|
Originally published In Press as doi:10.1074/jbc.M109046200 on February 1, 2002
J. Biol. Chem., Vol. 277, Issue 18, 15241-15251, May 3, 2002
Alternative Splicing of the Adenylyl Cyclase Stimulatory
G-protein G s Is Regulated by SF2/ASF and Heterogeneous
Nuclear Ribonucleoprotein A1 (hnRNPA1) and Involves the Use of an
Unusual TG 3'-Splice Site*
Alison J.
Pollard ,
Adrian R.
Krainer§,
Stephen C.
Robson, and
G. Nicholas
Europe-Finner
From the Department of Obstetrics and Gynaecology, University of
Newcastle upon Tyne, Royal Victoria Infirmary, Richardson Road,
Newcastle upon Tyne, NE1 4LP, United Kingdom
Received for publication, September 19, 2001, and in revised form, January 30, 2002
 |
ABSTRACT |
The factors involved in regulating alternative
splicing of the human adenylyl cyclase stimulatory G-protein
G s in different cell types remain undefined. We
have designed a G s minigene that retains the signals
required for G s alternative splicing in
vivo. Employing transient transfection of human myometrial smooth
muscle cells and HeLa cells, as well as in vitro splicing
assays, we have provided evidence that the antagonistic splicing
factors SF2/ASF and hnRNPA1 act as potent regulators of
G s isoform expression in these cells. Both SF2/ASF and
hnRNPA1 control the selection of competing 5'-splice sites and
respectively promote inclusion or skipping of the small cassette-type
exon 3 of G s transcripts, resulting in the generation of
G s-long and G s-short mRNA isoforms. We have also provided evidence that SF2/ASF and hnRNPA1 play a role in
3'-splice site selection involving the use of a non-canonical TG
3'-splice site preceding exon 4. Using a score-matrix analysis to
identify putative exonic enhancer sequences (ESEs), we found multiple
high score ESE motifs for SF2/ASF, SC35, and SRp40 in exon 3 of
G s. These results suggest that tissue-specific
expression of SF2/ASF and hnRNPA1 governs the expression of alternative
isoforms of G s in these different cells types.
 |
INTRODUCTION |
The GTP-binding protein G s is the primary
stimulatory component of adenylyl cyclase in most cell types and has
also been associated with activation of dihydropyridine-sensitive
voltage-gated calcium channels (1) in skeletal muscle as well as
inactivation of cardiac sodium channels (2). Two ubiquitously expressed forms of G s have been identified via ADP-ribosylation
with cholera toxin or by Western blotting (3, 4). These proteins
migrate in SDS-PAGE with apparent molecular masses of 52 and 45 kDa,
depending on the experimental conditions, and have been designated the
long and short isoforms of G s, respectively (3-5). Both
isoforms of G s are generated by alternative splicing of
a single precursor mRNA transcript.
In humans, a single copy of the G s gene is found on
chromosome 20 and is composed of 13 exons separated by 12 introns,
altogether spanning a 20-kb region of genomic DNA (6). Cloning of the human G s gene and G s complementary DNAs
showed that the short form of G s is distinguished from
the long form by the exclusion of the 45-bp exon 3, which encodes 15 amino acids. Similar studies have pointed to the existence of two
additional G s mRNA species. These isoforms may be
produced by the use of an unusual alternative TG 3'-splice site,
instead of the consensus AG 3'-splice site upstream of exon 4, resulting in the inclusion of an extra triplet coding for a serine
residue after amino acids 87 and 72 of the long and short forms of
G s, respectively (6) (Fig.
1). It has been suggested that inclusion
of this extra serine residue into G s proteins confers
additional consensus sequence sites for phosphoregulation by protein
kinases C and A (7, 8). Tissue-dependent alternative
splicing of the G s precursor transcript may therefore
result in the expression of two long and two short forms of
G s, depending upon the presence or absence of the extra serine residue. Initially, it was thought that these isoforms were the
only splicing products of the G s gene; however, several other variants (reviewed in Ref. 9) have been observed involving the
novel exons A and/or B upstream from exon 2, which are generated either
by alternative splicing or by use of an alternative promoter. Remarkably, the use of an alternative TG 3'-splice site in splicing of
human G s pre-mRNA appears to occur also in
Drosophila melanogaster (10). In this organism, alternative
splicing of intron 7 of the G s gene, involving the use
of either a non-consensus TG or a consensus AG 3'-splice site, results
in transcripts that code for either a long or short form of
G s. These protein species differ by inclusion or
exclusion of three amino acids and substitution of serine for a glycine
residue.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Exon/intron organization map of exons 2-4 of
the human G s gene.
Constitutively spliced exons (2 and 4) are represented by open
boxes and the alternatively spliced exon 3 by a hatched
box. In addition to the consensus 3'-splice site AG preceding exon
4, G s has an non-canonical 3'-splice site TG. Use of the
TG 3'-splice site incorporates an additional CAG triplet into the
spliced mRNA, resulting in an extra serine residue (shaded
box). The four individual protein isoforms generated from
inclusion and skipping of exon 3 with or without the extra serine
residue are shown.
|
|
There is evidence to suggest that the various isoforms of
G s have different regulatory functions. Sternweis
et al. (11) used partially purified preparations of long and
short isoforms of G s from rabbit liver and found that
the larger species has a greater ability to support hormone-stimulated
adenylyl cyclase activity. Yagami (12) studied the interaction of
G s species with -adrenergic receptors in liver plasma
membranes and found that the receptors were preferentially coupled to
the long G s isoform. More recently, Unson et
al. (13) showed that the long and short forms of G s
interact differently with the glucagon receptor, such that specific
coupling of the receptor to the long G s isoform results
in 10-fold higher binding affinity for glucagon. Furthermore, there is
substantial evidence that expression of alternatively spliced isoforms
of G s differs in various tissues. For instance, the long
form of G s predominates in cerebellum, cortex, kidney,
adrenal medulla, and placenta, whereas the short form is predominant in
platelets, liver, neostriatum, and heart (9). Dramatic changes in
steady state mRNA and protein levels of G s isoforms
have also been observed during ontogenetic development, aging, cellular
differentiation, and pathophysiological states such as obesity,
hypertension, diabetes, and alcoholism (9). Further evidence for
variable isoform expression was obtained in the human myometrium, where
short and long G s isoforms were found to be
significantly increased during gestation and subsequently down-regulated during labor, associated with a concomitant increase and
decrease in adenylyl cyclase activity (5, 14).
The above observations support the premise that expression of
alternative spliced isoforms of G s is regulated in a
tissue-specific manner, depending on the activity requirements of the
individual tissue or cell type and, as such, is controlled at the
pre-mRNA processing level by the splicing machinery. However, the
regulatory trans-acting factors and cis-elements
involved in modulating expression of the four potential spliced
isoforms of G s have not been elucidated.
In general, alternative precursor mRNA splicing is regulated by
trans-acting splicing factors, which include the
ubiquitously expressed small nuclear ribonucleoproteins, the
serine/arginine-rich (SR)1
family of nuclear phosphoproteins, and the heterogeneous nuclear ribonucleoproteins (hnRNPs) (15, 16). Variations in concentrations and
ratios of specific splicing factors present in different cell types and
tissues have also been shown to be a determinant in controlling
pre-mRNA processing (17-19), and it has been suggested that
individual splicing factors are specific for a particular pre-mRNA
or the tissue type in which it is expressed. SF2/ASF, an SR protein
family member, has been well characterized as a key factor involved in
5'-splice site determination in alternative splicing and has also been
shown to affect 3'-splice site selection in vitro (20-22).
Several studies have shown that variations in the concentration of
SF2/ASF can influence which 5'-splice site is selected (21-23).
hnRNPA1 has also been comprehensively studied in combination with
SF2/ASF (24-26), such that subtle changes in the concentrations of
these two proteins can define the formation of different spliced
mRNA isoforms derived from a number of precursor mRNA species.
