifuged at 800 × g
for 10 min. The post-nuclear supernatant was then centrifuged at
8000 × g for 5 min to obtain the crude cytosolic
fraction. The nuclear pellet was resuspended in extraction buffer A to
the same final volume as the cytosolic fraction.
For subcellular fractionation with the Dounce homogenizer, after
washing, cells were resuspended in extraction buffer B (20 mM Hepes, pH 7.5, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 250 mM saccharose, cytochalasin B 10 µg/ml, 1 mM
DTT, 1 mM PMSF, and 10 µg/ml each of chymostatin,
leupeptin, antipain, and pepstatin), incubated for 20 min on ice, and
then subjected to 40 strokes in a glass Dounce homogenizer type B. The
obtained cell lysate was centrifuged at 500 × g for 10 min. The obtained pellet was considered as nuclear fraction. The
supernatant was centrifuged at 6000 × g for 20 min,
and the resultant pellet was considered enriched in mitochondria (P2).
Finally the supernatant was further centrifuged at 100,000 × g × 60 min. The resultant supernatant (S100) was
considered as cytosol and the pellet as microsomal fraction (P100).
Pellets of each fraction were resuspended in a volume of extraction
buffer B equal to the S100 fraction. All steps were performed on ice or
at 4 °C.
After addition of the SDS sample buffer, equal amounts of each sample
were loaded on a 15% SDS-PAGE and subjected to the immunoblotting analysis.
Western Blotting--
For Western blotting, proteins were
transferred to a 0.2-µm pore-sized nitrocellulose membrane
(Schleicher & Schuell) using a semidry blotting apparatus (transfer
buffer: 20% methanol, 48 mM Tris, 39 mM
glycine, and 0.0375% SDS). After staining with Ponceau S, the
nitrocellulose sheets were saturated for 1 h in Blotto/Tween 20 (50 mM Tris-HCl, pH 7.5, 200 mM NaCl, 5%
non-fat dry milk, and 0.1% Tween 20) and incubated overnight at room
temperature with the anti-caspase-2 (18),
anti-carboxyl-terminal-caspase-2 (Santa Cruz Biotechnology),
anti-caspase-3 (42), anti-lamin (Transduction Laboratories), anti-Erk1
(Transduction Laboratories), and anti-cytochrome c
(Transduction Laboratories). Blots were then rinsed three times with
Blotto/Tween 20 and incubated with peroxidase-conjugated goat
anti-rabbit (Euroclone) or goat anti-mouse (Sigma) for 1 h at room
temperature. Blots were then washed three times in Blotto/Tween 20, rinsed in phosphate-buffered saline, and developed with Super Signal
West Pico, as recommended by the vendor (Pierce).
Immunofluorescence Microscopy--
For indirect
immunofluorescence microscopy, cells were fixed with 3%
paraformaldehyde in PBS for 20 min at room temperature. Fixed cells
were washed with PBS, 0.1 M glycine, pH 7.5, and then permeabilized with 0.1% Triton X-100 in PBS for 5 min. The coverslips were treated with the following antibodies: anti-caspase-2 (18), anti-HA (Sigma), anti-cytochrome c (Promega), anti-Ran
(Transduction Laboratories), anti-p62 (Transduction Laboratories), and
anti--galactosidase (Promega) diluted in PBS for 45 min in a moist
chamber at 37 °C. They were then washed with PBS twice and incubated
with the relative TRITC-conjugated secondary antibodies (Sigma),
fluorescein isothiocyanate (Sigma), or Alexa Fluor 633 (Molecular
Probes) for 30 min at 37 °C. Cells were examined with a laser scan
microscope (Leica TCS NT) equipped with a 488-534 
argon laser and
a 633 He-Ne laser.
Expression and Purification of GST Fusion
Protein--
pGEX-prodomain caspase-2 was transformed into
Escherichia coli strain BL21. GST and GST fusion proteins
were prepared as described previously (33).
In Vitro Binding Assays--
Radiolabeled RAIDD/CRADD,
caspase-2, and its deleted derivatives were generated using TNT
T7-coupled reticulocyte lysate system (Promega). GST prodomain
caspase-2 fusion protein immobilized onto glutathione-Sepharose beads
was incubated with 200 µl of binding buffer (20 mM Hepes,
pH 7.5, 150 mM NaCl, 0.05% Nonidet P-40, 10% glycerol, 1 mM PMSF) at 4 °C for 3 h in the presence of the
appropriate amounts of the 35S-labeled proteins. The beads
were separated by brief centrifugation and washed four times with
washing buffer containing 20 mM Hepes, pH 7.5, 150 mM NaCl, 0.05% Nonidet P-40, and 10% glycerol. Beads were
boiled in SDS sample buffer, and proteins were resolved on a 15%
SDS-PAGE.
| |
RESULTS |
Subcellular Localization of Caspase-2--
Caspase-2 localization
was investigated by subcellular fractionation of IMR90-EIA cells.
Nuclear and cytosolic extracts were prepared by detergent lysis and
were used to visualize caspase-2 in the different fractions by Western
analysis. As shown in Fig. 1a,
caspase-2 was revealed both in the nuclear and in the cytosolic fractions. The quality of the fractionation was verified by probing the
lysates for well defined nuclear and cytoplasmic markers as illustrated
in Fig. 1a. To confirm the observed caspase-2 subcellular distribution, fractionation was performed by a differential
centrifugation (see "Experimental Procedures"). As shown in
Fig. 1b, caspase-2 was detected both in the nuclear (P1) and
in the cytosolic fractions (S100). In addition, residual amounts of
caspase-2 were also detected in P100 and P2 pellets that should
represent microsomal and mitochondrial fractions, respectively (Fig.
1b). Here again fractionation quality was verified by
controlling the distribution of specific subcellular markers. The
subcellular localization of caspase-2 was next investigated by confocal
microscopy using the affinity-purified anti-caspase-2 antibody (18). In
IMR90-E1A endogenous caspase-2 was prevalently revealed as a nuclear
staining, with the exclusion of the nucleoli (Fig. 1c). The
nuclear staining was undetectable after pre-absorption of the antibody
with recombinant caspase-2 (Fig. 1c, PA).
View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Subcellular localization of caspase-2.
a, distribution of caspase-2 among subcellular fractions.
