 |
INTRODUCTION |
The proteasome performs a central and ubiquitous biological
function as follows: the degradation of intrinsically short lived regulatory proteins, such as those that control the cell cycle and
transcription, as well as the disposal of potentially toxic denatured
or misfolded proteins. Protein substrates are generally marked for
degradation by their attachment to multiubiquitin chains catalyzed by a
series of enzymes (1, 2). The ubiquitinated protein is then degraded by
the 26 S proteasome in an ATP-dependent manner. The latter
is a complex between a cylindrical 20 S proteasome and two 19 S
regulatory complexes attached to each end of the cylinder (3). The
19 S complex consists of a characteristic set of some 17 heterogeneous
protein subunits classified into two subgroups. One subgroup contains
six structurally related ATPases, designated Rpt1 to 6 in
Saccharomyces cerevisiae, which are encoded by a
unique multigene family well conserved during evolution (3) and perform
the presumed role of unfolding and translocating the proteins targeted
for proteasome degradation. Another subgroup of some 11 non-ATPase
subunit proteins, designated the Rpns in S. cerevisiae, are
mostly structurally unrelated to one another (3).
The 20 S proteasomes have been universally identified among the
eukaryotes as well as some of the archaea and eubacteria (3). There has
not been any 26 S proteasome identified in either Thermoplasma acidophilum, Rhodococcus erythropolis, or any other
prokaryote. But an archaebacterial ATPase, homologous to the ATPases in
eukaryotic 26 S proteasome, was recently identified in
Methanococcus jannaschii and found to activate protein
breakdown by bacterial 20 S proteasomes (4). The eukaryotic 20 S
proteasome has a similar structure as that of prokaryotes, and high
resolution crystal structures have been reported for the 20 S
proteasomes of T. acidophilum and S. cerevisiae
showing remarkable structural similarities (5, 6).
Trypanosoma brucei is a parasitic protozoan and one of the
causative agents of African trypanosomiasis. Recently, we have identified, purified, and characterized the 20 S proteasome from this
organism (7), and we cloned full-length cDNAs encoding each of the
seven 
- and seven 
-subunits of this
complex.1 The trypanosome
20 S proteasome exhibits striking morphological similarities to the
rat 20 S proteasome under electron microscopy (7). An activated form
of the trypanosomal 20 S proteasome was identified and found to
contain an additional protein of 26 kDa (PA26). Association with the
PA26 heptamer ring confers enhanced peptidase activities on the
trypanosomal 20 S proteasome (8, 9). A functionally similar but
structurally diverged protein PA28 has been described previously in
vertebrates (10). Despite the many elements of similarity between the
proteasomal systems of T. brucei and other eukaryotes, our
efforts to identify the 26 S proteasome in T. brucei have
been unsuccessful (8). There could be two causes of this failure as
follows: either the 26 S proteasome in T. brucei is
unstable and falls apart when cell lysates are processed by
conventional means, or there may be no 26 S proteasome in T. brucei. The second possibility suggests a need for an alternative
means of activating the 20 S proteasome in T. brucei. The
PA26-activated 20 S proteasome in T. brucei, which has not
yet been identified in any other eukaryotic microorganism including
S. cerevisiae, could fulfill such a need. However, the PA26-activated 20 S proteasome exhibits only peptidase activity, not
protease activity. Furthermore, although poly-ubiquitin genes (11) and
ubiquitinated proteins are found in T. brucei (12), these
are not digested by the PA26-activated 20 S
proteasome.2 In this report,
we demonstrate that a 26 S proteasome species is indeed present in
T. brucei, but it dissociates into the 19 S complex and
20 S proteasome upon cell lysis. By using RNA interference (RNAi) in
T. brucei (13), we also show that its function is essential
for degradation of ubiquitinated proteins and cell viability.
| |
EXPERIMENTAL PROCEDURES |
Materials--
T. brucei strain 427 procyclic form
cells were cultivated and harvested as described previously (7). The
procyclic form T. brucei strain 29-13, which contains the
genes expressing T7 RNA polymerase and tetracycline repressor (14), was
a gift from Dr. Paul T. Englund of The Johns Hopkins University School
of Medicine. The fluorogenic peptides
LLVY-MCA,3 PFR-MCA, and
GGR-MCA used in the peptidase assay, the cell-permeable bifunctional
cross-linking reagent dimethyl 3,3'-dithiobispropionimidate (DTBP),
rabbit anti-ubiquitin antiserum,
[methyl-14C]casein, and apyrase were purchased
from Sigma. Horseradish peroxidase-conjugated donkey antiserum against
rabbit IgG and [35S]methionine were from Amersham
Biosciences. Horseradish peroxidase-conjugated goat antiserum against
mouse IgG and protease inhibitor mixtures were from Roche Molecular
Biochemicals. Rabbit antisera against human Rpt1, Rpt2, Rpn8, and yeast
Rpt2 were from Affinity Research Products. The S. cerevisiae
strain RJD 1171 in which Rpt1 was fused to a FLAG His6 tag
was obtained from Verma et al. (15). Lactacystin was
purchased from Professor E. J. Corey, Harvard University. All the
other chemicals used in the current study were of the highest purity
commercially available.
Proteasome Isolation--
A mixture of 20 S and activated 20 S
proteasomes of T. brucei was purified from procyclic form
cells by centrifugation of the crude cell lysate in a 15-50% glycerol
gradient as previously described (8). For gel filtration, T. brucei lysate was fractionated using FPLC Superose 6 HR 10/30
chromatography (Amersham Biosciences) in a buffer containing 50 mM Tris-HCl, pH 7.0, 100 mM KCl, 10 mM NaCl, 1.1 mM MgCl2, 0.1 mM EDTA, and 10% glycerol. Further purification of 20 S
proteasome was accomplished by an additional DEAE-cellulose column
chromatography step (8). Isolation of 26 S proteasome from rat red
blood cells was described previously (7). The FLAG
His6-tagged 19 S proteasome regulatory complex from
S. cerevisiae was purified as described (15) using anti-FLAG M2 agarose beads from Sigma.
In Vitro Degradation of Casein--
For in vitro
degradation of [methyl-14C]casein (16),
samples of purified 26 S proteasome from rat red blood cells (5 µg), rat red blood cell crude lysate (200 µg), a purified mixture of T. brucei 20 S and activated 20 S proteasome (10 µg),
and T. brucei crude lysate (200 µg), each containing a
protease inhibitor mixture, were tested. Each sample was preincubated
in a buffer containing 50 mM Tris-HCl, pH 7.25, 5 mM MgCl2, 1 mM dithiothreitol
(DTT), 2 mM ATP (2 mM ATP
S or 2 units of
apyrase), and 1% dimethyl sulfoxide (Me2SO) for 30 min on
ice. [methyl-14C]Casein (3 µg) was then
added to make a final volume of 20 µl. After incubation at 37 °C
for 60 min, radioactivity in the trichloroacetic acid-soluble fraction
was determined by scintillation counting.
In Vivo [35S]Methionine Pulse-Chase Labeling and
Detection of Radiolabeled Ubiquitinated Protein--
T.
brucei procyclic form cells, suspended in methionine-depleted
Cunningham's medium at a density of 5 × 107
cells/ml, were pulse-labeled with [35S]methionine (50 µCi/ml, Amersham Biosciences) at 26 °C for 45 min. The
radiolabeled methionine was then replaced by 1.3 mM
unlabeled methionine to continue the incubation. Cell samples (4 × 107 cells) were taken periodically and lysed by
sonication in 400 µl of TBS buffer (20 mM Tris-HCl, pH
7.9, 150 mM NaCl) including a protease inhibitor mixture.