SF2/ASF and hnRNPA1 have an antagonistic relationship and can
counteract each other in a concentration-dependent manner. Increased expression of SF2/ASF generally activates proximal
(downstream) 5'-splice sites, whereas increased expression of hnRNPA1
usually activates distal (upstream) 5'-splice sites (23, 24, 27). This
switching of splice site usage also occurs after overexpression of
these proteins in vivo; when tested with a range of
alternatively spliced reporter genes, the proteins promote the expected
changes in exon skipping and inclusion (23, 26, 28). In this context, changes in the tissue levels of SF2/ASF and hnRNPA1 have recently been
described by Pollard et al. (29), who demonstrated that expression of these specific splicing factors is both spatially and
temporally regulated in the human myometrium during fetal maturation.
This finding further supports the premise that concentration ratios of
SF2/ASF to hnRNPA1 in vivo may therefore be critical in
defining the expression of specific protein isoforms in different tissues. Several studies have also indicated that cis-acting
elements within exons can function as splicing enhancers and contribute to the accuracy and efficiency of alternative splicing when bound by
specific trans-acting factors (30-32). Purine-rich splicing enhancer sequences (ESEs) have been identified in exons from a number
of different tissue-specific or developmentally regulated precursor
mRNA species (33, 34). These and other degenerate short RNA
sequences, which are recognized by one or more SR proteins, are capable
of influencing 5'- and 3'-splice site selection by affecting the
activity of weak splice sites in adjacent introns (32, 35, 36).
Consequently, to determine the trans-acting factors involved
in regulating expression of alternatively spliced isoforms of G s in different cell types, we have designed a human
G s minigene construct that incorporates intronic and
exonic regulatory cis-elements associated with
G s alternative splicing in vivo. Transfection of human myometrial smooth muscle cells and HeLa cells in culture with
this G s minigene and plasmids coding for SF2/ASF and
hnRNPA1, in conjunction with in vitro splicing assays,
strongly implicate these antagonistic splicing factors in regulating
G s expression in human tissues and cells. Overexpression
of SF2/ASF and hnRNPA1 promoted inclusion and skipping of exon 3 of
G s, respectively, which not only involved the use of the
consensus AG 3'-splice site preceding exon 4 but also of an unusual TG
3'-splice site immediately upstream. Moreover, motif-prediction
analysis based on randomization and functional selection of sequences
with enhancer activity (37) enabled us to identify putative elements
recognized by other members of the SR protein family in antagonizing
hnRNPA1 to control long and short G s isoform expression.
 |
EXPERIMENTAL PROCEDURES |
Plasmid Construction--
The G s minigene
splicing construct (pcDNA3.1G s) was generated from
human genomic DNA using specific G s PCR primers,
containing specific restriction sites, for the individual exon/intron
fragments of G s to facilitate the sequential insertion
of each fragment into the pcDNA3.1 expression vector (Invitrogen),
as shown in Fig. 2A. These
primers amplify G s exons 2-4, together with truncated versions of their adjacent intronic sequences. The DNA sequence for the
human G s gene has been described previously (6).
Briefly, the first fragment, consisting of the 73-bp exon 2 and the
first 87 bp (of 3258 bp) of intron 2, was amplified by PCR using
Pfu polymerase with primers A and B (see Fig. 2B
for full details of all primers used). The second fragment, consisting
of the last 132 bp of intron 2, the 45-bp exon 3, and the first 85 bp
(of 4547 bp) of intron 3, was then generated using primers C and D. The
third fragment, consisting of the last 76 bp of intron 3 and the 55-bp
exon 4, was amplified using primers E and F. PCR products were
individually cloned into the TOPO®-TA cloning vector (Invitrogen) and
sequenced to confirm exon/intron DNA sequences and ensure that the
necessary cis-acting regulatory signals were present. Each
G s fragment was then subcloned sequentially into
pcDNA3.1 by repeated restriction digestion and ligation using T4
DNA ligase (Promega) as shown in Fig. 2A to generate the
complete pcDNA3.1G s minigene splicing construct,
which is under transcriptional control of the cytomegalovirus promoter
(Fig. 2A, P1) and contains the bGH
polyadenylation signal. Plasmids encoding splicing factors SF2/ASF (pCG-SF2) and hnRNPA1 (pCG-A1) have been described
(23).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
Schematic diagram showing subcloning
procedure to generate G s minigene
splicing construct consisting of exons 2, 3, and 4, together with their
flanking intronic sequences. A, individual exon/intron
fragments were amplified from human genomic DNA using
G s-specific primers that contain specific restriction
sites as shown. The plasmid pcDNA3.1 was initially linearized with
NheI and XhoI, and the first G s
fragment of exon 2 and 87 bp of intron 2 (with NheI and
XhoI restriction sites at the 5'- and 3'-ends, respectively)
inserted. The subcloning procedure was then repeated using
XhoI and EcoRV to facilitate insertion of the
second G s fragment (132 bp of intron 2, exon 3, and 85 bp of intron 3), and the third fragment (76 bp of intron 3 and exon 4)
was finally subcloned using EcoRV and Pme I. B, DNA sequences for the G s-specific primers
(A-F) used throughout this study in RT-PCR and to amplify
individual G s exon/intron fragments by PCR.
|
|
Tissues and Cell Culture--
Both primary myometrial smooth
muscle cell cultures and an immortalized myometrial cell line (PHM1-41)
were used in this study. The PHM1-41 smooth muscle cells (provided by
Professor B. M. Sanborn, University of Texas) were originally isolated
from the myometrium of a pregnant woman and immortalized using a
replication-defective adenovirus vector expressing E6 and E7 proteins
from human papillomavirus HPV16 (38). Samples of myometrial tissue were
obtained from pregnant women undergoing elective caesarean section at
term. Written consent was obtained from all women, and ethical approval was granted by the Newcastle and North Tyneside Health Authority Ethics
Committee. Myometrial samples were taken from the upper corpus region
(termed upper segment) and from close to the cervix (termed lower
uterine segment). Primary myocyte isolation and culture were
essentially as described by Phaneuf et al. (39). Primary
myocytes were cultured with complete D-valine medium
(Invitrogen), whereas the immortalized pregnant human myometrial cells
(PHM1-41) and HeLa cells were cultured in Dulbecco's Glutamax II
modified Eagle's medium (Sigma), supplemented with 10% fetal calf
serum, penicillin (1 unit/ml), and streptomycin (1 ng/ml), and cultured in T75 flasks under standard conditions at 37 °C with 5% CO2. The
culture medium for PHM1-41 cells contained additional supplements of
4.5 g/ml glucose and 50 µg/ml G418 (Invitrogen).
Transfection--
All transfection experiments on primary
myometrial cells were undertaken on subculture passages 2-3.
Myometrial and HeLa cells were co-transfected, at 60-70% confluency
(in the absence of antibiotics) using Mirus LT-1 (Cambridge Bioscience)
or TransFastTM (Promega) cationic-lipid transfection
reagents with 3 µg of pcDNA3.1G s and 3 µg of
pCG-SF2, pCG-A1, or pCG control vector. Transfection efficiencies were
in the range of 25-30% for all experiments, as determined by
transfection with a -galactosidase-encoding plasmid,
pcDNA3.1LacZ (Invitrogen) (data not shown). Cells were harvested
either 48 h (HeLa cells) or 72 h (myometrial cells) after
transfection, using trypsin (0.5 g/liter)-EDTA (0.2 g/liter). Confirmation that the pcDNA3.1G s minigene plasmid
contained the necessary cis-acting regulatory signals for
efficient pre-mRNA splicing was obtained by runoff transcription
using a mMESSAGE-mMACHINE capping/transcription kit (described below)
and RT-PCR of the G s spliced products from total RNA
extracted from PHM1-41 cells post-transfection.