Crude nuclear (N) and cytosolic (C) fractions
were obtained using detergent lysis as described under "Experimental
Procedures." Protein samples were prepared for Western blotting, and
membranes were probed with the indicated antibodies. b,
distribution of caspase-2 among subcellular fractions. Fractions were
obtained using Dounce homogenizer as described under "Experimental
Procedures." P1 fraction was designed as enriched nuclear fraction;
P2 was designed as enriched mitochondrial fraction; and P100 was
designed as enriched microsomal fraction and S100 as cytosol. Protein
samples were prepared for Western blotting, and membranes were probes
with the indicated antibodies. c, immunolocalization of
caspase-2. IMR90-E1A cells were fixed, permeabilized, and labeled with
anti-caspase-2 antibody or labeled with anti-caspase-2 antibody
pre-absorbed on recombinant caspase-2 (PA). Bar,
15 µm. d, IMR90-E1A cells were transfected with
pGDSV7-caspase-2, fixed, permeabilized, and double-stained with
anti-caspase-2 antibody and with propidium iodide (PI) to
visualize nuclei. Bar, 5 µm. e, IMR90-E1A cells
were transfected with pEGFP-N1-caspase-2, fixed and analyzed by
confocal microscopy. Bar, 15 µm. f,
distribution of ectopic expressed caspase-2-GFP among subcellular
fractions. Crude nuclear (N) and cytosolic (C)
fractions were obtained using detergent lysis, whereas P1 and S100
fraction were obtained by differential centrifugation as described
under "Experimental Procedures." Protein samples were prepared for
Western blotting, and the membrane was probed with anti-caspase-2
antibody. C2-GFP, caspase-2-GFP; C2, endogenous
caspase-2.
|
|
Confocal analysis of the overexpressed caspase-2 by using the specific
antibody revealed the same diffuse nuclear staining as obtained for the
endogenous caspase-2 (Fig. 1d). Nuclei were visualized by
propidium iodide staining (Fig. 1d, PI). When
caspase-2wt was co-expressed with its previous identified adaptor
RAIDD/CRADD (21, 34) again, it was prevalently observed as a diffuse
nuclear staining, whereas RAIDD/CRADD showed both a nuclear and a
cytoplasmic distribution (data not shown).
To clarify the apparent discrepancy between the nuclear-cytoplasmic
localization of caspase-2 observed after biochemical fractionation and
its exclusively nuclear localization detected by immunofluorescence analysis, we decided to analyze the subcellular localization of the
overexpressed caspase-2 by subcellular fractionation. We used GFP-tagged caspase-2 to exclude epitope masking in the
immunofluorescence assay. To reduce the killer activity of caspase-2,
low amounts of the expression plasmid were transfected, and the
analysis was performed soon after transfection (within 10 h).
Under these conditions few cells entered apoptosis (data not shown),
and caspase-2-GFP was mainly revealed as unprocessed proenzyme (see
Fig. 1f).
Similarly to the untagged protein, caspase-2-GFP was mainly detected as
a diffuse nuclear staining with the exclusion of the nucleoli by
confocal microscopy (Fig. 1e). On the other hand ectopically expressed caspase-2-GFP was detected both in the nucleus and in the
cytoplasm, by means of subcellular fractionation and Western blotting.
Similarly endogenous caspase-2 was detected both in the nucleus and in
the cytoplasm.
In conclusion these results suggest that the accumulation of caspase-2
in the cytosolic compartment observed after subcellular fractionation
might be ascribed to a dissociation of caspase-2 from the nuclei
occurring during the experimental procedure.
Dissection of the Caspase-2 Prodomain, Implications for Nuclear
Localization and Killer Activity--
In order to map the regions of
caspase-2 required for its targeting to the nuclear compartment, a
number of different deleted constructs were generated, as outlined in
Fig. 2a. We created a
caspase-2 lacking the prodomain-(1-152), because it has been demonstrated that murine caspase-2 lacking this region is impaired in
nuclear localization (22). We also created a caspase-2 lacking the
first 27 aa (1-27), because a nuclear localization sequence is
present in this region, and it has been shown previously (22, 26) that
this region is required for the nuclear localization of the caspase-2
prodomain. Finally, a caspase-2 version lacking both the amino-terminal
region and the CARD domain-(1-104) and a caspase-2 consisting only
of the prodomain-(153-435) were also generated. All the deleted
derivatives were cloned in pcDNA3 expression vector
containing an HA epitope tag at the amino terminus.
View larger version (48K):
[in this window]
[in a new window]
|
Fig. 2.
Deletion constructs of caspase-2.
a, schematic representation of caspase-2 and deleted
derivatives. Prodomain, large subunit (LS), and
small subunit (SS). b, immunofluorescence
analysis of IMR90-E1A cells overexpressing caspase-2 wt and its deleted
derivatives. IMR90-E1A cells after transfection with the relative constructs were
fixed and processed for the immunofluorescence analysis to visualize
caspase-2. Bar, 7 µm. c, in vitro
caspase-2 binding. A GST-caspase-2-prodomain (GST-caspase-2)
and GST as control, immobilized on glutathione-Sepharose beads, were
incubated with the in vitro translated products of the
indicated constructs. After washing, proteins bound to the beads were
evaluated by SDS-PAGE. d, IMR90-E1A cells were
co-transfected with the indicated constructs and pEGFPN1 as a reporter.
The appearance of the apoptotic cells was scored after 20 h from
transfection. Cells showing a collapsed morphology and presenting
extensive membrane blebbing were scored as apoptotic. Data represent
arithmetic means ± S.D. of four independent experiments.
e, IMR90-E1A caspase-9 DN cells were co-transfected with the
indicated constructs and pEGFPN1 as a reporter. After 20 h
immunofluorescence assay was performed using anti-cytochrome
c antibody. Cells co-expressing GFP and caspase-2 or
caspase-2-(1-152) were scored for cytochrome c release
from mitochondria. Data represent arithmetic means ± S.D. of
three independent experiments.
|
|
The subcellular localization of the overexpressed proteins was analyzed
using both the anti-caspase-2 and the anti-HA antibodies with similar
results. Representative cells are shown in Fig. 2b. Overexpressed caspase-2wt was detected as a diffused nuclear staining. Caspase-2-(1-27), lacking the bipartite NLS, was
mainly detected as a diffuse staining in the cytoplasm, but some
staining was also observed in the nucleus. Surprisingly, a larger
deletion of the amino terminus that removes the bipartite NLS and the
CARD-(1-104) showed a reduced cytoplasmic staining and a consistent
nuclear accumulation. At last, deletion of the prodomain-(1-152)
resulted, prevalently, in a diffused cytoplasmic localization of the
enzyme. A complex picture emerged when an isolated caspase-2 prodomain was overexpressed. Cells showed a diffuse staining both in the nucleus
and in the cytoplasm or present higher order structures such as
filaments and dots highly positive for caspase-2 (Fig. 2b,
153-435), as reported previously (22, 26).