The lysate (containing 500 µg of protein) was first preabsorbed with
preimmune rabbit serum and protein A-Sepharose (17). Ubiquitinated
proteins were precipitated using anti-ubiquitin antiserum and protein
A-Sepharose. The immunocomplexes were washed three times with
phosphate-buffered saline and once with buffer A (30 mM
Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM
DTT, 5 mM ATP, 1 mM phenylmethylsulfonyl
fluoride, and 1 mM tosyl-lysine chloromethyl ketone).
Immunoprecipitates were fractionated by 10% SDS-PAGE,
autoradiographed, and immunostained using anti-ubiquitin antiserum.
Cloning of Full-length cDNAs Encoding the Six Proteasome
ATPase Homologues of T. brucei--
With DNA sequence information
available from the data base of the TIGR Trypanosome Genome Project
(www.tigr.org/tdb/mdb/tbdb/index.shtml), 14 cDNA fragments with
their sequences closely similar to those in the six proteasome ATPases
designated Rpt1 to 6 from other organisms were identified. Four
cDNA fragments, 49F12.TR, 13G6.TR, 100G1.TR, and 49F12.TF, that
appeared to code for an Rpt2 homologue were assembled by Dr. Colin D. Robertson of the University of Glasgow. By using reverse
transcription-polymerase chain reactions (RT-PCR) with
oligo(dT)30 (forward reaction) and the spliced leader (18)
(TTAGAACAGTTTCTGTACTATATTG; reverse reaction) as primers, we were able
to clone the full-length cDNA encoding an Rpt2 homologue (GenBankTM accession number AF227500). For the other five
Rpt homologues, we designed five specific forward and five specific
reverse primers (sequences available upon request) based on the 10 TIGR
partial cDNA sequences (clones 43D4.TR, 49F12.TR, 13G6.TR,
100G1.TR, 49F12.TF, 24C21.TF, 17C3.TF, 38C11.TF, 10F8.TR, and 18H6.TR)
and carried out RT-PCR with oligo(dT)30 and the spliced
leader as the primers for synthesizing full-length cDNA.
The five full-length cDNAs were each cloned and sequenced
(GenBankTM accession numbers: Rpt1, AF227499; Rpt3,
AF227501; Rpt4, AF227502; Rpt5, AF227503; Rpt6, AF227504). Pairwise
alignments of the open reading frames in the six full-length cDNAs
with those of the corresponding Rpts from human and S. cerevisiae were accomplished using the AlignX program in the
vector NTI 5.5 program suite (InforMax Inc.). The results indicate
sequence identities of 54-69% and similarities of 73-81% between
T. brucei and human Rpts and 51-66% identities and
67-80% similarities between T. brucei and S. cerevisiae Rpts, respectively (Table I in Supplemental Data).
Expression and Purification of the Six Recombinant T. brucei
Proteasome ATPase Homologues--
The six full-length T. brucei Rpt cDNAs were each amplified by PCR and expressed in
Escherichia coli M15 from the pQE30 vector (Qiagen),
following the manufacturer's protocol. The recombinant Rpt proteins,
expressed mostly as inclusion bodies in the transformed E. coli cell lysate, were each dissolved in 6 M guanidine
HCl and purified through a Ni2+-agarose column (Qiagen) by
the manufacturer's instructions. The purified recombinant T. brucei Rpt proteins (see the SDS-PAGE in Fig. I of Supplemental
Data) were each used to produce rabbit antibodies (Animal Pharm
Services, Inc., Healdsburg, CA).
Yeast Plasmids--
The coding regions of the six T. brucei Rpt full-length cDNAs were each amplified by PCR
(primer sequences available upon request) and integrated into the yeast
expression vector Dp22 by homologous recombination in yeast using the
PCR-gap repair method (19). The Dp22 plasmid is a low copy
(CEN/ARS), LEU2-marked vector into which a
multiple cloning site has been inserted between the 5' and 3' regions
of the S. cerevisiae RPT1 gene (20). PCR primers were
designed to append 5' or 3' sequences of the S. cerevisiae RPT1 untranslated regions to the corresponding ends of the
T. brucei coding regions. Following PCR-gap repair, the
resulting expression vectors contained the T. brucei Rpt1
coding regions inserted between the two yeast RPT1
untranslated regions and under the control of the yeast
RPT1 promoter.
Yeast Transformation and Genetic Methods--
Yeast
manipulations were carried out using standard procedures (21), unless
otherwise noted. Haploid yeast strains bearing HIS3-marked
chromosomal insertion-deletions of individual RPT genes and
containing the corresponding wild type gene on a low copy,
URA3-marked plasmid were obtained from Daniel Finley,
Harvard Medical School, and have been described previously (20). Yeast cells were transformed with individual T. brucei Rpt
expression vectors by the lithium acetate method (22), and the
transformants were selected on synthetic minimal (SM, Bio 101, Inc.)
medium lacking histidine, leucine, and uracil. For selection on
5-fluoroorotic acid (FOA), the SM medium was supplemented with 0.1%
FOA and 50 µg/ml uracil. The loss of URA3-marked plasmids
following FOA selection was confirmed by the failure of the reverted
strains to grow in medium lacking uracil.
Cross-linking the Proteasome Complex within Intact T. brucei
Cells and Isolating the Cross-linked Complex by
Immunoprecipitation--
The [35S]methionine
pulse-labeled T. brucei procyclic form cells, described
previously, were suspended in 10 volumes of HEDS buffer (25 mM HEPES, pH 7.8, 1 mM EDTA, 0.25 M
sucrose, and 50 mM KOAc) plus 5 mM of the
membrane-permeable chemical cross-linker DTBP and incubated at 26 °C
for 30 min. The cells were then washed twice with the HEDS buffer and
lysed in the lysis buffer (50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.1% SDS, 1% Nonidet P-40 plus a protease
inhibitor mixture) after 10 min at 4 °C. The lysate, preabsorbed
with rabbit preimmune serum, was incubated with rabbit antiserum at
room temperature for 1 h and precipitated with protein A-Sepharose. The precipitate was heated at 95 °C for 3 min, and the
supernatant was boiled in an equal volume of SDS sample buffer plus 5 mM DTT to break the disulfide bond in DTBP prior to
SDS-PAGE, which was followed by autoradiography.
Plasmid Constructs for RNA Interference--
Partial cDNA
fragments of the seven - and seven -subunits of 20 S proteasome,
the six Rpt homologues, and PA26 were each amplified in RT-PCR using
gene-specific primers with XhoI and HindIII
linkers (primer sequences available upon request). The PCR fragments
were each cloned into a pGEM-T easy vector and then subcloned into the
XhoI/HindIII linearized pZJM vector flanked with
tetracycline operators and T7 promoters (13). The 5' end cDNA
segment (~300-500 nucleotides) of each of the targeted mRNA was
chosen for constructing the transfecting plasmid (see Table II in
Supplemental Data) due to the highly diversified sequences in this
particular region among the 20 cDNAs, thus achieving specific interference of gene expression. For the control plasmid construction, the linearized vector was blunt-ended with T4 DNA polymerase and self-ligated.