Western Blotting--
Transfection efficiencies were further
confirmed by Western immunoblotting using monoclonal antibodies to
SF2/ASF (mAb96) and hnRNPA1 (4B10), both of which have been described
(18, 40). Endogenous levels of SF2/ASF and hnRNPA1 in myometrial cells
and HeLa cells were also calculated by this procedure. Briefly,
SDS-PAGE was performed under standard conditions using equal amounts of cell homogenate solubilized in 0.5 M Tris, 5 M
urea, 2.5% SDS, and 3% -mercaptoethanol and resolved on 12%
polyacrylamide gels. Immunoreactive bands were detected by enhanced
chemiluminescence (Amersham Biosciences).
G s mRNA Splicing Analysis by RT-PCR and
Restriction Digestion--
G s mRNA splice variants
generated from the minigene in transfected cells were analyzed by
RT-PCR. Total RNA was isolated from individual transfection
experiments, fresh pregnant myometrial tissue, or cultured cells, using
SV total RNA isolation kits, as recommended by the manufacturer
(Promega) and first strand cDNA synthesized from 1-3 µg of RNA
using 20 units of Superscript II reverse transcriptase (Invitrogen)
with 100 ng of oligo(dT)16 as primer. PCR amplification was
carried out with 2-4 µl of cDNA template with the
G s sense primer for exon 2 (primer A) and reverse primer
for exon 4 (primer F) that have 8 and 14 terminal nucleotides, respectively, derived from the pcDNA3.1G s minigene
construct and amplifying all four mRNA isoforms generated from
pcDNA3.1G s, although not endogenous
G s mRNA transcripts (see Fig.
3A, lanes 2 and
3). PCR was performed under standard conditions with an initial hot start cycle at 94 °C (4 min), 50 °C (30 s), and
72 °C (1 min), followed by 18-24 cycles at 94 °C (1 min),
50 °C (30 s), and 72 °C (1 min). Reactions were terminated
in the exponential phase in order to determine the relative ratios of
individual G s mRNA species. PCR products were
analyzed by 2% agarose gel electrophoresis. Note that the long
G s isoform results in a PCR product of 195 bp, which
includes the 8 extra nucleotides on primer A and 14 extra nucleotides
on primer F plus 173 bp of exons 2, 3, and 4, whereas the short
G s isoform results in a product of 150 bp because of
exclusion of the 45 bp of exon 3. Long or short G s
isoforms that included or lacked the extra CAG triplet at the 3'-end of
intron 3 could not be resolved under these electrophoretic conditions.
Therefore, to further analyze the relative abundance of each spliced
variant of G s, the sense G s primer A was
end-labeled with [ -32P]ATP by polynucleotide kinase
(Promega) prior to PCR amplification. The use of the alternative TG
3'-splice site upstream of exon 4 (Fig. 1) generates the
G s-short variant with three additional CAG nucleotides,
creating a unique BsmA1 endonuclease restriction site (see
Fig. 5A) as described previously (41). Thus, the two G s-short mRNA variants with and without the CAG
triplet can be distinguished from each other by restriction analysis. A
10-µl aliquot of each radiolabeled PCR product was digested with
BsmA1 at 55 °C, analyzed by PAGE on 6 or 8% acrylamide,
7 M urea gels, and visualized by autoradiography. The
different banding patterns were quantified by scanning densitometry
using a UMAX PS2400 scanner at 700 dots per inch coupled to the
Intelligent Quantifier software from BioImage (Ann Arbor, MI).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Controls for transient transfection
experiments using the minigene splicing construct
pcDNA3.1G s and plasmids
encoding SF2/ASF and hnRNPA1. A, lane 1,
precursor RNA synthesized via runoff transcription from pcDNA3.1.
G s; lane 2, RT-PCR using G s
A and F primers (see Fig. 2B) and
total RNA extracted from untransfected PHM1-41 cells; lane
3, RT-PCR using G s A and F
primers and total RNA extracted from PHM1-41cells transfected with the
pcDNA3.1G s minigene; note that the two PCR products
represent the G s spliced isoforms with and without exon
3. B, Western blotting using the specific monoclonal
antibody to SF2/ASF (mAb96), demonstrating overexpression of SF2/ASF
after transfection in HeLa cells with pCG-SF2. Lane 1,
transfection with pCG control vector; lane 2, transfection
with pCG-SF2. C, Western blotting using the specific
monoclonal antibody to hnRNPA1 (4B10), demonstrating overexpression of
hnRNPA1 after transfection in HeLa cells with pCG-A1. Lane
1, transfection with pCG control vector; lane 2,
transfection with pCG-A1.
|
|
Endogenous G s mRNA variants were detected using
G s-specific oligonucleotide primers
CAACGAGGAGAAGGCGCAGCGTGA and CTCTGAGGTTCTCGGGGTTGG. GAPDH-specific oligonucleotide exon primers (spanning a short 104-bp
intron) were also designed as control primers for use in RT-PCR with
each cDNA sample. DNA sequences for the GAPDH primers were
CTGCCGTCTAGAAAAACC and CCACC- TTCGTTGTCATACC.
In Vitro Splicing Assays--
To generate transcripts for
in vitro splicing, the pcDNA3.1G s
minigene plasmid, which also harbors a T7 promoter (Fig. 2A, P2) was linearized with PmeI. GpppG-capped and
[ -32P]UTP-labeled pre-mRNA substrate (Fig.
3A, lane 1) was synthesized by runoff
transcription using a mMESSAGE-mMACHINE capping/transcription kit with
T7 RNA polymerase (Ambion, Inc.). In vitro splicing assays were undertaken essentially as described (42). Briefly, 25-30 fmol of
radiolabeled precursor mRNA was incubated for 4 h at 30 °C
with 10 µl of HeLa nuclear extract supplemented with 15-25 pmol of
SF2/ASF, SC35, or hnRNPA1 recombinant proteins, which were expressed
and purified as described (27, 37). The MgCl2 concentration was 3.5 mM. The RNA products generated from splicing in
vitro were then fractionated by denaturing polyacrylamide
electrophoresis followed by autoradiography.
 |
RESULTS |
Effect of SF2/ASF and hnRNPA1 on G s Isoform
Expression--
Transient co-transfection experiments were performed
on primary myometrial cell cultures, immortalized myometrial cells
(PHM1-41), and HeLa cells to evaluate the effect of increased levels of
SF2/ASF and hnRNPA1 on the expression of spliced variants of
G s in these different cell types. The nuclear abundance
of SF2/ASF and hnRNPA1 in HeLa cells has been calculated previously at
3 × 107 copies/cell for SF2/ASF and 6-7 × 107 copies/cell for hnRNPA1 (18, 45).
Western immunoblotting using equal amounts of protein lysate (200/400
µg) from myometrial/PHM1-41 smooth muscle cells and HeLa cell
cultures was undertaken to determine the relative abundance of SF2/ASF
and hnRNPA1 mRNA in myometrial cells compared with HeLa cells (Fig.
4, A and B).
SF2/ASF levels in both primary myometrial cell cultures and PHM1-41
smooth muscle cells were calculated to be 42% of that found in HeLa
cells with a calculated estimate of 1.3 × 107
copies/cell, whereas the abundance of hnRNPA1 in myometrial
cells/PHM1-41 smooth muscle cells was 59% of that found in HeLa cells
with a calculated estimate of 3.8 × 107 copies/cell.