By using the GST-caspase-2 prodomain, we developed an in
vitro pull-down assay to evaluate the ability to heterodimerize
the different deleted versions of caspase-2. GST-prodomain caspase-2 was incubated with different caspase-2 deleted forms obtained by
in vitro translation. In these experiments RAIDD/CRADD was used as a positive control. As represented in Fig. 2, caspase-2 and the
prodomain-(153-435) were able to interact with GST-prodomain caspase-2. On the contrary, neither one of the other deleted versions tested interacted with caspase-2 in this assay (Fig. 2c).
Because the shorter amino-terminal deletion (1-27) also alters the
CARD by removing the first 
-helix (35), it is possible that a
functional CARD is required for caspase-2 dimerization.
We next evaluated the killer activity of these caspase-2 deletions that
exhibit different subcellular localizations. Cell death activity was
analyzed in IMR90-E1A cells by co-transfecting caspase-2 or its deleted
versions together with GFP as a reporter, and the appearance of
apoptotic cells in vivo was analyzed 24 h later.
As outlined in Fig. 2d, caspase-2 wt and the deleted version
lacking the prodomain-(1-152) efficiently induced cell death. All
the other deleted versions of the prodomain only modestly induced cell
death, just like the catalytically inactive caspase-2, thus suggesting
that this minor apoptotic response might result from some secondary
effects due to the overexpression of an altered caspase-2.
The comparable cell death activity of caspase-2 wt and
caspase-2-(1-152) was unexpected. As described above,
caspase-2-(1-152) was unable to interact with GST-caspase-2
prodomain and thus supposed to be unable to oligomerize. Therefore, in
order to study if the apoptotic pathway triggered by caspase-2 was
similarly activated by caspase-2-(1-152), we investigated if
caspase-2-(1-152) was able to trigger cytochrome c
release from mitochondria as recently demonstrated for caspase-2 wt
(18). IMR90-E1A cells, containing a dominant negative form of
caspase-9, were used (31) because they are resistant to caspase-2
overexpression. Cytochrome c translocation was evaluated by
immunofluorescence analysis. As summarized in Fig. 2e,
IMR90-E1A caspase-9 DN cells overexpressing caspase-2 wt or 1-152
showed the same percentage of cytochrome c release in the
cytoplasm. This result confirms that a caspase-2 lacking the prodomain
induces cell death by acting upstream of cytochrome c
release, similarly to caspase-2 wt.
The Prodomain of Caspase-2 Contains a Second Nuclear Localization
Signal--
Previous studies have suggested that caspase-2 can also be
targeted to the nuclear compartment independently from the previous identified bipartite NLS (22). We have demonstrated that
caspase-2-(1-104), which lacks the bipartite NLS and the CARD,
still showed a prevalent nuclear localization. This observation
prompted us to investigate whether other potential NLS were present in
the prodomain of caspase-2. Other types of NLS described include those
found in the proto-oncogene c-myc (PAAKRVKLD) where
proline and aspartic acid residues flank a central basic cluster (36).
Sequence analysis revealed that this type of NLS is present in the
prodomain of caspase-2 between aa 131 and 143 (see Fig.
3a). To investigate the role
of this second NLS (NLS-II) in the nuclear localization of caspase-2, the two lysines at position 135 and 136 were replaced by two alanines (K135A/K136A).
View larger version (71K):
[in this window]
[in a new window]
|
Fig. 3.
Caspase-2 contains a second nuclear
localization sequence (NLS-II). a,
schematic representation of caspase-2 where the putative nuclear import
sequences (NLSs) are underlined. Prodomain, large
subunit (LS), small subunit (SS). b,
immunofluorescence analysis of IMR90-E1A cells overexpressing caspase-2
wt and its deleted or point-mutated derivatives. IMR90-E1A cells after
transfection with the relative constructs were fixed and processed for
the immunofluorescence analysis to visualize caspase-2. Bar,
7 µm. c, immunofluorescence analysis of IMR90-E1A cells
overexpressing -galactosidase or -galactosidase containing
caspase-2 NLS-II. IMR90-E1A cells after transfection with the relative
constructs were fixed and processed for the immunofluorescence analysis
to visualize -galactosidase. Bar, 7 µm. d,
in vitro caspase-2 binding. A GST-caspase-2-prodomain
(GST-caspase-2) and GST as control, immobilized on
glutathione-Sepharose beads, were incubated with the in
vitro translated products of the indicated constructs. After
washing, proteins bound to the beads were evaluated by SDS-PAGE.
e, IMR90-E1A cells were co-transfected with the indicated
constructs and pEGFPN1 as a reporter. The appearance of the apoptotic
cells was scored after 20 h from transfection. Cells showing a
collapsed morphology and presenting extensive membrane blebbing were
scored as apoptotic. Data represent arithmetic means ± S.D. of
four independent experiments. f, IMR90-E1A caspase-9 DN
cells were co-transfected with the indicated constructs and pEGFPN1 as
a reporter. After 20 h immunofluorescence assay was performed
using anti-cytochrome c antibody. Cells co-expressing GFP
and caspase-2 or caspase-2 K135A/K136A were scored for cytochrome
c release from mitochondria. Data represent arithmetic
means ± S.D. of three independent experiments.
|
|
Caspase-2 K135A/K136A showed a predominant diffuse cytosolic staining
when overexpressed in IMR90-E1A cells, even though some nuclear
staining, as above described for 1-27, was still detectable (Fig.
3b). In contrast, caspase-2 wt was exclusively nuclear under the same experimental conditions. This residual nuclear localization could be both ascribed to a simple diffusion in the nuclear compartment of the overexpressed protein, which size is behind the exclusion limits
of the nuclear pore, or to a residual nuclear import activity of the
remnant NLS.