Cultivation and Transfection of T. brucei Procyclic Form
Cells--
The T. brucei procyclic form cells, expressing
T7 RNA polymerase and tetracycline repressor, were grown in
Cunningham's medium (23) supplemented with 10% fetal bovine serum
plus 15 µg/ml G418 and 50 µg/ml hygromycin B for maintaining
intracellular stability of the T7 RNA polymerase and tetracycline
repressor DNA constructs, respectively. Transfection of T. brucei cells with DNA constructs by electroporation was
essentially as described (13). Briefly, 109 cells were
harvested, washed once with cytomix buffer (24), and suspended in 0.5 ml of the same buffer containing 20 µg of the
phleo-containing pZJM DNA construct linearized with
NotI so that it can be integrated into the rDNA spacer
region of the chromosome in T. brucei. Electroporation was
carried out in a 2-mm cuvette using the Gene Pulser (Bio-Rad) with
parameters set as follows: 1.6 kV voltage, 400 ohms resistance, and 25 microfarads capacitance. The cells were transferred to 10 ml of the
antibiotics-supplemented Cunningham's medium immediately after
electroporation and incubated at 26 °C for 24 h. The
transfectants were then selected under 2.5 µg/ml phleomycin until
stable cell lines were grown up after about 3 weeks of continuous
incubation. The transfected cells were cloned by limiting dilution. To
induce synthesis of the ~300-500-bp dsRNA, the transfected cells
were further incubated in the presence of 1.0 µg/ml tetracycline to
induce the two tetracycline-inducible T7 promoters flanking the
cDNA insert in the integrated plasmid construct. Cell number in the
time sample was counted using a hemocytometer.
Expression of Yeast RPT2 Gene in the T. brucei Rpt2-deficient
Cells--
The T. brucei expression vector pTSO-HYG4 (25),
which utilizes the poly(ADP-ribose) polymerase promoter and replicates
extrachromosomally by virtue of a minicircle origin of replication, was
used for expressing the yeast RPT2 gene in T. brucei. By site-directed mutagenesis, a BglII
restriction site was introduced upstream of the hygromycin
phosphotransferase gene (hyg) in the vector to produce the
plasmid pTSO-HYG4m. A puromycin-N-acetyltransferase gene
(pac) was PCR-amplified from the plasmid pG-GFP (26)
using primers with BglII and BseAI linkers. The
PCR fragment was cloned into a pGEM-T easy vector and subcloned into
the BglII/BseAI-linearized pTSO-HYG4m to replace
the hyg gene with pac gene, thus generating the
plasmid pTSO-PAC. The entire coding region of yeast RPT2 was then PCR-amplified from yeast genomic DNA using primers with
SalI and BamHI linkers (primer sequences
available upon request), cloned into a pGEM-T easy vector, and then
inserted into the SalI/BamHI sites of pTSO-PAC.
The resulting plasmid, designated pScRPT2-PAC, was used to
transfect the T. brucei cells already harboring a pZJM-TbRPT2 RNAi construct. The transfectants, selected
under 1.0 µg/ml puromycin, were grown in the presence of puromycin, phleomycin, hygromycin B, and G418 in culture medium. Synthesis of the
dsRNA, encoding a portion of T. brucei Rpt2, was then
induced in the transfectant by adding tetracycline (1.0 µg/ml) to the medium to disrupt the expression of T. brucei Rpt2 through
RNAi.
Northern Blot Analysis and RT-PCR--
Total RNA was extracted
from T. brucei cells using the TRIzol reagent (Amersham
Biosciences). Thirty µg of total RNA was denatured, separated on
1.2% formaldehyde agarose gel, and blotted onto nitrocellulose membranes in a 20× SSC (150 mM NaCl and 0.15 mM sodium citrate) solution. Northern hybridization was
carried out overnight at 42 °C in 50% formamide, 6× SSC, 0.5%
SDS, 1× Denhardt's solution with 0.1 mg/ml salmon sperm DNA. After
stripping the probes, the same blots were re-hybridized with an
-tubulin gene fragment as a loading control. RT-PCR was performed
using gene-specific primers and first strand cDNAs as templates.
| |
RESULTS |
T. brucei Lysate Is Capable of Performing an
ATP-dependent and Lactacystin-sensitive Digestion of
Casein--
Instability of the 26 S proteasome could have frustrated
prior efforts to purify it from T. brucei (8). To test this
possibility, we monitored 26 S proteasome-like activity in the crude
lysate using [methyl-14C]casein as a substrate
(16). An appreciable fraction of the radioactivity appeared in the
trichloroacetic acid-soluble fraction (Table
I). This apparent degradation of casein
was inhibited when ATP was replaced with the inactive analogue ATPS
or when the lysate was pretreated to remove existing ATP. Addition of 5 µM lactacystin, a specific inhibitor of the 26 S
proteasome (27) and of the 20 S proteasome peptidase activity in
T. brucei (28), also blocked degradation (Table I). These
characteristics are those expected of the 26 S proteasome. The
activity is, however, less than one-third that in rat erythrocyte
lysate on an equal protein weight basis (Table I) and suggests a
relatively weak 26 S proteasome-like function in T. brucei
lysate.
There Is a Lactacystin-sensitive Turnover of Ubiquitinated Proteins
in T. brucei Cells--
We next examined the turnover of ubiquitinated
proteins in intact T. brucei cells. T. brucei
procyclic form cells were pulse-labeled with
[35S]methionine and chased with unlabeled methionine, and
the radiolabeled ubiquitinated proteins were immunoprecipitated and
analyzed by SDS-PAGE via autoradiography or immunostaining using the
anti-ubiquitin antiserum. The amount of
[35S]methionine-labeled ubiquitinated proteins in
T. brucei gradually decreased over a 30-h chase period (Fig.
1A). The half-life of the
ubiquitinated protein is about 10 h. Lactacystin treatment prevented the turnover for the duration of the chase period (Fig. 1A). Thus, there is an apparent proteasome-mediated turnover
of ubiquitinated protein in T. brucei, albeit at a
relatively slow rate.
View larger version (86K):
[in this window]
[in a new window]
|
Fig. 1.
Pulse-chase analysis of ubiquitinated
proteins in T. brucei. The procyclic cells
(108) of T. brucei were radiolabeled with
L-[35S]methionine for 45 min and chased with
cold methionine for the indicated times. Cells (1 × 107) were washed, lysed, and immunoprecipitated with
anti-ubiquitin antiserum. The pellets were analyzed by 10% SDS-PAGE
and autoradiography. A, immunostaining of the
immunoprecipitates using the same antiserum; B, the major
stained band in the mid-portion of the blot is most likely the antibody
heavy chain brought down by immunoprecipitation.
|
|
When the same time samples of immunoprecipitated ubiquitinated protein
were analyzed by immunostaining with anti-ubiquitin antibodies (Fig.
1B), there was no obvious time-dependent change in the amount of ubiquitinated protein; instead, lactacystin caused an
increase in the abundance of ubiquitinated proteins. Similar immunostaining of whole cell lysates, rather than immunoprecipitates, with anti-ubiquitin antibody yielded similar results (data not shown).
The accumulation of ubiquitinated protein upon treatment with a
specific proteasome inhibitor indicates that ubiquitinated protein is
continuously synthesized and degraded in the absence of inhibitor.
Genes Encoding the Six Proteasome ATPase Homologues Are Present and
Expressed in T. brucei--
The presence of 26 S proteasome-like
activity in T. brucei suggests the presence of the
proteasome 19 S regulatory unit in the cells. By using the information
available from the TIGR Trypanosome Genome Project, six full-length
cDNAs encoding the homologues of proteasome ATPases Rpt 1-6, were
each cloned from T. brucei procyclic form cells by RT-PCR.