The ratio of SF2/ASF to hnRNPA1 in both myometrial cells and HeLa cells
is thus ~1:3. However, employing RT-PCR with the
G s-specific primers to monitor endogenous splicing in
these cell types (Fig. 4C) indicates that in the two
myometrial cell types the long form of G s is
predominant, whereas the short form is predominant in HeLa cells. The
latter is as predicted from the SF2/ASF:hnRNPA1 ratio of 1:3 in these
cells. The discrepancy in myometrial cells is discussed.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
Abundance of SF2/ASF and hnRNPA1 and
expression of G s isoforms in human
myometrial and HeLa cells. Western immunodetection and subsequent
densitometric analysis of SF2/ASF protein expression (A) and
hnRNPA1 protein expression (B). Lane 1, primary
myometrial cells cultures; lane 2, immortalized myometrial
cells (PHM1-41); lane 3, HeLa cells. SF2/ASF levels in
myometrial cells were calculated to be 42% of that found in HeLa cells
with a calculated estimate of 1.3 × 107 copies/cell.
hnRNPA1 levels in myometrial cells were calculated to be 59% of that
found in HeLa cells with a calculated estimate of 3.8 × 107 copies/cell. C, identification of endogenous
G s splice variants by RT-PCR. Lane 1, primary
myometrial cell cultures; lane 2, PHM1-41 cells; lane
3, HeLa cells. The two PCR products of 344 and 299 bp represent
the long and short G s spliced variants.
|
|
Alternative splicing of human G s mRNA transcripts
involves the inclusion or exclusion of a small internal cassette-type
exon of 45 bp (exon 3) as well as the inclusion/exclusion of an extra triplet. The G s-spliced mRNA variants generated from
the pcDNA3.1G s plasmid, co-transfected with pCG-SF2
or pCG-A1, were analyzed by RT-PCR using a sense primer for exon 2 (primer A) and an antisense primer for exon 4 (primer F), resulting in
amplification of all four exogenous G s mRNA
isoforms. The data presented are based on each transfection experiment
being performed in triplicate. Representative RT-PCR splicing analyses
of transfection experiments in primary myometrial, PHM1-41, and HeLa
cells are shown in Fig. 5. The two PCR
products (195 and 150 bp) represent the long and short
G s mRNA isoforms (plus or minus the extra 3 bp)
generated by the presence or absence of exon 3. Note that
G s-spliced variants containing or excluding the three
nucleotides (CAG) at the 5'-end of exon 4 cannot be resolved under
these experimental conditions.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of SF2/ASF and hnRNPA1 on
G s isoform expression. RT-PCR
with G s A and F primers from transient co-transfection
of pcDNA3.1G s, together with plasmids encoding
SF2/ASF (pCGSF2) and hnRNPA1 (pCGA1) in human
primary myometrial cell cultures (A), immortalized
myometrial cells (PHM1-41) (B), and HeLa cells
(C). Lane 1, cells transfected with pCGSF2;
lane 2, cells transfected with pCGA1; lane 3,
cells transfected with the pCG control vector; lane 4, no
template control. The quantitations are based on each transfection
experiment being performed in triplicate. GAPDH controls for each cell
type are shown below.
|
|
Co-transfection of pcDNA3.1G s and pCG-SF2 plasmids
in primary myometrial and PHM1-41 cells resulted in increased
expression of the long G s mRNA isoform, which
includes exon 3, as reflected by the intensity of the 195-bp band
compared with the 150-bp band (Fig. 5, A and B,
lane 1). In contrast, co-transfection with pCG-A1 in both of
these cell types resulted in a significant increase in the expression
of the smaller 150-bp G s isoform, which has exon 3 spliced out (Fig. 5, A and B, lane 2).
The observed switch in splicing of G s pre-mRNA upon
overexpression of SF2/ASF or hnRNPA1, resulting in the inclusion or
exclusion of exon 3, is consistent with the hypothesis that the ratio
of SF2/ASF and hnRNPA1 is important in determining splice site
selection of G s pre-mRNA in these cells. Note that
in myometrial cells the basal splicing pattern for
pcDNA3.1G s in the presence of the control pCG
plasmid (Fig. 5, A and B, lane 3) is
similar to endogenous splicing of G s (Fig.
4C), in that the predominant isoform expressed in these cells is G s-long, as indicated by an increase in the
intensity of the large 195-bp band compared with the small 150-bp band.
In HeLa cells, the basal splicing pattern for
pcDNA3.1G s was different from that found in
myometrial cells. RT-PCR analysis of HeLa cells transfected with
pcDNA3.1G s and the control pCG plasmid (Fig.
5C, lane 3) indicated that the principal isoform expressed in these cells is G s-short, as indicated by a
high intensity band of 150 bp and a low intensity band of 195 bp. This is in agreement with endogenous splicing of G s in these
cells (Fig. 4C). However, a switch in the splicing pattern
of the G s minigene as a consequence of overexpression of
SF2/ASF or hnRNPA1 was also observed in HeLa cells, consistent with the
results obtained in myometrial cells. Overexpression of SF2/ASF
resulted in a slight increase in expression of G s-long,
which includes exon 3 (Fig. 5C, lane 1). In
contrast, overexpression of hnRNPA1 promoted skipping of exon 3, increasing the expression of the G s-short isoform (Fig.
5C, lane 2).
Effect of SF2/ASF and hnRNPA1 on Use of a Non-canonical TG
3'-Splice Site--
Inclusion or skipping of exon 3 of
G s may not only involve the use of the consensus AG
3'-splice site at the 5'-end of exon 4 but also of a non-canonical TG
3'-splice site located three nucleotides upstream (Fig. 1). The use of
this TG 3'-splice site generates G s variants (with and
without exon 3) that have an additional triplet (CAG) that results in
an extra serine residue at the 5'-end of exon 4. This CAG base
insertion creates a unique BsmA1 restriction site in
G s-short, which was utilized to distinguish G s isoforms generated from the use of the atypical TG
3'-splice site from those generated via the consensus AG 3'-splice site (Fig. 6A).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Restriction analysis of the short
G s isoform generated from
pcDNA3.1G s, showing the use of
the non-canonical TG 3'-splice site by SF2/ASF and hnRNPA1.
A, the short G s isoform resulting from the
use of the TG 3'-splice site preceding exon 4 has a unique
BsmA1 restriction site. B, RT-PCR of extracted
RNA from transfected primary and PHM1-41 myometrial cells was carried
out using G s primers A (end-labeled with
[ -32P]ATP) and F, with subsequent BsmA1
restriction analysis of the small G s product. Lane
1, primary cells transfected with the pCG control vector;
lane 2, primary cells transfected with pCGSF2; lane
3, primary cells transfected with pCGA1; lane 4,
PHM1-41 cells transfected with the pCG control vector; lane
5, PHM1-41 cells transfected with pCGSF2; lane 6,
PHM1-41 cells transfected with pCGA1. C, GAPDH control for
each of the lanes described in B. D,
BsmA1 restriction analysis of the small G s
product in HeLa cells. Lane 1, cells transfected with
pCGSF2; lane 2, cells transfected with pCGA1; lane
3, cells transfected with the pCG control vector. E,
GAPDH control for each lane described in (D).
|
|
To ascertain whether SF2/ASF and hnRNPA1 influence 3'-splice site
selection in G s pre-mRNA, the PCR products generated
in the above transfection experiments were digested with
BsmA1. Representative analyses are shown in Fig. 6. In Fig.
6B, lanes 1-6, the larger uncleaved
PCR bands of 150 bp represent the G s-short mRNA
variant generated from the use of the consensus AG 3'-splice site,
whereas the smaller cleaved PCR bands of 76 bp generated after
digestion with BsmA1 represent the G s-short
mRNA variant derived from use of the alternative TG 3'-splice site.