To confirm that the nuclear localization of caspase-2-(1-104)
lacking NLS-I was dependent on NLS-II, we used a caspase-2-(1-104) fragment, where the lysines 134-135 were substituted with alanines. As
shown in Fig. 3b, whereas caspase-2-(1-104) was mainly
nuclear, caspase-2-(1-104) K135A/K136A showed a prevalent
cytosolic localization.
To determine whether the newly identified NLS-II could target a
cytosolic protein to the nucleus, a peptide containing NLS-II was fused
to the reporter protein -galactosidase. The immunofluorescence analysis demonstrated that -galactosidase containing the caspase-2 NLS-II was localized prevalently in the nucleus, and on the contrary -galactosidase lacking the caspase-2 NLS-II was localized
prevalently in the cytoplasm.
To characterize further the caspase-2 K135A/K136A mutant, we evaluated
its ability to dimerize in an in vitro pull-down assay using
GST-caspase-2 prodomain. Caspase-2 K135A/K136A was able to interact
with caspase-2 similarly to the wt form (Fig. 3c).
By having demonstrated that caspase-2 K135A/K136A was still able to
dimerize with caspase-2 and that it was impaired in the nuclear
localization, the next question was to study its killer activity.
A cell death assay was performed as described above, and the results
obtained are summarized in Fig. 3d. Caspase-2 K135A/K136A was able to induce cell death similarly to caspase-2 wt in IMR90-E1A cells, and moreover, caspase-2 wt and caspase-2 K135A/K136A showed similar capacity to induce cytoplasmic relocalization of cytochrome c in IMR90-E1A caspase-9 DN cells (Fig.
3e).
Subcellular Localization of Caspase-2 Fused to GFP in
Vivo--
The demonstration that the caspase-2 mutants (K135A/K136A
and 1-152), which showed a predominant cytoplasmic localization, were equally able to induce cell death and cytochrome c
release raises the question of a possible cytoplasmic function of
caspase-2 during apoptosis. To address this point, we decided to study
if ectopically expressed caspase-2 can relocalize from the nucleus into
the cytoplasm during cell death. Because this relocalization cannot be
unambiguously analyzed by biochemical fractionation, we decided to
monitor the subcellular localization of active caspase-2 during
apoptosis by confocal microscopy. We used a fusion of caspase-2 with
GFP at the carboxyl terminus (caspase-2-GFP) to visualize the proenzyme
and, after its processing, the active tetramer and a fusion of
caspase-2 with GFP at the amino terminus (GFP-caspase-2) to visualize
the proenzyme and, after its processing, the prodomain.
The ability of caspase-2-GFP and GFP-caspase-2 to undergo autocatalytic
activation was investigated by transient transfection in 293 cells.
Active caspase-2 is a tetramer consisting of two large 18-kDa subunits
and two small subunits of 14 or 12 kDa (Fig. 2a) (1, 37). We
used an antibody specific for the small subunit of caspase-2 in
immunoblot analysis to evaluate caspase-2 processing (Fig.
4a). Caspase-2-GFP and
GFP-caspase-2 both were detected as processed forms. Moreover, in the
case of caspase-2-GFP the molecular size of the small subunits was
increased as a consequence of the GFP. This indicates that the GFP,
when fused to the carboxyl terminus of caspase-2, assembles into the
active tetramer.
View larger version (76K):
[in this window]
[in a new window]
|
Fig. 4.
Subcellular localization of caspase-2 fused
to GFP in vivo. a, equal amount of 293 cell lysates transfected with pEGFP-N1-caspase-2
(caspase-2-GFP), pEGFP-C3-caspase-2
(GFP-caspase-2), or mock-transfected were subjected to
10-17.5% gradient SDS-PAGE. Immunoblotting was performed using
anti-carboxyl-terminal caspase-2 antibody. The asterisk
points to the endogenous caspase-2. b, time-lapse images of
a representative IMR90-E1A cell overexpressing caspase-2-GFP. Frames at
selected times after microinjection (as indicated) of a representative
cell injected with pEGFP-N1-caspase-2 (50 ng/µl) are shown.
Bar, 4 µm. c, time-lapse images of a
representative IMR90-E1A cell overexpressing GFP-caspase-2. Frames at
selected times after microinjection (as indicated) of a representative
cell injected with pEGFP-C3-caspase-2 (50 ng/µl) are shown.
Bar, 4 µm. d, localization of GFP-caspase-2 in
nuclear dots precedes cell death. A time-lapse sequence of cells
undergoing apoptosis following caspase-2 overexpression. Each
filled square represents a single cell at the time of the
death as established by nuclear collapse.
|
|
We next performed a time-lapse analysis to evaluate the ability of
GFP-caspase-2 and caspase-2-GFP to induce apoptosis. The time-lapse
analysis was performed in IMR90-E1A cells 30-60 min after
microinjection, and frames were collected every 2 min for 12 h.
Selected frames of a representative experiment, at the indicated times,
are shown in Fig. 4, b and c.
Caspase-2-GFP was detected as a diffuse nuclear staining with nucleolar
exclusion (Fig. 4b), similar to the untagged overexpressed caspase-2 as described above for fixed cells. Within 4 h after microinjection almost 90% of the overexpressing cells had died by
apoptosis as judged by nuclear fragmentation and membrane blebbing (data not shown).
A different scenario was observed when GFP-caspase-2 was overexpressed.
Initially, GFP caspase-2 was detected as a diffuse nuclear staining,
but at later time points (see Fig. 4c, 1.51) small dots were
observed in the nucleus containing GFP-caspase-2, which increased in
number and size over time (Fig. 4c, 2.41). These dots
resemble previously described (22) nuclear structures enriched in
caspase-2 prodomain observed in cultured cells after overexpression of
catalytic inactive caspase-2 or of the prodomain alone in fusion with
GFP. We have also noticed that these dots partially co-localize with
the promyelocytic leukemia oncogenic domain
(26)2 and that their
appearance anticipates cell death. The time dependence of apoptosis
induced by caspase-2 in relation to the appearance of the nuclear dots
containing caspase-2 is summarized in Fig. 4d. About 98% of
the cells die by apoptosis 100 min after the appearance of
caspase-2 in the nuclear dots. The occurrence of cell death shortly
after the appearance of caspase-2 in dot-like structures could
explain the failure to clearly observe these structures in transient
transfection experiment with untagged caspase-2. Because localization
of caspase-2-GFP in the nuclear dots was less evident, it is possible
that such dots are enriched in a processed form of caspase-2 consisting
of the prodomain but lacking the small subunit.