This outcome suggests the presence of the six respective genes and
their active transcription in T. brucei. The significant
sequence identities between T. brucei Rpts and the
corresponding Rpts from human and yeast (Table I in Supplemental Data)
suggest that these T. brucei proteins are proteasome
components. To elicit specifically reactive antisera, the six
recombinant Rpt proteins were each expressed in E. coli and
purified to apparent homogeneity (see Fig. I in Supplemental Data).
Although present in insoluble and apparently denatured form, each
protein induced production of specific antiserum in rabbits.
Five of the Six T. brucei ATPase Homologues Functionally Complement
the Corresponding Yeast rpt Deletion Mutants--
Genetic studies in
S. cerevisiae have demonstrated that, despite their high
degree of sequence similarity, the six proteasome ATPases are
functionally non-redundant (20). Deletions of individual RPT
genes in yeast are lethal. To determine whether the six T. brucei ATPases function as such in vivo, we tested the
ability of the individual T. brucei homologues to rescue
yeast rpt deletion mutants. The coding regions of T. brucei Rpt cDNAs were each cloned into a
LEU2-marked yeast expression vector and transformed into yeast strains bearing a chromosomal deletion of the corresponding S. cerevisiae RPT gene as well as a URA3-marked
plasmid carrying a wild type copy of the yeast gene. We imposed
selection for loss of the URA3-marked plasmids using FOA. In
five of six cases, except for T. brucei Rpt2, the yeast
cells harboring the other five T. brucei Rpt expression
plasmids grew following loss of the corresponding yeast Rpt expression
plasmid (Fig. 2). This implies that the
yeast ATPase, coded by the URA3-marked plasmid, is redundant
and that its function can be provided by the trypanosome homologue
carried on the remaining LEU2-marked plasmid. Growth of all
five complemented strains was equivalent at the normal growth
temperature of 30 °C but was diminished to varying degrees at the
more restrictive 37 °C (relative growth was wild type = Rpt1 > Rpt4 > Rpt5 > Rpt3 = Rpt6, see Fig. II in
Supplemental Data). T. brucei Rpt2, on the other hand,
failed totally to complement the corresponding yeast deletion mutant.
Interestingly, complementation of yeast rpt deletion mutants
by expression of Arabidopsis thaliana Rpt proteins had
previously yielded similar results (29). The expression of T. brucei Rpt2 protein in yeast, prior to selection on FOA, was
verified by immunoblot analysis of a transformant in which a
hemagglutinin epitope had been appended to the C terminus of the Rpt2
coding region (results not shown). Each of the six yeast rpt
deletion mutants was further tested for complementation by each of the
six T. brucei Rpt homologues and thus extended the cross-species complementation tests to all of the 36 possible combinations. Only the T. brucei RPT genes that were
identified as true homologues by sequence inspection provided
complementation (except for Rpt2), confirming the conclusion that, like
the yeast ATPases, each of the parasite ATPases plays a distinct and
essential role.
View larger version (70K):
[in this window]
[in a new window]
|
Fig. 2.
Functional complementation of yeast rpt
deletion mutants by T. brucei homologous
cDNAs. Yeast strains bearing chromosomal disruptions of each
of the six RPT genes and carrying a wild type copy on a
URA3-marked plasmid were transformed with empty
LEU2-marked expression vector (vector) or vectors carrying
each of the six respective T. brucei Rpt homologues
(TbRPT). Transformants were streaked onto synthetic complete
medium (SC) or medium containing 0.1% FOA. Growth on FOA
requires loss of the URA3-marked yeast RPT
plasmid and functional complementation of the chromosomal deletion by
the remaining T. brucei RPT plasmid.
|
|
Rpt Proteins Are Found in a 19 S Complex in the T. brucei
Lysate--
To determine whether the 26 S proteasome is present but
dissociates into a 20 S proteasome and an either intact or fragmented 19 S regulatory unit upon cell lysis, T. brucei lysate was
fractionated on a Superose 6 column, and fractions were stained on
immunoblots with either rabbit antisera to T. brucei Rpt2,
Rpt5, 6, and 20 S proteasome. A purified sample of yeast 19 S
complex tagged with a FLAG His6 epitope was included as a
marker of molecular mobility of the complex. Results presented in Fig.
3 indicate that both Rpt2 and Rpt5 are
located predominantly in the same fractions (fractions 12 and
13) as the 19 S complex, suggesting that they are present in a
19 S-like complex in the lysate of T. brucei. The 6
protein band located in fractions 13-15 appears to be in a protein
complex sharing the same molecular mass with the 20 S proteasome.
These stained bands, indicated by arrows, were positively identified by loss of immunoreactivity in the corresponding antisera upon a preabsorption with an excess of the purified corresponding recombinant protein originally used for immunization, whereas the other
stained bands in the later eluting fractions were unaffected by the
preabsorption and were apparently due to nonspecific immunoreactivity (data not shown). Addition of ATP to the lysis and fractionation buffers had no apparent effect on the pattern of immunoreactive protein
fractionation (data not shown).
View larger version (53K):
[in this window]
[in a new window]
|
Fig. 3.
Fractionation of proteasome complex by gel
filtration. Lysate of T. brucei procyclic form cells or
purified 19 S yeast proteasome regulatory complex was eluted through a
Superose 6 HR 10/30 column in fast protein liquid chromatography. The
fractions collected from the column were separated by SDS-PAGE,
blotted, and stained with rabbit antisera to FLAG His6
epitope (for yeast 19 S complex), T. brucei recombinant
Rpt2, T. brucei recombinant Rpt5, T. brucei
recombinant 6 or T. brucei 20 S proteasomes as
indicated.
|
|
T. brucei lysate prepared in the presence of 1 mM ATP was also fractionated by a glycerol gradient
centrifugation as described previously (7, 8). Fractions collected from
the gradient were analyzed in native 4.5% PAGE and monitored for
peptidase activity in a gel overlay assay using a mixture of three
fluorogenic peptides LLVY-MCA, PFR-MCA, and GGR-MCA as substrates. The
results, presented at the top of Fig.
4A, indicate that the 20 S
and the activated 20 S proteasomes were located in fractions 4-6,
known to have the highest peptidase activity (7, 8). There was no
detectable peptidase activity in fractions 1 and 2, where the mammalian
26 S proteasome sediments (see Ref. 7 and top of Fig.
4B).
View larger version (38K):
[in this window]
[in a new window]
|
Fig. 4.
Fractionation of proteasome complex by
glycerol gradient centrifugation. A, lysate of T. brucei procyclic form cells was fractionated by 15-50% glycerol
gradient centrifugation. Gradient fractions (bottom fraction
number 1) were analyzed by native PAGE, and peptidase activity was
visualized with an overlay assay. The fractions were also fractionated
by SDS-PAGE, immunoblotted, and stained with rabbit antisera against
T. brucei 20 S proteasome (7), T. brucei
recombinant Rpt3, T. brucei recombinant Rpt4, or T. brucei recombinant Rpt5, as indicated. B, lysate of rat
red blood cells was similarly analyzed. The immunoblots were stained
with rabbit preimmune serum or with rabbit antisera against human Rpt1,
human Rpt2, and human Rpn8, respectively.
|
|
When the collected fractions were separated by SDS-PAGE, immunoblotted,
and stained with the rabbit antiserum against T. brucei 20 S proteasome, the latter was identified primarily among fractions 4-6 (Fig. 4A). When the immunoblot was stained with rabbit
antiserum against T. brucei recombinant Rpt3, Rpt4, or Rpt5,
each of the three proteins was identified exclusively in fractions 3-5
(Fig. 4A). Adsorption of these antisera with an
excess of corresponding purified recombinant Rpt antigen caused
these immunoreactive bands to disappear (data not shown), implying that
the stained bands represent genuine Rpt3-5 from T. brucei.