The predominant exogenous G s-short isoform expressed in
both primary myocytes and PHM1-41 cells under all transfection regimes resulted from the use of the alternative TG 3'-acceptor site, as
indicated by the intensity of the BsmA1-cleaved band of 76 bp. Co-transfection with hnRNPA1 resulted in a decrease in the level of
the 76-bp band and a corresponding increase in the level of the 150-bp
band (Fig. 6B, lanes 3 and 6,
asterisk) indicating that overexpression of hnRNPA1 switched
splice site selection in myometrial cells from the TG 3'-splice site to
the consensus AG 3'-splice. In contrast, overexpression of SF2/ASF in
these cells resulted in a slight increase in the expression of the
G s spliced isoform derived from the use of the TG
3'-splice site (Fig. 6B, lanes 2 and
5). The observation that SF2/ASF promoted the use of the
alternative TG 3'-splice site was confirmed upon overexpression of this
regulatory factor in HeLa cells (Fig. 6D, lane
1). Note that the predominant band after co-transfection with
pCG-SF2 was that of the BsmA1-digested PCR product of 76 bp,
compared with the uncleaved PCR product of 150 bp (Fig. 6D, lane 1). Co-transfection with pCG-A1 in HeLa cells resulted
in a shift in 3'-splice site usage consistent with that observed in
myometrial cells, in that overexpression of hnRNPA1 reduced the use of
the TG 3'-splice site and favored selection of the consensus AG
3'-splice site (Fig. 6D, lane 2,
asterisk).
Effect of SF2/ASF, hnRNPA1, and SC35 on G s Isoform
Expression by in Vitro Splicing Assays--
The role of SF2/ASF and
hnRNPA1 in regulating alternative splicing of G s
pre-mRNA was further examined by in vitro splicing. Transcripts from the pcDNA3.1G s minigene construct
were spliced in HeLa nuclear extract supplemented with recombinant
SF2/ASF and hnRNPA1 proteins (Fig.
7A). The G s
pre-mRNA was spliced under these experimental conditions,
generating mRNA products in which introns 2 and 3 were removed,
with and without skipping of exon 3. Addition of hnRNPA1 induced
skipping of exon 3, generating the short G s variants
consisting of exons 2 and 4, (Fig. 7A, lane 2),
whereas addition of SF2/ASF promoted inclusion of exon 3, thus
generating the long G s isoform containing exons 2, 3, and 4 (Fig. 7A, lane 1). The spliced mRNA
product representing the long G s isoform was also the
principal band generated when the SR protein family member SC35 was
added to the splicing reactions (Fig. 7A, lane
3). SC35 has been shown previously to have similar splicing
activities to SF2/ASF in modulating exon inclusion in vitro
(43). Note that the use of the TG 3'-splice site cannot be determined
under these experimental conditions.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
A, in vitro splicing of
pcDNA3.1G s pre-mRNA in HeLa cell nuclear
extracts supplemented with recombinant SF2/ASF, SC35, or hnRNPA1.
Precursor RNA was synthesized by runoff transcription with subsequent
in vitro splicing assays as described under "Experimental
Procedures." Lane 1, nuclear extract supplemented
with SF2/ASF; lane 2, nuclear extract supplemented with
hnRNPA1; lane 3, nuclear extract supplemented with SC35;
lane 4, unsupplemented nuclear extract control.
B, high score SR protein motifs in alternative exon 3 of
G s. The 45-nucleotide sequence was searched with four
nucleotide-frequency matrices derived from pools of functional enhancer
sequences selected in vitro (22). Motif scores reflect the
extent of matching to a degenerate consensus, and only the scores above
the threshold for each SR protein are shown. High score motifs are
shown in black for SF2/ASF, dark gray for SC35,
and light gray for SRp40. The width of each
bar represents the length of the motif (7 or 8 nucleotides),
the placement of each bar indicates the position of the motif along the
exon 3 sequence (shown below the x axis), and the
height of each bar corresponds to the numerical
score on the y axis. No high score motifs for SRp55 were
found in this exon.
|
|
Identification of Putative Exonic Splicing Enhancer Sequences in
Exon 3 of G s--
Cis-acting nucleotide
sequences other than the consensus splice sites at intron:exon
junctions can influence pre-mRNA splicing by activating splice
sites in nearby introns (28, 30, 31). These ESEs consist of short RNA
sequences that fit one of several degenerate consensus motifs and have
been identified in both alternatively and constitutively spliced exons
(27, 32, 34, 35). Specific ESEs interact functionally with individual
trans-acting factors, which include SF2/ASF and SC35, as
well as other members of the SR protein family (27, 32, 36, 44). To
investigate whether G s contains any potential ESE
sequences that may be involved in regulating the selection of
alternative 5'- and 3'-splice sites, the alternative exon 3 sequence of
G s was analyzed using statistical scoring matrices for
four SR proteins, previously derived on the basis of functional
selection from random sequence pools (35, 37). Briefly, this procedure
identifies putative SR protein-specific enhancer sequences by a
motif-search algorithm that calculates numerical scores greater than a
previously established threshold. The results from this analysis
demonstrate that ESE motifs for three SR proteins, SF2/ASF, SC35, and
SRp40, are present within the G s exon 3 sequence (Fig.
7B). Two heptameric high score motifs (AAGAGGA and CGCAGGC)
for SF2/ASF were identified, which overlap with two octameric SC35
motifs (GACCCGCA and GGCTGCAA). Furthermore, two ESE motifs for SRp40
were also found (CCGCAGG and CAACAGC). No high score motifs for SRp55
were found. The significance of these observations is discussed below.
Spatio-temporal Expression of SF2/ASF, hnRNPA1, and
G s Isoforms within the Myometrium during
Pregnancy--
Both SF2/ASF and hnRNPA1 were found to be spatially and
temporally expressed within the myometrium during gestation. Notably, SF2/ASF levels increased significantly in the lower uterine region (Fig. 8A), and this was
associated with a parallel decrease in levels of hnRNPA1 (Fig.
8B). Conversely, the reverse pattern was observed for the
upper uterine region where hnRNPA1 was significantly up-regulated (Fig.
8B), which was associated with a concurrent decrease in
SF2/ASF levels (Fig. 8A). RT-PCR using RNA extracted from
the upper and lower regions of the myometrium was undertaken to
ascertain whether endogenous G s splice variants were
also spatially expressed within these different regions during fetal maturation. The splicing pattern of G s splice variants
is shown in Fig. 8C; the two PCR products (344 and 299 bp)
represent the long and short mRNA variants (plus and minus the
extra 3 bp). The data indicate an increase in expression of
G s-long in the lower uterine region, as reflected by the
intensity of the 344-bp band compared with the 299-bp band (Fig.
8C), whereas an increase in expression of
G s-short is observed within the upper uterine region, as
reflected by the increase in the intensity of the 299-bp band compared
with the 344-bp band (Fig. 8C). The significance of the
differential expression of SF2/ASF, hnRNPA1, and G s
spliced variants is discussed.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
Spatial expression of myometrial SF2/ASF,
hnRNPA1, and G s isoforms within
the upper and lower uterine regions during human gestation. This
is described by Pollard et al. (29). Western immunodetection
and subsequent densitometric analysis of SF2/ASF protein expression in
the upper (U) and lower (L) myometrium
(A). B, hnRNPA1 protein expression in the upper
and lower myometrium. C, identification of endogenous
G s splice variants by RT-PCR using total RNA extracted
from the upper and lower myometrium during pregnancy. The two PCR
products of 344 and 299 bp represent the long and short
G s spliced variants. Data indicate an increase in
expression of G s-long in the lower uterine region,
whereas an increase in expression of G s-short is
observed within the upper uterine region.
|
|
 |
DISCUSSION |
The mechanism by which alternative splicing of the adenylyl
cyclase stimulatory GTP-binding protein G s is controlled
has remained undefined. We now provide evidence that G s
isoform expression in human myometrial and HeLa cells is regulated by
the trans-acting splicing factors SF2/ASF and hnRNPA1. Our
data from transfection of a G s minigene in human
myometrial and HeLa cells are consistent with previous findings with
other splicing reporters, in that high levels of hnRNPA1 favored the
distal alternative 5'-splice site, such that exon 2 of
G s was spliced to exon 4. In contrast, increased
levels of SF2/ASF selected the proximal alternative 5'-splice site,
thus promoting mRNA transcripts in which exon 3 was spliced to exon 4.