In summary, these experiments indicate that the fusion to GFP did not
affect the subcellular localization of caspase-2, its catalytic
activity, and its ability to induce cell death.
Subcellular Localization of Caspase-2 during Different Phases
of the Apoptotic Response--
At least two different phases can be
identified during apoptosis induced by caspase-2. An initial apoptotic
phase during which cytochrome c is released from the
mitochondria, but no significant alterations of the nuclear morphology
can be observed, and a late phase when drastic alterations of the
nuclear morphology are evident. Therefore, in order to evaluate
caspase-2 localization during early and late apoptosis, we performed a
triple immunofluorescence analysis in IMR90-E1A cells to visualize
caspase-2-GFP, cytochrome c, and nuclei. More than 300 cells
were analyzed in triplicate experiments, and the results obtained are
exemplified in Fig. 5. As expected in
non-apoptotic cells both caspase-2-GFP and GFP-caspase-2 were revealed
as a diffused nuclear staining (Fig. 5a). Again in cells at
an early apoptotic stage, as judged by cytochrome c release,
both caspase-2-GFP and GFP-caspase-2 were localized in the nucleus
(Fig. 5b). However, whereas caspase-2-GFP was prevalently detected as a diffused nuclear staining, GFP-caspase-2 was observed prevalently in nuclear dots, thus suggesting a different subnuclear localization of the active enzyme with respect to the prodomain.
View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5.
Caspase-2-dependent
cytochrome c release from mitochondria. IMR90-E1A
cells were injected with pEGFP-N1-caspase-2 (caspase-2-GFP)
or with pEGFP-C3-caspase-2 (GFP-caspase-2) (20 ng/µl). After 3 h cells were fixed and processed for
immunofluorescence to visualize caspase-2-GFP, cytochrome c
(Cyt-c), and GFP-caspase-2. Nuclei were stained with
propidium iodide (PI). Images were obtained using a Leica
TCS confocal microscopy and are displayed in pseudocolors.
a, non-apoptotic cells; b, cells in a early
apoptotic phase; c, cells in a late apoptotic phase.
Bar, 8 µm.
|
|
Caspase-2-GFP can be observed both in the nucleus and in the cytoplasm
(Fig. 5c, caspase-2-GFP, arrowheads) in cells at
late apoptotic phase, as judged by nuclear morphology (Fig.
5c, PI), whereas GFP-caspase-2 was prevalently
localized to the nuclear compartment (Fig. 5c,
GFP-caspase-2).
Even in IMR90-E1A caspase-9 DN cells, release of cytochrome
c following caspase-2 activation occurs in the absence of
relocalization of the enzyme in the cytoplasm (data not shown).
The Subcellular Localization of Ran but Not Nuclear Pores Were
Altered by Caspase-2--
The above-described studies suggest that
caspase-2 can trigger mitochondrial dysfunction from the nucleus and
that, only during the final events of the apoptotic process,
active caspase-2 can translocate, at some extent, into the cytoplasm.
How can caspase-2 trigger cytochrome c release from the nucleus?
In eukaryotic cells macromolecular traffic between
the nucleus and the cytoplasm can occur by simple diffusion, for
particles of less than 50/60 kDa, or mediated by soluble transport
receptors that shuttle through the nuclear pore complex (NPC) for
larger molecules (38). Cargo molecules are recognized via import or export targeting signals by the transport receptors, which are able to
associate with components of the NPC (39). The small GTPase Ran is
highly enriched in the nucleus in its GTP-bound form, and it regulates
nuclear-cytoplasmic transport (40). Ran-GTP binds to importins,
inducing the release of imported cargo, on the other side exportins
interact with their substrates only in the nucleus in the presence of
Ran-GTP, and they release the substrates in the cytoplasm after GTP
hydrolysis (41).
The translocation of the apoptotic signal triggered by caspase-2 from
the nucleus to the mitochondria could occur (i) by simple diffusion,
(ii) by regulated nuclear export, and (iii) by increased diffusion
(i.e. by increasing the diffusion limits of the nuclear pores).
Interestingly in apoptotic cells the diffusion limit of the nuclear
pores is increased, thus allowing the redistribution throughout the
cell of soluble proteins normally restricted to the nucleus or to the
cytoplasm (42). In addition in apoptotic cells Ran subcellular
localization is altered, thus suggesting a dysfunction of nuclear
transport (42, 43)
Therefore, in order to investigate how nuclear localized caspase-2
could trigger cytochrome c release, we first evaluated if
caspase-2 could regulate Ran localization and nuclear pores status. We
used Bid translocation to the mitochondria as marker of caspase-2
activation (18).
pcDNA3-caspase-2 and pGFPN1Bid were co-expressed by nuclear
microinjection in IMR90-EIA. Cells were fixed 3 h later and
processed for immunofluorescence to visualize Bid-GFP, nuclei, and p62, a component of the plug of the nuclear pores and a marker for nuclear
pore integrity (42) (Fig. 6a)
or Bid-GFP, nuclei, and Ran (Fig. 6b).
View larger version (58K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of caspase-2 on nuclear pores and Ran
gradient. a, IMR90-E1A cells were injected with
pcDNA3HA-caspase-2 (50 ng/µl) and pEGFP-N1-Bid (5 ng/µl). After 3 h cells were fixed and processed for
immunofluorescence to visualize Bid-GFP and the nuclear pore protein
p62. Nuclei were stained with propidium iodide (PI). Images
were obtained using a Leica TCS confocal microscopy and are displayed
in pseudocolors. Bar, 7 µm. b, IMR90-E1A cells
were injected with pcDNA3HA-caspase-2 (50 ng/µl) and
pEGFP-N1-Bid (5 ng/µl). After 3 h cells were fixed and processed
for immunofluorescence to visualize Bid-GFP and the GTPase Ran. Nuclei
were stained with propidium iodide (PI). Images were
obtained using a Leica TCS confocal microscopy and are displayed in
pseudocolors. Bar, 7 µm. c, IMR90-E1A caspase-9
DN cells were injected with pcDNA3HA-caspase-2 (50 ng/µl) and pEGFP-N1-Bid (5 ng/µl). After 3 h cells were fixed
and processed for immunofluorescence to visualize Bid-GFP and the
GTPase Ran. Images were obtained using a Leica TCS confocal microscopy
and are displayed in pseudocolors. Bar, 7 µm.
d, quantitative analysis of Ran distribution on IMR90-E1A
caspase-9 DN cells overexpressing caspase-2 and Bid-GFP. 200 cells were
analyzed, and the subcellular localization of Ran was scored in
relation to Bid-GFP distribution.
|
|
The antibody against p62 similarly detected the nuclear rim in cells
presenting Bid-GFP as a diffuse staining or translocated to
mitochondria, thus excluding overt alterations of the nuclear pores. As
expected a large part of Ran was concentrated in the nucleus in cells
presenting a diffuse localization of Bid-GFP. On the contrary Ran was
distributed throughout the cell and therefore released from the nucleus
in cells presenting Bid translocated to the mitochondria (Fig.