They migrated together in a glycerol gradient to a location
accommodating a molecular mass higher than that of the 20 S
proteasome, which is distributed primarily among fractions 4-6 in the
same gradient (Fig. 4, A and B). In yeast and
mammals, the 19 S regulatory complex is known to have a higher
molecular weight than the 20 S proteasome (3, 30). T. brucei 20 S proteasome has an estimated molecular mass of
728 kDa (inferred from cDNA sequence analyses). Among the six T. brucei Rpts we have identified and the 11 full-length
cDNAs from T brucei encoding the homologues of Rpn 1-12
that we have just cloned and submitted to the GenBankTM
data base (with the exception of Rpn4, see "Discussion"), the 19 S
complex from T. brucei can be estimated to have a molecular mass of 873 kDa. These two estimated molecular weights agree well with
the position of 20 S proteasome versus that of the Rpt
proteins in the gel filtration chromatography (Fig. 3) and glycerol
gradient (Fig. 4A), thus suggesting that the Rpts are
present in a 19 S-like complex in T. brucei lysate. This
conclusion is also supported by data from a control experiment (Fig.
4B), in which rat red blood cell lysate was fractionated
using identical glycerol gradient conditions and analyzed with
commercially available rabbit antisera against human Rpt1, Rpt2, and
Rpn8 for immunoblot staining. The results presented in Fig.
4B indicate that the three mammalian proteins are in the
bottom two fractions 1 and 2 where the 26 S proteasome is located.
Substantial quantities of these proteins are also located in fractions
3-5 that are apparently where the rat 19 S complex localizes. Some
free Rpt1 and Rpt2 (but not Rpn8) are also present in the gradient,
suggesting that rat 19 S complex may not be as stable as the T. brucei 19 S complex under the same experimental conditions or
that pools of Rpt proteins that have not yet entered the complex may be present.
The 26 S Proteasome Is Present in Intact T. brucei Cells--
If
the 26 S proteasome indeed dissociates into 20 S proteasomes and
19 S regulatory complexes upon lysis of T. brucei, chemical cross-linking may preserve its integrity and thus reveal its presence in intact cells. We therefore labeled T. brucei cells with
[35S]methionine and treated them with the
membrane-permeable bifunctional cross-linker DTBP (31). The
DTBP-treated cells were lysed, and the lysate was immunoprecipitated
with the rabbit anti-T. brucei 20 S proteasome antiserum
(7). The proteins thus precipitated were boiled in SDS sample buffer in
the presence of 5 mM DTT to reduce the disulfide bond in
DTBP and dissociate the cross-linked proteins. SDS-PAGE and
autoradiography of control samples not subjected to DTBP treatment
revealed that anti-20 S proteasome antiserum brings down only the
20 S proteasome protein subunits, which lie within the molecular mass
range of 23-34 kDa (Fig. 5A). With the DTBP pretreatment, however, the same immunoprecipitation procedure recovers many additional proteins. These include a double band in the 36-kDa region, three major bands between 43 and 50 kDa, a
pair of bands around 100 kDa, and several other minor protein bands.
This band pattern is similar to that of the S. cerevisiae 19 S complex (30), suggesting that cross-linker treatment can stabilize the 26 S complex and enable co-immunoprecipitation of the
19 S complex with the 20 S proteasome. A similar outcome was observed
when the rabbit anti-T. brucei Rpt3 antiserum was used in
the immunoprecipitation experiment (Fig. 5B). A typical
spectrum of protein subunits in the 19 S complex was precipitated by
the antiserum without prior cross-linking, suggesting the presence of
the Rpt3-containing 19 S complex as an integral entity in the cell
lysate. After cross-linking, however, the 20 S proteasome subunit
proteins were apparently co-precipitated with the 19 S proteins,
suggesting the presence of integral 26 S proteasome in the lysate of
cross-linked T. brucei cells. Notably, the patterns of
proteins precipitated after cross-linking were very similar regardless
of whether the antiserum was directed to the 19 S or 20 S subunit
protein (compare the rightmost lanes in Fig. 5, A and B). In a control experiment, in which the chemical
cross-linker was added to the T. brucei lysate instead of
the intact cells, there was no detectable co-immunoprecipitation
between the 20 S proteasome subunit proteins and the 19 S subunit
proteins (data not shown), thus confirming our working hypothesis that
dissociation of the 26 S proteasome occurs upon cell lysis.
View larger version (77K):
[in this window]
[in a new window]
|
Fig. 5.
Identification of the proteins
co-immunoprecipitated after a pretreatment of T. brucei
cells with a chemical cross-linker DTBP.
[35S]Methionine-labeled T. brucei procyclic
form cells were treated with DTBP, washed, lysed, immunoprecipitated
with rabbit antiserum (7), and subjected to SDS-PAGE and
autoradiographic analysis. A, immunoprecipitation by
antibodies against T. brucei 20 S proteasome; lane
1, protein bands immunoprecipitated from untreated T. brucei cell lysate representing mainly the 20 S proteasome
subunit proteins; lane 2, protein bands immunoprecipitated
from lysate of DTBP-pretreated T. brucei cells but not
exposed to a reducing agent prior to SDS-PAGE. The majority of the
proteins migrate at the top of the gel, suggesting their association in
a large complex; lane 3, protein bands immunoprecipitated
from lysate of DTBP-pretreated T. brucei cells and reduced
with 5 mM DTT prior to SDS-PAGE. In addition to 20 S
proteasome subunit proteins, additional protein bands are seen with a
profile similar to that of the 19 S complex from S. cerevisiae (30). B, immunoprecipitation by antibodies
against T. brucei Rpt3; lane 1, proteins
co-precipitated with Rpt3 without a prior cross-linking step, showing a
pattern consistent with the integral 19 S complex. Lane 2,
proteins co-immunoprecipitated after cross-linking: lane 3,
proteins co-immunoprecipitated after cross-linking and reduction,
including an additional series of 23-34-kDa proteins characteristic of
the 20 S proteasome.
|
|
In order to verify whether the co-immunoprecipitated proteins in
Fig. 5, A and B, were indeed subunits of the
19 S and the 20 S complex, respectively, the immunoprecipitate
brought down by anti-20 S proteasome antiserum from Fig. 5A
was immunoblotted with the rabbit antiserum to T. brucei
Rpt4. An immunoreactive protein band co-migrating with the authentic
recombinant Rpt4 was seen; its presence depended on the cross-linker
treatment (Fig. 6A).
Conversely, immunoblot analysis of the anti-Rpt3 antiserum immunoprecipitate in Fig. 5B with a rabbit anti-recombinant
T. brucei 6 antiserum shows the presence of an
immunoreactive protein migrating at the position of authentic 6
protein from cross-linker-treated cells but not from the untreated
cells (Fig. 6B). We conclude that the 19 S regulatory
complex and the 20 S proteasome are combined to form the 26 S
proteasome in intact T. brucei cells, and that chemical
cross-linking was required to maintain this association during the
process of cell lysis and immunoprecipitation.