Our studies also indicate that the basal splicing pattern of
G s transcripts appears to be different in myometrial
cells compared with HeLa cells. In both primary/PHM1-41 myometrial
cells the principal G s isoform expressed was the long
spliced variant that included exon 3, whereas in HeLa cells the short
form of G s resulting from the skipping of exon 3 was
predominant. This pattern was also observed for endogenous splicing of
G s in these cells. The predominant expression of
G s-short in HeLa cells under endogenous conditions
conforms with the abundance of hnRNPA1 6-7 × 107
copies/cell (18, 45) in these cells, which promotes exon skipping by
favoring the use of the distal 5'-splice site. However, in myometrial
cells, although hnRNPA1 is more abundant than SF2/ASF, G s-long is the principal isoform expressed. This may
indicate that in these smooth muscle cell cultures endogenous levels of the SR proteins SC35 and SRp40 may play a role in regulating
alternative splicing of G s, because we have observed two
high score motifs within exon 3 for these factors (see below). The
expression profile of these factors remains to be determined in the
cells. However, it must be recognized that these cells are used as an
in vitro model and that the splicing of G s
in vivo in the upper and lower myometrial segments during
pregnancy does conform to the ratio of SF2/ASF to hnRNPA1 found in
these regions as detailed later.
The strengths of different splice sites relate to their binding
affinity for trans-acting factors, including the extent of their sequence complementarity to appropriate units of snRNAs, and
there is a correlation between splice site strength and the match to
the splice site consensus sequence (46). The 5'- and 3'-splice sites of
G s introns 2 and 3 conform to the GT-AG dinucleotide consensus. However, we report that an alternative, non-canonical TG
3'-splice site just upstream of the 5'-end of exon 4, as described by
Kozasa et al. (6), is also selected, to an extent that
appears to be governed by the expression levels of SF2/ASF and hnRNPA1. A database of canonical and non-canonical mammalian splice sites has
recently been compiled, based on the analysis of 22,489 verified splice
site junctions (47). Of relevance to our study, 98.71% of these splice
sites have the consensus GT-AG splice site pairs, 0.56% have
non-canonical GC-AG junctions, and of the remainder (0.73%) no GT-TG
splice site pairs (as found in the human G s gene
sequence) were found.
Usage of the alternative TG 3'-splice site generates G s
mRNA transcripts (with and without exon 3) that have an additional CAG triplet coding for an extra serine residue after amino acids 87 and
72 of the long and short isoforms of G s, respectively. The predominant short G s isoform expressed in myometrial
and HeLa cells resulted from the use of the TG 3'-splice site and not
the consensus AG 3'-splice site. However, both SF2/ASF and hnRNPA1
could influence the use of this atypical TG 3'-splice site, whereby an
increase in the level of hnRNPA1 switched splice site selection from
the TG 3'-splice site to that of the consensus AG 3'-splice site.
Conversely, and in keeping with its antagonistic relationship with
hnRNPA1, SF2/ASF promoted the use of the alternative TG 3'-splice site.
These data further demonstrate that the short variant of
G s is primarily generated from the use of the TG
3'-splice site and incorporates an additional serine residue.
Similarly, since SF2/ASF promoted the use of the non-canonical TG
3'-splice site and the inclusion of exon 3 into the long isoform of
G s, it is reasonable to predict that the long
G s variant is also primarily generated from the use of
the alternate TG 3'-splice site and not the consensus AG 3'-splice
site. Consequently, expression of the long and short G s
isoforms in different tissues and cell types may occur from the
predominant selection of the atypical TG 3'-splice site, resulting in
protein species containing an extra serine residue.
The use of the alternative TG 3'-splice site in producing
G s spliced isoforms may be conserved in other mammalian
species, such as the rat, in which the homology with the human
G s gene is high and in which proteins of 52 and 45 kDa
have been observed (41). This peculiar feature may also be present in
lower organisms, including D. melanogaster, in
which a TG 3'-splice site or a consensus AG 3'-splice site results in
transcripts that code for either a long or short form of
G s (10). Given the unusual nature of the non-consensus
TG 3'-splice site, it is remarkable that the Drosophila
G s gene also contains such a splice site, yet it
corresponds to intron 7, which interrupts a different region of the
coding sequence (10). In this case, there is also an alternative AG 3'-splice site, but it is located 9 bp downstream. Neither unusual intron in human or Drosophila G s has a direct
counterpart in the orthologous gene.
Two other examples of a TG 3'-splice site have been reported in the
human DRD2 and DLG4 genes, which encode the
dopamine receptor D2 and the postsynaptic density 95 protein (48, 49).
In the DRD2 pre-mRNA, the UG 3'-splice site is located
six nucleotides upstream of the conventional AG 3'-splice site of
intron 5, and its use generates the D2Longer isoform, which
is expressed at low levels in human brain (48). In the DLG4
pre-mRNA, the UG dinucleotide was originally reported as the sole
3'-splice site for intron 5, and the splice junction was confirmed by
cDNA sequencing (49). However, the Ensemble database
(www.ensembl.org) reports an AG nine nucleotides downstream as the
3'-splice site for this intron, as supported by EST sequences (gene ID
ENSG00000132535). Thus, in all the known cases of TG 3'-splice site
dinucleotides, an alternative AG 3'-splice site dinucleotide is located
1, 2, or 3 codons downstream.
ESEs are sequences that have been shown to influence the selection of
both 5'- and 3'-splice sites (50, 51). Some of these cis-acting sequences are purine-rich, although non-purine
enhancer elements have also been identified (30, 32, 35, 37). ESEs regulate alternative splicing by acting in combination with other cis-acting signals at intron/exon junctions. The specific
recognition and binding of ESEs by protein factors, including members
of the SR protein family, is well documented, and characterization of their mechanism of action is an active area of research. In this context, we investigated whether the alternative exon 3 of
G s has any such ESE motifs that may be relevant to
regulation of G s post-transcriptional gene expression.
Exon 3 is rich in purines, particularly G residues, and contains only
two T residues (Fig. 7B). ESE motifs for several SR proteins
were identified in exon 3 using scoring matrices derived from a
functional SELEX procedure that identifies motifs with the potential to
interact functionally with specific SR proteins to promote splicing
(35, 37). Notably, two high score ESE motifs for SF2/ASF are present
within the exon 3 sequence, which overlap with two high score SC35
motifs. In addition, two high score motifs for another SR protein
member, SRp40, are present in exon 3, but no high score SRp55 motifs
are present in this exon. SRp40 has been tested for its role in
alternative splicing and appears to function in a substrate-specific
manner in selecting either distal or proximal 5'-splice sites depending on the pre-mRNA substrate (17). SC35 has also been shown to have
similar splicing activities as SF2/ASF in favoring proximal sites in
5'- and 3'-splice site selection and in antagonizing the effect of
hnRNPA1 in alternative 5'-splice site selection (43). The specificity
of SR proteins in regulating the efficiency or pattern of alternative
splicing of different genes has been attributed in part to the specific
recognition of different ESEs. Consequently, it is of interest that the
G s exon 3 sequence contains three different types of SR
protein-specific ESE motifs, which raises the question of whether
different sets of SR proteins are involved in regulating
G s isoform expression in vivo. Interestingly, it was recently reported that previously uncharacterized SR-like proteins also antagonize the roles of SF2/ASF and SC35 in regulating alternative pre-mRNA splicing in a activity that is similar to that
of hnRNPA1 (53).