6b).
Caspase-2 can induce Bid translocation and cytochrome c
release independently from caspase-9; therefore the relocalization of
Ran was assayed in IMR90-E1A caspase-9 DN. As shown in Fig. 6c and summarized in Fig. 6d, caspase-2 can
induce redistribution of Ran from the nucleus to the cytoplasm
independently from caspase-9, and this event correlates with the
translocation of Bid to the mitochondria.
Nuclear Caspase-2 Can Modulate Mitochondrial Integrity without
Altering the Nuclear/Cytoplasmic Barrier--
The above-described
studies do not exclude a possible effect of caspase-2 on the diffusion
limits of the nuclear pore that could not be evidenced by p62 staining.
To test this hypothesis we investigated the ability of caspase-2 to
alter the diffusion limits of the nuclear pores. Fluorescent 66-kDa
dextran, which does not diffuse passively through the nuclear pores,
can be used as marker for nuclear breakdown in living cells (44). Here
again, because caspase-9 is described to directly or indirectly disrupt the nuclear-cytoplasmic barrier, we decided to investigate if caspase-2
can specifically alter the permeability of the nuclear barrier in cells
lacking caspase-9 activity. The nuclei of IMR90-E1A caspase-9 DN cells
were injected with pcDNA3-caspase-2, dextran-TRITC 66-kDa, and
pGFP-Bid. 4 h later cells were fixed to visualize Bid-GFP and
dextran. As expected, in cells showing Bid-GFP in its unprocessed form
(diffuse nuclear and cytosolic distribution), the 66-kDa dextran showed
a nuclear localization (Fig.
7a). The same nuclear
localization of the 66-kDa dextran was preserved in cells showing
Bid-GFP translocated to the mitochondria. Similar results were obtained
when caspase-2-GFP was co-expressed with dextran-TRITC 66-kDa, and
caspase-2 activation was evaluated by cytochrome c
distribution (Fig. 7b). Hence nuclear caspase-2 can trigger
mitochondrial dysfunction without altering the nuclear/cytoplasmic barrier.
View larger version (60K):
[in this window]
[in a new window]
|
Fig. 7.
Caspase-2 can induce cytochrome c
release without altering the nuclear/cytoplasmic barrier.
a, IMR90-E1A caspase-9 DN cells were injected with
pcDNA3HA-caspase-2 (50 ng/µl), pEGFP-N1-Bid (5 ng/µl), and 66-kDa dextran (1 mg/ml). After 3 h cells were
fixed and processed for immunofluorescence to visualize Bid-GFP
and dextran. Images were obtained using a Leica TCS confocal
microscopy. Bar, 1 µm. b, IMR90-E1A caspase-9
DN cells were injected with pEGFP-N1-caspase-2 (20 ng/µl) and 66-kDa dextran (1 mg/ml).
After 3 h cells were fixed and processed for immunofluorescence to
visualize caspase-2-GFP, dextran and cytochrome c. Images
were obtained using a Leica TCS confocal microscopy. Bar, 1 µm.
|
|
Caspase-2 Can Induce Cytochrome c Release and Apoptosis in the
Presence of Leptomycin B--
Nuclear pore complex protein CRM1 is
able to recognize specific nuclear export sequences and mediate nuclear
export from the nucleus (45). CRM1 is the target of the cytotoxic LMB.
By direct binding to CRM1, LMB disrupts nuclear export
sequence-dependent nuclear export. To understand if active
nuclear export mediated by CRM1 could be implicated in triggering
cytochrome c release once caspase-2 is activated in the
nucleus, we investigated the effect of LMB on cytochrome c
release in cells overexpressing caspase-2. IMR90-E1A caspase-9 DN cells
were pretreated with LMB (5 ng/ml) 2 h before microinjection with
plasmid encoding GFP-caspase-2. After further incubation for 3 h
in the presence of LMB cells were fixed and processed for
immunofluorescence. As shown in Fig. 8a, release of cytochrome
c after activation of caspase-2 was independent from LMB
treatment. Fig. 8b represents the quantitative analysis.
Under the same experimental conditions LMB was able to inhibit the
nuclear export of I
B- (Fig. 8c) (45).
View larger version (70K):
[in this window]
[in a new window]
|
Fig. 8.
Caspase-2-mediated release of cytochrome
c from mitochondria is independent from LMB.
a, IMR90-E1A caspase-9 DN after 2 h of pretreatment
with LMB were microinjected with pEGFP-C3-caspase-2 incubated for a
further 3 h in the presence or absence of LMB and then processed
for immunofluorescence to visualize cytochrome c and GFP
caspase. Control cells were grown in the absence of LMB.
Bar, 5 µm. b, quantitative analysis of the
effect of LMB on caspase-2-mediated release of cytochrome c
from mitochondria. Data represent arithmetic means ± S.D. of
three independent experiments. c, IMR90-E1A caspase-9 DN
cells after 2 h of pretreatment with LMB were microinjected with
pcDNA3IB- incubated for a further 3 h in the presence of
LMB and then processed for immunofluorescence to visualize IB-.
Control cells were grown in the absence of LMB.
|
|
Disruption of the Nuclear/Cytoplasmic Barrier during the Late Phase
of the Apoptotic Process Could Permit Caspase-2 Translocation into the
Cytoplasm--
To clarify the mechanism by which active caspase-2 can
exit from the nucleus during the late apoptotic phase (see Fig.