View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6.
Identification of the co-immunoprecipitated
proteins by immunoblotting. A, the gel from an SDS-PAGE
equivalent to that in Fig. 5A was blotted and stained with
antiserum against T. brucei recombinant Rpt4. Lane
1, purified recombinant Rpt4. An apparently equivalent band
appears also in the DTT-treated anti-20 S proteasome immunoprecipitate
from a cross-linked cell sample (lane 2) but is not seen
without cross-linking (lane 3). The result indicates that
Rpt4 was co-immunoprecipitated with the 20 S proteasome only after a
DTBP treatment of the cells. B, the gel from an SDS-PAGE
similar to that of Fig. 5B was blotted and stained with
antiserum against recombinant T. brucei 6. Lane
1, purified recombinant 6. A band with 6-like mobility is
found in the anti-Rpt3 immunoprecipitate of chemically cross-linked
cell lysates (lane 2) but is missing from the lysate of
untreated cells (lane 3). Both the native Rpt4 in
A and native 6 in B migrate a little ahead of
the recombinant samples in SDS-PAGE due to the presence of
hexahistidine tags in the latter.
|
|
Isolation and Identification of the 26 S Proteasome from
Cross-linker-treated T. brucei Cells--
The previous observations
imply that DTBP treatment could be used to isolate intact 26 S
proteasome in its active form from T. brucei cells. Lysates
of DTBP-pretreated T. brucei cells were thus prepared and
fractionated by glycerol gradient centrifugation in the absence of DTT.
Fractions were examined on native PAGE and stained for fluorogenic
peptidase activity as in Fig. 4A (Fig. 7). Portions of each fraction were also
separated by SDS-PAGE, and their immunoblots were developed with rabbit
antisera against T. brucei 20 S proteasome, Rpt3, Rpt4, or
Rpt5. The results presented in Fig. 7 demonstrate that a substantial
proportion of each of the immunoreactive protein bands is now shifted
into fractions 1 and 2, where the 26 S proteasome is localized
(compare with the data from untreated cells in Fig. 4A). The
peptidase activity in these two most rapidly sedimenting fractions is,
however, relatively low when compared with that of the 26 S proteasome
from rat red blood cells in Fig. 4B. This suggests that
cross-linking may have an inhibitory effect on the activity of T. brucei 26 S proteasome, although the peptidase activities in the
20 S and activated 20 S proteasomes appear to be relatively
unaffected by DTBP (Fig. 7). The cross-linker may exert little effect
on the catalytic activities inside the 20 S cylindrical chamber, but
cross-linking the subunits in the 19 S complex may block entrance of
the peptide substrates into the catalytic chamber. Overall, data in
Fig. 7 indicate that the 26 S proteasome can be isolated in its
integral form from DTBP-pretreated T. brucei cells.
View larger version (63K):
[in this window]
[in a new window]
|
Fig. 7.
Fractionation of the proteasome complex from
DTBP-treated T. brucei cells by glycerol gradient
centrifugation. Lysate of DTBP-treated T. brucei cells
was fractionated by glycerol gradient centrifugation. Gradient
fractions were subfractionated by native PAGE and examined in an
overlay assay for peptidase activity and by Coomassie Blue stain for
protein. Gradient fractions were also subjected to SDS-PAGE and Western
blotting and stained with rabbit antisera against T. brucei
20 S proteasome or recombinant protein Rpt3, Rpt4, or Rpt5 as
indicated. Gradient fractions 1 and 2 contain active complexes with the
native gel mobility of 26 S proteasome. The 20 S proteasome proteins
and Rpt proteins are present in gradient fractions 1 and 2. The
presence of the 26 S proteasome in high molecular mass fractions is a
consequence of cross-linking treatment, comparing with Fig. 4.
|
|
Effects of RNAi Disrupted Expression of Genes Encoding the Fourteen
20 S Proteasome Subunit Proteins and the Six Rpt Proteins on the
Growth of T. brucei Cells--
To test whether the 26 S proteasome in
T. brucei performs a vital function and whether impairing
that function will result in the accumulation of ubiquitinated
proteins, RNA interference (RNAi) experiments were performed. cDNAs
coding for all seven -type and all seven -type protein subunits
of T. brucei 20 S proteasome (32-34) (see Table III in
Supplemental Data) and all six T. brucei Rpt homologues (see
Table I in Supplemental Data) were used. Twenty individual T. brucei procyclic form cell lines, each expressing a dsRNA fragment
corresponding to the 5' terminus of one of the 20 genes, were
generated. Synthesis of the dsRNA was placed under the control of two
opposing tetracycline-inducible T7 promoters. The time course of cell
growth of each of the 20 transfectants was monitored and compared in
cultures incubated with or without the addition of 1.0 µg/ml
tetracycline. Representative results for RNAi on 1, 1, and Rpt1
are shown in Fig. 8A. The cells grew normally in the absence of tetracycline, but growth was
rapidly and strongly inhibited by induction of RNAi. All 20 RNAi cell
lines yielded very similar results (Figs. III-V in Supplemental Data)
demonstrating without any exception that impaired expression of any of
the fourteen 20 S proteasome subunit proteins or any of the six Rpt
proteins in T. brucei can strongly inhibit cell growth.
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 8.
A, effects of RNAi on expression of
genes encoding proteasome 1-, 1-, and Rpt1 subunits and on
T. brucei growth. The growth profile of each of the 1-,
1-, and Rpt1 subunit-deficient transfectants of T. brucei
procyclic form was determined by cultivating the cells in the absence
( Tet) and presence (+Tet) of tetracycline. Cell
number is plotted versus tetracycline treatment time.
Insets show Northern blot analysis of mRNA levels of the
1, 1, and Rpt1 before (0) and 1-3 days after
tetracycline treatment. The same blots were stripped and rehybridized
with an -tubulin cDNA fragment as an RNA loading control.
Control cells transfected with the empty RNAi vector were identically
treated and analyzed. For results of RNAi effects on the other -,
-, and Rpt subunits, please refer to Figs. III-V in Supplemental
Data, respectively. B, Western blot analysis of T. brucei cells harboring dsRNAs of 5, 6, Rpt3, and Rpt5. Cell
lines harboring cDNAs for synthesis of dsRNA fragments encoding the
5'-portions of 5, 6, Rpt3, and Rpt5 mRNA were grown in the
absence or presence of tetracycline for 3 days and lysed by sonication.
Cell lysates were fractionated by 12.5% SDS-PAGE, blotted, and
immunostained with rabbit antisera against T. brucei 5,
6, Rpt3, or Rpt5 protein as indicated. Immunoblotting of -tubulin
was performed on a duplicate membrane as a loading control. The
molecular mass of the immunoreactive bands (kDa, left side
of each panel) was determined by comparison with the molecular weight
standards. C, immunoblot analysis of poly-ubiquitinated
proteins in T. brucei RNAi cells. Cell lines expressing a
dsRNA encoding the 1-subunit, 1-subunit, or Rpt1 protein of the
T. brucei proteasome were each induced with tetracycline for
3 days or grown without tetracycline for the same length of time.