Variations in the concentration ratios of SF2/ASF and hnRNPA1 in
different cell types and tissues may be important in controlling processing of G s pre-mRNA. In this context, previous
studies have demonstrated that SF2/ASF and hnRNPA1 levels vary
considerably in different tissues from rat and mouse (18, 55).
Moreover, it has also been reported that hnRNPA1 expression in the
mouse fluctuates considerably during different stages of
differentiation (55). Recently, Pollard et al. (29) have
described the differential expression of SF2/ASF and hnRNPA1 in the
myometrium of the human uterus during pregnancy and parturition.
Essentially the data, as summarized in Fig. 8, indicate that SF2/ASF
and hnRNPA1 are spatio-temporally regulated within the lower and upper
uterine regions during fetal maturation (29). In this context, we have also demonstrated that G s splice variants are
differentially expressed within these regions and that the pattern of
splicing for G s is consistent with the known roles for
SF2/ASF and hnRNPA1.
In conclusion, our studies provide strong evidence that alternative
splicing of human G s gene transcripts is regulated in part by the antagonistic relationship of the trans-acting
splicing factors SF2/ASF and hnRNPA1 and involves the use of a
non-canonical, alternative TG 3'-splice site. The differential
expression of SF2/ASF and hnRNPA1 in various tissues/cell types may
thus under normal physiological and pathophysiological conditions
define the degree of formation of the long and short protein isoforms of G s, with their subsequent effects on cell function.
 |
ACKNOWLEDGEMENTS |
We thank Professor B. M. Sanborn
(University of Texas) for kindly providing the PHM1-41 cells.
Anti-hnRNPA1/A1B 4B10 monoclonal antibody was a gift from Dr. Gideon
Dreyfuss (University of Pennsylvania, Philadelphia).
 |
FOOTNOTES |
*
This study was funded by a grant from Action Research
(S/P/3232).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 44-191-282-4107;
Fax: 44-191-222-5066; E-mail: A.J.Pollard@ncl.ac.uk.s.
§
Funded in part by NCI, National Institutes of Health Grant CA13106.
Present address: Cold Spring Harbor Laboratory, Box 100, 1 Bungtown
Rd., Cold Spring Harbor, NY 11724.
Published, JBC Papers in Press, February 1, 2002, DOI 10.1074/jbc.M109046200
 |
ABBREVIATIONS |
The abbreviations used are:
SR, serine/arginine-rich;
ESE, exonic splicing enhancer sequence;
GADPH, glyceraldehyde-3-phosphate dehydrogenase;
hnRNP, heterogeneous nuclear ribonucleoprotein..
 |
REFERENCES |
| 1.
|
Mattera, R.,
Graziano, M. P.,
Yatani, A.,
Zhou, Z.,
Graf, R.,
Codina, J.,
Birnbaumer, L.,
Gilman, A.,
and Brown, A.M.
(1989)
Science
243,
804-807[Abstract/Free Full Text]
|
| 2.
|
Schubert, B.,
Van Dongen, A. M. J.,
Kirsch, G. E,
and Brown, A. M.
(1989)
Science
245,
516-519[Abstract/Free Full Text]
|
| 3.
|
Mumby, S. M.,
Khan, R. A.,
Manning, D. R.,
and Gilman, A. G.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
265-269[Abstract/Free Full Text]
|
| 4.
|
Northup, J. K.,
Sternweis, P. C.,
Smigel, M. D.,
Shleifer, L. S.,
Ross, E. M.,
and Gilman, A. G.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
6516-6520[Abstract/Free Full Text]
|
| 5.
|
Europe-Finner, G. N.,
Phaneuf, S.,
Mardon, H. J.,
and López Bernal, A.
(1996)
J. Clin. Endocrinol. Metab
81,
1069-1075[Abstract]
|
| 6.
|
Kozasa, T.,
Itoh, T.,
Tsukamoto, T.,
and Kaziro, Y.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
2081-2085[Abstract/Free Full Text]
|
| 7.
|
Pyne, N. J.,
Freissmuth, M.,
and Palmer, S.
(1992)
Biochem. J
285,
333-338
|
| 8.
|
Pyne, N. J.,
Freissmuth, M.,
and Pyne, S.
(1992)
Biochem. Biophys. Res. Comm
186,
1081-1086[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Novotny, J.,
and Svoboda, P.
(1998)
J. Mol. Endocrinol
20,
163-173[Abstract]
|
| 10.
|
Quan, F.,
and Forte, M. A.
(1990)
Mol. Cell. Biol
10,
910-917[Abstract/Free Full Text]
|
| 11.
|
Sternweis, P. C.,
Northup, J. K.,
Smigel, M. D.,
and Gilman, A. G.
(1981)
J. Biol. Chem
256,
11517-11526[Abstract/Free Full Text]
|
| 12.
|
Yagami, T.
(1995)
Mol. Pharmacol
48,
849-854[Abstract]
|
| 13.
|
Unson, C. G., Wu, T. P.,
Sakmar, C. R.,
and Merrifield, R. B.
(2000)
J. Biol. Chem
275,
21631-21638[Abstract/Free Full Text]
|
| 14.
|
Europe-Finner, G. N.,
Phaneuf, S.,
Tolkovsky, A. M.,
Watson, S. P.,
and López Bernal, A.
(1994)
J. Clin. Endocrinol. Metab
79,
1835-1839[Abstract]
|
| 15.
|
Graveley, B. R.
(2000)
RNA (N. Y.)
6,
1197-1211[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Smith, C. W,
and Valcarel, J.
(2000)
Trends Biochem. Sci
25,
381-388[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Cáceres, J. F,
and Krainer, A. R.
(1997)
in
Eukaryotic mRNA Processing
(Krainer, A. R., ed)
, pp. 174-212, IRL Press, Oxford
|
| 18.
|
Hanamura, A.,
Cáceres, J. F.,
Mayeda, A.,
Franza, B. R., Jr.,
and Krainer, A. R.
(1998)
RNA (N. Y.)
4,
430-444[Abstract]
|
| 19.
|
Zahler, A. M.,
Neugebauer, K. M.,
Lane, W. S.,
and Roth, M. B.
(1993)
Science
260,
219-222[Abstract/Free Full Text]
|
| 20.
|
Bai, Y.,
Lee, D., Yu, T.,
and Chasin, L. A.
(1999)
Nucleic Acids Res
27,
1126-1134[Abstract/Free Full Text]
|
| 21.
|
Ge, H.,
and Manley, J. L.
(1990)
Cell
62,
25-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Krainer, A. R.,
Conway, G. C.,
and Kozak, D.
(1990)
Cell
62,
35-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Cáceres, J. F.,
Stamm, S.,
Helfman, D. M.,
and Krainer, A. R.
(1994)
Science
265,
1706-1709[Abstract/Free Full Text]
|
| 24.
|
Mayeda, A.,
and Krainer, A. R.
(1992)
Cell
68,
365-375[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Mayeda, A.,
Helfman, D. M.,
and Krainer, A. R.
(1993)
Mol. Cell. Biol
13,
2993-3001[Abstract/Free Full Text]
|
| 26.
|
Yang, X.,
Bani, M. R., Lu, S. J.,
Rowan, S.,
Ben-David, Y.,
and Chabot, B.
(1994)
Proc. Natl. Acad. U. S. A
91,
6924-6928[Abstract/Free Full Text]
|
| 27.
|
Mayeda, A.,
Screaton, G. R.,
Chandler, S. D., Fu, X.-D.,
and Krainer, A. R.
(1999)
Mol. Cell Biol
19,
1853-1863[Abstract/Free Full Text]
|
| 28.
|
Wang, J.,
and Manley, J. L.
(1995)
RNA (N. Y.)
1,
335-346[Abstract]
|
| 29.
|
Pollard, A. J.,
Sparey, C.,
Robson, S. C.,
Krainer, A. R.,
and Europe-Finner, G. N.