5c), we analyzed the diffusion limits of the
nuclear/cytoplasmic barrier in vivo throughout the apoptotic
process triggered by caspase-2.
pGFPN1-caspase-2 and 66-kDa TRITC dextran were microinjected in the
nucleus of IMR90-EIA cells, and soon afterward the cells were subjected
to a time-lapse analysis. Frames were collected every 2 min during an
8-h period. Selected frames of a representative experiment, at the
indicated times, are shown in Fig.
9a.
View larger version (57K):
[in this window]
[in a new window]
|
Fig. 9.
An increase of the diffusion limits of the
nuclear pore is a late event during the apoptotic response elicited by
caspase-2. a, time-lapse images of a representative
IMR90-E1A cell double-stained for caspase-2-GFP and dextran. Frames at
selected times after microinjection (as indicated) of a representative
cell injected with pEGFP-N1-caspase-2 (20 ng/µl) and 66-kDa dextran
(1 mg/ml) are shown. Bar, 2 µm. b, time-lapse
images of a representative IMR90-E1A caspase-9 DN cell double-stained
for caspase-2-GFP and dextran. Frames at selected times after
microinjection (as indicated) of a representative cell injected with
pEGFP-N1-caspase-2 (20 ng/µl) and 66-kDa dextran (1 mg/ml) are shown.
Bar, 2 µm. c, time-lapse images of a
representative IMR90-E1A caspase-9 DN cell double-stained for Bid-GFP
and dextran. Frames at selected times after microinjection (as
indicated) of a representative cell injected with
pcDNA3HA-caspase-2 (50 ng/µl), pEGFP-N1-Bid (5 ng/µl), and 66-kDa dextran (1 mg/ml) are shown. Bar, 2 µm.
|
|
Caspase-2-GFP and dextran were well confined in the nucleus even though
alterations of the nuclear morphology, indicative of the apoptotic
process, were evident (starting from 2.30 h after microinjection).
Localization of the 66-kDa dextran into the cytoplasm was first
detected after 2.36 h and was more evident 2.42 h after microinjection. During the same time points caspase-2-GFP was more
confined in the altered nucleus relative to the 66-kDa dextran. This
observation might suggest that a fraction of caspase-2-GFP was not
soluble at the indicated time points.
The time-lapse studies indicate that apoptosis triggered by caspase-2
in IMR90-E1A could induce alterations of the nuclear permeability,
possibly as a consequence of caspase-9 activation (42). We next wanted
to study if caspase-2 could alter nuclear permeability also
independently from caspase-9. To this end pGFPN1-caspase-2 and 66-kDa
TRITC dextran were microinjected in the nucleus of IMR90-EIA caspase-9
DN, and soon afterward cells were subjected to the time-lapse analysis.
Frames were collected every 2 min during an 8-h period. Selected frames
of a representative experiment at the indicated times are shown in Fig.
9b.
Caspase-2 and the 66-kDa dextran were well confined in the nucleus up
to 4.00 h after microinjection. Some dextran staining can be
observed in the cytoplasm 4.50 h after microinjection. This
becomes more evident at later time points and parallels a decreased
signal in the nucleoplasm (see Fig. 9b, 5.20 h
after microinjection). Here again, although some caspase-2-GFP can
relocalize into the cytoplasm, it is more confined in the nucleus with
respect to the 66-kDa dextran during the same time course. Again, this observation might suggest that a fraction of nuclear caspase-2-GFP was
not soluble at the indicated time points. It is important to note that
the described time schedule can differ among cells. These differences
probably reflect a differential responsiveness of IMR90-E1A cells to
caspase-2 overexpression (data not shown).
To establish clearly the timing of caspase-2 activation in relation to
the increased permeability of the nuclear barrier, we used Bid-GFP as a
reporter for caspase-2 activation. pcDNA3-caspase-2, pGFPN1Bid, and
dextran-TRITC were co-expressed by nuclear microinjection in IMR90-EIA
caspase-9 DN cells, and soon after microinjection cells were subjected
to time-lapse analysis. Frames were collected every 2 min during the
period of 8 h. Selected frames of a representative experiment, at
the indicated times, are shown in Fig. 9c.
We observed translocation of Bid-GFP to the mitochondria as early as
4 h after microinjection (see Fig. 9c,
arrowhead 4.01-4.15). During the same time course the first
evidence of an effect of caspase-2 on the nuclear diffusion limits can
detected 2 h later (see Fig. 9c, arrowhead
5.47 and 5.51) with the appearance of the dextran
staining in the cytoplasm. Taken together these results demonstrate
that the alteration of the nuclear/cytoplasmic barrier is a late event
triggered by caspase-2.
Here again it is important to note that the schedule of Bid-GFP
translocation and of dextran release from the nucleus can differ among
cells (data not shown).
| |
DISCUSSION |
The proteolytic machinery controlling apoptosis includes numerous
caspases that are localized in different subcellular compartments and
play specific roles during the regulative and the executive phases of
the cell death process (3-5).
The subcellular localization of caspase-2 is still debated. By means of
immunofluorescence analysis endogenous caspase-2 was observed in the
cytosol, in the nucleus, and in the Golgi (20, 25), whereas ectopically
expressed caspase-2 accumulated mainly in the nucleus (22, 26). A
different study, using subcellular fractionations, has indicated a
prevalent cytosolic localization of endogenous caspase-2 (24). Our
immunofluorescence studies support a nuclear localization for both
endogenous and ectopically expressed caspase-2. In contrast, upon
subcellular fractionation a large amount of caspase-2 was detected in
the cytoplasm. We analyzed the subcellular localization of
caspase-2-GFP both by fractionation and by confocal microscopy and
present data strongly suggesting that the cytosolic localization of
caspase-2, observed after fractionation, might be ascribed to a
dissociation of caspase-2 from the nuclei during the experimental
procedure. However, we cannot exclude that the nuclear import of
caspase-2 could be regulated thus making possible its accumulation in
the cytoplasm in certain cell types (20). Further studies are necessary
to unambiguously answer this point.
The bipartite NLS present within the amino-terminal 44-amino acid
residues is necessary for the nuclear localization of caspase-2 (22,
26). In the current study we have confirmed that this sequence is a
critical NLS of caspase-2, and in addition we have identified a second,
previously unrecognized NLS within the prodomain of caspase-2. The
existence of a second NLS was suggested by Colussi et al.