Lysate proteins were resolved by 8.5% SDS-PAGE, blotted, and
immunostained with an anti-ubiquitin antibody. Duplicate membranes were
immunostained with antibody against -tubulin as a protein loading
control. Molecular mass markers were shown in kilodaltons on the
left side of each panel. For effects of RNAi with the other
proteasome , , and Rpt expressions on the levels of ubiquitinated
protein refer to Fig. VI in Supplemental Data.
|
|
In order to determine whether the inhibited cell growth is indeed
related to the synthesis of dsRNAs and the anticipated destruction of
the specific mRNA targeted in each of the 20 transfectants, the
mRNA and dsRNA levels in all the time samples collected after tetracycline addition (0-3 days) were monitored by Northern blotting. Representative results for 1, 1, and Rpt1 are presented in the insets of Fig. 8A (and the complete data set in
Figs. III-V in Supplemental Data). As anticipated, the levels of
dsRNAs increased dramatically upon addition of tetracycline (data not
shown). The levels of mRNAs encoding 1, 3, 5, 1, 4,
5, and 7 subunits of the 20 S proteasome and the ATPase
homologues Rpt1, Rpt3, Rpt4, and Rpt5 all exhibit dramatic quantitative
decreases within a day of incubation and reach an undetectable level
after 3 days. The decreases in levels of mRNAs of 2, 4, 6,
7, 2, 3, and 6 subunits and Rpt2 are somewhat less marked,
but their quantities begin decreasing following tetracycline addition
and reach ~5% of the original level after 3 days. The level of Rpt6
mRNA in the wild type cells was too low to be readily
detected by Northern blot analysis. RT-PCR method was used instead to
monitor the level of this mRNA, which disappeared totally 1 day
after tetracycline induction (see Fig. V in Supplemental Data). Control
experiments indicated that RNAi was highly specific; there was no
cross-inhibition on the levels of other mRNAs among any of the 20 individual transfectants (data not shown).
Selective immunoblot analysis was also performed on the lysates
of T. brucei RNAi transfectants of 5, 6, Rpt3, and
Rpt5. Lysates from each of the four transfectant cell lines grown
without and with added tetracycline were compared on immunoblots. The results presented in Fig. 8B demonstrate that the level of
each protein is significantly reduced after tetracycline induction of
dsRNA synthesis. Inhibited growth of the four transfectant cell lines
could thus be ascribed to the absence of 5, 6, Rpt3, and Rpt5
proteins, respectively. Taken as a whole, these data demonstrate that
expression of each of the seven -subunit genes, seven -subunit
genes, and six Rpt genes is essential for growth of T. brucei procyclic form cells.
Accumulation of Ubiquitinated Proteins in -, -, and
Rpt-deficient T. brucei Cells--
Since poly-ubiquitinated proteins
have been identified as the primary substrates for the proteasome
complexes in eukaryotic cells (35) and lactacystin-sensitive turnover
of poly-ubiquitinated protein have been observed in T. brucei (Fig. 1), the loss of any of the proteasome - and
-subunits and the Rpt proteins from T. brucei could
result in a cessation of proteasome degradation of poly-ubiquitinated
proteins, which could then lead to arrested cell growth. We thus
analyzed the profile of poly-ubiquitinated proteins in each of the 20 T. brucei transfectant cell lines on immunoblots and
compared their quantities between those without and with prior
tetracycline induction within the same transfectant cell line. The
poly-ubiquitinated proteins, running in a smeared pattern from the top
of the gel in SDS-PAGE as anticipated, were only lightly stained by
anti-ubiquitin monoclonal antibody in the lysate from un-induced cells
under the present experimental conditions. But after induction of RNAi
in the transfectants, the quantities of poly-ubiquitinated proteins are
significantly enhanced on all 20 transfectant cell samples (1, 1
and Rpt1 in Fig. 8C) (for the rest, see Fig. VI in
Supplemental Data), suggesting that the loss of any one of the ,
, or Rpt proteins leads to a dysfunction of the proteasome complex
in T. brucei, resulting in accumulation of
poly-ubiquitinated proteins. This inhibited turnover of ubiquitinated
proteins in T. brucei may constitute the basis of arrested
cell growth observed in Fig. 8A.
Expression of Yeast RPT2 Gene Cannot Rescue the Growth of T. brucei Rpt2-deficient Cells--
The failure of the trypanosome
RPT2 gene to rescue a yeast rpt2 deletion mutant
prompted us to perform an experiment in reverse to test if yeast
RPT2 gene could functionally complement the T. brucei Rpt2-deficient cells. The yeast gene was expressed in the T. brucei cell line harboring the pZJM-TbRPT2
RNAi construct for tetracycline-inducible knockout of TbRPT2
gene expression. Northern blot analysis (Fig.
9A) indicate that whereas the
level of yeast RPT2 mRNA remains relatively constant
throughout the 3-day tetracycline-induction time, the T. brucei
RPT2 mRNA begins to diminish visibly on day 2 and becomes
essentially undetectable on day 3. Immunoblotting of the cell lysates
harvested after different days of induction with rabbit antibodies
against the yeast Rpt2 protein indicated that the latter was expressed
and maintained at a constant level in the transfected cells throughout
the 3-day period (Fig. 9B). The cell growth was, however,
arrested upon disappearance of T. brucei RPT2 mRNA,
despite the abundant presence of yeast Rpt2 protein (Fig.
9C), suggesting that yeast Rpt2 protein cannot functionally substitute for trypanosome Rpt2 protein in a trypanosome cell. Thus,
there is no Rpt2 functional crossover between yeast and trypanosome.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 9.
Expression of yeast RPT2
gene in Rpt2-deficient T. brucei cells and its
effect on T. brucei growth. Yeast RPT2
gene was expressed under the control of poly(ADP-ribose) polymerase
promoter in T. brucei cell lines containing the
pZJM-TbRPT2 RNAi construct. A, Northern blot of
total RNA extracted from untransfected cells (UT) and
transfectants without (0) and with (+Tet)
tetracycline induction for 1-3 days. Northern blot analysis was
performed on duplicate membranes with a T. brucei RPT2 gene
fragment (TbRPT2) and a yeast RPT2 gene fragment
(ScRPT2) as probe, respectively. Quantitation of -tubulin
transcript (Tubulin) in the same RNA sample was presented as
a loading control. B, Western blot analysis of the yeast
Rpt2 protein expressed in the transfected T. brucei. Cell
lysate proteins were separated by SDS-PAGE, blotted, and immunostained
with rabbit polyclonal antibodies raised against the N-terminal 100 amino acids of the S. cerevisiae Rpt2 protein (Affinity).
The same blot was also immunostained with a mouse monoclonal antibody
against -tubulin as a protein loading control. C, the
growth of T. brucei cells harboring only the
pZJM-TbRPT2 RNAi construct (solid and open
squares) or with both the pZJM-TbRPT2 RNAi construct
and the pScRPT2-PAC construct (solid and
open triangles) were grown in the absence (open
squares and triangles) or presence (solid
squares and triangles) of tetracycline for 4 days. The
cell number is plotted against time. Cell growth data from three
independent experiments were averaged.
|
|
The 11 S Regulator Protein from T. brucei (PA26) Is Not Essential
for Proliferation of the Procyclic Form--
The 11 S proteasome
regulator protein (PA26) identified in T. brucei is capable
of enhancing the peptidase activity of 20 S proteasomes from T. brucei, rat red blood cells, and yeast (9, 36). The activated
20 S proteasome contributes most of the proteasome-associated peptidase activity in the T. brucei lysate (8). To determine whether this form of the proteasome plays an important role in growth
of T. brucei procyclic form cells, RNAi was used to disrupt PA26 expression. Tetracycline induction of a PA26 dsRNA fragment dramatically reduced the level of PA26 mRNA after 1 day (Fig. 10A). Lysates of cells
harvested after 10 days of incubation with tetracycline were
fractionated by glycerol gradient centrifugation, and fractions
collected from the gradient were separated by native PAGE and stained
for peptidase activity and protein. Whereas the un-induced cell lysate
contains a significant amount of activated 20 S proteasome activity
and protein, the tetracycline-induced cells demonstrate no detectable
peptidase activity or protein in the region associated with the
activated 20 S proteasome in native PAGE (Fig. 10, B and
C). Despite the absence of PA26 mRNA and PA26-activated
20 S proteasomes, however, the growth of PA26-deficient cells
proceeded normally (Fig. 10A). Apparently, the function of PA26-activated 20 S proteasome is not essential for the growth of
T. brucei procyclic form cells.
View larger version (36K):
[in this window]
[in a new window]
|
Fig. 10.