(2000)
J. Clin. Endocrinol. Metab
85,
1928-1936[Abstract/Free Full Text]
|
| 30.
|
Elrick, L. L.,
Humphrey, M. B.,
Cooper, T. A.,
and Berget, S. M.
(1998)
Mol. Cell. Biol
18,
343-352[Abstract/Free Full Text]
|
| 31.
|
Humphrey, M. B.,
Bryan, J.,
Cooper, T. A.,
and Berget, S. M.
(1995)
Mol. Cell. Biol
15,
3979-3988[Abstract]
|
| 32.
|
Schaal, T. D.,
and Maniatis, T.
(1999)
Mol. Cell. Biol
19,
1705-1719[Abstract/Free Full Text]
|
| 33.
|
Ichida, M.,
Hatamata, Y.,
Hayakawa, M.,
Ueno, E.,
Ikeda, U.,
Shimada, K.,
Hamamoto, T.,
Kagawa, Y.,
and Endo, H.
(2000)
J. Biol. Chem
275,
15992-16001[Abstract/Free Full Text]
|
| 34.
|
Tanaka, K.,
Watakabe, A.,
and Shimura, Y.
(1994)
Mol. Cell. Biol
14,
1347-1354[Abstract/Free Full Text]
|
| 35.
|
Liu, H-X.,
Chew, S. M.,
Cartegni, L.,
Zhang, M. Q.,
and Krainer, A. R.
(2000)
Mol. Cell. Biol
20,
1063-1071[Abstract/Free Full Text]
|
| 36.
|
Ramchatesingh, J.,
Zahler, A. M.,
Neugebauer, K. M.,
Roth, M. B.,
and Cooper, T. A.
(1995)
Mol. Cell. Biol
15,
4898-4907[Abstract]
|
| 37.
|
Liu, H-X.,
Zhang, M. Q.,
and Krainer, A. R.
(1998)
Genes Dev
12,
1998-2012[Abstract/Free Full Text]
|
| 38.
|
Monga, M., Ku, C. Y.,
Dodge, K.,
and Sanborn, B. M.
(1996)
Biol. Reprod
55,
427-432[Abstract]
|
| 39.
|
Phaneuf, S.,
Europe-Finner, G. N.,
Varney, M.,
MacKenzie, I. Z.,
Watson, S. P.,
and López Bernal, A.
(1993)
J. Endocrinol
136,
497-509[Abstract/Free Full Text]
|
| 40.
|
Piñol-Roma, S.,
Choi, Y. D.,
Matunis, M. J.,
and Dreyfuss, G.
(1988)
Genes Dev
2,
215-227[Abstract/Free Full Text]
|
| 41.
|
Granneman, J. G,
and Bannon, M. J.
(1991)
J. Neurochem
57,
1019-1023[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Mayeda, A.,
and Krainer, A. R.
(1999)
Methods Mol. Biol
118,
315-321[Medline]
[Order article via Infotrieve]
|
| 43.
|
Fu, X-D.,
Mayeda, A.,
Maniatis, T.,
and Krainer, A. R.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11224-11228[Abstract/Free Full Text]
|
| 44.
|
Sun, Q.,
Mayeda, A.,
Hampson, R. K.,
Krainer, A. R.,
and Rottman, F. M.
(1993)
Genes Dev
7,
2598-2608[Abstract/Free Full Text]
|
| 45.
|
Kiledjian, M.,
Burd, C. G.,
Görlach, M.,
Portman, D. S.,
and Dreyfuss, G.
(1994)
in
RNA-Protein Interactions
(Mattaj, I. W.
, and Nagai, K., eds)
, pp. 127-149, IRL Press, Oxford
|
| 46.
| Burge, C. B., Tuschl, T., and Sharp, P. A. in The RNA
World (Gesteland, R. A., Cech, T. R, and Atkins J. F.,
eds) 2nd Ed., pp. 38-46, Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY
|
| 47.
|
Burset, I.,
Seledtsov, A.,
and Solovyev, C. V.
(2001)
Nucleic Acids Res
29,
255-259[Abstract/Free Full Text]
|
| 48.
|
Seeman, P.,
Nam, D.,
Ulpian, C.,
Liu, I. S. C.,
and Tallerico, T.
(2000)
Mol. Brain Res
76,
132-141[Medline]
[Order article via Infotrieve]
|
| 49.
|
Stathakis, D. G.,
Udar, N.,
Sandgren, O.,
Andreasson, S.,
Bryant, P. J.,
Small, K.,
and Forsman-Semb, K.
(1999)
J. Neurochem
73,
2250-2265[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Chua, K.,
and Reed, R.
(2001)
Mol. Cell. Biol
21,
1509-1514[Abstract/Free Full Text]
|
| 51.
|
Selvakumar, M.,
and Helfman, D. M.
(1999)
RNA (N. Y.)
5,
378-394[Abstract]
|
| 52.
|
Kamma, H.,
Portman, D. S.,
and Dreyfuss, G.
(1995)
Exp. Cell Res
221,
187-196[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Cowper, A. E.,
Cáceres, J. F.,
Mayeda, A.,
and Screaton, G. R.
(2001)
J. Biol. Chem
276,
48908-48914[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A J Tyson-Capper, E A Shiells, and S C Robson
Interplay between polypyrimidine tract binding protein-associated splicing factor and human myometrial progesterone receptors
J. Mol. Endocrinol.,
July 1, 2009;
43(1):
29 - 41.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Akerman and Y. Mandel-Gutfreund
Does distance matter? Variations in alternative 3' splicing regulation
Nucleic Acids Res.,
August 17, 2007;
(2007)
gkm603v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Qi, S. Su, M. E. McGuffin, and W. Mattox
Concentration dependent selection of targets by an SR splicing regulator results in tissue-specific RNA processing
Nucleic Acids Res.,
December 4, 2006;
34(21):
6256 - 6263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sheth, X. Roca, M. L. Hastings, T. Roeder, A. R. Krainer, and R. Sachidanandam
Comprehensive splice-site analysis using comparative genomics
Nucleic Acids Res.,
September 1, 2006;
34(14):
3955 - 3967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Tyson-Capper, J. Bailey, A. R. Krainer, S. C. Robson, and G. N. Europe-Finner
The Switch in Alternative Splicing of Cyclic AMP-response Element Modulator Protein CREM{tau}2{alpha} (Activator) to CREM{alpha} (Repressor) in Human Myometrial Cells Is Mediated by SRp40
J. Biol. Chem.,
October 14, 2005;
280(41):
34521 - 34529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. C. H. Kerr, F. E. Holmes, and D. Wynick
Novel Isoforms of the Sodium Channels Nav1.8 and Nav1.5 Are Produced by a Conserved Mechanism in Mouse and Rat
J. Biol. Chem.,
June 4, 2004;
279(23):
24826 - 24833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Christian, M. Lang, P. Maurel, and F. Raffalli-Mathieu
Interaction of Heterogeneous Nuclear Ribonucleoprotein A1 with Cytochrome P450 2A6 mRNA: Implications for Post-Transcriptional Regulation of the CYP2A6 Gene
Mol. Pharmacol.,
June 1, 2004;
65(6):
1405 - 1414.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Xu, D. Y. M. Leung, and K. O. Kisich
Serine-Arginine-rich Protein p30 Directs Alternative Splicing of Glucocorticoid Receptor Pre-mRNA to Glucocorticoid Receptor {beta} in Neutrophils
J. Biol. Chem.,
July 11, 2003;
278(29):
27112 - 27118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Zerbini, A. Maestroni, D. Breviario, R. Mangili, and G. Casari
Alternative Splicing of NHE-1 Mediates Na-Li Countertransport and Associates With Activity Rate
Diabetes,
June 1, 2003;
52(6):
1511 - 1518.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|