(22) to explain the failure of the amino-terminal 44-amino acid
sequence to drive the nuclear localization of a reporter protein. This
second NLS (NLS-II) is placed between aa 131 and 143 (PLYKKLRLSTD) and
resembles the NLS of the proto-oncogene c-myc, where proline
and aspartic acid residues define a central basic cluster (36). Our
present study shows that NLS-II can drive the nuclear import of a
cytoplasmic protein. The two separate NLSs present in the prodomain of
caspase-2 could functionally collaborate with each other, and thus
provide the cells with greater versatility in regulating caspase-2
nuclear import.
The prodomain of caspase-2 also contains the CARD, which is composed by
six antiparallel amphipathic -helices, and mediates homophilic
interactions, thus triggering proenzyme activation (35, 46). Caspase-2,
containing deletions or alterations of the CARD, was impaired in
inducing cell death. Surprisingly, a caspase-2 without the
prodomain-(1-152) was able to induce cell death and cytochrome
c release similarly to the wt form, whereas a shorter
deletion of the prodomain-(1-104) was impaired in inducing cell
death. Previous studies (47) have shown that murine
caspase-2-(1-138), which corresponds to human
caspase-2-(1-121), was also unable to induce cell death. Therefore,
it is possible that the prodomain contains an inhibitory domain, which
should be located between aa 104 and 151 likely between aa 121 and 151. An inhibitory effect of the prodomain was previously suggested by the
observation that active recombinant caspase-2 could be obtained by
expressing in E. coli a fragment lacking the
prodomain-(1-152). Expression of full-length caspase-2 did not show
proteolytic activity even though it was processed into a prodomain
large subunit and a small subunit (37). It is interesting to note that
an autoinhibitory domain has been recently discovered in procaspase-3.
Caspase-3 is under strict regulatory self-control by a "safety
catch" Asp-Asp-Asp tripeptide, contained within the proenzyme itself
(48).
The identity of apoptotic signals specifically activating caspase-2 is
unknown. However, upon ectopic expression, one can artificially
activate caspase-2, possibly as consequence of the forced
oligomerization. This phenomenon has allowed us to study the apoptotic
signals originated by caspase-2 in the nucleus.
We have observed that activated caspase-2 can trigger the release of
cytochrome c from the nucleus, and only at a later phase can
the active enzyme partially translocate into the cytoplasm.
Caspase-2 triggered the release of cytochrome c in the
cytoplasm when (i) active caspase-2 was still confined in the nucleus, (ii) no changes of the diffusion limits of the nuclear pores were evident, (iii) Ran accumulated in the cytoplasm, and (iv) the CRM1-dependent nuclear export was inhibited by LMB treatment.
These observations can be explained with two hypothetical mechanisms as
follows: a nuclear factor, regulated by caspase-2, may exit the nucleus
by a CRM1-independent pathway, or alternatively, the nuclear factor may
translocate to the cytoplasm by simple diffusion.
In a simple model system the nuclear factor should be cleaved directly
or indirectly by caspase-2, and once cleaved it should be able to exit
the nucleus and to propagate the signal to the mitochondria.
Unfortunately, the number of known death substrates, cleaved by
caspase-2, is limited. Besides caspase-2 autocatalysis, it has been
reported that caspase-2 can cleave Golgin-160 and Bid (18, 25, 49).
Golgin-160 is a peripheral Golgi membrane-associated protein, and
therefore its involvement in transferring the apoptotic signal from the
nucleus to the cytoplasm is unlikely. Bid has been localized in the
cytosol by subcellular fractionation (50). Nevertheless, when
overexpressed as GFP fusion or epitope-tagged (18, 49, 51), it can be
localized throughout the cell including the nuclear compartment where
it probably accumulates by simple diffusion. Interestingly the
time-lapse analysis, reported in this work, has demonstrated that,
after caspase-2 activation, nuclear localized Bid-GFP can efficiently
relocalize to mitochondria (Fig. 9c). If endogenous Bid can
localize, at some extent, in the nuclear compartment it might represent
a caspase-2 substrate, which bears the requested characteristics for
transducing a caspase-2 apoptotic signal to the mitochondria. The
presence of Bid both in the nucleus and in the cytoplasm might also
explain the ability of the cytoplasmic localized mutants of caspase-2
(K135A/K136A and 1-152) to efficiently induce cell death and
cytochrome c release. However, it is clear that it will be
necessary to characterize new caspase-2 substrates to answer this question.
During the late apoptotic phase, coupled to nuclear fragmentation,
caspase-2 can relocalize at some extent in the cytoplasm. When present
in the cytoplasm active caspase-2 could cleave new death substrates
such as Golgin-160, thus contributing to the dismantling of the
apoptotic cell.
The nuclear pore complex spans both membranes of the nuclear envelope
and allows the receptor-mediated transport of macromolecules and the
passive exchange of ions, metabolites, and intermediate sized
macromolecules (52). The NPC harbors an ~10-nm diameter diffusion
channel that admit polypeptides of around 50-kDa (38, 53). Processed
caspase-2 is supposed to be a tetramer of about 60-64 kDa in its
uncomplexed form (37, 47). This implies that processed caspase-2, even
though not complexed to other proteins, cannot exit the nucleus by diffusion.
Caspase-9 directly or indirectly is responsible for increasing nuclear
permeability during apoptosis, which is due to alterations of nuclear
pores (42). Caspases can cleave some nuclear pore elements, thus
suggesting a possible mechanism for the increase of the nuclear
diffusion limit (42, 43, 54), but alternative mechanisms could also be
evoked (55). We found that caspase-2 can increase the nuclear diffusion
limits. This effect was shown to be independent from caspase-9,
indicating that caspase-2 can activate alternative pathways to increase
nuclear permeability.
One possibility is that caspase-2 might cleave directly some of the
more than 50 proteins of the vertebrate nuclear pore complex (38, 56).
However the observed delay, ~2.00 h, between caspase-2 activation, as
indicated by Bid-GFP processing, and the diffusion of dextran out of
the nucleus, argues against a direct processing of the nuclear pore
components by caspase-2. Hence we suggest an indirect effect of
caspase-2 on the nuclear-cytoplasmic barrier.
In conclusion our data clarify the subcellular localization of
caspase-2 and demonstrate the existence of two NLSs regulating its
nuclear import. Active caspase-2 can mediate cytochrome c release from the nucleus thus indicating the existence of a
nuclear/mitochondrial apoptotic pathway.
§¶
,
TOP
ABSTRACT
INTRODUCTION
Fondazione Italiana per la Ricerca sul Cancro fellow.