A, RNAi on PA26 gene expression and its
effect on T. brucei growth. T. brucei cells
harboring the pZJM-PA26 construct were grown in the absence
(Tet) or presence (+Tet) of tetracycline for 10 days. The cell number is plotted against time. Inset shows
Northern blot analysis of the PA26 mRNA level after tetracycline
induction for 1-3 days. The same blot was rehybridized with an
-tubulin cDNA fragment and presented as an internal sampling
control. B, fractionation of crude T. brucei
proteasome by glycerol gradient centrifugation. The crude proteasome
was prepared from pZJM-PA26 transfected T. brucei
cells cultivated for 10 days with (+Tet) or without
(Tet) tetracycline induction. The crude proteasome was
further purified by glycerol gradient centrifugation, and a portion of
each gradient fraction was subjected to native PAGE and a gel overlay
assay using LLVY-MCA, PFR-MCA, and GGR-MCA as fluorogenic substrates.
Numbers on top indicate the gradient fractions
containing 50 (lanes 1 and 2), 45 (lanes
3-5), and 40% (lanes 6 and 7) glycerol.
C, analysis of the glycerol gradient fractions by
immunoblotting. The gradient fractions were separated by native PAGE,
blotted, and analyzed with antiserum against T. brucei 20 S
proteasome.
|
|
| |
DISCUSSION |
We provide here both in vitro and in vivo
evidence for proteasome-mediated turnover of casein and
ubiquitinated proteins in T. brucei, which belongs to the
function of 26 S proteasome, a composite of 20 S and 19 S
assemblies. We had shown previously (7, 8) that T. brucei contains the 20 S and activated 20 S form of proteasomes,
and we now document the presence of the genes required for production
of the 19 S form; those for the six Rpt ATPase proteins and (as
described below) for the full repertory of established Rpn non-ATPase
subunits. Furthermore, the T. brucei cell lysate contains a
protein assembly of the anticipated 19 S size with a composition that
incorporates the putative T. brucei 19 S subunit proteins.
The identity and role of five of the six T. brucei Rpt
ATPases are further confirmed by their ability to complement
deficiencies of the corresponding yeast homologues. Finally, a
functional role for each of the fourteen T. brucei 20 S
proteasome proteins and six 19 S ATPases in T. brucei was tested; in every case prevention of individual protein expression led
to inhibition of cell growth and an increase in ubiquitinated protein
pools. These data strongly substantiate the presence in T. brucei of both 20 S catalytic and 19 S regulatory proteasome components, suggesting the presence in T. brucei the 26 S proteasome.
A conventional means for establishing the presence of 26 S proteasome
in eukaryotes has been biochemical purification. By using methods that
readily suffice with other organisms, our previous efforts to obtain
biochemical evidence for the 26 S proteasome in T. brucei
had failed persistently. In an effort to stabilize a structure that we
presumed to be present in intact cells, we treated the cells with a
membrane-permeable chemical cross-linker. By this means, we were able
to document the presence of the 26 S proteasome. This complex is
apparently readily dissociated into the 20 S proteasome and the 19 S
regulatory complex upon cell lysis, even in the presence of ATP, which
serves to impede dissociation in other organisms (15, 37). The ready
dissociation of the parasite's 26 S proteasome is clearly a property
distinctive to this organism rather than an idiosyncrasy of our
methodology; lysis of rat red blood cells under the same condition
yielded a substantial amount of intact 26 S proteasome (see Fig.
4B).
Formation of the 26 S proteasome is most likely through binding of the
Rpt hexamer ring in the 19 S complex with the outer surface of the
-ring in the 20 S proteasome (3, 38). The 19 S Rpt proteins of
T. brucei are close homologues of those found in other
eukaryotes; this is also true of the seven 20 S -proteins (see
Tables I and III in Supplemental Data). In the absence of three-dimensional structural data on the interface between the -ring
and the presumed Rpt ring of any organism, it is difficult to surmise
what specific features determine the kinetics or equilibrium of 19 S
to 20 S association and dissociation. It is likely that small
differences in Rpt or -subunit primary structures could confer very
large differences on the stability of interaction, thus frustrating a
direct comparison of primary sequences. Determining the basis of the
seemingly weak association between the 19 S and 20 S complexes in
T. brucei will require further structure-function analyses.
The ready dissociation of the 26 S proteasome in T. brucei
lysate may reflect a lesser in vivo stability as well. If
so, free 19 S complex may predominate over that in the 26 S form. It
has become increasingly apparent in recent years that the functions of
the 19 S complex and its proteins go beyond regulating protein
degradation. It is possible that the 19 S complex of T. brucei may play non-proteolytic roles, which may
require a relatively loose association with the 20 S proteasome.
With the DNA sequence information available from the data base of
TIGR Trypanosome Genome Project, we have recently isolated and
identified 11 full-length cDNAs from T. brucei encoding
11 distinct Rpn homologues Rpn1-3 and Rpn5-12, bearing significant sequence identities and similarities with the corresponding Rpns from
yeast and
human.4,5
The molecular mass of each of the Rpn proteins estimated from the
full-length cDNAs are as follows: Rpn1, 99.9; Rpn2, 106.6; Rpn3,
38.2; Rpn5, 54.9; Rpn6, 57.3; Rpn7, 45.5; Rpn8, 42.3; Rpn9, 45.9;
Rpn10, 35.8; Rpn11, 33.8; and Rpn12, 31.3 kDa. (Rpn4 was recently
identified as a transcription factor unassociated with the proteasome
(39); no homologue is apparent in T. brucei.) The 11 Rpns we
have cloned could represent the complete profile of Rpn proteins in the
T. brucei 19 S complex. The predicted molecular weights of
T. brucei Rpn and Rpt proteins are typical of 19 S proteins
in other organisms and are consistent with the protein profile found in
the SDS-PAGE data shown in Fig. 5, A and B. The following identifications are probable: the two protein bands around
100 kDa are Rpn1 and Rpn2; the bands in the 43-50-kDa region are Rpns
5-9; and the protein bands in the 36-kDa region are Rpn3 and Rpns
10-12.
Since its first discovery (40), RNAi has been proven an efficient
reverse genetic approach to study gene function in Caenorhabditis elegans (41, 42) as well as certain other organisms such as T. brucei (13, 43). Using that technique, we demonstrate
that proteasome proteins are essential and are involved in degradation of ubiquitinated proteins. Comparable investigations have been performed on S. cerevisiae using gene disruption of the
individual genes encoding the 14 subunit proteins of the 20 S
proteasome (44
,
TOP
ABSTRACT
INTRODUCTION
